WO2002006489A1 - A novel polypeptide, a human cytochrome c oxidase subunit 8.91 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human cytochrome C oxidase subunit 8.91, the polynucleotide encoding the poypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as sugar, lipid, protein metabolic disorder relative disease, etc. The invention also discloses the agonistes against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human cytochrome C oxidase subunit 8.91.

Description

A new peptide-human cytokine C oxidase Ya 8.91 and the polynucleotide of this polypeptide

 The present invention belongs to the field of biotechnology, and specifically, the present invention describes a new polypeptide ˜Λ cytochrome C oxidase subunit 8. 91, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Control background

 The energy required for the normal metabolism of the human body comes from ATP. Mitochondria are where sugar, fat, and amino acids eventually release energy. Pyruvic acid and fatty acids are produced in the cytoplasm through the fermentation of nutrients such as sugar and fat. These substances selectively enter the mitochondrial matrix from the cytoplasm and are degraded into units containing 2 carbon atoms through a series of changes. Acetyl-CoA enters the tricarboxylic acid cycle, and the hydrogen removed from the tricarboxylic acid cycle passes through the electron transport system on the inner membrane of the mitochondria, the respiratory chain, and is finally passed to oxygen. During this process, electrons with higher energy levels are reduced to lower energy levels through electron transfer. The energy released in the form of high-energy phosphate bonds is phosphorylated by ADP to generate ATP containing high-energy phosphate bonds and stored in the body. It can be seen from the above that the respiratory chain is an important system for supplying energy to living organisms and has great significance for life activities (cell biology, editor of Wang Ren et al., Beijing Normal University Press).

 The respiratory chain is mainly composed of the following types of molecules: pyridine nucleotide-linked dehydrogenases, flavin-associated dehydrogenases (flavin proteins), iron sulfur protein, coenzyme Q, and cytochromes.

Among them, complex IV (cytochrome c oxidase complex), consisting of eight polypeptide chains, with a total molecular weight of 160KD, exists in the form of a dimer. Each monomer contains 2 cytochrome oxidases, a ₃ ) and 2 copper atoms. The cytochrome c oxidase complex is both an electron transporter and a proton translocation body.

 According to the study of the structure of the cytochrome 'c oxidase complex, we can know from the data obtained from X-ray experiments that His 240-Tyr244, which is bound to a copper atom, is an enzyme active center that catalyzes the oxygen accepting electrons (Os terraeier C et a l., 1997, Proc Nat l Acad Sci USA 94: 10547-10553; Yoshikawa S et al., 1998, Science 280: 1723-1729); (Protein Sc i 1999 May; 8 (5): 985-90 ).

 Cytochrome oxidase inhibitors (such as NaN3, KCN) can stimulate XTT activity of cells to decrease (Biol Pharm Bull, 1999, Jun; 22 (6): 660-1).

Autogenous degenerative deletion of cytochrome oxidase gene causes acute local neuronal machinery Disturbances, the examination revealed that the patient's brain was ischemic and the arteries were normal. The experimental results prove that this is caused by mutations in the genes encoding cytochrome oxidase in human mitochondrial DNA (Ann Neurol 1999 Mar; 45 (3): 389-92).

 In some patients with Alzheimer's disease, we found a decrease in the level of cytochrome oxidase activity, and the results of the study tell us that decreased levels of cytochrome oxidase expression in mitochondria and nuclei are secondary to some brain and nervous system diseases Reaction (J Neurochem 1999 Feb; 72 (2): 700-7).

 Cytochrome oxidase activity even regulates enamel development in rat incisors (Ana t Rec 1998 Dec; 252 (4): 519-31).

 The Vl lb subunit of cytochrome C oxidase has 88 amino acid residues, including 24 amino acid N-terminal leader sequences.

 Gene chip analysis revealed that in the bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line thymus, normal fibroblasts 1 024NC, Fibrob l as t, growth factor stimulation, 1024NT, scar into fc growth factor stimulation, 101 3HT, scar into fc without stimulation with growth factor, 1 01 3HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, placenta, spleen, prostate cancer, jejunal adenocarcinoma, cardia cancer The expression profile of the polypeptide of the present invention is very similar to the expression profile of the cytochrome C oxidase Vl lb subunit, so the functions of the two may also be similar. The invention is designated as the human cytochrome C oxidase subunit 8.91.

 As described above, the human cytochrome C oxidase subunit 8.91 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More human cytochrome C oxidase subunit 8.91 proteins involved in these processes, especially the amino acid sequence of this protein was identified. The new human cytochrome C oxidase subunit 8.91 The isolation of the protein-coding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide, the human cytochrome C oxidase subunit 8.91, and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human cytochrome C oxidase subunit 8.91.

Another object of the present invention is to provide a polysaccharide containing human cytochrome C oxidase subunit 8.91. Genetically engineered host cells of nucleotides.

 Another object of the present invention is to provide a method for producing a human cytochrome C oxidase subunit 8.91. Another object of the present invention is to provide an antibody against the polypeptide-human cytochrome C oxidase subunit 8.91 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the polypeptide of the present invention, a human cytochrome C oxidase subunit 8.91.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to the abnormality of the human cytochrome C oxidase subunit 8.91. Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 283-528 in SEQ ID NO: 1; and (b) a sequence having 1-747 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human cytochrome C oxidase subunit 8.91 protein activity, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human cytochrome C oxidase subunit 8.91 protein, which comprises detecting the presence of the polypeptide or its encoding polynucleotide sequence in a biological sample. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.

The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier. The present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for the treatment of cancer, developmental disease or immune disease or other drugs caused by abnormal expression of human cytochrome C oxidase subunit 8.91. use.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a comparison diagram of gene chip expression profiles of the human cytochrome C oxidase subunit 8.91 and cytochrome C oxidase Vl lb subunit of the present invention. The upper graph is a graph of the expression profile of the human cytochrome C oxidase subunit 8. 91, and the lower graph is the graph of the expression profile of the cytochrome C oxidase Vl lb subunit. Among them, 1-fetal brain, 2-bladder mucosa, 3-PMA + Ecv304 cell line, 4-LPS + Ecv304 cell line thymus, 5-normal fibroblasts 1024NC, 6- Fibroblas t, growth factor stimulation, 1024NT, 7- Scar-like fc growth factor stimulation, 1013HT, 8-scar scar-fc without growth factor stimulation, 1013HC, 9-bladder cancer cell EJ, 10-bladder cancer, 11-bladder cancer, 12-liver cancer, 13-liver cancer cells Strains, 14-fetal skin, 15-spleen, 16-prostate cancer, 17-jejunum adenocarcinoma, 18 cardia cancer.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human cytochrome C oxidase subunit 8.91. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band.

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as a replacement with leucine Isoleucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with the human cytochrome C oxidase subunit 8.91, causes a change in the protein to regulate the activity of the protein. Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds to human cytochrome C oxidase subunits 8, 91.

 "Antagonist" or "inhibitor" refers to a biological activity or immunity that can block or regulate human cytochrome C oxidase subunit 8.91 when combined with human cytochrome C oxidase subunit 8.91. Chemically active molecules. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to the human cytochrome C oxidase subunit 8.91.

 "Regulation" refers to a change in the function of human cytochrome C oxidase subunit 8.91, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of human cytochrome C oxidase subunit 8.91 Changes in nature, function, or immunity.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human cytochrome C oxidase subunit 8.91 using standard protein purification techniques. Substantially pure human cytochrome C oxidase subunit 8.91 produces a single main band on a non-reducing polyacrylamide gel. Human cytochrome C oxidase subunit 8.91 The purity of the polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" may be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Sou thern blotting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and suppress Binding of a homologous sequence to a target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The ME GAL I GN program can compare two or more sequences according to different methods, such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching the sequence

Residues sequences - sequences spacer residues - the sequence of residues ^X interval S

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in (Hein J., (1990) Me thods in enzymol ogy 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, such as negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having uncharged head groups are Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to the human cytochrome C oxidase subunit 8.91 epitope.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, It is also possible that such a polynucleotide or polypeptide is part of a certain composition. Since the carrier or composition is not a component of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human cytochrome C oxidase subunit 8.91" means human cytochrome C oxidase subunit 8.91 is substantially free of other proteins, lipids, sugars, or other substance. Those skilled in the art can purify human cytochrome C oxidase subunit 8.91 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. Human cytochrome C oxidase subunit 8.91 The purity of the 91 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human cytochrome C oxidase subunit 8.91, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

 The invention also includes fragments, derivatives and analogs of the human cytochrome C oxidase subunit 8.91. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human cytochrome C oxidase subunit 8.91 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be:) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid It may or may not be encoded by a genetic code; or (Π) such a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (III) such a type Wherein the mature polypeptide is fused to another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into a mature polypeptide (such as a leader Sequences or secreted sequences or sequences used to purify this polypeptide). As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes SEQ ID NO: 1 Nucleotide sequence. Polynucleotides of the invention are found from a CDM library of human fetal brain tissue. It contains a polynucleotide sequence that is 747 bases in length and its open reading frames 283-528 encode 81 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to the cytochrome C oxidase Vl lb subunit. It can be inferred that the human cytochrome C oxidase subunit 8.91 has the cytochrome C oxidase Vllb subunit. Similar functionality.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) 1 ° /。 Adding a denaturant during hybridization, such as 50¾ (v / v) formamide, 0.1 ° /. Calf serum / 0.1% Fi col 1, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95% or more, and more preferably 97% or more. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, preferably at least 100 nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human cytochrome C oxidase subunit 8.91.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human cytochrome C oxidase subunit 8.91 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRM, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RM hybridization; (2) the presence or absence of marker gene functions; (3) determination of the human cytochrome C oxidase subunit 8.91 transcript (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, the protein product of human cytochrome C oxidase subunit 8.91 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). . A method for amplifying DNA / RM using a PCR technique (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using the human cytochrome C oxidase subunit 8.91 coding sequence, and the present invention is produced by recombinant technology Methods of the polypeptide.

 In the present invention, a polynucleotide sequence encoding the human cytochrome C oxidase subunit 8.91 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct an expression vector containing a DM sequence encoding human cytochrome C oxidase subunit 8.91 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, and the like (Sambroook, et al. Molecular Cl on ing, Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. Expression vector also includes a nucleus for translation initiation Glycosome binding sites and transcription terminators. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polytumor enhancers and adenoviral enhancers on the late stage of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human cytochrome C oxidase subunit 8.91 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector. Host cells. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DM sequence according to the present invention or a recombinant vector containing the DNA sequence can be performed by conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human cytochrome C oxidase subunit 8.91 (Scence, 1984; 224: 1431). Generally, the following steps are taken:

 (1) using the polynucleotide (or variant) encoding the human human cytochrome C oxidase subunit 8.91 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. When host cells grow to proper After inducing the cell density, the appropriate promoter (such as temperature conversion or chemical induction) is used to induce the selected promoter, and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 The human cytochrome C oxidase nib subunit is a component of the cytochrome c oxidase complex, which is involved in the functioning of the respiratory chain of human cells. Abnormal expression of the human cytochrome C oxidase Vl lb subunit in vivo can cause dysfunction of the cytochrome c oxidase complex and affect the functioning of the respiratory chain. This leads to the occurrence of related diseases.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human cytochrome C oxidase Vllb subunit protein, and both have similar biological functions. The polypeptide of the present invention is a component of a cytochrome c oxidase complex, which is involved in the operation of the respiratory chain of human cells. Abnormal expression of the polypeptide of the present invention in vivo can cause dysfunction of the cytochrome c oxidase complex and affect the operation of the respiratory chain. As we all know, the ATP produced by the cell's respiratory chain is the source of energy for the normal metabolism of the human body. The obstacles in the operation of the respiratory chain will inevitably lead to the metabolism of various substances (sugar, lipid, protein) in the human body, which will lead to related diseases. These diseases include, but are not limited to:

 Disorders of glucose metabolism can lead to the following consequences: 1. Hypoglycemia / highness can cause hyper / hypoinsulinemia. Hyperinsulinemia can promote lipid synthesis and stimulate arterial intimal smooth muscle cell proliferation (causing vascular lumen narrowing); hypoinsulinemia can reduce lipid clearance and vascular lysosomal lipase activity and accelerate arteries Occurrence and development of atherosclerosis. Coupled with an increase in the content of glycosylated hemoglobin, tissue hypoxia can be aggravated, so glucose metabolism disorders can lead to atherosclerosis of large and medium blood vessels and microvessels in the whole system. 2. Hyperglycemia can cause changes in aqueous osmotic pressure and promote eyeballs. The glucose in the crystal is converted into sorbitol, which leads to the accumulation of sorbitol in the crystal, etc. 3. Disturbance of glucose metabolism and the microvascular disease caused by it can lead to neurodegeneration, which is mainly mutation of peripheral nerve axis and demyelination. Reduced; 4. Disturbance of glucose metabolism leads to poor nutritional status throughout the body, low immunity, and prone to various infections;

Comprehensive appeal, glucose metabolism disorders can lead to systemic multi-systemic lesions, which in turn trigger the development of related diseases Health:

 I. Systemic multisystem vascular sclerosis

 1. Cardio-cerebral vessels: angina pectoris, myocardial infarction, arrhythmia, coronary heart disease, metabolic cardiomyopathy, heart failure, cardiogenic shock (aorta, coronary arteries, cardiac microvasculature), transient ischemic attack, cerebral infarction, Lacunar infarction, cerebral hemorrhage (intracerebral artery), etc .;

 2. Renal blood vessels: renal artery stenosis, renal artery embolism and thrombosis, arteriolar renal sclerosis (benign, malignant), acute / chronic renal failure, etc .;

 3. Peripheral blood vessels of the limb: occlusive arteriosclerosis (lower limb arteries), malnutrition skin ulcers (small skin arteries), etc .;

 2. Ophthalmic diseases: metabolic cataract, refractive error, iridocyclitis, ocular motor palsy, retinopathy (simple, proliferative), iris redness, neovascular glaucoma, etc .;

 3. Nervous system diseases: peripheral neuropathy (symmetrical distal polyneuropathy, majority mononeuropathy, autonomic neuropathy), myelopathy, hypertonic coma, hypoglycemic encephalopathy, dementia, paralysis, etc.

 4. Various infections: skin infections (疖, 痈, foot, body, sepsis), reproductive system infections (fungal vaginitis, pasteuritis), urinary system infections (pyelonephritis, cystitis), etc .; protein metabolism Disturbances can affect the following major physiological functions of proteins, which can lead to the occurrence of related diseases:

 I. Provide body energy to maintain tissue growth, renewal and repair:

 Muscle atrophy, weak limbs, weight loss, severe cases can be "caustic"

 2. Produce some physiologically active substances, such as hormones, antibodies, amines, etc .:

 1. Protein peptide hormone dysfunction can cause the following diseases:

 1) Insulin and glucagon: diabetes, hypoglycemia, etc .;

 2) Hypothalamus and pituitary hormones: Giant disease, dwarfism, acromegaly, Cortisol syndrome (Cushing's syndrome), primary hyperaldosteronism, secondary chronic adrenal insufficiency, hyperthyroidism Hypothyroidism (minor ailment, juvenile hypothyroidism, adult hypothyroidism), male / female infertility, menstrual disorders (functional uterine bleeding, amenorrhea, polydipsia ovarian syndrome, premenstrual tension syndrome, Menopause syndrome), sexual development disorder, diabetes insipidus, inappropriate antidiuretic hormone secretion syndrome, abnormal lactation, etc .;

 3) parathyroid hormone: hyperparathyroidism, hypoparathyroidism, etc .;

 4) Gastrointestinal hormones: peptic ulcer, chronic indigestion, chronic gastritis, etc .;

2. Disorders of amine metabolism can cause the following diseases: Insanity, epilepsy, chorea, hepatic encephalopathy (Y-aminobutyric acid, serotonin, glutamine), motion sickness, I-type allergic diseases (urticaria, hay fever, allergic rhinitis, skin Allergies), peptic ulcer (histamine), hypercholesterolemia (taurine), tumors (polyamines), etc .;

3. Antibody deficiency is prone to various infections:

 Septicemia, suppurative meningitis, pneumonia, bronchitis, otitis media, pyoderma, etc .;

 3. The special physiological effects of certain proteins: various hemoglobin diseases (anemia, jaundice, tissue-induced organic acidemia due to hypoxia), various coagulation factor deficiency (bleeding), muscle spasm, muscle coercion, muscle paralysis (muscle motion) Protein) and so on;

 Disorders of lipid metabolism can cause disorders in physiological functions of lipids, which in turn can lead to the occurrence of related conditions, including but not limited to:

 1. Energy supply and energy storage: wasting, obesity, etc.

 2. Formation of biofilms: Phospholipids and cholesterol are important components of cell membranes, nuclear membranes, and nerve myelin membranes.

 1. Demyelinating peripheral neuropathy: limb paralysis, limb dysfunction, respiratory palsy (intercostal, diaphragmatic paralysis), facial paralysis, medulla paralysis (hoarseness, cough), autonomic symptoms (increased sweating, skin flushing) , Tachycardia, orthostatic hypotension, urine retention), ataxia, mental disorders, etc .;

 2. White matter dystrophy (demyelinating) diseases: metachromatic white matter dystrophy, Pel izaeus-Merzbach disease, Alexander disease, Cockaynes syndrome, etc .;

 3. Phospholipids and cholesterol molecules contain hydrophilic and hydrophobic groups, so they can emulsify triglycerides and fat-soluble vitamins, and promote their absorption and transport.

 1. Fat-soluble vitamin deficiency: Vi tA (night blindness, dry eye, bone retardation), Vi tE (infertility, abortion, anemia, muscle wasting, neurodegeneration), Vi tK (coagulation factors II, VII, IX, X Lack), Vi tD3 (child rickets, adult osteomalacia, kidney stones), etc .;

 2. Hypertriglyceridemia, fatty deposition diseases (fatty liver, fatty deposition cardiomyopathy, fatty deposition kidney disease) and related tumors (lipoma, lipoblastoma, liposarcoma), etc .;

 4. Phospholipid molecules contain many unsaturated fatty acids. Among them, linoleic acid, linolenic acid and arachidonic acid are essential fatty acids of the human body and are indispensable for maintaining normal life activities. Such as arachidonic acid is the raw material for the synthesis of prostaglandins.

Disorders of prostaglandins and related products: bleeding / coagulant diseases (thromboxane A ₂ ), bronchial asthma (PGE ₂ / PGF ₂ ), peptic ulcer (PGE ₂ ), uterine contraction abortion, etc .;

V. Cholesterol metabolism disorders: 1. Hypercholesterolemia and hyperlipoproteinemia (hyperlipoproteinemia π, ΙΠ, IV, V, etc.)

2. Systemic multi-system atherosclerosis (mainly involving cardiovascular, cerebrovascular, renal, and peripheral blood vessels of limbs, see the [Glucose Metabolism Disorder] section for details)

 3. Fat-soluble vitamin deficiency (see above)

 4. Cholesterol-related products metabolic disorders:

 1) Bile acid metabolism disorders: steatosis (fat malabsorption can cause fat-soluble vitamin deficiency), cholelithiasis, cholelithiasis, biliary cirrhosis, etc .;

 2) Disorders of hormonal metabolism:

 a. Glucocorticoids (Cortisol): high / low blood sugar, muscle wasting, osteoporosis, delayed wound healing, infection, concentric obesity, water poisoning (headache, convulsions, coma), mental disorders, etc

 b. Mineralocorticoids (aldosterone): leech, hypertension, high / low blood sodium (headache, convulsions, coma), high / low blood potassium (muscle paralysis, arrhythmia, renal failure, paralytic intestinal obstruction, drowsiness) , Coma), etc .;

 c. Sex hormones (testosterone, progesterone): abnormal sexual development, abortion, etc .;

 The three major metabolic disorders of sugar, lipid, and protein are causal and affect each other, and their specific clinical manifestations need to be considered in combination with the patient's original physical condition.

 In summary, the polypeptide of the present invention and the antagonist, agonist and inhibitor of the polypeptide can be directly used for the treatment of various diseases, such as diseases related to the three major metabolic disorders of sugar, lipid, and protein.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human cytochrome C oxidase subunit 8.91. Agonists enhance human cytochrome C oxidase subunits. 8. 91 Stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human cytochrome C oxidase subunit 8.91 can be cultured with labeled human cytochrome C oxidase subunit 8.91 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human cytochrome C oxidase subunit 8.91 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonist of human cytochrome C oxidase subunit 8.91 can bind to human cytochrome C oxidase subunit 8.91 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.

In screening compounds that act as antagonists, human cytochrome C oxidase subunit 8.91 can be added to the bioanalytical assay, and by measuring the compound against human cytochrome C oxidase subunit 8.91 and its receptor, Effect to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Can interact with human cytochrome C oxygen The enzymatic subunit 8.91-bound polypeptide molecule can be obtained by screening a random peptide library consisting of various possible combinations of amino acids bound to a solid phase. When screening, the human cytochrome C oxidase subunit 8.91 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against the human cytochrome C oxidase subunit 8.91 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human cytochrome C oxidase subunit 8.91 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human cytochrome C oxidase subunit 8. 91 include, but are not limited to, hybridoma technology (Kohler and Miste in. Nature, 1975, 256: 495-497), triple tumor technology, human B -Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions to non-human-derived variable regions can be produced using existing techniques (Morrison et al., PMS, 1985, 81: 6851). The existing technology for producing single chain antibodies (ϋ. S. Pat No. 4946778) can also be used to produce single chain antibodies against human cytochrome C oxidase subunit 8. 91.

 Antibodies against human cytochrome C oxidase subunit 8.91 can be used in immunohistochemical techniques to detect human cytochrome C oxidase subunit 8.91 in biopsy specimens.

 Monoclonal antibodies that bind to human cytochrome C oxidase subunit 8. 91 can also be labeled with radioisotopes, and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human cytochrome C oxidase subunit 8. 91 High affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human cytochrome C oxidase subunit 8 91 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to the human cytochrome C oxidase subunit 8.91. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human cytochrome C oxidase subunit 8.91.

The invention also relates to a diagnostic test method for quantitative and localized detection of human cytochrome C oxidase subunit 8.91 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human cytochrome C oxidase subunit 8.91 detected in the test can be used to explain human cell color The importance of cyclin C oxidase subunit 8.91 in various diseases and for the diagnosis of diseases in which human cytochrome C oxidase subunit 8.91 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding the human cytochrome C oxidase subunit 8.91 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human cytochrome C oxidase subunit 8.91. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human cytochrome C oxidase subunit 8.91 to inhibit endogenous human cytochrome C oxidase subunit 8.91 activity. For example, a variant human cytochrome C oxidase subunit 8.91 may be a shortened human cytochrome C oxidase subunit 8.91, which lacks a signaling domain, although it can bind to downstream substrates, However, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human cytochrome C oxidase subunit 8.91. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human cytochrome C oxidase subunit 8.91 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding a human cytochrome C oxidase subunit 8.91 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human cytochrome C oxidase subunit 8.91 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense A and DM) and ribozymes that inhibit human cytochrome C oxidase subunit 8.91 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human cytochrome C oxidase subunit 8.91 can be used for the diagnosis of diseases related to human cytochrome C oxidase subunit 8.91. Multinucleus encoding human cytochrome C oxidase subunit 8. 91 Nucleotide can be used to detect the expression of human cytochrome C oxidase subunit 8.91 or abnormal expression of human cytochrome C oxidase subunit 8.91 in disease states. Encoding human cytochrome C oxidase subunit DNA sequences of 8.91 biopsy specimens may be used for hybridization to determine the expression of human cytochrome C oxidase subunit 1 ^8.9. Hybridization techniques include Southern blotting, Nor thern blotting, in situ hybridization, and the like. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human cytochrome C oxidase subunit 8.91 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the human cytochrome C oxidase subunit 8.91 transcription products.

 Detection of mutations in the human cytochrome C oxidase subunit 8.91 gene can also be used to diagnose human cytochrome C oxidase subunit 8.91-related diseases. Human cytochrome C oxidase subunit 8.91 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human cytochrome C oxidase subunit 8.91 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine the presence or absence of mutations in a gene.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DM to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to build a chromosome-specific c-shiphouse.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verraa et al., Human Chromosomes: a Manua l of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be To correlate with genetic map data. These data can be found in V. Mckusick, Mende lian Inheritance in Man (available online with Johns Hopkins University Wetch Medica l Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the cD or genomic sequence differences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human cytochrome C oxidase subunit 8. 91 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human cytochrome C oxidase subunit 8.91 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to conventional conditions such as Sarabrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions Conditions recommended by the manufacturer. Example 1 Cloning of human cytochrome C oxidase subunit 8.91

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) m legs were isolated from total RNA using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 fragment was inserted into the multiple cloning site of the pBSK (+) vector (Clontech), and transformed into DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkiri-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with an existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones, 0472h06, was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full length CDM contained in the 0472h06 clone is 747bp (as shown in Seq ID N0: l), and there is a 245bp open reading frame (0RF) from 283b _P to 528bp, which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0472h06, and the encoded protein was named human cytochrome C oxidase subunit 8.91. Example 2 The gene encoding human cytochrome C oxidase subunit 8.91 was cloned by RT-PCR. Fetal brain cells were used as a template, and ol igo-dT was used as a primer to perform reverse transcription reaction to synthesize cDM. After the cassette was purified, PCR was performed using the following primers:

 Primerl: 5'- ACCAAGGATGAAGAACTTCATGTT -3, (SEQ ID NO: 3)

 Pr imer2: 5'- TTGGACAACCTCAGCCTAATACTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 ′ end of SEQ ID NO: 1;

 Pr iraer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Amplification conditions: 50 mmol / L KC 1, 1 Ommo 1 / L Tris- HCl, pH 8. 5, 1. 5 mmol / L MgCl ₂ , 200 μιηο1 / ί dNTP, 1 Opmol primer, 1U in 50 μ1 reaction volume Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-747bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human cytochrome C oxidase subunit 8.91 gene expression Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method includes acid guanidinium thiocyanate- Extraction with chloroform. That is, 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0) Homogenize the tissue, add 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), mix and centrifuge. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. , (PH7. 0) was electrophoresed on a 1.2% agarose gel -5mM sodium acetate -ImM BDTA-2. 2M formaldehyde with 20μ ₈ RNA containing 20mM 3- (N- morpholino) propanesulfonic acid. It was then transferred to a nitrocellulose membrane. A ³² P dATP was used to prepare ³² P-labeled DM probes by random primer method. The DNA probe used was the PCR amplified human cytochrome C oxidase subunit 8.91 coding region sequence (283bp to 528bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH7. 4)-5 x SSC-5 x Denhardt, s solution and ²⁰ (^ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-0. 1 ° /. SDS at 55 ° Wash for 30 min at C. Then, use Phosphor Imager for analysis and quantification. Example 4 Recombinant human cytochrome C oxidase subunit 8.91 in vitro expression, isolation and purification according to SEQ ID NO: 1 and the coding region shown in Figure 1 Sequence, design a pair of specific amplification primers, the sequence is as follows:

Pr imer3: 5'-CATGCTAGCATGTATAACATCTGTACCAGCTGG-3 '(Seq ID No:) Pr imer4: 5' -C ATGGATCCTC ACTGCAGCCTCC ACCTCCC AGG- 3 '(Seq ID No: 6) The 5' ends of these two primers contain Nhel and BaraHI, respectively Enzymatic digestion sites, followed by coding sequences for the 5 'end and 3, end of the gene of interest, respectively. The Nhel and BamHI digestion sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) a selective endonuclease site. The PCR reaction was performed using pBS-0472Ii06 plasmid containing the full-length target gene as a template. The PCR reaction conditions are as follows: the total volume of 50 μ1 contains 10 pg of pBS-0472h06 plasmid, primers? 1 ^ 0161: -3 and? 1 ^ 11161: -4 are 1 (^ 11101, Advantage polymerase Mix (Clontech)) 1μ1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Use Ntiel and BamHI digested the amplified product and plasmid pET-28 (+) respectively, and recovered large fragments, respectively, and ligated them with T4 ligase. The ligation product was transformed by the calcium chloride method of colibacillus DH5 C, which contained kanamycin. After the LB plate (final concentration 30μ ₈ / ίη1) was cultured overnight, the positive clones were screened by colony PCR and sequenced. The positive clones with the correct sequence (pET-0472h06) were selected to transform the recombinant plasmid into E. coli BL21 using the calcium chloride method. (DE3) plySs (N _OV agen products). LB liquid medium containing kanamycin (final concentration of 30μ Ε _/ πι1), the host strain BL21 _(P ET-0472h06) grown to log in 37.C During the growth period, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. Centrifuge the bacteria to collect the bacteria, sonicate the bacteria, centrifuge to collect the supernatant, and use an affinity layer capable of binding to 6 histidines (6His-Tag). Analytical column His s. Bind Quick Cartr idge (product of Novagen) Analysis to obtain a purified protein of human cytochrome C oxidase subunit 8. 91. SDS-PAGE electrophoresis and a single band (FIG. 2) at 9kDa The strip The N-terminal amino acid sequence was analyzed by Edams hydrolysis method after being transferred to a PVDF membrane. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human cytochrome C oxidase subunit 8.91 antibody

The following peptides specific for human cytochrome C oxidase subunit 8, 91 were synthesized using a peptide synthesizer (product of PE): NH2-Met-Tyr-Asn-I le-Cys-Thr-Ser-Trp-Val-Gln -Trp-Leu-Met-Pro-Val-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For the method, see: Avraraeas, et al. Immunochemis try, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and the anti-peptide antibody was separated from the total I _g by affinity chromatography. Immunoprecipitation demonstrated that the purified antibody could specifically bind to human cytochrome C oxidase subunit 8.91. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 The suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to the genome or CDM library of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; A needle is an oligonucleotide fragment that is partially identical or complementary to a polynucleotide SEQ ID ³ NO: 1 of the present invention. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5 -TGTATAACATCTGTACCAGCTGGGTACAGTGGCTGATGCCT-3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5 -TGTATAACATCTGTACCAGCCGGGTACAGTGGCTGATGCCT-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES G. KeKeller; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1000 g for 10 minutes. 3) Suspend the precipitate (approximately 10 ml / g) with a cold homogenate buffer solution (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / L NaCl; 25 mmol / L MgCl ₂ ). 4) at 4. C Homogenize the tissue suspension at full speed with an electric homogenizer until the tissue is completely broken. 5) 1000g centrifuge 10 minutes. 6) Resuspend the cell pellet (add 1-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, D phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (1x10 ^s cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1800 volumes of 2mol / L sodium acetate and 2 volumes of cold 100 ° / »ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until DM is fully dissolved, and add approximately 1 ul per 1-5 X 10 ^fi cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RMase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / mL and incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 10 volumes of 2: 1101/1 ^ sodium acetate and 2.5 volumes of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determination of A _26Q and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° C after dispensing.

 Preparation of sample film:

1) Take 4x2 sheets of nitrocellulose (NC membrane) of appropriate size, and mark it lightly with a pencil For spotting position and sample number, two NC membranes are required for each probe, in order to wash the membranes with high-strength conditions and intensity conditions in the subsequent experimental steps.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5mol / L NaCl for 5 minutes (twice), dry and place in 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) it Sephadex G-50 column.

5) Collect the first peak before ³² P-Probes are washed out (monitorable).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) combining the first peak was collected after ³² P-Prob _e is prepared as required (the second peak to the free γ- ³² Ρ- dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3 to 10 mg of prehybridization solution (10xDen ardt> s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 Jane, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

1) Take out the hybridized sample membrane. 2) 2xSSC, 0.1% SDS, 37. C wash for 15 minutes (2 times).

 3) 0.1xSSC, 0.1% SDS, 37. C wash for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious. Stronger in radioactivity than the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as the target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slide was hydrated, dried, and cross-linked in a UV cross-linker. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time; 4. NaBH _{4 is} blocked for 5 minutes;

 5. 95. C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total RNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). Cy3dUTP (5-Amino-propargyl-2--deoxyur idine 5 · -triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) was used to label mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl-2 '-deoxyur idine 5'-tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> <SSC, 0.2% SDS) was used at room temperature. ) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed and processed with Iraagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are fetal brain, bladder mucosa, PMA + Ecv304 cell line, LPS + Ecv304 cell line, thymus, normal fibroblasts 1024NC, Fibroblas t, growth factor stimulation, 1024NT, scar formation fc growth factor stimulation, 1013HT, scar into fc without growth factor stimulation, 1013HC, bladder cancer cell EJ, bladder cancer, bladder cancer, liver cancer, liver cancer cell line, fetal skin, spleen, prostate cancer, jejunal adenocarcinoma, Cardiac cancer. Based on these 18 Cy3 / Cy5 ratios, a bar graph is drawn (Figure 1). It can be seen from the figure that the expression profiles of the human cytochrome C oxidase subunit 8.91 and the cytochrome C oxidase Vllb subunit according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-human cytochrome C oxidase subunit 8.91, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof Thing.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 283-528 in SEQ ID NO: 1 or a sequence of positions 1-747 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from any one of claims 4 to 6 and the polynucleotide, a plasmid, a virus or a vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human cytochrome C oxidase subunit 8.91 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell of claim 8 under the condition of expressing human cytochrome C oxidase subunit 8.91;

(b) A polypeptide having human cytochrome C oxidase subunit 8.91 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to a human cytochrome C oxidase subunit 8.91.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the human cytochrome C oxidase subunit 8.91.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. Use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human cytochrome C oxidase subunit 8.91 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a polypeptide related to any one of claims 1-3, characterized in that it comprises detecting the expression level of said polypeptide, or detecting said Polypeptide activity, or detection of changes in the polynucleotide that cause abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used to screen a mimetic, agonist, antagonist or inhibitor of human cytochrome C oxidase subunit 8.91 Agents; or for identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with a human cytochrome C oxidase subunit 8.91 abnormality.

 18. The application of any one of claims 1-6 and 11, the application of the polypeptide, polynucleotide or compound described in claim 1, which is characterized in that the polypeptide, polynucleotide or compound is used to prepare for the treatment of malignant tumors. Drugs for blood diseases, HIV infection and immune diseases and various types of inflammation.