WO2002004952A2 - Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors - Google Patents
Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors Download PDFInfo
- Publication number
- WO2002004952A2 WO2002004952A2 PCT/EP2001/007924 EP0107924W WO0204952A2 WO 2002004952 A2 WO2002004952 A2 WO 2002004952A2 EP 0107924 W EP0107924 W EP 0107924W WO 0204952 A2 WO0204952 A2 WO 0204952A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tumor
- antibody
- ovarian
- fragment
- patient
- Prior art date
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57449—Specifically defined cancers of ovaries
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57442—Specifically defined cancers of the uterus and endometrial
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70503—Immunoglobulin superfamily, e.g. VCAMs, PECAM, LFA-3
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70596—Molecules with a "CD"-designation not provided for elsewhere in G01N2333/705
Definitions
- the present invention relates to a method for the diagnosis of an ovarian or endometrial tumor or for a prognosis, characterized in that the Ll level is determined in a patient sample, the presence of Ll being an indication of the presence of an ovarian or endometrial tumor or a possible predisposition for such a tumor. This detection is made preferably via a monoclonal anti Ll antibody or a fragment thereof.
- the invention also relates to pharmaceutical preparations for use in the therapy of an ovarian or endometrial tumor. Furthermore, the present invention concerns a method of treating ovarian or endometrial tumors.
- TAG tumor antigens
- tissue, individual and species-specific TAGs which may also be present physiologically as differentiation antigens on cells and between TAGs which are referred to as tumor-specific neoantigens and TAGs as intermediate products of the oncogenesis of a cell type which disappear again with further differentiation. They are detectable as tumor markers by immunochemical methods, above all intracellular antigens (AG) or antigens forming (increasingly) as surface antigens on tumor cells being of interest. Of diagnostic significance are e.g.
- the oncofetal AG e.g. the carcinoembryonal AG (in the case of colon carcinoma), the SCC AG ("squamous cell carcinoma antigen"), ⁇ ⁇ fetoprotein (in the case of primary liver cell carcinoma) , isoferritin and fetal sulfoglycoprotein (in the case of gastric cancer and colon carcinoma) , ⁇ 2 ⁇ H ferroprotein (in the case of a malignant tumor occurring in early childhood), ⁇ - fetoprotein (in the case of sarcomas, leuke ias, breast cancers) , furthermore "Tennessee AG” (tennagen) , "tissue polypeptide AG” (TPA) , oncofetal membrane AG (OFMA) , tumor-specific transplantation AG (TSTA) , membrane- associated tumor AG (MATA) as well as minor antigens such as "A-like” AG, "Forss an” AG, WGL, etc.
- OFA oncofeta
- CA125 highly glycosylated cellular mucin which occurs in tumor cells to a greater degree and is released
- CA125 highly glycosylated cellular mucin which occurs in tumor cells to a greater degree and is released
- the diagnosis based on the detection of CA125 has a number of serious drawbacks.
- increased serum levels of CA125 can also occur in a number of benignant diseases, e.g. in the case of an endometrial inflammation, pelvic inflammation, cirrhosis or also during the menstruation or a pregnancy.
- CA125 is also found in the case of non-gynecologic malignant tumors such as breast cancer, colorectal cancer, pancreatic carcinoma or lung cancer. Thus, this can lead to false-positive diagnoses.
- CA125 is also found in the case of imunostaining of colon-adenocarcinomas, gastric cancer, lung cancer and atypical hyperplasias of the endometrium. For the early detection of ovarian or endometrial carcinoma the measurement of CA125 - in combination with ultrasound - does not yield any satisfactory reliable results either.
- CA125 is not suited for an early detection of ovarian or endometrial cancer but - if at all - rather for subsequent stages or relapses, however, the above described problems regarding the specificity existing, i.e. the diagnostically hardly acceptable occurrence of false-positive findings.
- the invention is based on the technical problem of providing markers which permit an improved and more specific diagnosis of ovarian and endometrial cancers, including the possible distinction between various tumor types and the possibility of detecting metastases and thus improved therapeutic, e.g. surgical, measures.
- a further technical problem is to provide a therapeutic approach by using Ll as therapeutic target. The solution to this technical problem is achieved by providing the embodiments characterized in the claims.
- Ll adhesion molecule represents a highly specific marker in body fluids (e.g. in the blood serum, ascites and fluid from Douglas coule de sac) and tissue from ovarian and endometrial tumors, above all for highly aggressive forms of these tumors .
- Ll is a neuronal adhesion molecule of 200 - 230 kDa, which as regards its structure belongs to the Ig superfamily.
- Ll is a protein associated with cell migration, which in the brain is involved in the neuronal migration in the cerebellum and in the fasciculation of neurites.
- Ll has several binding partners among them Ll itself, the proteoglycan neurocan and various integrins (Kadmon et al., Differentiation 61: 143-150, 1997). Soluble Ll can stimulate the migration of tumor cells and hence promote metastasis (Mechtersheimer et al., JBC 2001, in press) . In the screening experiments resulting in the present invention it turned out that Ll is not expressed in normal tissues with the exception of peripheral nerves and ganglions. In benignant ovarian and endometrial tumors no Ll expression could be detected, and the screening of other malignant tumors (breast, prostate, cervix) was also negative.
- Ll is expressed on highly aggressive serous papilloma carcinomas of the ovary and the endometrium. Soluble Ll was detectable in the serum and ascitic or pleural fluids of tumor patients but not in normal sera and body fluids or in patients having benignant tumors . Preoperative samples which were obtained by gynecologic curettage were positive in serous papilloma carcinomas of the endometrium and with the involvement of the ovary. Thus, the expression of Ll as cell surface molecule in the serum and in body fluids is highly significant as regards the early detection of aggressive ovarian and endometrial tumors and also as regards the prognostication.
- the Ll detection permits the early detection and accurate diagnosis or prognosis of aggressive ovarian and endometrial tumors .
- the subject matter of the present invention relates to a method for the diagnosis of an ovarian or endometrial tumor or for a prognosis, characterized in that the Ll level is determined in a patient sample, the presence of Ll being an indication of the presence of an ovarian or endometrial tumor or a predisposition for such a tumor.
- the Ll adhesion molecule can be detected via common methods, the known amino acid sequence of the Ll protein or the nucleic acid sequence of the corresponding gene being used as a basis (Reid, R.A. et al., J. Mol. Neurosci. 3: 127-135, 1992).
- the detection may refer to the transcription (detection of the concentration of the RNA via common methods) or the Ll protein per se, the latter being preferred.
- the expression "the presence of Ll [as] an indication of the presence of an ovarian or endometrial tumor or a predisposition for such a tumor” also comprises the situation in which the concentration of Ll is increased as compared to a control (e.g. body fluid or tissue of a healthy person) .
- a control e.g. body fluid or tissue of a healthy person
- the Ll level is determined by determining Ll as cell surface molecule in tissue. Suitable tissues are removed tumor tissue and cell material obtained by curettage, the tissue obtained from a gynecologic curettage being preferred.
- the Ll level is determined by determining Ll in soluble form in a body fluid.
- Suitable body fluids are blood serum, ascitic or pleural fluid or fluid from Douglas coule de sac, serum being preferred.
- a third preferred embodiment does not carry out the detection of Ll but the detection of Ll-specific antibodies by means of (recombinant) Ll.
- purified (recombinant) Ll is immobilized on the surface of microtitration plates and then incubated with patient serum. Bound antibodies are then detected by means of an enzyme-conjugated second antibody and a color reaction.
- Ll mRA is detected in a body fluid sample, preferably in blood serum.
- Suitable detection methods of Ll, Ll mRNA and Ll antibodies, respectively, and suitable specific probes are known to the person skilled in the art, the detection of Ll protein via specific antibodies being preferred, the same or different antibodies being usable for both the soluble form and for the form on the cell surface.
- the Ll level is therefore determined by contacting the patient sample with an anti-Ll antibody or a fragment thereof and then determining whether the anti-Ll antibody or the fragment thereof has been bound to Ll .
- Fig. 6A-C the Ll level is therefore determined by contacting the patient sample with an anti-Ll antibody or a fragment thereof and then determining whether the anti-Ll antibody or the fragment thereof has been bound to Ll .
- the antibodies suitable for this purpose may be monoclonal, polyclonal or synthetic antibodies or fragments thereof.
- fragment refers to all parts of the monoclonal antibody (e.g. Fab-, Fv- or "single chain Fv” fragments) which have the same epitope specificity as the complete antibody. The production of such fragments is known to the person skilled in the art.
- the antibodies according to the invention are preferably monoclonal antibodies.
- the antibodies according to the invention can be prepared according to standard methods, Ll or a synthetic fragment thereof, which is present in both Ll forms (soluble/anchored on the cell surface) preferably serving as an immunogen. This polypeptide or peptide and the fragment thereof, respectively, can be produced e.g.
- Anti-Ll antibodies suitable for the diagnostic method according to the invention are commercially available. These are e.g. the primary human monoclonal anti Ll antibodies 15551A (Company of Pharmingen, San Diego, USA) or MCA1753 (BIOZOL Diagnosticamaschine GmbH, Eching, Germany) .
- the Ll level is determined via a primary ⁇ monoclonal anti-Ll antibody and a commercially available secondary antibody.
- the secondary antibody may carry any label which may be detected. It is, however, preferred that this secondary antibody may be biotin-conjugated and may be detected by using streptavidin peroxidase. The person skilled in the art is perfectly familiar with methods of carrying out this embodiment.
- the detection of Ll e.g. via ELISA
- the patient sample is immobilized, e.g. as paraffin section.
- the patient sample can also be absorbed to the wall of a plastic dish by common methods such that Ll does not loose its bonding specificity e.g. for a specific antibody added thereto.
- the anti Ll antibody or the fragment thereof is immobilized, i.e. it is absorbed e.g. to the wall of a plastic dish without loosing its bonding specificity for Ll . Then a patient sample is added.
- the bonding of the antibody can be detected by common methods, e.g. Western blot, ELISA, radioimmunoassay (RIA) , etc., RIA and ELISA being preferred.
- common methods e.g. Western blot, ELISA, radioimmunoassay (RIA) , etc., RIA and ELISA being preferred.
- the above mentioned preferred fourth embodiment of the method of the present invention is based on the detection of Ll mRNA by RT-PCR. It has shown before that different isoforms of human Ll (i.e. hemoatopoietic Ll vs. neural Ll) can be distinguished on the basis of Ll exon 27 usage. Hematopoietic cells do not express exon 27. (Ebeling et al, Eur J Immunol. 26:2508-2516,1996). This exon encodes 4 aminoacids in the cytoplasmic tail of Ll .
- RT-PCR By RT-PCR using specific primer for this region of Ll it has now found out that ovarian tumors (established cell lines and tumor speciments) express the neural form of Ll which is characterized by an insertion of 12 nucleotides ( Fig. 4) . Using the same primers it has been observed that Ll specific mRNA could be detected in tumor patient sera. RT-PCR detection of tumor derived mRNA (possibly derived from tumor cells in the blood) in addition to protein detection by ELISA is a sensitive technique for diagnosis.
- a kit which is of use for the diagnostic method according to the invention and preferably contains an anti Ll antibody or a fragment thereof and in addition Ll or a bond-active part thereof for the purpose of control.
- the expression "bond-active part” refers to a fragment which reacts with the antibody with which the whole molecule reacts as well .
- the antibody can be conjugated to another unit, e.g. a marker, and/or it can be immobilized on a solid carrier (substrate) .
- the kit can also contain a second antibody for the detection of Ll/antibody complexes.
- the antibody or the fragment thereof may be present in free form or be immobilized on a solid carrier, e.g.
- the kit may also contain instructions which describe the use of the antibody or a fragment thereof in an assay for the detection of a predisposition or the presence of a tumor.
- the kit can also contain suitable reagents for the detection of labelings or for the labeling of positive and negative controls, wash solutions, dilution buffers, etc.
- immunotherapy via the sensibilization of tumor-specific T lymphocytes can also be carried out according to known methods with the above mentioned antibodies or fragments thereof or with peptides which are derived from Ll (on the basis of the known amino acid sequence) and have preferably a length of at least 9 - 12 amino acids .
- antibodies against Ll can also be used with the intention to use Ll as a tumor-specific target antigen.
- the present invention also relates to a pharmaceutical preparation which contains an anti Ll antibody or a fragment thereof, or a peptide derived from Ll, or a Ll antisense oligonucleotide.
- the antibodies are preferably monoclonal antibodies.
- said monoclonal antibody is an antibody originating from an animal (e.g. mouse), a humanized antibody or a chimeric antibody or a fragment thereof.
- Chimeric antibodies resembling human antibodies or humanized antibodies have a reduced potential antigenicity, however, their affinity for the target is not lowered.
- Humanized immunoglobulins have variable framework regions which originate substantially from human immunoglobulin (with the designation of acceptor immunoglobulin) and the complementarity of the determining regions which originate substantially from a non-human immunoglobulin (e.g. of a mouse) (with the designation of donor immunoglobulin).
- the constant region(s) originate (s) , if present, also substantially from a human immunoglobulin.
- humanized (and the human) antibodies offer a number of advantages over antibodies of mice or other species: (a) the human immune system should not regard the framework or the constant region of the humanized antibody as foreign and therefore the antibody response against such an injected antibody should be less than against a completely foreign mouse antibody or a partially foreign chimeric antibody; (b) since the effector region of the humanized antibody is human, it interacts better with other parts of the human immune system, and (c) injected humanized antibodies have a half life which is substantially equivalent to that of naturally occurring human antibodies, which permits to administer smaller and less frequent doses as compared to antibodies of other species .
- Ll itiAb is labeled with (123)1 for imaging and injected i.p. or i.v. as described (vanZanten-Przybysz,I. Int.J.Cancer 92:106-114, 2001).
- MAb to Ll is injected after stable conjugation with cytotoxic drugs in order to kill tumor cells.
- cytotoxic drugs are radionuclides, toxic proteins (e.g. saporin) , chemotherapeutic agents or further antibodies with other specificity (e.g. against T cells, e.g. CD3) , so that bifunctional antibodies form which effect the killing of tumor cells by means of cytotoxic T cells.
- overexpression of Ll in ovarian and endometrium tumors can be used to prime cytotoxic T lymphocytes in order to kill tumor cells in situ.
- A) Peptides derived from the sequence Ll may be used to vaccinate tumor patients.
- a mixture of Ll- peptides restricted by HLA-Al ATEGWFIGF and GSDDSLADY
- HLA-A2 LLANAYIYV and WLDEDGTTV
- HLA-A3 VLTGYVLSY
- GM-CSF and Montanide ISA-51 adjuvant (Seppic, Fairfield, NJ, USA)
- Patients receive a vaccine comprising the 5 Ll peptides (50-200 ⁇ g, preferably 100 ⁇ g each) and 150-200 ⁇ g (preferably 190 ⁇ g) of the HLA- DR-restricted tetanus helper peptide AQYIKANSKFIGITEL .
- This peptide represents peptide p2 of tetanus toxoid (residues 830-844) plus an amino- erminal alanine residue to prevent formation of pyroglutamate from the N-terminal glutamine residue.
- Tetanus peptide p2 is a promiscuous binder to HLA- DR molecules.
- Vaccines are administered with 150-250 g (preferably 225 ⁇ g) GM-CSF in Montanide ISA-51 adjuvant.
- Each patient is preferably immunized at days 0, 7, 14, 28, 35 and 42 for a total of 6 immunizations as described by Yamshchikov et al Int.J.Cancer 92:703 (2001).
- the individual time frame, doses and total number of immunizations can be determined by a medical doctor depending on the kind of tumor, tumor growth, presence/absence of metastasis and patient's data (weight, age etc.).
- Dendritic cells derived from tumor patients may be pulsed with the above mentioned Ll peptides as decribed by Lau et al J.Immunother 24:66-78 (2001).
- the dendritic cells are preferably obtained by incubation of plastic-adherent peripheral blood mononuclear cells from tumor patients with IL-4 and GM-CSF for 8 days in serumless medium.
- the dendritic cells are then pulsed with Ll peptides (each at approximately 50 ⁇ g/ml) for overnight and then used for (intravenous) infusions.
- Ll antisense oligonucleotides are used to downregulate Ll expression in tumor cells. It corresponds preferably to the sequence AGGCTGTCGTCACTGCCCA and is the inverse complement of nucleotides +3593/3611 of the sequence of human Ll.
- the phosphorothioate oligo-nucleotide is preferably injected into the peritoneum of the tumor patient at doses between 1- 12 mg/kg to achieve significant concentrations of oligonucleotide.
- the individual time frame, doses and total number of administrations can be determined by a medical doctor depending on the kind of tumor, tumor growth, presence/absence of metastasis and patient's data (weight, age etc. ) .
- Figure 1 Endometroid ovarian adenocarcinoma composed of tubular glands and lined by non-mucin secreting stratified epithelium. Immunohistochemical staining with anti Ll antibody shows strong heterogenous membral staining.
- B Serous carcinoma of the ovary showing papillary and slit like configurations with solid tumor masses in the stroma. Strong positive immunohistochemical staining with anti Ll.
- D Appendical wall infiltrated by ovarian carcinoma cells. Strong homogeneous staining of tumoral cells by anti Ll antibody. No staining of normal mucosal glands and lymphatic tissue. Small peripheral nerve bundles show strong positive staining.
- E Vaginal wall showing small tumoral mass in the lamina limbal and small tumor emboli in the dilated lmyphatics. Immunostaining with anti Ll shows strong homogeneous staining.
- Fig. 2 Detection of Ll from curettage material A: Tissue obtained from curettage B: Control sections from ovarian adenocarcinoma
- Fig. 3 Detection of soluble Ll in body fluids (1F-14F) and sera (1S-32S) by means of ELISA.
- the samples 4F, 5F, 8F, 12F and 23F originate from female ovarian cancer patients.
- Fig. 4 1%-Agarose gel after PCR analysis of exon 27 usage mRNAs from ovarian tumor speciments or known tumor cell lines (AR, OAW, Mel63) were isolated and transcribed in cDNA. These cDNAs were used as template for PCR analysis of exon 27 usage, Plasmids encoding both forms were used as control (-RSLE/+RLSE) .
- Fig. 5 Comparison of two different ELISA formats
- the ELISA was carried out as described in A but bound soluble Ll was detected using Ll mAB 1 followed by Streptavidin-Peroxidase. This ELISA format can detect only dimeric (multimeric) Ll.
- Fig. 6 A: Ovarian tumor specimens were lysed and analysed by SDS-PAGE and Western blotting using an antibody to the cytoplasmic portion of Ll
- Example 1 The examination of curettage tissue shows a high correlation between the expression of Ll and the clinical stage and the pathological degree of the tumors, respectively
- Tumor tissue is embedded in paraffin according to standard methods and serial sections are made. Following the treatment of the sections in the microwave oven (10 min., 92°C) in the presence of 1 mmol EDTA (pH 8.0) immunostaining of the tissue is carried out by means of the MCA1753 antibody (Biozol Diagnostica Vertiebs GmbH) . The bound first antibody is detected by means of an enzyme-coupled second antibody (Vector ABC Kit; www.vectorlabs.com) . Some exemplary stainings are shown in Figure 1. The clinical data are listed in Tables 1 and 2.
- Figure 2 shows that Ll can also be detected by means of curettage tissue. Using the above described procedure, a similar staining pattern as on the tumor sections results. The determination of Ll by means of curettage material permits an early preoperative classification of the tumor within the meaning of Tables 1 and 2.
- Example 2 ELISA shows the presence of soluble Ll in sera and ascitic fluid of tumor patients, a correlation between the presence of Ll and the tumor type (ovarian and endometrial tumor) being observed.
- Samples of body fluids were tested for the presence of soluble Ll using a "capture" ELISA.
- microtitration plates were coated with the human anti Ll antibody (concentration: 1 ⁇ g/ml) described in Example 1 and then a blocking step was carried out with 3 % BSA in PBS (45 min., room temperature) to eliminate the non-specific bonding to the plate.
- the body fluid was added at differing concentrations (1:2 and 1:10 of the fluid in 3 % BSA in PBS), and incubation was carried out at room temperature for 1 hour. Therefore, four wash steps followed in Tris-buffered common salt solution (TBS, pH 8.0, in the presence of 0.02 % Tween- 20) .
- TBS Tris-buffered common salt solution
- Bound soluble Ll was determined by the addition of human biotin-conjugated anti Ll antibody.
- the biotinylated antibody MCA1753 is added to the microtitration plates for 1 hour. This was followed by 4 wash steps as described above. Another incubation at room temperature for 1 hour with peroxidase-conjugated streptavidin (Dianova Hamburg, Germany) follows. Finally, another 4 wash steps are carried out.
- the substrate solution is added to the microtitration plates and upon appearance of the color reaction the result is evaluated on the ELISA reader. The results are shown in Figure 3.
- Example 3 A new ELISA format for the detection of soluble Ll
- the ELISA described above in Example 2 used the coating of the microtiter plate with Ll mAb 1 (capturing monoclonal antibody) and the detection of soluble Ll with a biotinylated (or otherwise labelled) Ll mAb 2 (detecting monoclonal antibody) .
- This type of ELISA is termed G/K format .
- Fig. 5 A and B a comparison of both types of ELISA is shown using a positive serum (CA526, ovarian tumor patient) and seval control sera from unrelated tumors.
- Example 4 PCR analysis for detecting Ll mRNA in tumor samples
- Primer sequences for PCR analysis are deduced from the human Ll cDNA sequence (EMBL accession number M 74387) .
- mRNA is isolated using commercial kits (Roche Molecular Biochemicals) and transcribed into cDNA.
- a nested PCR approach is used with the following primer combinations: First amplification primer 1: ACTGAGGGCTGGTTCATC (sense), primer 2: CTTGCACTGTACTGGCCA (antisense) (one cycle 45 sec, 94°C, 30 cycles of 1 in at 94°C, 1 min at 56°C, 1 min at 72°C) .
- primer 1 ACTCAGTGAAGGATAAGGAG (sense)
- primer 2 TTGAGCGATGGCTGCTGCT.
- primer 1 AGGTCCCTGGAGAGTG (sense)
- primer 2 TTGAGCGATGGCTGCTGCT (antisense)
- the temperature profile for the PCR reaction are as described above.
- PCR products are preferably separated on a 2% agarose gel containing 0.5 ⁇ g/ml ethidium bromide.
- the gel is blotted and hybridized with the labeled Ll oligonucleotide probe (TCTGAGGCCCGACCGATGAAAGATGAGACCTTC) by southern blotting to increase the sensitivity.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- General Chemical & Material Sciences (AREA)
- Reproductive Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU2001285820A AU2001285820A1 (en) | 2000-07-10 | 2001-07-10 | Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors |
US10/332,876 US7618785B2 (en) | 2000-07-10 | 2001-07-10 | Diagnostic and therapeutic methods based on the L1 adhesion molecule for ovarian and endometrial tumors |
JP2002509771A JP5165827B2 (en) | 2000-07-10 | 2001-07-10 | Method for detecting ovarian tumor or endometrial tumor based on L1 adhesion molecule for ovarian tumor and endometrial tumor |
EP01965101A EP1386162A2 (en) | 2000-07-10 | 2001-07-10 | Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors |
CA002415364A CA2415364C (en) | 2000-07-10 | 2001-07-10 | Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors |
US11/865,989 US7670601B2 (en) | 2000-07-10 | 2007-10-02 | Diagnostic and therapeutic methods based on the L1 adhesion molecule for ovarian and endometrial tumors |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
EP00114788.3 | 2000-07-10 | ||
EP00114788A EP1172654B1 (en) | 2000-07-10 | 2000-07-10 | Diagnostic method based on the detection of the L1 adhesion molecule for ovarian and endometrial tumors |
Related Child Applications (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
US10332876 A-371-Of-International | 2001-07-10 | ||
US11/865,989 Division US7670601B2 (en) | 2000-07-10 | 2007-10-02 | Diagnostic and therapeutic methods based on the L1 adhesion molecule for ovarian and endometrial tumors |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2002004952A2 true WO2002004952A2 (en) | 2002-01-17 |
WO2002004952A3 WO2002004952A3 (en) | 2003-11-06 |
Family
ID=8169210
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/EP2001/007924 WO2002004952A2 (en) | 2000-07-10 | 2001-07-10 | Diagnostic and therapeutic methods based on the l1 adhesion molecule for ovarian and endometrial tumors |
Country Status (10)
Country | Link |
---|---|
US (2) | US7618785B2 (en) |
EP (2) | EP1172654B1 (en) |
JP (1) | JP5165827B2 (en) |
CN (1) | CN1479871A (en) |
AT (1) | ATE377192T1 (en) |
AU (1) | AU2001285820A1 (en) |
CA (1) | CA2415364C (en) |
DE (1) | DE60036935T2 (en) |
ES (1) | ES2296586T3 (en) |
WO (1) | WO2002004952A2 (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1623995A1 (en) * | 2004-08-06 | 2006-02-08 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibitors of L1 and ADAM10 for the treatment of carcinomas |
US7070939B2 (en) | 2000-10-02 | 2006-07-04 | The Scripps Research Institute | Methods for detecting vasculopathies and tumors |
WO2009127414A2 (en) * | 2008-04-16 | 2009-10-22 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibition of angiogenesis and tumor metastasis |
US8138313B2 (en) | 2007-06-15 | 2012-03-20 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | Treatment of tumors using specific anti-L1 antibody |
Families Citing this family (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE60036935T2 (en) * | 2000-07-10 | 2008-08-21 | Mor-Research Applications Ltd. | Diagnostic procedure for ovarian and endometrial tumors based on the detection of the L1 adhesion molecule |
WO2007114550A1 (en) * | 2006-04-03 | 2007-10-11 | Korea Research Institute Of Bioscience And Biotechnology | A novel monoclonal antibody specific to the l1cam, a hybridoma producing the same and a method producing the same |
KR100931976B1 (en) | 2006-08-23 | 2009-12-15 | 한국생명공학연구원 | A pharmaceutical composition for treating cholangiocarcinoma, a method for inhibiting growth or invasion of cholangiocarcinoma and a method for treating cholangiocarcinoma |
KR20100060351A (en) | 2008-11-27 | 2010-06-07 | 한국생명공학연구원 | A composition for treating l1cam-expressing cancer comprising an inhibitor of activity or expression of l1cam and anticancer agent |
CN104936984B (en) * | 2012-11-16 | 2018-09-14 | 江原大学校产学协力团 | Specifically bind the antibody and application thereof of people and mouse L1CAM |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2339200A (en) * | 1998-06-06 | 2000-01-19 | Genostic Pharma Ltd | Genomic profiling of disease susceptibility |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US4939240A (en) * | 1983-03-04 | 1990-07-03 | Health Research, Inc. | Monoclonal antibodies to human breast carcinoma cells and their use in diagnosis and therapy |
DE60036935T2 (en) * | 2000-07-10 | 2008-08-21 | Mor-Research Applications Ltd. | Diagnostic procedure for ovarian and endometrial tumors based on the detection of the L1 adhesion molecule |
US20020115065A1 (en) * | 2000-08-28 | 2002-08-22 | Ton Logtenberg | Differentially expressed epitopes and uses thereof |
EP1399850A2 (en) * | 2001-02-21 | 2004-03-24 | The Board of Regents of The University of Oklahoma | Hla ligand database utilizing predictive algorithms and methods of making and using same |
-
2000
- 2000-07-10 DE DE60036935T patent/DE60036935T2/en not_active Expired - Lifetime
- 2000-07-10 EP EP00114788A patent/EP1172654B1/en not_active Expired - Lifetime
- 2000-07-10 ES ES00114788T patent/ES2296586T3/en not_active Expired - Lifetime
- 2000-07-10 AT AT00114788T patent/ATE377192T1/en active
-
2001
- 2001-07-10 WO PCT/EP2001/007924 patent/WO2002004952A2/en active Application Filing
- 2001-07-10 EP EP01965101A patent/EP1386162A2/en not_active Withdrawn
- 2001-07-10 CN CNA018125344A patent/CN1479871A/en active Pending
- 2001-07-10 US US10/332,876 patent/US7618785B2/en not_active Expired - Fee Related
- 2001-07-10 CA CA002415364A patent/CA2415364C/en not_active Expired - Fee Related
- 2001-07-10 JP JP2002509771A patent/JP5165827B2/en not_active Expired - Fee Related
- 2001-07-10 AU AU2001285820A patent/AU2001285820A1/en not_active Abandoned
-
2007
- 2007-10-02 US US11/865,989 patent/US7670601B2/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
GB2339200A (en) * | 1998-06-06 | 2000-01-19 | Genostic Pharma Ltd | Genomic profiling of disease susceptibility |
Non-Patent Citations (9)
Title |
---|
F. CARREIRAS ET AL.: "Migration properties of the human ovarian adenocarcinoma cell line IGROV1: importance of alpha-v-beta-3 integrins and vitronectin" INTERNATIONAL JOURNAL OF CANCER, vol. 80, no. 2, 18 January 1999 (1999-01-18), pages 285-294, XP000972600 * |
G. KADMON ET AL.: "L1 makes immunological progress by expanding its relations" DEVELOPMENTAL IMMUNOLOGY, vol. 6, no. 3-4, 1998, pages 205-213, XP000972595 * |
G. KADMON ET AL.: "The neural cell adhesion molecule N-CAM enhances L1-dependent cell-cell interactions" JOURNAL OF CELL BIOLOGY, vol. 110, no. 1, January 1990 (1990-01), pages 193-208, XP000972639 * |
G. KADMON ET AL: "The cell adhesion molecule L1: species- and cell-type-dependent multiple binding mechanisms" DIFFERENTIATION, vol. 61, no. 3, February 1997 (1997-02), pages 143-150, XP000972596 cited in the application * |
K. MASAHIRO ET AL.: "Expression of neural cell adhesion molecule L1 in human lung cancer cell lines" CELL STRUCTURE AND FUNCTION, vol. 22, no. 5, October 1997 (1997-10), pages 511-516, XP000972603 * |
L. LOIUDICE ET AL.: "Ascitic fluid-associated lymphocytes in patients with metastatic ovarian cancer" EUROPEAN JOURNAL OF GYNAECOLOGICAL ONCOLOGY, vol. 16, no. 4, 1995, pages 301-306, XP000972604 * |
R. A. REID ET AL: "Varients of human L1 cell adhesion molecule arise through alternate splicing of RNA" JOURNAL OF MOLECULAR NEUROSCIENCE, vol. 3, no. 3, 1992, pages 127-135, XP000972637 cited in the application * |
T. STROBEL ET AL.: "Beta1- integrins partly mediate binding of ovarian cancer cells to peritoneal mesothelium in vitro" GYNOCOLOGIC ONCOLOGY, vol. 73, no. 3, June 1999 (1999-06), pages 362-367, XP000972601 * |
X. HAN ET AL.: "Tumor lymphocytes in patients with advanced ovarian cancer: changes during in vitro culture and implications for immunotherapy" GYNNECOLOGIC ONCOLOGY, vol. 65, no. 3, June 1997 (1997-06), pages 391-398, XP000972606 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7070939B2 (en) | 2000-10-02 | 2006-07-04 | The Scripps Research Institute | Methods for detecting vasculopathies and tumors |
EP1623995A1 (en) * | 2004-08-06 | 2006-02-08 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibitors of L1 and ADAM10 for the treatment of carcinomas |
WO2006013051A1 (en) * | 2004-08-06 | 2006-02-09 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibitors of l1 and adam10 for the treatment of carcinomas |
US8003599B2 (en) | 2004-08-06 | 2011-08-23 | Deutsches Krebsforschungszentrum | Inhibitors of L1 and ADAM10 for the treatment of carcinomas |
US8138313B2 (en) | 2007-06-15 | 2012-03-20 | Deutsches Krebsforschungszentrum Stiftung Des Offentlichen Rechts | Treatment of tumors using specific anti-L1 antibody |
US9260521B2 (en) | 2007-06-15 | 2016-02-16 | Medigene Ag | Treatment of tumors using specific anti-L1 antibody |
WO2009127414A2 (en) * | 2008-04-16 | 2009-10-22 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibition of angiogenesis and tumor metastasis |
WO2009127414A3 (en) * | 2008-04-16 | 2010-04-22 | Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts | Inhibition of angiogenesis and tumor metastasis |
Also Published As
Publication number | Publication date |
---|---|
DE60036935D1 (en) | 2007-12-13 |
US7618785B2 (en) | 2009-11-17 |
ATE377192T1 (en) | 2007-11-15 |
US20040259084A1 (en) | 2004-12-23 |
US7670601B2 (en) | 2010-03-02 |
CA2415364C (en) | 2009-02-24 |
EP1172654B1 (en) | 2007-10-31 |
DE60036935T2 (en) | 2008-08-21 |
CA2415364A1 (en) | 2002-01-17 |
AU2001285820A1 (en) | 2002-01-21 |
EP1172654A1 (en) | 2002-01-16 |
EP1386162A2 (en) | 2004-02-04 |
US20080138331A1 (en) | 2008-06-12 |
JP2004513074A (en) | 2004-04-30 |
JP5165827B2 (en) | 2013-03-21 |
ES2296586T3 (en) | 2008-05-01 |
WO2002004952A3 (en) | 2003-11-06 |
CN1479871A (en) | 2004-03-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US7670601B2 (en) | Diagnostic and therapeutic methods based on the L1 adhesion molecule for ovarian and endometrial tumors | |
Price et al. | Summary report on the ISOBM TD-4 Workshop: analysis of 56 monoclonal antibodies against the MUC1 mucin | |
US6645465B2 (en) | Annexin proteins and autoantibodies as serum markers for cancer | |
AU2005219322B2 (en) | Pharmaceutical Composition Comprising CXCR3 Inhibitor | |
EP2126577B1 (en) | Use of he4 for assessment of breast cancers | |
JP2008309612A (en) | Ovarian cancer detecting method and detecting kit | |
WO2001085762A2 (en) | Cancer diagnosis and assays for screening anti-cancer agents | |
EP0753011B1 (en) | Thymidine kinase tk1, peptide, corresponding antibodies and use of these in determination of tumor proliferation | |
US20040072189A1 (en) | Prognostic indicator | |
WO2003024304A2 (en) | Detection and treatment of cancers of the liver | |
US6858386B1 (en) | Method of diagnosing, monitoring, staging, imaging and treating colon cancer | |
JP2004514909A (en) | Diagnosis method for cancer patients by measuring PIBF concentration | |
WO2002006515A2 (en) | Method of diagnosing, monitoring, staging, imaging and treating colon cancer | |
JP2002506437A (en) | Novel method of detecting and treating cancer | |
WO2012133994A1 (en) | Method for screening for a cancer treatment agent using the interaction between pauf and a binding partner thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
WWE | Wipo information: entry into national phase |
Ref document number: 2415364 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 018125344 Country of ref document: CN |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2001965101 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 10332876 Country of ref document: US |
|
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWP | Wipo information: published in national office |
Ref document number: 2001965101 Country of ref document: EP |