WO2001092540A1 - Novel polypeptide - a human stat2 protein 11 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns a human Stat2 protein 11 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, disorder of development, infection of HIV, immunological diseases and a variety of inflammation etc. utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes a human Stat2 protein 11.

Description

 A new peptide-human Stat2, and a polynucleotide encoding this polypeptide

The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human

St2 gene 11, and a polynucleotide sequence encoding this polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. technical background

 STAT protein (signal transducer and transcription activator) is a family of eukaryotic transcription factors, which has the dual functions of signal transduction and activation of transcription. When cells encounter cytokines and growth factors, STAT proteins are specifically activated and regulate gene transcription. They mediate a large number of cytokines and growth factors (Darne ll, JE, Jr., Kerr, Ι.Μ. and Stark GM (1994) Science 264, 1415-1421). After forming homodimers or heterodimers that translocate to the nucleus, these proteins are activated by phosphorylation on tyrosine in response to different ligands. They directly bind to DM or transcribe multiple proteins in the nucleus Other DM-binding proteins in the complex work together. These intracellular proteins include receptors, kinases, translocation proteins, other transcription proteins, and tyrosine phosphatases. The STAT protein family includes the first four regions of the STAT protein. The third region has DM-like immunoglobulin folds. The STAT protein also includes a SH2 domain. After being activated by cell surface receptors or related and enzymes, STAT proteins dimerize, translocate to the nucleus, and bind to specific promoter sequences on target genes. Members of this family contain a highly conserved sequence template in a single exon: (T / S) LPVV (V / I) ISN.

The Stat 2 protein is activated by the ligand IFN (interferon)-alpha. Stat2 human gene contains ²⁴ exons, and there is an incomplete interferon-stimulated reaction components. The human Stat2 gene is very similar to the human Statl gene structure. Therefore, the complex gene structure of the Stat family is formed by replication, and has been closely preserved during the evolution process. The human Sta t2 gene has much shorter exons than the human Stat l gene. The human Stat2 gene is weakly activated by IFN (interferon)-α. Its core interferon-stimulating response component (AGTTTCGGTTCC) is similar to the interferon-stimulating response component (AGTTTCGGTTTC) of the multiple protein complex ISG15, but the interferon-stimulating response component of the Stat2 gene The sequence is 5 times weaker than the formation of the ISGF-3 complex. This weak interferon-stimulated response component site provides limited positive self-regulation iqiang Y., Saj jad Q., (1995) Nucleic Acids Research 23 (3), 459-463).

Analysis by gene chip found that in the thymus, testis, muscle, spleen, lung, skin, and thyroid Gland, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic stimulated L02 cell line for 1 hour, arsenic stimulated L02 cell line for prostate, heart, lung cancer, fetal bladder, In the fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetal lung, and fetal heart, the expression profile of the polypeptide of the present invention is very similar to the expression profile of the human Stat2 gene. User functions may also be similar. The invention is named human Stat2 gene 11.

 As mentioned above, the human St'at2 gene 11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes The human Stat2 gene 11 protein, in particular, identifies the amino acid sequence of this protein. The isolation of the Stat2 gene 11 protein from the newcomer also provides a basis for the study to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Object of the invention

 It is an object of the present invention to provide an isolated novel polypeptide, the human Stat2 gene 11 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding the human Stat2 gene 11.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding the human Stat2 gene 11.

 Another object of the present invention is to provide a method for producing human Stat2 gene 11.

 Another object of the present invention is to provide an antibody against the polypeptide of the present invention, the human Stat2 gene 11.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human Stat2 gene 11 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of the human Stat2 gene 11. Summary of invention

The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2. The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

(b) a polynucleotide complementary to the polynucleotide ( _a );

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 1452-1760 in SEQ ID NO: 1; and (b) a sequence having 1-2098 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of the human Stat2 gene 11 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of the human Stat2 gene 11 protein in vitro, which comprises detecting a mutation in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, or detecting a mutation in a biological sample. The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of malignant tumors, hematological diseases, developmental disorders, HIV infection, immune diseases and various types of inflammation or other caused by abnormal expression of human Stat2 gene 11 Use of medicine for disease.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of the Stat2 gene 11 and the human Stat2 gene of the present invention. The upper graph is a graph of the expression profile of the human Stat2 gene 11, and the lower graph is the graph of the expression profile of the human Stat2 gene. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates non-starved L02, 8 indicates L02 +, lhr, As ³⁺ , and 9 indicates ECV304 PMA-, 10 means ECV304 PMA +, 11 indicates fetal liver, 12 indicates normal liver, 13 indicates thyroid, 14 indicates skin, 15 indicates fetal lung, 16 indicates lung, 17 indicates lung cancer, 18 indicates fetal spleen, 19 indicates spleen, 20 indicates prostate, and 21 indicates fetal heart rate. , 22 means the heart, 23 means muscle, 24 means testis, 25 means fetal thymus, 26 means thymus.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human Stat2 gene 11. lKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the Invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with the human Stat2 gene 11, can cause the protein to change, thereby regulating the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds to the human Stat2 gene 11.

An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human Stat2 gene 11 when combined with human Stat2 gene 11. Antagonists and inhibitors can These include proteins, nucleic acids, carbohydrates, or any other molecule that binds the human Stat2 gene 11.

 "Regulation" refers to a change in the function of human Stat2 gene 11, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune changes in human Stat2 gene 11.

 "Substantially pure" means substantially free of other proteins, lipids, carbohydrates or other substances with which it is naturally associated. Those skilled in the art can purify the human Stat2 gene 11 using standard protein purification techniques. Basically pure human Stat2 gene 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human Stat2 gene 11 peptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Clus ter method compares each pair by checking the distance between all pairs. Group sequences are arranged in clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of residues matching between sequence ^ and sequence S

Number of residues in sequence ^-number of spaced residues in sequence-number of spaced residues in sequence ^X

 The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art, such as Jotim Hein (Hein J., (1990) Methods in enzymology 183: 625-645).

"Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids for conservative substitutions, such as negatively charged amino acids, can include Including aspartic acid and glutamic acid; positively charged amino acids can include lysine and arginine; amino acids with similarly hydrophilic head groups that have no charge can include leucine and isoleucine Acids and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "" Derivative "means HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and?, Which can specifically bind to the epitope of human Sta t2 gene 11.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human Stat2 gene 11" means that human Stat2 gene 11 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can purify the human Stat2 gene 11 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human Stat2 gene 11 peptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide, a human Stat2 gene 11, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or Can be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of the human St2 gene 11. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially retains the same biological function or activity of the human St2 gene 11 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as the leader or secretory sequence or the sequence used to purify the polypeptide or protease sequence). As explained herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 2,098 bases, and its open reading frame of 1452-1760 encodes 102 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to the human Stat2 gene, and it can be deduced that the human Stat2 gene 11 has similar functions to the human Stat2 gene.

 The polynucleotide of the present invention may be in the D form or the R form. MA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DM can be coded or non-coded. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants Body, deletion variant, and insertion variant. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% Fi col l, 42 ° C, etc .; or (3) only in two sequences The hybridization occurs when the identity between at least 95% and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding the human Stat2 gene 11.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human Stat2 gene 11 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDM of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDM library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spiring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

These genes can be screened from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the appearance or loss of marker gene function; (3) measurement Determine the level of the transcript of the human Stat 2 gene 11; (4) Detect the protein product of the gene expression by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human Sta t2 gene 11 gene.

 A method (Saiki, et al. Science 1985; 230: 1350-1354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used, and the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using the human Stat2 gene 11 coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology. .

In the present invention, a polynucleotide sequence encoding the human Stat2 gene 11 may be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements. Methods known to those skilled in the art can be used to construct an expression vector containing a DNA sequence encoding the human StaU gene 11 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, band synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manua, Cold Spring Harbor Laboratory. New York, 1989). The DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM to cut off these promoters. Representative examples are: iac or trp promoter of E. coli; PL promoter of lambda phage; eukaryotic Promoters include the CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoters, retroviral LTRs, and other known controllable genes expressed in prokaryotic or eukaryotic cells or their viruses Promoter. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and recording Chromofluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli, etc.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding the human Stat2 gene 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as Fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DM may be in exponential growth phase were harvested after the treatment with (^ 1 ₂ method used in steps well known in the art. Alternatively, it is a MgCl _2. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposomes Packaging, etc.

By conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used for expression or production Recombinant human Stat2 gene 11 (Science, 1984; 224: 1431). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding the human Stat2 gene 11 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.

 STAT protein belongs to a family of eukaryotic transcription factors, and has the dual functions of signal transduction and activation of transcription. When cells encounter cytokines and growth factors, STAT proteins are specifically activated and regulate gene transcription. They mediate a large number of cytokines and growth factors. After forming homodimers or heterodimers that translocate to the nucleus, these proteins are activated by phosphorylation on tyrosine in response to different ligands. They directly bind to DNA or transcribe multiple proteins in the nucleus Other DM-binding proteins in the complex work together. These intracellular proteins include receptors, kinases, translocation proteins, other transcription proteins, and tyrosine phosphatases.

 The human Stat2 gene is weakly activated by IFN (interferon) -c. This weak interferon stimulates the response component site to provide limited positive self-regulation.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of the human Stat2 gene protein, and both have similar biological functions. It is responsible for the transcriptional regulation of genes in the body and is involved in signal transduction. Its abnormal expression is usually closely related to the occurrence of some related disorders of substance metabolism, disorders of protein metabolism, and related tissue tumors and cancers, and produce related diseases.

It can be seen that the abnormal expression of the human Stat2 gene 11 of the present invention will cause various diseases, especially Various tumors, embryonic developmental disorders, growth disorders, inflammation, immune diseases, these diseases include but are not limited to:

 Tumors of various tissues: stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

 Fetal developmental disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness

 Growth and development disorders: mental retardation, brain development disorders, skin, fat and muscular dysplasia, bone and joint dysplasia, various metabolic deficiencies, stunting, dwarfism, Cushing syndrome, Sexual retardation

 Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations

 Immune diseases: Systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, specific dermatitis, post-infection myocarditis, scleroderma, myasthenia gravis, Guillain-Barre syndrome, common variable immunodeficiency disease , Primary B-lymphocyte immunodeficiency disease, Acquired immunodeficiency syndrome

 The abnormal expression of the human Stat2 gene 11 of the present invention will also produce certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially various tumors, embryonic development disorders, growth and development disorders, inflammation, and immunity. Sexual diseases, certain hereditary, blood diseases, etc.

 The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) the human Stat2 gene 11. Agonists enhance human Stat2 gene 11 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human Stat2 gene 11 can be cultured with labeled human Stat2 gene 11 in the presence of drugs. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human Stat2 gene 11 include antibodies, compounds, receptor deletions, and analogs that have been screened. The antagonist of the human Stat2 gene 11 can bind to the human Stat2 gene 11 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human Stat2 gene 11 can be added to bioanalytical assays In the determination, whether the compound is an antagonist is determined by measuring the influence of the compound on the interaction between the human Stat2 gene 11 and its receptor. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human Stat2 gene 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In the screening, 11 molecules of human Stat2 gene should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against the human Stat2 gene 11 epitope. These antibodies include (but are not limited to): Doklon antibodies, monoclonal antibodies, chimeric antibodies, single-chain antibodies, Fab fragments, and fragments from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human Stat2 gene 11 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Techniques for preparing monoclonal antibodies to the human Stat2 gene 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology, and EBV- Hybridoma technology, etc. Chimeric antibodies that combine human constant regions and human-dependent variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The unique technology for producing single-chain antibodies (U.S. Pat No. 4946778) can also be used to produce single-chain antibodies against human Stat2 gene 11.

 Anti-human Stat2 gene 11 antibodies can be used in immunohistochemistry to detect human Stat2 gene 11 in biopsy specimens.

 Monoclonal antibodies that bind to human Stat2 gene 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human Stat2 gene 11 high-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human Stat2 gene 11 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to the human Stat2 gene 11. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human Stat2 gene 11.

The invention also relates to a diagnostic test method for quantitatively and locally detecting the level of human Stat2 gene 11. These tests are well known in the art and include FISH assays and radioimmunoassays. Tested in the test The human Stat2 gene 11 level can be used to explain the importance of human Stat2 gene 11 in various diseases and to diagnose diseases in which human Stat2 gene 11 plays a role.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding the human Stat2 gene 11 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human Stat2 gene 11. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human Stat2 gene 11 to inhibit endogenous human Stat2 gene 11 activity. For example, a mutated human Stat2 gene 11 may be a shortened human Stat2 gene 11 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, the recombinant gene therapy vector can be used to treat diseases caused by abnormal expression or activity of human Stat2 gene 11. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding the human Stat2 gene 11 into a cell. Methods for constructing a recombinant viral vector carrying a polynucleotide encoding the human Stat2 gene 11 can be found in the existing literature (Sambrook, et al.). In addition, the recombinant polynucleotide encoding human Stat2 gene 11 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense MA and DNA) and ribozymes that inhibit human Stat2 gene 11 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence 'length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

The polynucleotide encoding human Stat2 gene 11 can be used for diagnosis of diseases related to human Stat2 gene 11. The polynucleotide encoding human Stat2 gene 11 can be used to detect the expression of human StaU gene 11 or the abnormal expression of human Stat2 gene 11 in a disease state. Such as DM encoding human Stat2 gene 11 The sequence can be used to hybridize biopsy specimens to determine the expression of human Stat2 gene 11. Hybridization techniques include Southern blotting, Northern blotting, and 'in situ hybridization'. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue. Human Stat2 gene 11 specific primers can also be used to detect the transcription product of human Stat2 gene 11 by RM-polymerase chain reaction (RT-PCR) in vitro amplification.

 Detection of mutations in the human Stat2 gene 11 gene can also be used to diagnose human Stat2 gene 11-related diseases. Human Stat2 gene 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human StaU gene 11 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDM clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Pres s, New York (1988).

Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inherance in Man (available online with Johns Hopkins University Welch Medica l Library). Linkage analysis can then be used to identify genes and diseases that have been mapped to chromosomal regions Relationship.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cD sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. The human Stat2 gene 11 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human Stat2 gene 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions, such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Pres s, 1989), or according to the conditions described in Conditions recommended by the manufacturer.

 Example 1 Cloning of human Stat2 gene 11

Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) tiiRM forms cDNA by reverse transcription. Use Smart cDNA Cloning Kit (purchased from Clontech). 0 Directional insert of fragment into pBSK (+) At the multiple cloning site of the vector (Clontech), DH5a was transformed, and the bacteria formed a cDNA library. Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined CDM sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0780d04 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results showed that the full-length cDNA contained in the 0780d04 clone was 2098bp (as shown in Seq ID NO: l), and there was a 309bp open reading frame (0RF) from 1452bp to 1760bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0780d04 and named the encoded protein human Stat2 gene 11. Example 2 Cloning of a gene encoding human Stat2 gene 11 by RT-PCR

 CDM was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR was performed using the following primers:

 Pr imer 1: 5'- GTATGGCATTCAGAAAACGTTAAA -3 '(SEQ ID NO: 3)

 Pr imer2: 5'- CTAATTGGCACATTTGCTTTATTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Conditions for the amplification reaction: 50 legs of 01 / L KC 1, 1 Ommo 1 / L Tri s-HCl pH 8.5, 1.5 mmol / L MgCl ₂ in 50 _μ 1 reaction volume,

dNTP, lOpmol primer, 1ϋ Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DM thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55. C 30sec; 72. C 2rain. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2098bp shown in SEQ ID NO: 1. Example 3 Northern blot analysis of human Stat2 gene 11 gene expression

One-step extraction of total RM CAnal Biochem 1987, 162, 156-159] ₀ which comprises guanidinium thiocyanate acid phenol - chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. 20μ§ RNA was applied on a 1.2% agarose gel containing 20mM 3- (N-morpholino) propanesulfonic acid (PH7. 0)-5mM sodium acetate-ImM EDTA-2. 2M formaldehyde Line electrophoresis. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The D probe used was the PCR-encoded human Stat2 gene 11 coding region sequence (1452bp to 1760bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 × 10 ⁶ cpm / ral) and RNA-transferred nitrocellulose membrane were placed in a solution at 42 ° C. C hybridization overnight, the solution contains 50% formamide- ² 5mM KH ₂ P0 ₄ (pH7. 4)-5 x SSC-5 x Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was placed in 1 x SSC-0.1% SDS was washed at 55 ° C for 30 min. Then, analysis and quantification were performed using Phosphor Imager. Example 4 In vitro expression, isolation and purification of recombinant human Stat2 gene 11

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'- CCCCATATGATGCCTCATTACACCCTCCTCCCT -3, (Seq ID No: 5) Primer4: 5'- CATGGATCCTCAATCAACACATGTAAGATGTAC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI digestion sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively, and the Ndel and BamHI restriction sites correspond to the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3) Selective endonuclease site. PCR was performed using the pBS-0780d04 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0780d04 plasmid in a total volume of 50 _μl , primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into the colibacillus DH5 ct by the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 μ ₈ Αη1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0780d04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In containing kanamycin (final concentration ₃₀ μ§ / ιη1) in LB liquid medium, host strain BL _(P ET-0780d04) at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was subjected to centrifugation, and chromatography was performed using an affinity chromatography column His s. Bind Quick Cartridge (product of Novagen) capable of binding to 6 histidines (6His-Tag). The purified human protein Stat2 gene 11 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at llKDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of Anti-Human Stat2 Gene 11 Antibody

 The following peptides specific for human Stat2 gene 11 were synthesized using a peptide synthesizer (product of PE company): NH2-Met-Pro-His-Tyr-Thr-Leu-Leu-Pro-Leu-Gly-I le-I le- Asp-Arg-Thr-C00H (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin-polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin-polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15A titer plate coated with 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine the antibody titer in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human Stat2 gene 11. Example 6 Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2.The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genome sequences and their complement The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, then the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments. After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (view):

 5'- TGCCTCATTACACCCTCCTCCCTTTGGGAATTATTGATAGA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (machine) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5'- TGCCTCATTACACCCTCCTCCCTTTGGGAATTATTGATAGA -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 ( USA) and more commonly used molecular cloning laboratory manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Use cold homogenate buffer solution (0. 25mol / L sucrose; 25 round 1 / L Tris-HCl, pH7.5; 25mmol / L NaCl; 25cryptol / L MgCl ₂ ) suspension pellet (about 10ml / g) . 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the original tissue sample), and centrifuge at 1000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then take the following 2, DM extraction of phenol

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells (1 × 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to a final concentration of 0.5% and 100ug / mh at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) A _26fl and A _{28fl were measured} to check the purity and yield of DM. 15) Store at -20 ° C after dispensing.

 Preparation of sample film: _

 1) Take 4 x 2 pieces of nitrocellulose membrane (NC membrane) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe so that In the experimental steps, the film was washed with high-strength conditions and strength conditions, respectively.

2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature. 3) Place on filter paper infiltrated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and put in 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) combining the first peak was collected after ³² P-Prob _e is prepared as required (the second peak to the free γ- ³² Ρ- dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-1 Omg pre-hybridization solution (1 OxDenhardt-s; 6xSSC, 0.1 mg / ml CT DM (calf thymus D)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 SDS, 40. C wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 4) 0. lxSSC, 0.1 ° /. Wash in SDS at 55 ° C for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1¾SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

4) In 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature. X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the sting spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene chip or gene microarray (DNA Microarray) is a new technology that many national laboratories and large pharmaceutical companies are currently researching and developing. It refers to the orderly and high-density arrangement of a large number of target gene fragments on slopes. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRis i, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μηι. The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. ddH ₂ 0 was washed twice for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. 0 ° 2 ° /. Wash with SDS for 1 minute;

7. Rinse twice with ddH ₂ 0; 8. Dry dry, 25. C Store in a dark place for future use.

 (Two) probe marking

 Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRM was purified with Oligotex mRNA Midi Kit (purchased from QiaGen), and the fluorescent reagents were separately reverse-transcribed Cy3dUTP (5-Amino-propargyl-2'-deoxyuridine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Pharaacia Biotech) was used to label the raRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5-Amino- propargyl-2 '-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech, was used to label the mRNA of specific tissues (or stimulated cell lines) in the body, and probes were prepared after purification. For specific steps and methods, see:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995 ) Science. 270 (20): 467-480.

 (Three) cross

 The probes from the two types of tissues and the chip were hybridized in a UniHyb ™ Hybridizat ion Solution (purchased from TeleChem) hybridization solution for 16 hours, and washed with a washing solution (lx SSC, 0.2% SDS) at room temperature. Scanning was performed with a ScanArray 3000 scanner (purchased from General Scanning, USA), and the scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a graph based on these 26 Cy3 / Cy5 ratios (Figure 1). It can be seen from the figure that the expression profiles of human Stat2 gene 11 and human Stat2 gene according to the present invention are very similar.

Claims

Rights request

1. An isolated polypeptide-human Stat2 gene 11, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment, analog or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 1452-1760 in SEQ ID NO: 1 or the sequence of positions 1-2098 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or vector expression vector Recombinant vector.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with the polynucleotide according to any of claims 4-6.

 9. A method for preparing a polypeptide having human Stat2 gene 11 activity, characterized in that the method includes:

 (a) cultivating the engineered host according to claim 8 under the condition of expressing the human Stat2 gene 11

(b) Isolating a polypeptide having human Stat2 gene 11 activity from the culture.

10.An antibody capable of binding to a polypeptide, characterized in that the antibody is capable of binding to the human Stat2 gene 11 Antibodies that specifically bind.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of the human Stat2 gene 11.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

 13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of the human Stat2 gene 11 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a polypeptide related to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. The use of the polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human Stat2 gene 11; or for peptide fingerprinting Atlas identification.

 16. The application of the nucleic acid molecule according to any of the claims 4 to 6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing Gene chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human Sta t2 gene 11 abnormality.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.