WO2001090196A1 - Immunoassay method for x-type phospholipase a¿2? - Google Patents

Abstract

A method for assaying activated X-type sPLA2. Use of an antibody which recognizes specifically a part of X-type sPLA2 makes it possible to assay activated X-type sPLA2.

Description

 Specification

Immunoassay art X phospholipase eight ₂ - present invention, X phospholipase A ₂ (X-type sPLA ₂₎ which specifically recognizes a part of the antibody; active type X sPLA ₂ with antibody A diagnostic kit comprising the antibody. Background art

Phospholipase ₂ (PLA ₂ ; EC 3.1.1.4) is a general term for phospholipidases that hydrolyze the 2-acyl ester bond of 3-S / J-phosphodariseride. PLA ₂ is involved in the digestion of phospholipids in food, the generation and metabolism of biological membrane phospholipids, and the production of lipid media such as prostaglandin, leukotriene, platelet activating factor (PAF), and lysophospholipid. Functions as an acid cascade initiating enzyme. In mammals are clearly the presence of various PLA ₂ summer, its localization, calcium ion (Ca ²⁺⁾ requirement, based on the substrate specificity, secreted PLA _2, cytosolic PLA _2, Ca ² ÷ Independent PLA ₂ , and: have been classified into four families of PAF-acetylhydrolase (Balsinde et al., J. Biol. Chem. 272, 16069-16072 (1997)). Of these, the secreted PLA ₂ (sPLA ₂ ) family is a group of low molecular weight (13,000 to 15,000) PLA ₂ molecules secreted extracellularly. In humans, IB, ΠΑ, IID, Six types, IIE, V, and X, are known. All molecular species have 12 to 16 Cys residues in their structure, form intramolecular disulfide bonds, and have a conserved active center site consisting of His-Asp residues. Furthermore, they have a common Ca ²⁺ binding domain and require an order of Ca "for expression of enzyme activity (Tischfield et al., J. Biol. Chem. 272, 17247-17250 (1997), Cupillard et al. J. Biol. Chem. 272, 15745-15752 (1997), Ishizaki et al., J. Biol. Cem. 274, 24973-24979 (1999), and Suzuki et al., J. Biol. Chem. 275, 5785-5793 (2000)). Human type X sPLA ₂ on the basis of the sPLA ₂ related sequences from DNA databases were Ri by fetal lung tissue black-learning (Cupillard, et, J. Biol Chem, 272, 15745-15752 (1997)..): Human gene X type sPLA ₂ is located in the first 6 on chromosome unlike other sPLA _2.

Human type X sPLA ₂ protein, the most acidic in the sPLA ₂ family one (pi = 5.3), containing the N- linked sugar chain binding site capable. This sPLA ₂ has 16 cysteine residues in the molecule, and all of the characteristic intramolecular disulfide bridges present in each of IB type sPLA ₂ and IIA / IID / IIE type 51 ⁾ 1 ^ _2. Contains. Furthermore, having a unique force Rupokishiru group terminal extension structure IIA / IID / IIE type sPLA _2. By Northern analysis, the expression of type X sPLA ₂ mRNA (1.5 key port basis) was detected in human spleen, thymus. Therefore, the raw physical type X sPLA _2, is unknown detail with pathological features, the localization of the expression site, may present enzyme is involved in the regulation of the immune system and inflammatory conditions Presumed.

The cDNA black one Eng type X sPLA _2, 1 ₂ 3 or the presence of active X-type sPLA ₂ and Purebu port base peptide consisting of amino acids are envisaged (SEQ ID NO: 1;. Cupillard, et, J. Biol Chem. , 272, 15745-15752 (1997)). However, as pointed out by Cupi 11 ard et al., The cleavage by signal peptidase on the prepb mouth peptide was difficult.

Disclosure of the invention

An object of the present invention, a part of X-type sPLA ₂ specifically recognizes bowtie; to provide a diagnostic kit comprising said antibody; Measurement method of active type X sPLA ₂ with antibody . The present inventors have been conducted extensive study with the aim to clarify the physiological function of human type X sPLA _2, in the process, the X-type sPLA _2, the non-active form that has propeptide sequence N- terminus And two active species, the pro-type of which is generated by cleavage of the pro-peptide portion Thus, the amino acid sequence of the propeptide portion cleaved during the activation process was identified. Moreover, the propeptide levels or by measuring the amount of X-type sPLA ₂ its Re own active, heading measurements how to specifically detect the type X sPLA ₂ concentration of the active state, the present invention completed. That is, the present invention

 (1) an antibody that specifically recognizes a part of a polypeptide consisting of amino acids from Glu at position 11 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3;

 (2) the antibody according to (1), which specifically recognizes a polypeptide consisting of amino acids from Glu at position 11 to Arg at position 11 in the amino acid sequence of SEQ ID NO: 3;

(3) the antibody according to (1), which specifically recognizes a polypeptide consisting of the amino acid from Gly at position 1 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3;

 (4) The antibody according to any one of (1) to (3) above, which is a polyclonal antibody;

 (5) The antibody according to any one of (1) to (3) above, which is a monoclonal antibody;

 (6) the monoclonal antibody according to (3), which is produced by a hybridoma having an accession number of FERM BP-7393;

 (7) A therapeutic agent for a PLA2-related disease, comprising the antibody according to (3) or (6);

 (8) a polypeptide consisting of the amino acids from Glu at position 11 to Arg at position 11 in the amino acid sequence of SEQ ID NO: 3;

 (9) a polypeptide comprising an amino acid from Gly at position 1 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3;

 (10) a standard antigen comprising the polypeptide of (8) or (9);

(11) The method for measuring the polypeptide according to (8) or (9), wherein the method according to (8) or (9) is characterized by using the antibody according to any one of (1) to (6); (1 2) measurement methods described in (1 1), wherein the measuring the active type X sPLA _2;

 (13) A kit for measuring the polypeptide according to (8) or (9), comprising the antibody according to any one of (1) to (6);

(14) Measurement kit according to above, wherein the measuring the active type X sPLA ₂ (1 3);

 (15) a cancer diagnostic kit comprising a reagent capable of detecting the polypeptide of (8) or (9) above;

 (16) The kit for cancer diagnosis according to (15), wherein the reagent is the antibody according to any one of (1) to (6);

 (17) The cancer according to (15) or (16) above, wherein the cancer is colorectal cancer, lung cancer, liver cancer, stomach cancer, kidney cancer, gallbladder cancer, prostate cancer, kidney cancer, testicular cancer, ovarian cancer or skin cancer. The kit for cancer diagnosis according to the above;

(18) a kit for diagnosing Alzheimer's disease, comprising a reagent capable of detecting the polypeptide according to (8) or (9) above;

 (19) The kit for diagnosing Alzheimer's disease according to (18), wherein the reagent is the antibody according to any one of (1) to (6);

 (20) A kit for diagnosing cirrhosis comprising a reagent capable of detecting the polypeptide according to (8) or (9) above;

 (21) The kit for diagnosing cirrhosis according to claim 20, wherein the reagent is the antibody according to any one of (1) to (6) above;

 (22) a method for screening for cancer, Alzheimer's disease or cirrhosis, characterized by detecting the polypeptide according to (8) or (9); and

 (23) The screening method according to (22), wherein the cancer is colorectal cancer, lung cancer, liver cancer, stomach cancer, kidney cancer, gallbladder cancer, prostate cancer, Tengler cancer, testicular cancer, ovarian cancer or skin cancer. About.

Depending on the degree of maturity, X-type sPLA ₂ includes prebub-type X-type sPLA ₂ and pro-type X-type sPLA ₂ And active X-type sPLA ₂ (also referred to as mature X-type sPLA ₂ ).

immediately after being translated from the mRNA, X-type sPLA ₂ is produced as Purebu port type having a signal peptide. The Purebu port type X type sPLA _2, in the amino acid sequence set forth in SEQ ID NO: 3, refers to a polypeptide consisting of amino acids up to Asp 1 2 3 position from a 3 2-position of Me t. Among them, the signal peptide is a polypeptide consisting of amino acids from Mei at position 132 to Gly at position 12 in the amino acid sequence of SEQ ID NO: 3.

Proform; X-type sPLA ₂ occurs connexion by that signal peptide from Purebu port type is disconnected. The proform type X sPLA _2, in the amino acid sequence set forth in SEQ ID NO: 3 means a polypeptide consisting of amino acids up to Asp 1 2 3 position from Gl u one 1 first. Furthermore, pro-type X-type sPLA ₂ is the amino acid sequence set forth in SEQ ID NO: 3, is cleaved between one 1-position of Arg and position 1 Gly, in the amino acid sequence according to the propeptide (SEQ ID NO: 3, one 11 A polypeptide consisting of 11 amino acids from Glu at position 1 to Arg at position 11; and active X-type sPLA ₂ (in the amino acid sequence of SEQ ID NO: 3, position G to position 1 2 3 Of Asp). In vivo, this active type X sPLA ₂ is it is thought to have a function as Hosuhoripa Ichize A _2.

 In the present invention, a fragment consisting of a signal peptide and a propeptide may be referred to as a prebub peptide. The Prebu-mouth peptide means a polypeptide consisting of the amino acids from the 132nd position Met to the 11th position Arg in the amino acid sequence of SEQ ID NO: 3 (FIG. 1).

In the present invention, "a part of a polypeptide consisting of an amino acid sequence from Glu at position 11 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3" refers to pro-form X-type sPLA ₂ Means part of. Preferably, that means the pro-peptide or active type X sPLA _2. In addition, the "polypeptide according to (6) or (7)" means Purobe petit de or active type X sPLA _2. The present invention aims to measure the active type X sPLA ₂ by immunological means.

In the course of activation, pro-type X sPLA ₂ produces a pair of pro-peptides with active X-type sPLA ₂ . The present inventors have found that by specifically measuring Purobe peptide that is produced equimolar mass and active type X sPLA ₂ in the course of active type X sPLA ₂ or activation, of the active X-type sPLA ₂ The measurement method was completed.

In the present invention, "an antibody that specifically recognizes a polypeptide consisting of amino acids from Glu at position 11 to Arg at position 11 in the amino acid sequence of SEQ ID NO: 3" Means an antibody that recognizes By "specifically sure to identify the propeptide", although the reaction propeptide means cross-reactivity with active type X sPLA ₂ is 5% or less'. Moreover, "in the amino acid sequence of SEQ ID NO: 3, Poribe peptide specifically recognize antibodies consisting of amino acids from position 1 Gl y up 1 2 3 position of the Asp" and the active type X sPLA ₂ Means an antibody that specifically recognizes. The "recognizes activity type X-type sPLA ₂ specifically", although the reaction with active type X sPLA _2, cross-reactivity with propeptide or pro-X-type sPLA ₂ is 5% or less Means that Such antibodies may be either polyclonal or monoclonal antibodies. For example, the active X-type s! As specifically recognizes monochromator opening one monoclonal antibody to »LA _2, National Institute of Advanced Industrial Science and Technology Institute of Patent Organism Depositary center one (Japan, Tsukuba, Ibaraki,巿東1-chome 1 address 1 Chuo No. 6) exemplifies a monoclonal antibody produced by hybridoma 3C10 (accession number: FERMBP-7393) deposited on December 12, 2000. Moreover, the propeptide or active type X sPLA ₂ is used to examine the specificity of these antibodies can be used as "standard antigen" to generate a standard curve. By using the antibodies of the present invention, it is measured only active type X sPLA ₂ becomes possible.

Secreted PLA ₂ is a fatty acid derived from phospholipids found in cell membrane lipoproteins. (Eg, arachidonic acid). Excessive release of fatty acids and the production of various lipid mediators due to their metabolism cause diseases such as septic shock, adult respiratory distress syndrome, tengitis, trauma, bronchial asthma, allergic rhinitis, and rheumatoid arthritis. By "PLA ₂ related disease" in the present invention means those diseases. Antibodies to activated type X sPLA ₂ of the present invention are useful for the treatment of these diseases. In addition, it is considered that the use of the measurement method of the present invention enables the diagnosis of these diseases caused by active X-type SPLA. Accordingly, the present invention provides a "method of measuring active type X sPLA _2". Furthermore, the present inventors have found that, by immunohistochemical analysis, colorectal cancer tissue of colon cancer patients, lung cancer tissue of lung cancer patients, liver tissue of liver cancer patients, stomach tissue of gastric cancer patients, kidney tissue of kidney cancer patients, gallbladder Gallbladder tissue of cancer patients, prostate tissue of prostate cancer patients, lignum tissue of kidney cancer patients, testicular tissue of testicular cancer patients, ovarian tissue of ovarian cancer patients, skin tissue of skin cancer patients, cerebral tissue of Alzheimer's disease patients and in cirrhotic patients with liver tissue, it was confirmed that the X-type sPLA ₂ in comparison to their tissue of a normal human is significantly high expression. ^Thus,; sPLA a _second substrate to the antibody of the re phospholipids or the present invention using as a "reagent", by confirming the activity or expression of type X sPLA _2, cancer, and can be diagnosed Alzheimer's disease or cirrhosis Become. The present invention provides a "kit for diagnosing cancer", a "kit for diagnosing Alzheimer's disease", or a "kit for diagnosing cirrhosis". Each diagnostic kit contains at least a reagent capable of detecting the polypeptide of the present invention. Examples of the reagent include a phospholipid which is a substrate of SPLA2 and the antibody of the present invention. Examples of the detection method include a sedimentation reaction method, an ELISA method, an RIA method, and a western blotting method. For example, an appropriately diluted patient serum is reacted with an antibody on a microplate on which a solid phase is immobilized, and after washing, an anti-Egret IgG antibody labeled with a secondary antibody, peroxidase, is added. After that, the peroxidase substrate is added to develop a color, and the absorbance at 450 nm is measured, whereby the polypeptide of the present invention can be detected. When the detection reagent is an antibody, the kit of the present invention includes, as necessary, various reagents such as a coloring reagent, a reaction stopping reagent, a standard antigen reagent, and a sample pretreatment reagent in addition to the antibody of the present invention. An appropriate reagent according to the measurement method can be appropriately selected and can be attached to the kit of the present invention.

In addition, by using the diagnostic kit of the present invention, cancer, particularly colon cancer, lung cancer, liver cancer, stomach cancer, kidney cancer, gallbladder cancer, prostate cancer, Tengler cancer, testicular cancer, ovarian cancer or skin cancer, Group screening for early detection of Alzheimer's disease or cirrhosis is possible. Specifically, the subject of the biological sample, e.g., blood as a sample, by the like diagnostic kits of the present invention, cancers involving active type X s PLA _2, the onset of Aruhha one more disease or cirrhosis The present invention also provides a "screening method" for prediagnosis. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 is a diagram showing the relationship between a prebub-type X-type sPLA ₂ , a pro-type X-type sPLA ₂ and an active-type X-type sPLA ₂ .

FIG. 2 is a diagram showing the enzymatic activities of mouse activated X-type sPLA ₂ , mouse pro-X-type sPLA _2, and trypsin-enhanced pro-X-type sPLA ₂ . In the figure, M, P and P + T, respectively active means proform and proform type X sPLA ₂ was digested with trypsin.

Figure 3 shows a standard curve in the ELISA method using the anti-X type sPLA ₂ propenyl peptide antibodies of the present invention.

Figure 4 is a diagram showing the specificity of the active type X sPLA ₂ monoclonal antibody (3 C 10) of the present invention.

 FIG. 5 is a diagram showing the specificity of the propeptide monoclonal antibody (HPX-6E1) of the present invention.

Figure 6 is a diagram showing a standard curve and specificity of EL I SA system using the active type X sPLA ₂ monoclonal antibody of the present invention (3C 10). FIG. 7 is a diagram showing a standard curve and specificity of an ELISA system using the propeptide monoclonal antibody (HPX-6E1) of the present invention.

 FIG. 8 is a diagram showing measurement results of a sample derived from a colorectal cancer patient using various measurement systems.

BEST MODE FOR CARRYING OUT THE INVENTION

The present invention relates mainly measurement of active type X sPLA ₂ with Purobe peptide.

 The process for preparing propeptide, the process for preparing an antibody, and the immunoassay method using an antibody are described below. In this specification, unless otherwise specified, unless otherwise indicated, gene recombination techniques known in the art, techniques for producing recombinant proteins in animal cells, insect cells, yeast and E. coli, methods for separating and purifying expressed proteins, and analysis Methods and immunological techniques are employed.

Preparation of MA encoding X-type sPLA

DNA encoding the type X sPLA ₂ may be readily manufactured and obtained by a general genetic engineering technique based on the sequence information taught by the present invention (Molecular Cloning 2d Ed, Cold Spring Harbor Lab. Press (1989 ) Etc.). Specifically from an appropriate origin which X type sPLA ₂ is expressed, a cDNA library was prepared according to a conventional method, using a suitable probe or antibody specific from the stripe library one of the nucleotide sequence of X-type sPLA ₂ It can be carried out by selecting a desired clone (see Proc. Natl. Acad. Sci., USA., 78, 6613 (1981); Science, 22, 778 (1983), etc.). The origin of the cDNA, various cells expressing type X sPLA _2, cultured cells derived from tissues or these are exemplified. The isolation of total RNA, the isolation and purification of mRNA, and the acquisition and cloning of cDNA from them can all be carried out in accordance with conventional methods. Further, cDNA libraries are commercially available, and in the present invention, such cDNA libraries, for example, various cDNA libraries commercially available from Clontech can also be used. Type X sPLA ₂ of DNA a method of subscription-learning from a cDNA library one can follow particularly limited Sarezu the usual way. Specifically, for example, a method for selecting a corresponding cDNA clone by immunoscreening using a protein-specific antibody to a protein produced by cDNA, selectively binding to a desired DM sequence Plaque hybridization, colony hybridization and the like using a probe to be used, and combinations thereof. The professional one blanking to be used herein is DNA chemically synthesized based on information about the sequence of the X-type sPLA _2, etc. can be generally exemplified, even better of course already present invention DNA itself or fragments obtained It can be used for In addition, sense primers and antisense primers set based on the nucleotide sequence information of the DNA of the present invention can also be used as screening probes. Furthermore, DNA encoding a type X sPLA ₂ is conventional chemical methods, for example tricalcium E ester method (Narang et al., Meth. Enzymol., 68, 90-108 (1979)) or phosphate Wells ester It can be synthesized by the method (Brown et al "Meth. Enzymol" 68, 109-151 (1979)).

Preparation of X-type sPLA and protein

(1) Expression of recombinant type X sPLA ₂ protein

X-type sPLA ₂ protein, according to the base sequence information of the X-type sPLA _2, genetic engineering proposed method (Sc i enc e, 224, 1431 (1984);.... Bi ochem Bi ophys Res Comm, 1 30, 692 Natl. Accad. ScI., USA., 80, 5990 (1983), etc.) can be obtained as a recombinant protein. More specifically, a gene encoding a desired protein is inserted into an appropriate vector. This vector is introduced into a host cell to prepare a transformant. By culturing the transformant, a recombinant protein can be obtained.

Here, both eukaryotes and prokaryotes can be used as host cells. You. The eukaryotic cells include cells such as vertebrates and yeast. Examples of the vertebrate cells include COS cells (Cell, 23, 175 (1981)) which are monkey cells and Chinese vertebrate cells. · Hamster ovary cells are often used.

 As an expression vector, one having a promoter located at the upstream of the gene to be expressed usually, one having an RNA splice site, polyadenylation site, transcription termination sequence, etc. can be used. It may have a replication origin. Examples of the expression vector include, for example, pSV2dhfr (Mol. Cell. Biol., 1, 854 (1981)), which has an initial promoter of SV40. As eukaryotic microorganisms, yeasts are generally used, and among them, Saccharomyces yeasts can be used. As a yeast expression vector, for example, pAM82 (Pro Natl. Acad. Sci., USA., 80, 1 (1983)) having an acid phosphatase gene promoter can be used. Escherichia coli and Bacillus subtilis are commonly used as prokaryotic hosts. When these are used as a host, for example, a plasmid vector capable of replicating in the host bacterium is used, and a promoter and SD sequence upstream of the gene so that the desired gene can be expressed in the vector, Further, it is preferable to use an expression plasmid having an initiation codon required for initiation of protein synthesis. As the above host, E. coli K12 strain or the like is used. Generally, PBR322 and its improved vectors are often used as vectors, but not limited thereto, and various known strains and vectors can also be used. As the promoter, for example, trp promoter, lpp promoter, lac promoter, PL / PR promoter and the like can be used.

As a method for introducing a desired recombinant MA into a host cell and a transformation method using the same, various general methods can be adopted. The obtained transformant can be cultured according to a conventional method, and the desired protein is produced by the culture. As the medium used for the culture, various types commonly used depending on the host cell can be appropriately selected and used, and the culture can be performed under conditions suitable for the host cell. For example, pSVL SV40 Late Promo One Night Of the human type X sPLA vector one containing _two genes of the present invention downstream, to create a transformant by introducing into monkey-derived cells C0S-7, the transformants 5% C02 presence, 37 ° by culturing for 3 days in C, and recombinant human type X sPLA ₂ protein that obtained produced. Proteins can be separated by various separation procedures utilizing their physical and chemical properties (Biochemistry, 25 (25), 8274 (1986); Eur. J. Biochem., 163, 313 (1987), etc.). Can be purified. Examples of the method include salting out, centrifugation, osmotic shock, sonication, ultrafiltration, gel filtration, adsorption chromatography, ion exchange chromatography, affinity chromatography, and high performance liquid chromatography. Examples include various types of liquid chromatography, dialysis, and combinations thereof. Purified X-type sPLA ₂ is for containing a proform type X sPLA _2, (if example embodiment, Supuchirishin like endoproteases, trypsin, etc.) Suitable proteases in the child cut by, obtaining active type X sPLA ₂ Can be done.

• Further, X-type sPLA ₂ protein, or X-type sPLA ₂ protein fragment (e.g. Purobe Petit de), based on the amino acid sequence information taught by the present invention, can be synthesized by a peptide synthesizer. Preparation of antibodies against the protein of the present invention

 An antibody against the protein of the present invention is produced by the following method.

 (1) Preparation of polyclonal antibody

Based on the amino acid sequence of type X sPLA _2, produced synthetic synthetic base peptide Ya in conventional peptide synthesizer, bacteria transformed with a vector expressing the type X sPLA _2, yeast, insect cells, and the like animal cells The purified proteins are purified by conventional protein chemistry methods and used as immunogens. Using this immunogen, Antibodies; ALaboratory Manual, Lane, HD et al., Edited by Cold Spring Harber Laboratory Press New York 1989 By immunizing an animal with an appropriate method according to any of the methods described above, a polyclonal antibody that specifically recognizes a protein serving as an antigen can be easily prepared and purified. Animals such as mice, rats, hamsters, and egrets can be immunized to produce polyclonal antibodies derived from the sera.

(2) Monoclonal antibody

 Lymphocytes are extracted from the spleen or lymph node of a mouse rat immunized with the above-mentioned immunogen, fused with myeloid cells, and Kohler and Milstein's method (Nature, 256, 495-497 (1975))

After preparing a hybridoma according to the above, a monoclonal antibody can be produced from the hybridoma. For example it is possible to obtain a monoclonal antibody against the Purobe peptide or active type X sPLA ₂ by the following steps:

 (a) immunization of mice with proteins,

 (b) removal of spleen and separation of spleen cells from immunized mice,

 (c) fusion of the isolated spleen cells and mouse myeloma cells in the presence of a fusion promoter (eg, polyethylene glycol) by the method described in Kohler et al.

(d) culturing of hybridoma cells obtained in a selective medium in which unfused myeloma cells do not grow,

 (e) Selection of hybridoma cells producing the desired antibody by methods such as enzyme-linked immunosorbent assay (ELISA) and Western plot, and cloning by limited dilution, etc.

 (f) Culture the hybridoma cells that produce the monoclonal antibody, and harvest the monoclonal antibody. Active X-type sPLA measurement method

In the present invention, with reference to枋体for Purobe peptide or active type X sPLA _2, it is possible to perform measurement of active type X sPLA ₂ protein. The measurement method of the present invention The amount of the body, antigen, or antibody-antigen complex corresponding to the amount of antigen (propeptide or active X-type sPLA ₂ ) in the measurement solution is detected by chemical or physical means, and the amount is detected. Any measurement method may be used as long as it is a measurement method calculated from a standard curve prepared using a standard solution containing the antigen. For example, nephrometry, a competition method, an immunometric method and a sandwich method can be used.

In immobilizing an antigen or an antibody, a chemical bond usually used for immobilizing a protein or an enzyme can be used. As the carrier, insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, and glass are used. Radiolabels, enzymes, and fluorescent substances are used as labeling agents. Radioisotopes, ^m I,, as the "C etc. are used. Enzymes, Peruokishidaze,

3-galactosidase, ^ -darkosidase, alkaline phosphatase, etc. are used. Example

 The present invention is further described by the following examples. '' Example 1 Preparation of human X-type sPLA and expression vector

CDNA encoding human type X sPLA ₂ is a human placental cDNA as錡型obtain Ri by the PCR method. The following primers were used for PCR.

hGX-S: 5'-ctgtgtacgcgtccatgctgctcctgctactgccgtc-3 '(SEQ ID NO: 5)

hGX-AS: 5'-tcaa tgcggccgctcagtcacact tgggcgcgtcc-3 (SEQ ID NO: 6)

hGGX-S has a Kozak sequence and a Mlul recognition site. HGX-AS also has a NoU recognition site.

PCR was performed for 35 cycles under the conditions of 30 degrees at 94 degrees, 50 seconds at 50 degrees, and 2 minutes at 72 degrees. The PCR amplified fragment was digested with Mlul and Notl, and introduced into pBS-SK (-). After confirming sequence, force Rupokishiru group terminal to the six X-type by adding the His residue sPLA ₂ -HisTag body, HGx - S-flop la y M a及beauty hGX-H6AS flops la y M a (5 ' - It was constructed by PCR using tcaagtgcggccgctcaatggtg tggtgatgatggtcacaci tgggcgagtccggc t-3 ': system! j number 7). PCR amplified fragment was cut with NGU and Xhol, and replaced with the corresponding region of the X-type sPLA ₂ plasmid. After confirming the sequence of the region amplified by PCR, the cDNA was inserted downstream of the SR-α promoter in an expression vector for mammalian cells. Example 2 Expression, purification and characterization of human X-type sPLA ^ -HisTag recombinant protein

LipofectAMINE reagent (Life Technologies, Inc.) was added to 293 cells derived from human embryonic kidney (293T cells) transformed with SV-40 at 0.5 / zg of hygromycinB resistance gene together with 20 g of plasmid containing sPLA ₂ -HisTag cDNA of type X. ). 293T clones stably expressing X-type sPLA ₂ -HisTag were obtained by selection based on their resistance to hygromycin B. Expression of the recombinant protein was detected by a chromogenic PLA ₂ activity assay. Culturing the present 293T clones 1 0% fetal © shea fetal serum-containing medium, X-type sPLA ₂ - were prepared culture supernatant containing HisTag expression protein. The main culture supernatant was equilibrated with a 20 mmol / L sodium phosphate buffer (pH 7.4) containing 10 mmol / L imidazole and 0.5 mol / L sodium chloride, and the column was equilibrated with a Ni "-charged chelating Sepharose fast flow column (Amersham Pharmacia Biotech). ) to was added followed, X-type sPLA ₂ in this column were combined binding -. a HisTag protein, 500 mmol / L imidazole, the 20 mmol / L sodium phosphate buffer containing 0.5 mol / L sodium chloride (pH 7.4) The fraction containing the obtained X-type sPLA ₂ -HisTag protein was dialyzed against a 20 mmol / L Tris-HCl buffer containing 1 mmol / L phenylmethyl sulfonic acid, and a HiTrap Q column (Amersham Pharmacia Biotech). ) to was added. bound proteins were eluted with a gradient of chloride Natoriumu from 0 to 0 · 5 mol / L, the fraction containing the X-type sPLA ₂ -HisTag evening Npaku, then reverse phase IffLC column ( Cosmosil, 5C18 300AR, 4.6X 150mm, Nakarai Tesque Was added to. 0.05 Torifuruoro acetic acid, 0.880 Asetonitori Le from 20 to 95% for the resulting fractions were subjected to chromogenic PLA ₂ activity measurement, Form X sPLA ₂ -HisTag was eluted with 43% acetonitrile. Each eluted fraction was analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using a 15-25% acrylamide gradient gel (Daiichi Kagaku). As another experiment, the purified X-type sPLA ₂ -HisTag protein, 0.2 Units Gurikoshida Ichize F; 0.5 containing 40 - (E - 5003 Oxford GlycoSystem ), 5% 2- mercaptoethanol, 3% Nonide' preparative P After treatment at 37 ° C for 18 hours in% SDS, SDS-PAGE was performed, and electroblotting was performed on Immobilin-P membrane (Millipore Co., Ltd.) (Hanasaki, K. et. al., J. Biol. Cem., 270, 7543-7550 (1995)). After staining the plots have been tamper click in Kumashi one Buri Rianto Bull one, X-type sPLA ₂ - cut of the band of HisTag protein, the amino acid sequence of its N-terminal was analyzed by Applied Biosystems Procise Sequencer. X-type sPLA ₂ of purified protein preparation obtained by adding a His residue at the C-terminal obtained from the above had a PLA ₂ activity. As a result of SDS-PAGE analysis, most were molecular species with a molecular weight of 16-kDa, but some showed a molecular weight of 14-kDa. As a result of treatment with W-daricosidase F (an enzyme that releases -linked sugar chains from glycoproteins), the 16-kDa molecular species disappeared and all were aggregated into a single 14-kDa molecular species. Result of performing analysis of N-terminal amino acid sequence of the 14- kDa protein, the amino acid sequence of sequence (SEQ ID NO 3, wherein the active form of human type X sPLA _2, from position 1 Gly to position 8 Thr amino acids Sequence). During the sequence of X-type sPLA _2, N-linked glycosylation site capable to 7 1-position is present. Therefore, these findings are in 293T cells, most of the X-type sPLA ₂ was pressurized with the His residue at the C-terminus, to be expressed in active form glycoproteins N- linked sugar chain is added Is shown. Example 3 Preparation and characterization of anti-X type sPLA and antibody

Purified human type X sPLA ₂ - after immunization of Usagi in HisTag protein, the antiserum was prepared and the IgG fraction HiTrap Protein G - force ram (Amersham Pharmacia Biotech) Purified using The specificity and titer of the antiserum and the purified antibody were measured by the following ELISA method. Prepare 96-L plates (Nunc, Immuno MaxiSorp plates) coated with purified human IB, IIA, and X sPLA ₂ -HisTag proteins (100 ng each), and use Block Ace solution (Dainippon Pharmaceutical) After blocking nonspecific adsorption with, add anti-human X-type sPLA ₂ -HisTag antibody, anti-human IB si »LA ₂ antibody (Biochemical) and anti-human type IIA sPLA ₂ serum (Cayman Chemical Co.). Allowed to react for hours. After washing with PBS containing 0.05% Tween20 (Phosphate-buffered saline, H 7.4), the plate is further reacted with a peroxidase-conjugated anti-egg igG antibody (Immunotech), and finally 0.5 fflg / mL of 0-phenylenediamine and 0.01¾ (v / v) was H ₂ 0 50 comprising ₂ mmo L / L click E phosphate sodium buffer is added (pH 5.3) and developed in. The color reaction was terminated by adding 2 mol / L sulfuric acid, and the color intensity was measured at a wavelength of 492 nm. In another study, the plate type X sPLA ₂ - coated with HisTag or Ax Bok Hi sTag protein was analyzed by method towards the above.

Inhibitory effect of anti-X type sPLA ₂ antibody to PLA ₂ activity, having conducted 'by luminescent Atsusi. That is, each sPLA ₂ protein purified (50 ng), or IID type, V-type sPLA ₂ was reacted for 2 hours with current to CH0 cell anti type X sPLA ₂ antibody culture supernatant, followed PLA ₂ activity described above It was measured as follows. Inhibitory effect of bo type X sPLA ₂ antibody, were tested under conditions in which each of sPLA ₂ reaction reaches the maximum nearly at 3 7 ° C. Thus anti-X type sPLA ₂ antibody thus obtained contained human type X sPLA ₂ was added HisTag although to recognize, did not react with type IB and type IIA sPLA _2. Furthermore, antibodies prepared did not react with HisTag additional proteins not related to the X-type sPLA _2. Therefore, HisTag additional part, it became clear that not Epitopu anti X type sPLA ₂ antibody. Furthermore, by pre-treatment with KX type sPLA ₂ antibody, the enzymatic activity of human type X sPLA ₂ was added HisTag is dose-dependently inhibited, in a concentration of 100 g / mL, the other five sPLA ₂ activity effects not observed, only the enzymatic activity of type X sPLA ₂ was impaired about 90% inhibitory. From the above results, anti-type X sPLA ₂ antibody preparation of human type X sPLA ₂ Tan It was proved to be specific for the park portion. Example 4 Expression, purification and characterization of recombinant X-type sPLA, protein

Using X-type sPLA ₂ expression plasmid, the CH0 cells that the enzyme was stable expression was prepared as described above. The CH0 cells were cultured in Dulbecco's Modified Idal medium containing 10% fetal calf serum and, when the cells became confluent, changed to serum-free PM-1000 medium (Eiken, Japan). Was further cultured for 3 days. The resulting culture supernatant was added to Afi two tee one column coupled with the anti-type X sI> LA ₂ antibodies. This column is an anti-type X _{sPLA 2 IgG (30 mg),} HiTrap N- hydroxysuccinimide imide activated column according to a conventional method; prepared by coupling the (5 mL Amersham Pharmacia Biotech). After washing the column with sodium phosphate buffer (pH 7.4), the bound proteins were eluted with 0.1 mol / L glycine-HCl (H1.7). This eluted fraction was added to the above-mentioned reversed-phase HPLC column, and separated with a concentration gradient of acetonitrile in 0.1% trifluoroacetic acid from 20 to 40 μi. Three large fractions were obtained, collected, dried and dissolved in 50 mmol / L Tris-HCl (pH 7.4) containing 0.3 mol / L sodium chloride. By the above method, it was purified recombinant protein human type X sPLA _2. SDS-PAGE analysis of the acid-eluted fraction obtained from the antibody column shows molecular species exhibiting a wide range of molecular weights ranging from 15 to 18-kDa, and single bands at 14-kDa and 13-kDa. The presence of two molecular species was observed. By N-glycosidase F treatment, it was aggregated into two molecular species (14-kDa and 13-kDa), and as a result of their N-terminal amino acid sequence analysis, the majority of the 13-kDa protein (GILELAGT: SEQ ID NO: 8) was estimation mature human type X sPLA ₂ (in the amino acid sequence set forth in SEQ ID NO: 3, a polypeptide consisting of 1 2 3 position of Asp from position 1 Gly) is, on the other hand, proteins of a few 14-kDa is peptide consisting of 11 residues at the N-terminus of the active X-type sPLA _2: in the amino acid sequence set forth in (EASRILRVHRR SEQ ID NO: 9) is added professional type (SEQ ID NO: 3, 1 2 3 position from a 1 1-position of Glu Asp polypeptide). Therefore, it shows a wide range of molecular weights over 15-18-kDa Species was considered to X-type sPLA ₂ that these proform and active type X sPLA ₂ is N- linked sugar chain is added.

For even reverse phase HPLC 3 one fraction that was further separated by N - Darikoshidaze F processing result of the analysis by SDS-PAGE after, Fraction 1 and type X sPLA ₂ carbohydrate unconjugated 13-kDa activated N - a mixture of pro-type linked sugar chain is added and active type X sPLA _2, fraction 2 is X-type sPLA ₂ protein N- linked glycosylation has been activated, fraction 3 Was found to be a non-glycosylated 13-kDa active protein. Example 5 Analysis of substrate specificity of human X-type sPLA

The substrate specificity of purified human type X sPLA ₂ each purified sample, position to have Parumichi phosphate, various different fatty acids were purchased commercially having different 1 two phosphorus lipid polar group with the 2-position They were tested as substrates. Each sPLA ₂ protein for enzymatic activity (IB type, I IA type sPLA ₂及Pi human type X sPLA ₂ in HPLC 3 fractions) from each phospholipid 1 mmo l / L and 3 mmo l / L Dokishikoru acid It was measured under mixed micelle conditions. Indicated a result, (proform HPLC fractions 1 'mixture of active type X sPLA _2), only one active' only 30-40% of PLA ₂ activity than fraction 2 or fraction 3 composed et al Did not. This decrease less is considered to be due to the presence of 14- kDa pro-type enzyme contained in fraction 1, pro X-type sPLA ₂ suggests that weak enzymatic activity as compared to the active form . On the other hand, the activity of Fraction 3, which is composed of the non-glycosylated type, was almost the same as that of Fraction 2, which is the active enzyme having N-glycans. N- binding type sugar chains bound to the ₂ was considered not inherently affect the expression of PLA ₂ activity. In one two phospholipid substrates using the active form of X-type sPLA ₂ (fraction 2 and 3) showed the highest activity against phosphatidylcholine to hold the position to Arakidon acid. In contrast, IB-type and I IA type sPLA ₂ showed the highest activity against host scan phosphatidyl glycerol for holding Orein acid at the 2-position. The present inventors have found that in the process of purification of recombinant human type X sPLA ₂ protein, active X-type sPLA ₂ propenyl peptide consisting of 11 amino acids at the N-terminus of the protein revealed the presence of additional pro-type X-type sPLA _2, the further substrate specificity analysis, pro enzyme is compared to the activity enzyme The activity was likely to be very low. In addition, using the SignalP computer analysis to predict the cleavage site of the signal sequence (Nielsen et al., Protein Eng., 12, 3-9 (1999)), the site which is most susceptible to signal peptide cleavage is analyzed. Indicates that the amino acid residue is between 11 and 11 before the N-terminus of the active protein, thereby proving that the 11 amino acid residue is a propeptide. Thus, the expression of maximum enzymatic activity of type X sPLA _2, together with the cutting of Purobe peptide from proform by subtilisin-like or trypsin-like flop port Teaze is shown to be essential, production of this propeptide by measuring, it became possible to predict the production of active type X sPLA ₂ occurring in pairs. Example 6 Immunohistochemical analysis of human colon cancer tissue using anti-X type sPLA ^ ¾

Specimens of healthy adult colon tissue and colon cancer tissue from colorectal cancer patients were purchased from Biochain Inc. (San Leandro, CA). The slide of the tissue section was removed from paraffin wax, reacted with methanol containing 0.3% H ₂ O ₂ for 30 minutes to remove endogenous peroxidase, and then treated with 5% normal goat serum for 20 minutes. Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 ii g / ml) and 14 hours to reaction at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, 50 mmol / L Tris-HCl (H 7.6) were colored with by Ri Peruokishidaze activity to react for 10 minutes in a buffer tissue specimen containing 200 g / mL of Jiamino base Njijin and 0.006 H ₂ 0 ₂ X-type sPLA _{2 in the} inside was visualized. In addition, cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits dark brown di § amino benzylidene den. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 g / mL) by reacting for 2 hours. As a result, a positive signal is X-type sPLA _2, is hardly detected in normal colon tissues was detected strongly in cancer cells of colon adenocarcinoma tissues. These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sPLA ₂ protein. Moreover, these positive signals were not observed in IgG prepared from non-immunized egrets. From the above results, the expression of type X sPLA ₂ protein in colorectal cancer is Rukoto have significantly high expression was suggested. Example 7 Immunohistochemical analysis of human lung tissue using anti-X type sPLA and antibody

Specimens of healthy adult lung tissue and lung tissue from lung cancer patients were purchased from Biocha in Inc. (San Leandro, CA). Slide of tissue section, except take paraffin wax, after removing the endogenous Peruokishita Ichize reacted for 30 minutes in methanol containing 0. 3¾ H ₂ 0 _2, treated with 5% normal turbocharger formic serum for 20 minutes did. Then, in PBS with 0. 1 ¾ bovine serum albumin, anti-X type sPLA ₂ antibody (6 ng / mL) and 14 hours, the mixture was reacted at 4 * C. After washing with PBS, the cells were reacted for 30 minutes with a goat anti-Peacock IgG antibody conjugated with biotin, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, Peruokishi by reacting for 10 minutes at 200 g / Jiamino base Njijin and 0.006% of mL H ₂ 0 50 comprising ₂ mmo l / L Tr i s- HC l (H 7. 6) buffer and colored to Daze activity type X sPLA ₂ in the tissue specimens were visualized. In addition, cell nuclei were counterstained by reaction with a 0. hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits diaminobenzidine den dark brown. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 g / mL) by reacting for 2 hours.

As a result, positive signals X type sPLA ₂ is in normal lung tissue is detected while low levels in type II alveolar epithelial cells in the lung cancer patients from lung tissues was detected strongly in the cancer cells. These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. From the above results, lung cancer In suggesting that the expression of type X sPLA ₂ protein is significantly high expression. Example 8 Immunohistochemical analysis of human liver tissue using anti-X type sPLA and antibody

Specimens of healthy adult liver tissue and lung tissue from liver cancer patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, except take paraffin wax, after removing the endogenous Peruokishitaze reacted for 30 minutes in methanol containing 0.3¾ H ₂ 0 _2, was treated with 5% normal turbocharger formic serum for 20 minutes. Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 g / mL) and 14 hours, the mixture was reacted at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, coloration of Peruokishi da Ichize activity by reacting 200 H g / mL 50 negation ol / L Tris-HCl (pH 7.6) containing Jiamino base Njijin and 0.006% H ₂ 0 ₂ for 10 min in buffer type X sPLA ₂ in the color and tissue specimens were visualized. In addition, cell nuclei were counterstained by reaction with an aqueous solution of hematoxylin. X-type sPLA ₂ positive signal was detected as deposits diaminobenzidine den dark brown. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 g / mL) by reacting for 2 hours.

As a result, positive signals X type sPLA ₂ is in normal liver tissues was detected with low levels in the liver lobule and Kupfier stellate cells, in the liver cancer patient from liver tissue was detected strongly in the cancer cells. These signals, it was confirmed to be specific to type X sPLA ₂ from that extinguishing deleted by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. These results, in liver cancer it was suggested that the expression of type X sPLA ₂ protein is significantly high expression. Example 9 Immunohistochemical analysis of human gastric tissue using anti-X type sPLA antibody

Specimens of healthy adult stomach tissue and lung tissue from gastric cancer patients were purchased from Biochain Inc. Leandro, CA). Slide of tissue section, except take paraffin wax, after removing the endogenous Peruokishita Ichize reacted for 30 minutes in methanol containing 0.3¾ H ₂ 0 _2, was treated with 5% normal turbocharger formic serum for 20 minutes . Then, in PBS with 0.1¾ bovine serum albumin, anti-X type sPLA ₂ ¾ body (6 g / mL) and 14 hours, the mixture was reacted at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, coloration and tissue specimens Peruokishi Daze activity by reacting with 200 ng / mL of base Jiamino Njijin and 50 mmol containing _{0.006% H 2 0 2 / L} Tris-HCl (H 7.6) buffer for 10 min X-type sPLA _{2 in the} inside was visualized. Cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits diaminobenzidine den dark brown. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide, was purified X-type sPLA ₂ protein and (60 IX g / mL) carried out by reacting for 2 hours.

As a result, a positive signal is X-type sPLA _2, was hardly detected in normal stomach tissues, in gastric cancer patient-derived stomach tissue was detected strongly in the cancer cells. These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type si> LA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. These results, in gastric cancer suggested that the expression of type X sPLA ₂ protein is remarkably represents Takahatsu. Example 10 Immunohistochemical analysis of human kidney tissue using anti-X type sPLA ^ ¾

Specimens of healthy adult kidney tissue and lung tissue from kidney cancer patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, except take paraffin wax, after removing the endogenous Peruokishitaze reacted for 30 minutes in methanol containing 0.3¾ H ₂ 0 _2, was treated with 5% normal turbocharger formic serum for 20 minutes. Thereafter, 0.1%. In PBS containing bovine serum Alp Min, anti X type sPLA ₂ antibody (6 ng / mL) and 14 hours, allowed to react at 4 ° C. After washing with PBS, react with goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, The cells were treated with peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, 200 g / Jiamino base Njijin and 0.006% or in _{mL H 2 0 2 50 mmol /} L Tris-HCl (H 7.6) containing color Mr. the Peruokishi da Ichize activity by reaction for 10 minutes in buffer type X sPLA ₂ in the tissue specimens were visualized. In addition, cell nuclei were counterstained by reaction with an aqueous solution of hematoxylin. X-type sPLA ₂ positive signal was detected as deposits diaminobenzidine den dark brown. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide, was purified X-type sPLA ₂ protein and (60 / ig / mL) carried out by reacting for 2 hours.

As a result, positive signals X type sPLA ₂ is in normal kidney tissue was detected with low levels in the glomerular Mesangiu acellular, in renal cancer patients kidney tissues was detected strongly in the cancer cells. These signals, it was confirmed to be specific to type X sPLA ₂ from that extinguishing deleted by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. From the above results, in the kidney cancer it has been suggested that the expression of type X s! »LA ₂ protein is significantly high expression. Example 11 Immunohistochemical analysis of human gallbladder tissue using anti-X type sPLA ^ fi

Specimens of healthy adult gallbladder tissue and lung tissue from gallbladder cancer patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, except take paraffin wax, after removing the 0.3% H ₂ 0 ₂ is reacted for 30 minutes in methanol containing endogenous Peruokishi evening Ichize, treated with 5% normal turbocharger formic serum for 20 minutes did. Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 g / mL) and 14 hours, the mixture was reacted at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, 50 mmol / L Tris-HCl (pH 7.6) X of by reaction for 10 min in buffer and colored the Peruokishi Daze active tissue specimens containing 200 / mL of Jiamino base Njijin and 0.006% or 0 ₂ Type sPLA ₂ was visualized. Also, 0. «Hematoki Cell nuclei were counterstained by reaction with aqueous syrin. X-type sPLA ₂ positive signal was detected as deposits diaminobenzidine den dark brown. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 iig / mL) by reacting for 2 hours.

As a result, a positive signal is X-type sPLA _2, was hardly detected in normal gallbladder tissues, in gallbladder cancer patient-derived gallbladder tissues was detected strongly in the cancer cells. These sheets Gunaru, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egret. These results, in the gallbladder cancer suggested that the expression of type X sPLA ₂ protein is significantly high expression. Example 12 Immunohistochemical analysis of human prostate tissue using anti-X type sPLA ^ antibody

Specimens of healthy adult prostate tissue and prostate tissue from prostate cancer patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, remove the Parafinwa' box, after removing the endogenous Peruoki sheet evening over peptidase reacted methanol for 30 minutes containing 0.3% H ₂ 0 _2, were treated with normal catcher formic serum 5 20 minutes . Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 g / mL) and 14 hours, the mixture was reacted at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). Washing狰後, 200 g / Jiamino base Njijin and 0.006% or in _{mL H 2 0 2 50 mmol /} L Tris-HCl (H 7.6) containing buffer coloration said the I Ri Peruokishidaze activity to react for 10 minutes in type X sPLA ₂ in the tissue specimens were visualized. In addition, cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits dark brown di § amino benzylidene den. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 g / mL) by reacting for 2 hours.

Most detection of the result, positive signals X type sPLA ₂ is normal prostate tissue However, in prostate tissue from prostate cancer patients, it was strongly detected in cancer cells. These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type SlPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. These results, in prostate cancer suggested that the expression of type X sPLA ₂ protein is significantly high expression. Example 13 Immunohistochemical analysis of human kidney tissue using anti-X type sPLA and antibody

Specimens of healthy adult Teng tissue and Teng tissue from Teng cancer patients were purchased from Biocha in Inc. (San Leandro, CA). Slide of tissue section, remove the paraffin wax, 0. 3% H ₂ 0 ₂ after removal of the 3 0 min reacted endogenous Peruokishi evening over zero in methanol containing, 20 minutes with 5% normal turbocharger formic serum Treated. Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 g / mL) and 14 hours to reaction at 4 ° C. After washing with PBS, the cells were reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes, and treated with a peroxidase-containing avidin-biotin complex reagent (Vector or Labo rat or ies). After washing, 200 g / mL 50 mmo l / L Tr is -HC l containing the Jiamino base Njijin a 0. 006% H ₂ 0 ₂ in (H 7. 6) Ri by the reacting for 10 minutes in buffer the Peruokishida Ichize X type sPLA ₂ activity was colored tissue specimens were visualized. Cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits dark brown di § amino benzylidene den. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 g / mL) by reacting for 2 hours.

As a result, a positive signal is X-type sPLA _2, was hardly detected in normal塍臓tissues, in塍臓cancer patient-derived滕臓tissues was detected strongly in the cancer cells. These sheets Gunaru, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egret. These results, in滕臓cancer suggested that the expression of type X sPLA ₂ protein is significantly high expression. Example 14 Immunohistochemical analysis of human cerebral tissue using anti-X type sPLA ^ it body

Specimens of healthy adult cerebral tissue and cerebral tissue from Alhamama patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, remove the Parafinwa' box, after removal of the 0.3% H ₂ 0 ₂ is reacted for 30 minutes in methanol containing endogenous Peruoki Shitaze were treated with 5% normal turbocharger formic serum for 20 minutes. Then, in PBS with 0.1¾ bovine serum albumin, anti-X type sPLA ₂ antibody (6 g / mL) and 14 hours, the mixture was reacted at 4 ° C. After washing with PBS, it was reacted with a goat anti-Peacock IgG antibody conjugated with biotin for 30 minutes and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, coloration and 50 Dimol / L Tris-HCl ( H 7.6) Ri by the reacting for 10 minutes in buffer Peruokishida Ichize activity comprising 200 mu g / ml of Jiamino base Njijin and 0.006% H ₂ 0 ₂ type X sPLA ₂ in the color and tissue specimens were visualized. In addition, cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits dark brown di § amino benzylidene den. X-type, neutralization experiments sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ Midorishiro cytoplasm and (60 g / mL) by reacting for 2 hours.

As. A result, a positive signal is X-type sPLA _2, is hardly detected in normal cerebral tissues, part of the nerve cell population of Alzheimer patients from cerebral tissue, particularly senile plaques (senile plaque) and neurofibrillary tangles site (neurofibrillary tangle regions). These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sI> LA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egrets. These results, in Aruhhaima one patient cerebral suggested that the expression of type X sPLA ₂ protein is significantly high expression. Example 15 Immunohistochemical analysis of human liver cirrhosis tissue using anti-X type sPLA and antibody

Specimens of healthy adult liver tissue and liver tissue from cirrhosis patients were purchased from Biochain Inc. (San Leandro, CA). The slides of the tissue sections were treated with 5 normal goat sera for 20 minutes after removing paraffin wax, reacting with methanol containing 0.3% H ₂ O ₂ for 30 minutes to remove endogenous peroxidase. Then, in PBS containing 0.1% bovine serum albumin, anti-X type sPLA ₂ antibody (6 ng / mL) and 14 hours to reaction at 4. After washing with PBS, the cells were reacted for 30 minutes with a heron IgG antibody conjugated with biotin and treated with a peroxidase-containing avidin-biotin complex reagent (Vector Laboratories). After washing, 200 / xg / ml 50 mmol / L Tris-HCl (H 7.6) containing Jiamino base Njijin and 0.006% H ₂ 0 ₂ of buffer coloration said the I Ri Peruokishidaze activity to react for 10 minutes in type X sPLA ₂ in the tissue specimens were visualized. Cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ positive signal was detected as deposits dark brown di § amino benzylidene den. Neutralization experiments X-type sPLA ₂ signal, prior to the addition of antibody to slide was performed purified X-type sPLA ₂ protein and (60 ng / mL) by reacting for 2 hours.

As a result, a positive signal is X-type sPLA _2, in normal liver tissues was detected with low levels in the liver lobule and Kup ί ί er stellate cells, in patients with cirrhosis derived from liver tissue, observed significant enhanced expression in sham lobule Was done. These signals, it was confirmed to be specific to type X sPLA ₂ since disappeared by the addition of X-type sPLA ₂ protein. In addition, these positive signals were not observed in IgG prepared from non-immunized egret. These results, in cirrhotic tissue suggesting that expression of type X sPLA ₂ protein is significantly high expression. Example 16 Cloning of Gene Encoding Mouse X-Type sPLA

Mouse homolog of type X sPLA ₂ in order to isolate, on the basis of the human type X sPLA ₂ sequence

Two types of primers were designed, and PCR was performed using mouse thymus cDNA as a cycl type. 5'-atcatgctgctcctgctac-3 '(SEQ ID NO: 10)

 ό -cagcaccagtcaatggcatc-3 (SEQ ID NO: 11)

PCR was performed for 40 cycles under the conditions of 1 minute at 92, 1 minute at 58, and 1 minute at 72 ° C. Next, using the mouse spleen marathon-ready cDNA (Clontech), the 3,-and 5'-ends were cloned by the rapid amplification of the cDNA ends (RACE) method, and finally the following primers were used: Te, the coding region of the mouse type X sPLA ₂ cDNA, was obtained by PCR mouse spleen cDNA as錡型.

5 -agtagttgatgcggccgccaccatgctgctgctactgctgctgt tgc-3 (SEQ ID NO: 1 2) 5 -ac tctct at gtct agate agtcgcact tgggtgagtct t tct-3 '( SEQ ID NO: 1 3) mouse type X sPLA ₂ is, Valentin β (J. Biol. Chem ., 274 , 44, 31195-31202 (1999)) so as to report, to have a 1 5 1 consists amino acid (SEQ ID NO: 1 4), 7 0.9% homology to the human X-type sPLA ₂ Was estimated. Mouse type X sPLA ₂ has a pre-pro peptide consisting of 2 8 amino acids in the N-terminal as well as the human type X sPLA _2, having an extended structure in the C-terminus. However, mouse type X sPLA ₂ is different from the human type X sPLA _2, N-linked glycosylation sites had no.

Example 17 Enzyme activity of mouse pro-type and activated X-type sPLA

Expression and purification of mouse type X sPLA ₂ is I line in the same manner as described in Example 4

: Tsu, this.

Purified proform and enzymatic activity of active type X sPLA ₂ was determined I- palmitoyl-2- linoleoy Bok phosphatidylcholine a (PLPC) as substrate. As shown in FIG. 2, the proform X type sPLA ₂ were not only has only 8% of the activity compared to the active form. The presence of Arg at the C-terminus of the propeptide suggests that trypsin-like endogenous protease may be involved in cleavage. Therefore, after digestion the proform type X sPLA ₂ with trypsin, a result of analysis by SDS-PAGE, conversion to activity type is confirmed by trypsinization, and correspondingly, up to PLA ₂ activity about 5-fold Rose (Figure 2). From the above analysis, the propeptide portion component of cutting and removing from pro-form according endoprotease, it was suggested is essential for maximal activity expression of type X sPLA _2.

Example 18 Preparation of anti-X type sPLA ^ 7 ° mouth peptide antibody and its measurement system

X-type sPLA ₂ Purobe peptide is based on the amino acid sequence information taught by the present invention Synthesized with a peptide synthesizer. The resulting probeptide was combined with bovine thyrologous purine as an immunogen, and immunized with egret to prepare antiserum. The IgG fraction was purified using a HiTrap plug-in G-column (Amersham Pharmacia Biotech). The specificity and titer of the antiserum and the purified antibody were measured by the following ELISA method. 9 6 © El plates coated with type X sPLA ₂ propeptide conjugated with bovine serum albumin (Nunc, Immuno MaxiSorp pre Ichito) was prepared, after Proc the nonspecific adsorption in 1% bovine serum albumin solution, It was reacted by the addition of anti-human type X sPLA ₂ Purobe peptide antibodies. After washing with PBS containing 0.05% Tween20 (Phosphate-buffered saline, H7.4), the plate was further reacted with a peroxidase-conjugated goat anti-pea IgG antibody (Cappel), and TBMplus (DAKO) was added to develop color. The coloring reaction was terminated by adding 0.5 mol / L sulfuric acid, and the coloring intensity was measured at a wavelength of 450 nm.

Thus anti-X type sPLA ₂ Purobe peptide obtained by the antibody does not react with pro-X-type sPLA ₂ or active type X sPLA ₂ in an ELISA system shown in Example 3, Purobe peptide only It was something to recognize. Using this antiserum, the propeptide was measured by the following ELISA first method. The propeptide was reacted with EZ-Link Su1fo-NHS-LCLCBiotin (Pierce) and separated by reversed-phase HPLC to prepare a biotinylated propeptide. A 96-well plate coated with avidin was prepared, nonspecific adsorption was blocked with a 1% bovine serum albumin solution, and then biotinylated probepeptide was added and reacted for 2 hours. PBS containing 0.05% T een20 (Phosphate-buffered saline, pH 7.4) After washing, the added sample or standard solution to measure the anti-X type sPLA ₂ Purobe peptide antibodies were simultaneously allowed to react for 1 8 hours. After washing, it was further reacted with peroxidase-conjugated goat anti-Peacock IgG antibody (Cappel), and after washing, TBMplus (DAK0) was added to develop color. The color reaction was terminated by adding N sulfuric acid, and the color intensity was measured at a wavelength of 450 nm. A standard curve (Fig. 3) was created by calculating the percentage B / B „% of the absorbance B obtained with the standard solution at each concentration relative to the absorbance Bo obtained with the standard solution of 0 ng / raL, and used to calculate the unknown sample. The propeptide concentration contained in the unknown sample was calculated from the obtained absorbance, and the propeptide was also measured by the following ELISA method 2. The X-type sPLA ₂ propeptide conjugated with albumin to prepare a coated 9 6 © El plates, after blocking nonspecific adsorption with 1% bovine serum albumin solution, to be measured with an anti-X type sPLA ₂ propeptide antibody Samples or standard solutions were added simultaneously and allowed to react for 18 hours. After washing, a color reaction was performed in the same manner as in the first method, and the concentration of the peptide contained in the unknown sample was calculated. Example 19 Immunohistochemical analysis of human colon cancer tissue using anti-X type sPLA and propeptide antibody

In this test, anti-human X-type sPLA2 propeptide derivative was used. Specimens of colorectal tissues of healthy adults and colorectal cancer tissues from colorectal cancer patients were purchased from Biochain Inc. (San Leandro, CA). Slide of tissue section, remove the paraffin wax, after removing the endogenous Peruokishita one peptidase allowed to react for 30 minutes in methanol containing 0.3% H ₂ 0 _2, was treated with 5% normal turbocharger formic serum for 20 minutes. Then, it was allowed to react with an anti-human X-type sPLA ₂ (ゥ Sagi) propeptide antibody (24 ig / mL) at 4 ° C for 14 hours in a PBS aqueous solution containing 0.1% bovine serum albumin. After washing with 0.1% Polyoxyethylene (20) sorbitan monolaurate (Tween 20; Wako Pure Chemical Industries, Ltd. Osaka) -containing PBS aqueous solution, react with goat anti-Egret IgG antibody conjugated with biotin for 30 minutes, and contain peroxidase Of Streptavidin reagent (DAKO Corporation, Carpinteria, CA) for 15 minutes. After washing with an aqueous PBS solution, a biotin-labeled ilamide solution (DAKO Corporation, Carpinteria, CA) was allowed to react for 15 minutes, followed by thorough washing with a PBS aqueous solution containing 0.1% Tween20. The peroxidase-labeled streptavidin solution was further treated for 15 minutes, and similarly washed sufficiently with a PBS aqueous solution containing 0.1% Tween20. After washing, 200 / _t g / mL diaminobenzidine and 50 mmol / L Tris-HCl ( pH 7.6) containing 0.006% H ₂ 0 ₂ to Peruokishidaze activity caused a color by reacting for 10 minutes in buffer, tissues the X-type sPLA ₂ propeptide in the sample was visualized. In addition, cell nuclei were counterstained by reaction with 0.4% hematoxylin aqueous solution. X-type sPLA ₂ propeptide positive signal, di § amino benzylidene den brown Detected as deposition. The absorption neutralization experiment for the propeptide-positive signal was performed by reacting with propeptide-conjugated bovine serum albumin (300 // g / mL) for 2 hours before adding the antibody to the slide.

As a result, X-type sPLA ₂ propeptide positive signal, the normal colon tissues not photons throat detected was detected strongly in cancer cells of colon adenocarcinoma tissues. These signals, it was confirmed from the lost this with the addition of antibody treatment before the propeptide linked bovine serum albumin to tissue that is specific to the type X sPLA ₂ propeptide. In addition, these positive signals were not observed in IgG prepared from non-immunized egret. From the above results, that the pro-X-type sPLA ₂ Purobe peptide amount that has been released with the activation of is significantly increased is suggested at colorectal cancer. Based on the amino acid sequence information taught by preparing the present invention Mausumonoku port one monoclonal antibody for Example 2 0 activated human type X sPLA _9, human active type X sPLA _2: peptide comprising the N-terminal sequence (GILEL AGGGC : SEQ ID NO: 16) was synthesized, and conjugated to KLH was used as an immunogen to immunize mice. The increase in the antibody titer was measured by the following PEG method. It was added mouse anti Plasma and radioactive iodine-labeled X-type sPLA ₂ protein to the tube and allowed to react for 18 hours or more at 4 degrees. After the reaction, a 1% bovine gamma-globulin solution and a 25% PEG6000 solution were added, and the radioactivity precipitated by binding to the antibody by centrifugation was measured using a gamma counter.

Splenocytes were prepared from mice with the highest antibody titers, and cell fusion was performed with mouse myeloma cells in the presence of PEG1500. The produced antibody-producing hybridomas were detected by the RIA method described below. Goat anti-mouse IgG was immobilized on a 96-well plate and non-specific adsorption was blocked with PROC-ACE (Dainippon Pharmaceutical), and the monoclonal antibody contained was captured by reacting with the hybridoma culture supernatant. After washing, reacted radioactive iodine-labeled X-type sPLA ₂ protein was determined residual after washing radioactivity. The detected High Priestess dormer repeated black-learning by limiting dilution, active type X; establish murine monoclonal antibody production High Priestess dormer strain 3C10 which reacts to PLA ₂ did. On December 12, 2000, the hybridoma was registered as FERMBP-73 993 (accession number) under the Patent Organism Depositary Center for Patented Organisms, National Institute of Advanced Industrial Science and Technology (1-1 Tsukuba East, Ibaraki, Japan 1 1 Central No. 6) has been commissioned.

3C10 results antibodies of the specificity was examined in PEG method described above, X-type sPLA ₂ propeptide and SEQ ID NO: 3 amino acid sequence described - bond in the case of addition of peptides comprising the amino acid sequence of the 10-position from 11-position decrease of radioactivity was not observed to specifically recognize X-type sPLA ₂ that if we inhibition of binding only when the protein has been added was noted, the antibody is a active type X sPLA ₂ comprising active (Fig. 4). Example 21 X-type sPLA. Based on the amino acid sequence information taught by preparing the present invention of a mouse monoclonal antibody against propeptide peptide comprising X-type sPLA ₂ Puropepu tide (EASM LRVHR RC: SEQ ID NO: 1 7) was synthesized and it to KLH The conjugate was used as an immunogen to immunize mice. The increase in the antibody titer was measured by the following ELISA method. 96 © el plate and catcher formic anti-mouse I _g G antibodies to the solid phase, after blocking nonspecific adsorption in block Kuesu (Dainippon Pharmaceutical), were captured antibody contained by reacting the mouse anti-plasma. After washing, a peptide containing the amino acid sequence at positions −11 to 10 in the amino acid sequence described in SEQ ID NO: 3 that had been biotinylated was reacted. After washing, the plate was further reacted with peroxidase-labeled streptavidin (Pierce), and finally the color was developed by adding the DAKO TMB One-Step Substrate System (DAKO). The color intensity was measured at a wavelength of 450 nm. .

Splenocytes were prepared from mice with the highest antibody titers, and cell fusion was performed with mouse myeloma cells in the presence of PEG1500. The produced antibody-producing hybridomas were detected by the ELISA method described above. The High Priestess de one Ma detected repeated black one nin grayed by limiting dilution, were established murine monoclonal antibody production High Priestess dormer strain HPX-6E1 reactive to X-type sPLA ₂ Purobe peptide. On April 17, 2001, the hybridoma was registered as FERMBP-7 5 4 7 (accession number) under the Patent Organism Depositary Center for Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology, Japan. 6) Has been commissioned.

HPX-6E1 results antibodies of the specificity was examined in ELISA method described above, the decrease in absorbance was not observed in the case where the active added including X-type _S PLA ₂ proteins, addition of X-type sPLA ₂ propeptide was only observed inhibition of binding when present antibody that has been shown to specifically recognize the X-type _S PLA ₂ propeptide (Figure 5). Example 2 2 proform, purification of active human type X sPLA ₉

After mass cultivation of established active type X sPLA ₂ specific monoclonal antibodies 3C10 producing High Priestess dormer as described above, it was implanted in nude mice intraperitoneally, to prepare ascites. The obtained ascites was added to a HiTrap Protein G column (Amercham Pharmacia), washed and eluted with 10 mM citrate buffer (pH 3.0) to obtain a purified antibody fraction.

The X-type sPLA ₂ propenyl peptide-specific monoclonal antibody HPX-6E1, performs mass culture in a serum-free medium, were added directly to the culture supernatant to HiTrap Protein G column, the purified antibodies by elution under the above conditions Obtained.

 For each of the obtained purified antibodies, use HiTrap NHS-Activated (Amersham

Pharmacia), and 3C10 antibody cross-linking column and HF-6E1 antibody cross-linking column were prepared.

Using these 3C 10 antibody column and HPX-6E1 antibody column, the active type X sPLA ₂ and pro-X-type sPLA ₂ was isolated. Invention Example 4 CHO cells expressing recombinant type X sPLA ₂ protein according to added pressure to the 3C10 antibody column or HPX-6E1 antibody column, washed, 0.1 M phosphate buffer containing 0.3 M NaCl (pH 12) Eluted. The eluted fraction was analyzed by SDS-PAGE. As a result, the active form was recovered in the 3C10 antibody column-adsorbed fraction and the pro-type was recovered in the HPX-6E1 antibody column-adsorbed fraction.

A small amount of pro-form was contaminated in the fraction adsorbed on the 3C10 antibody column, and a small amount of active protein was contaminated in the fraction adsorbed on the HPX-6E1 antibody column. % And 8.7%. Example 23 Establishment of an ELISA system specific for activated X-type sPLA ^

The IgG fraction manufactured from anti X-type _S PLA ₂ antibodies of the present invention described in Example 3 and solid phase 96 Uerupure Ichito, after Proc nonspecific adsorption in Block Ace (Dainippon Pharmaceutical), the antibody titer ram using reacting a solvent solution containing the active X-type sPLA ₂ or proform X type sPLA ₂ purification were captured X-type SPLA2 contained in the solution. After washing, a biotinylated 3C10 antibody was reacted. After washing, the plate was further reacted with peroxidase-labeled streptavidin (Pierce), and finally, a color was developed by adding a DAKO TMB One-Step Substrate System (DAKO), and the color intensity was measured at a wavelength of 450 nm.

As a result, strong color development was observed in the case of using the active type X s PL A ₂ as a specimen, resulting absorbance is proportional to the active type X sPLA ₂ concentration. However, when using the pro-X-type sPLA _2, the reaction of obtaining the active X-type s PL A ₂ than in cases where the antigen is weak, which is detected as about 5% crossreactivity but since the observed slightly mixed activated the pro-type fraction as described above (8.7%), specificity for active X-type PLA ₂ of the ELISA system can be determined as very high (Figure 6 ). Establishment of Example 2 4 proform sPLA _¾ specific ELISA system

HPX-6E 1 Purified antibody was solid phase 96 Uerupure Bok, after blocking nonspecific adsorption in Block Ace (Dainippon Pharmaceutical), as a specimen, active X-type _S PLA ₂ or proform X type different concentrations reacting the solution containing the sPLA _2, it was captured sPLA ₂ contained in the solution. After washing, it was reacted with anti-X type sPLA ₂ antibody IgG fraction Piochin of. After washing, the plate was further reacted with peroxidase-labeled streptavidin (Pierce), and finally, a color was developed by adding a DAKO TMB One-Step Substrate System (DAKO), and the color intensity was measured at a wavelength of 450 nm.

As a result, strong color development was observed in the case of using the proform X type sPLA ₂ as a specimen, resulting absorbance is proform: proportional to the X-type sPLA ₂ concentration. In the case of using the active type X sPLA ₂ is reactive obtained compared with the case where the proform type X sPLA ₂ and拭原is weak, but was detected as about 4% crossreactivity, active Slightly professional mix in the mold fraction Standing is observed (4.0%), it present ELISA system proform: JP isomeric for X-type sPLA ₂ can be determined very髙doctor (Figure 7). Example 2 5 Examination of detection of type X sPLA _{9 in} serum

Activated using a monoclonal antibody and pro forms: X-type sPLA ₂ specific ELISA system and, using a mold nonspecific X type sPLA ₂ measurement system using a polyclonal antibody, a normal person serum and colon cancer patient sera the X-type sPLA ₂ concentration was determined.

X-type sPLA ₂ concentration of colorectal cancer patients serum six of when the one of the average value of the X-type sPLA ₂ concentration of normal subjects Serum 5 example is as shown in FIG. 8, active X-type _S PLA ₂ specific The quantitative measurement system was able to detect samples with high levels in colorectal cancer patients. And pairs to this, in a proform type X sPLA ₂ specific assay system及Pi-type non-specific measurement system could not detect a sample value definitive in patients. The grades, active X-type sPLA ₂ specific measurement system using the created made the active type X sPLA ₂ specific antibodies in the present invention have shown the potential to be clinically useful in the diagnosis of colorectal cancer ( (Figure 8). Industrial applicability

According to the present invention, X-type part of sPLA ₂ antibodies specifically recognizing; method of measuring the active type X sPLA ₂ with said antibody; such as diagnostic kits comprising the antibody is provided.

By using the measurement method of the present invention, along with specific becomes possible diseases X type sPLA ₂ is involved specifically, certain diseases caused by type X sPLA _2, in particular colon cancer, lung cancer, liver cancer, stomach cancer, A kit for diagnosing kidney cancer, gallbladder cancer, prostate cancer, kidney cancer, testicular cancer, ovarian cancer, skin cancer, Al-Hachi-Ima-ichi disease, and cirrhosis is provided.

Claims

 The scope of the claims

I. An antibody that specifically recognizes a part of a polypeptide consisting of an amino acid from Glu at position 11 to Asp at position 23 in the amino acid sequence of SEQ ID NO: 3.

 2. The antibody according to claim 1, which specifically recognizes a polypeptide comprising an amino acid from Glu at position 11 to Arg at position 11 in the amino acid sequence of SEQ ID NO: 3.

 3. The antibody according to claim 1, which specifically recognizes a polypeptide comprising an amino acid from Gly at position 1 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3.

 4. The antibody according to any one of claims 1 to 3, wherein the antibody is a polyclonal antibody. '

 5. The antibody according to any one of claims 1 to 3, wherein the antibody is a monoclonal antibody.

 6. The monoclonal antibody according to claim 3, which is produced by a hybridoma having an accession number of FEHMBP-73993.

7. Treatment for PLA ₂ related diseases comprising the antibody of claim 3 or 6.

8. A polypeptide consisting of an amino acid from Glu at position 11 to Arg at position 11 in the amino acid sequence of SEQ ID NO: 3.

 9. A polypeptide comprising an amino acid from Gly at position 1 to Asp at position 123 in the amino acid sequence of SEQ ID NO: 3.

 10. A standard antigen comprising the polypeptide according to claim 8 or 9.

 I I. The method for measuring a polypeptide according to claim 8 or 9, wherein the antibody according to any one of claims 1 to 6 is used.

 12. The method according to claim 11, wherein active X-type sPL is measured.

 13. The kit for measuring a polypeptide according to claim 8 or 9, comprising the antibody according to any one of claims 1 to 6.

1. Measurement key according to claim 1, wherein measuring the active X-type sPLA ₂ ヅ

 15. A cancer diagnostic kit comprising a reagent capable of detecting the polypeptide according to claim 8 or 9.

 16. The kit for cancer diagnosis according to claim 15, wherein the reagent is the antibody according to any one of claims 1 to 6.

 17.The cancer according to claim 15 or 16, wherein the cancer is colon cancer, lung cancer, liver cancer, stomach cancer, kidney cancer, gallbladder cancer, prostate cancer, Tengler cancer, testis cancer, ovarian cancer or skin cancer. Diagnostic kit.

 18. A kit for diagnosing Alzheimer's disease, comprising a reagent capable of detecting the polypeptide according to claim 8 or 9.

 19. The kit for diagnosing Alheimer's disease according to claim 18, wherein the reagent is the antibody according to any one of claims 1 to 6.

 20. A kit for diagnosing cirrhosis, comprising a reagent capable of detecting the polypeptide according to claim 8 or 9.

 21. The kit for cirrhosis diagnosis according to claim 20, wherein the reagent is the antibody according to any one of claims 1 to 6.

 22. A screening method for cancer, Alheimer's disease or cirrhosis, characterized by detecting the polypeptide according to claim 8 or 9.

 23. The screening method according to claim 22, wherein the cancer is colon cancer, lung cancer, liver cancer, stomach cancer, kidney cancer, gallbladder cancer, prostate cancer, kidney cancer, testicular cancer, ovarian cancer, or skin cancer.