WO2001087976A2 - Gpcr 4-helix and 5-helix bundles - Google Patents

Gpcr 4-helix and 5-helix bundles Download PDF

Info

Publication number
WO2001087976A2
WO2001087976A2 PCT/US2001/015262 US0115262W WO0187976A2 WO 2001087976 A2 WO2001087976 A2 WO 2001087976A2 US 0115262 W US0115262 W US 0115262W WO 0187976 A2 WO0187976 A2 WO 0187976A2
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
gpcr
transmembrane
receptor
ofthe
Prior art date
Application number
PCT/US2001/015262
Other languages
French (fr)
Other versions
WO2001087976A3 (en
Inventor
Barry A. Springer
Michael W. Pantoliano
Dionisios Rentzeperis
Original Assignee
3-Dimensional Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 3-Dimensional Pharmaceuticals, Inc. filed Critical 3-Dimensional Pharmaceuticals, Inc.
Priority to AU2001259743A priority Critical patent/AU2001259743A1/en
Publication of WO2001087976A2 publication Critical patent/WO2001087976A2/en
Publication of WO2001087976A3 publication Critical patent/WO2001087976A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression

Definitions

  • This invention relates to protein-based ligand receptor molecules.
  • this invention relates to novel derivatives of seven transmembrane (TM) helix G-protein coupled receptors.
  • G-protein coupled receptors are members of a super-family of proteins that are responsible for transducing signals across a cell membrane so as to initiate a second messenger response. All G-protein coupled receptors have been characterized as having seven membrane- spanning domains (conserved hydrophobic stretches of about 20 to 30 amino acids which have been postulated to be transmembrane ⁇ -helices) connected by hydrophilic extracellular and intracellular loops (also referred to herein as "connector polypeptides"), an extracellular amino terminus, and a cytoplasmic carboxyl terminus.
  • connector polypeptides also referred to herein as "connector polypeptides”
  • G- protein coupled receptors bind a variety of ligands ranging from small biogenic amines to peptides, small proteins and large glycoproteins (C. D. Strader et al, (1994) Ann. Rev. Biochem. 63: 101-132).
  • the G-protein superfamily of coupled receptors are sensitive to a wide variety of hormonal, viral, neurochemical, metabolic, and regulatory stimuli, and includes, but is not limited to, adrenergic, muscarinic, cholinergic, dopaminergic, serotonergic, andhistaminergic receptors, numerous peptide receptors, including glucagon, somatostatin, and vasopressin receptors, as well as sensory receptors for vision (rhodopsin), taste, and olfaction.
  • cytomegalovirus receptors examples include dopamine, calcitonin, endothelin, cAMP, adenosine, acetylcholine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, and cytomegalovirus receptors.
  • the GPCR protein superfamily now contains over 250 types of paralogues, receptors that represent variants generated by gene duplications (or other processes), as opposed to orthologues, the same receptor from different species.
  • the superfamily can be broken down into five families: Family I, receptors typified by rhodopsin and the ⁇ 2 -adrenergic receptor and currently represented by over 200 unique members (reviewed by Dohlman et al. (1991) Annu. Rev. Biochem. 60:653-688 and references therein); Family II, the parathyroid hormone/calcitonin/secretin receptor family (Juppner et al.
  • adrenergic receptors are a pharmaceutically prominent subfamily due to the many related illnesses associated with defective adrenergic receptor mechanisms.
  • adrenergic receptors bind the same endogenous catecholamines (epinephrine and norepinephrine) their physiological as well as pharmacological specificity is markedly diverse. This diversity is due primarily to the existence of at least nine different proteins encoding distinct adrenergic receptors types ( ⁇ ,, ⁇ 2 , and ⁇ ⁇ 2 , ⁇ 3 ). While all the receptors ofthe adrenergic type are recognized by epinephrine, they are pharmacologically distinct and are encoded by separate genes.
  • receptors are generally coupled to different second messenger pathways that are linlced through G-proteins.
  • ⁇ , and ⁇ 2 receptors activate the adenylate cyclase
  • ⁇ 2 receptors inhibit adenylate cyclase
  • receptors activate phospholipase C pathways, stimulating breakdown of polyphosphoinositides (Chung, F. Z. etal, J. Biol. Chem. 263:4052 (1988)).
  • Adrenergic receptors were initially classified as either ⁇ or ⁇ by
  • Ahlquist who demonstrated that the order of potency for a series of agonists to evoke a physiological response was distinctly different at the 2 receptor subtypes (Ahlquist, 1948).
  • ⁇ - Adrenergic receptors were first classified based on their anatomical location, as either pre or post-synaptic ( ⁇ 2 and ⁇ ,, respectively) (Langer et al, 1974). This classification scheme was confounded, however, by the presence of ⁇ 2 receptors in distinctly non-synaptic locations, such as platelets (Berthelsen and Pettinger, 1977).
  • ⁇ adrenergic receptors were shown to control vasoconstriction, pupil dilation and uterine inhibition, while ⁇ adrenergic receptors were implicated in vasorelaxation, myocardial stimulation and bronchodilation (Regan et al, 1990).
  • ⁇ adrenergic receptors were implicated in vasorelaxation, myocardial stimulation and bronchodilation (Regan et al, 1990).
  • ⁇ adrenergic receptor subtypes ⁇ adrenergic receptors in the heart were defined as ⁇ b while those in the lung and vasculature were termed ⁇ 2 (Lands et al, 1967).
  • ⁇ ,-ARs The molecular cloning of three genes encoding ⁇ ,-ARs supports the existence of pharmacologically and anatomically distinct ⁇ r receptor subtypes.
  • ⁇ adrenergic receptors could be distinguished pharmacologically based on their affinities for the antagonists prazosin or yohimbine (Stark, 1981). Definitive evidence for adrenergic receptor subtypes, however, awaited purification and molecular cloning of adrenergic receptor subtypes.
  • Drosophila express a photoreceptor-specific protein bride of sevenless (boss), a seven-transmembrane-segment protein which has been extensively studied and does not show evidence of being a GPCR (Hart el al. (1993) Proc. Natl. Acad. Sci. USA 0.5O47-5O51 (1993)).
  • the gene frizzled (fz) in Drosophila is also thought to be a protein with seven transmembrane segments. Like boss, fz has not been shown to couple to G-proteins (Vinson et al. (1989) Nature 338:263-264).
  • GPCRs plasma membrane receptors
  • G-proteins guanine nucleotide exchange proteins
  • various cellular effectors intracellular enzymes and channels which are modulated by G-proteins
  • second messengers include: the GPCRs, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al, Proc. Natl Acad.
  • G-proteins themselves include effector proteins, such as phospholipase C, adenylyl cyclase, andphosphodiesterase; actuator proteins, such as protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8), and second messengers such as cAMP (Lefkowitz, Nature, 1991, 351:353-354).
  • effector proteins such as phospholipase C, adenylyl cyclase, andphosphodiesterase
  • actuator proteins such as protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8), and second messengers such as cAMP (Lefkowitz, Nature, 1991, 351:353-354).
  • GPCRs are major targets for new drug discovery a d development. Over 50% of commercially available drugs interact with a GPCR (Gudermann, et al, J. Mol. Med. 73:51-63 (1995)). Thus far, more than 250 GPCRs have been identified, and the functions of about 100 are known. It is estimated that 2000-5000 GPCRs may exist in the human genome (Marchese, et al, TIPS 20:370-375 (1999)). This indicates that these receptors have an established, proven history as therapeutic targets.
  • the GPCR superfamily of proteins are characterized as having seven transmembrane domains.
  • the domains are believed to represent transmembrane ⁇ -helices connected by hydrophilic extracellular or cytoplasmic loops, the whole protein terminated by hydrophilic amino and carboxyl-terminal tails.
  • the 7 transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7.
  • Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops which are believed to form disulfide bonds that stabilize a functional protein structure. Phosphorylation and lipidation (palmitation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs.
  • GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxyl terminus.
  • GPCRs such as the ⁇ -adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
  • the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic pockets formed by several G- protein coupled receptor transmembrane domains, said pockets being surrounded by hydrophobic residues ofthe G-protein coupled receptors.
  • the hydrophilic side of each G-protein coupled receptor transmembrane helix is postulated to face inward and form a polar ligand binding site.
  • TM3 has been implicated in several G -protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue.
  • TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.
  • novel agonists and antagonists for GPCRs would also be greatly facilitated by an improved means of determining the three dimensional (3-D) structure ofthe ligand binding site ofthe receptor.
  • novel ligands may be created tlirough rational drug design processes.
  • high quality crystals of 7TM GPCRs i.e., 7TMHRs
  • 7TMHRs high quality crystals of 7TM GPCRs
  • a protein containing a minimal binding site with similar specificity for ligands to that ofthe native GPCR would be easier to crystallize, and would therefore enable rapid analysis ofthe 3-D structure ofthe ligand binding site for rational design purposes.
  • This invention relates to newly identified polypeptides, polynucleotides encoding such polypeptides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides ofthe present invention are novel 4-helix or 5-helix derivatives of 7-transmembrane G-protein coupled receptors (4- or 5- transmembrane helix receptor polypeptides, or 4TMHRs or 5TMHRs).
  • novel polypeptides which are functional 4-transmembrane helix receptor polypeptides.
  • functional is meant that a polypeptide is able to bind to the same ligands as does the wild-type 7-transmembrane version (7TMHR) of the polypeptide.
  • the 4TMHR derivative binds to ligands with the same hierarchy of affinities as does the wild-type 7TMHR.
  • such 4TMHRs also bind to ligands with the same relative affinities as exhibited by a wild-type 7-transmembrane version of the polypeptide.
  • the 4TMHR exhibits KJ s for ligands within two orders of magnitude ofthe KJ s obtained with the wild-type 7TMHR.
  • Such functional 4TMHRs need not be able to transduce signal across cell membranes, i.e., they need not be "biologically active.”
  • 4TMHRs include transmembrane helices 3, 4, 5, and 6 (TM3, TM4, TM5, and TM6) of a 7TMHR.
  • a4TMHR may contain TM3, TM5, TM6, and TM7 of a 7TMHR.
  • 5TMHRs include TM3 , TM4, TM5, TM6, and TM7 of a 7TMHR.
  • Such functional 5TMHRs need not be biologically active.
  • such 5TMHRs may contain all or a portion ofthe C-terminus of a GPCR.
  • the 5TMHRs containing a C-terminus are "biologically active," i.e., able to transduce signal across a cell membrane so as to initiate a second messenger response.
  • the 5TMHR derivative binds to ligands with the same hierarchy of affinities as does the wild-type 7TMHR.
  • such 5TMHRs also bind to ligands with the same relative affinities as exhibited by a wild-type 7-transmembrane version ofthe polypeptide. More preferably, the 5TMHR exhibits KJs for ligands within two orders of magnitude ofthe KJs obtained with the wild-type 7TMHR.
  • nucleic acid molecules encoding 4- or 5 -transmembrane helix receptor polypeptides, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
  • a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a 4- or 5 -transmembrane helix receptor polypeptide nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • a method for treating an illness caused by faulty expression (e.g., overexpression or underexpression) of a GPCR includes administering to a patient suffering from an illness caused by underexpression of a GPCR a polynucleotide encoding a biologically active GPCR (e.g., a 5TMHR containing a C-terminal domain), and allowing expression of the polynucleotide to produce the polypeptide on cell membranes ofthe patient.
  • a biologically active GPCR e.g., a 5TMHR containing a C-terminal domain
  • a patient suffering from a illness caused by overexpression of a GPCR can be treated with a functional, but biologically inactive, 4TMHR or 5TMHR by administering a polynucleotide encoding such a polypeptide, or by administering such a polypeptide, to the patient.
  • a soluble, biologically active 5TMHR polypeptide can be administered to the patient (without expression of the 5TMHR on cell membranes) to block activity of an endogenous GPCR.
  • non-naturally occurring synthetic, isolated and/or recombinant 4TMHRs and 5TMHRs which are fragments, consensus fragments and/or sequences having conservative amino acid substitutions such that 4TMHRs or 5TMHRs of the present invention may bind G-protein coupled receptor ligands, or which may also modulate, quantitatively or qualitatively, G-protein coupled receptor ligand binding.
  • G-protein coupled receptor polypeptides conservative substitution and derivatives thereof, antibodies, anti-idiotype antibodies, compositions and methods that can be useful as potential modulators of G-protein coupled receptor function, by binding to ligands or modulating ligand binding, due to their expected biological properties, which may be used in diagnostic, therapeutic and/or research applications.
  • the present invention also provides synthetic or recombinant 4- transmembrane helix receptor polypeptides or 5 -transmembrane helix receptor polypeptides which are designed to inhibit or mimic various G-protein coupled receptors or fragments thereof.
  • diagnostic probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the G-protein coupled receptor nucleic acid sequences.
  • a diagnostic assay for detecting a disease or susceptibility to a disease related to a mutation in a G-protein coupled receptor nucleic acid sequence.
  • a 4-transmembrane helix receptor polypeptide having a ligand binding site essentially identical with the ligand binding site of a 7TMHR suitable for use in determining the three dimensional structure ofthe ligand binding site ofthe 7TMHR by X-ray crystallographic analysis, and means for using such a 4- transmembrane helix receptor polypeptide in the design of novel agonists and antagonists for the 7TMHR.
  • a 5 -transmembrane helix receptor polypeptide having a ligand binding site essentially identical to the ligand binding site of a 7TMHR.
  • Such 4TMHRs and 5TMHRs can be used in molecular replacement methods and in structure-based drug design methods.
  • FIG. 1 A is a schematic representation of the wild-type ⁇ 2 adrenergic receptor (B 2 AR).
  • B 2 AR wild-type ⁇ 2 adrenergic receptor
  • the seven transmembrane helices are shown as rectangles, labeled TM1-TM7. Regions of the sequence that are incorporated into an exemplary ⁇ 2 AR-4THMR construct are shown with thick lines (Met 1- Val 24 and Thr 100-Glu 306). Regions that are not included in ⁇ 2 AR-4THMR are shown with thin lines.
  • FIG. IB is a schematic representation of an exemplary ⁇ 2 AR- 4TMHR. The N-terminal residue (Met 1) and the C-terminal residue (Glu 231) are indicated.
  • FIG. 2A is a schematic representation of the wild-type ⁇ 2 adrenergic receptor (B 2 AR).
  • B 2 AR wild-type ⁇ 2 adrenergic receptor
  • the seven transmembrane helices are shown as rectangles, labeled TM1-TM7. Regions of the sequence that are incorporated into an exemplary ⁇ 2 AR-5THMR construct are shown with thick lines (Met 1 - Leu 413).
  • FIG. 2B is a schematic representation of an exemplary ⁇ 2 AR-5TMHR.
  • the N-terminal residue (Met 1) and the C-terminal residue" (Leu 413) are indicated.
  • the shaded box at the C-terminus represents the position at which peptide "tags" (e.g., His 6 , flag, or Arg 6 ) can be added to facilitate purification using affinity resins, or to facilitate detection (e.g., with antibodies and Western blotting).
  • FIGS. 3 A and 3B are a listing ofthe nucleotide and amino acid sequence of an exemplary ⁇ 2 AR-4TMHR. The numbers identify the linear amino acid sequence from the N- to C-termini. Amino acids 1 to 24 are identical to wild- type ⁇ 2 AR. Amino acids 25 to 231 of 4TMHR correspond to amino acids 100- 306 of wild-type ⁇ 2 AR.
  • FIGS. 4A and 4B are a listing ofthe nucleotide and amino acid sequence of an exemplary ⁇ 2 AR-5TMHR. The numbers identify the linear amino acid sequence from the N- to C-termini. Amino acids 1 to 24 are identical to wild- type ⁇ 2 AR.
  • FIG. 5 is a histogram showing the relative expression levels of ⁇ 2 AR-
  • polynucleotide generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, including cDNA, genomic DNA, and synthetic DNA, or modified RNA or DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double- stranded RNA, and RNA that is mixture of single-and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • a 4TMHR of the invention is a polypeptide that consists essentially of four transmembrane helices of a 7TMHR and three connector polypeptides, with the three connector polypeptides linking the transmembrane helices in tandem.
  • Connector polypeptides are polypeptides that link transmembrane regions of a GPCR. Connector polypeptides may be located intracellularly or extracellulaiiy. Preferably, at least one of the connector polypeptides is hydrophilic; more preferably, all ofthe connector polypeptides are hydrophilic.
  • the lengths ofthe connector polypeptides may vary, and such polypeptides need only be long enough to permit re-insertion of the transmembrane region of the polypeptide into the membrane (preferably 10-200 amino acid residues, more preferably 10-100 amino acid residues).
  • the amino acid sequences of the connectors will typically, although not necessarily, correspond to the amino acid sequences of naturally-occurring connector polypeptides (i.e., intracellular or extracellular loops) of GPCRs. If desired, the connector polypeptides can be mutagenized to increase their hydrophilicity.
  • GPCRs can be used to make the 4TMHRs and 5TMHRs of the invention.
  • GPCRs can be categorized by the ligand to which they bind.
  • the polypeptides ofthe invention can include transmembrane domains ofthe families of GPCRs that bind to the following families of ligands:
  • Purines, nucleotides, and melatonin e.g., receptors for adenosine, cAMP, melatonin, ATP, UTP, ADP, and other NTPs;
  • Toxins e.g., latrotoxin
  • Lysophosphatidic acid Lysophosphatidic acid, platelet activating factor, leukotrienes, excitatory amino acids and ions, glutamate, calcium, and GAB A;
  • Biogenic amines and related natural ligands e.g., adrenaline, dopamine, histamine, acetylcholine, noradrenaline, octopamine/tyramine, serotonin (5-hydroxytryptamine), peptides, angiotensin, bradykinin, bombesin/neuromedin, C3a, C5a, calcitonin, calcitonin gene related peptide, chemokine, cholecystokinin, conopressin, corticotropin releasing factor (CRF), CD55 - decay accelerating factor (DAF), diuretic hormone receptors, endothelin, fMLP, FSH glycoprotein hormone, fungal mating pheremones, galanin, growth hormone releasing hormone (GHRH), growth hormone secretagogue (GHS), gastric inhibitory peptide, glucagon-like peptide, glucagon, gonadotrop
  • polypeptides of the invention include 4TMHRs and 5TMHRs of olfactory receptors.
  • the polypeptides ofthe invention are 4TMHRs or 5TMHRs of receptors that bind to biogenic amines.
  • Conventional hydropathy modeling methods can be used to identify hydrophobic regions of the polypeptides and thus predict the transmembrane domains, as well as the intracellular and extracellular domains. Suitable modeling programs can be found at http://www.expasy.ch/ and at http://www.expasy.ch cgi-bin siri-gpcr.pl.
  • An exemplary polynucleotide of the present invention encodes a polypeptide that is a 4TMHR, and is structurally related to the ⁇ 2 adrenergic receptor family.
  • the polynucleotide contains an open reading frame encoding a polypeptide of 207 amino acid residues, shown in FIGS. 3 A, and 3B as amino acidresidues 25-231 (corresponding to amino acids 100-306 of wild-type ⁇ 2 AR).
  • the polypeptide may include all or a portion of anon-transmembrane polypeptide, such as the extracellular N-terminus ofthe ⁇ 2 adrenergic receptor, e.g., amino acid residues 1-24 (corresponding to amino acids 1-24 of wild-type ⁇ 2 AR), as illustrated in FIGS. 3A and 3B as SEQ ID NOs: 1 and 2.
  • the polypeptide may include an N-terminal or C-terminal "tag" such as His or flag.
  • An exemplary polynucleotide encoding a 5TMHR polypeptide of the invention contains an open reading frame encoding a polypeptide corresponding to amino acid residues 100 to 413 of wild-type ⁇ 2 AR, as shown in FIGS. 4A and 4B as SEQ ID NOs: 3 and 4.
  • Such a polypeptide can be made biologically active by covalently linking it to all or a portion of the intracellular C-terminus of a GPCR.
  • the portion ofthe C-terminus does not include amino acid residues 355-413 of wild-type ⁇ 2 AR, thus removing two Cysteine residues normally located in this region, as these Cysteine residues can inhibit protein refolding.
  • the polypeptide may include all or a portion of a non- transmembrane polypeptide, such as the extracellular N-terminus of the ⁇ 2 adrenergic receptor, e.g., amino acidresidues 1-24 (corresponding to amino acids 1-24 of wild-type ⁇ 2 AR), as illustrated in FIGS. 4A and 4B as SEQ ID NOs.: 3 and 4.
  • the polypeptide may include an N-terminal or C-terminal "tag" such as His or flag.
  • Another preferred polynucleotide ofthe invention encodes a 4TMHR or
  • Angiotensin II is an octapeptide (D-R-V-Y-V-H-P-F (SEQ ID NO: 5)) that mediates blood pressure and water-electrolyte homeostasis via interactions with type I and type II angiotensin receptors - both of which are GPCRs.
  • GPCRs GPCRs
  • Unregulated, elevated levels of angiotensin II can result in hypertension, coronary ischemia, congestive heart failure, and renal insufficiency.
  • the receptors for angiotensin are targets for drug discovery and intervention.
  • Angiotensin II interacts with its cognate GPCR through specific interactions with residues found on extracellular loops and residues found in transmembrane TM helices three through seven.
  • the sequence for the type 1 and type 2 angiotensin receptors is available tlirough GenBank at accession numbers Z11162, M93394 and X65699, respectively.
  • the third TM domain begins at about amino acid number 103
  • the sixth TM domain ends at about amino acid number 266.
  • the seventh TM ends at about amino acid number 300 and the entire sequence ends at about amino acid number 363.
  • An exemplary 4TMHR variant of this GPCR can begin at amino acid number about 103 and end at amino acid 266 to encompass TM helices 3 through 6.
  • An exemplary 5TMHR variant of this GPCR can begin at about amino acid number 103 and end after the seventh TM, at about amino acid number 300.
  • a biologically active 5TMHR can begin at about amino acid number 103 and end at the end of the native sequence, at about amino acid number 363.
  • the polypeptides ofthe invention can include a predominantly hydrophilic sequence of amino acids at the N-terminus, which sequence is not expected to insert into the membrane.
  • this N-terminal sequence of amino acids can be (i) from the native GPCR, e.g., amino acids 1 through 27 of the angiotensin receptor; (ii) from another GPCR; or (iii) designed de novo.
  • the polypeptide can contain an additional sequence of amino acids to permit facile detection and/or purification, e.g., a stretch of 6 or more histidine residues.
  • the N-terminal sequence may contain a signal sequence that may be native to the receptor or from another protein known to use a signal sequence to direct an expressed protein to the plasma membrane of a typical eukaryotic cell for membrane insertion or secretion outside ofthe cell.
  • the signal sequence may be prokaryotic in origin to direct an expressed protein to the outer membrane of a typical prokaryotic cell.
  • An additional exemplary polynucleotide of the invention encodes a
  • Dopamine is a neurofransmitter found both in the Central Nervous system (CNS) and the periphery. In the CNS, dopamine interacts with a cognate GPCR to mediate a variety of biological functions including locomotor function, cardiovascular homeostasis, sexual function, endocrine regulation and cognition. Several disease states have been associated with defective dopamine neurotransmission, including schizophrenia, Parkinson's disease and various endocrine and cardiovascular abnormalities. As such, GPCRs for dopamine are targets for drug discovery. Examples of ligands that bind to the dopamine receptor include N-methylspiperone (NEN) and dopamine, and tritiated versions of these compounds can be used in ligand binding assays.
  • N-methylspiperone N-methylspiperone
  • dopamine tritiated versions of these compounds can be used in ligand binding assays.
  • At least 5 distinct receptor subtypes have been identified for dopamine.
  • the DNA sequences for the human dopamine receptors can be found in GenBank under the following accession numbers: X58987, X59308 and X55760 for Dl ; M30625 and X51362 for D2; L20469 for D3; X58497 for D4; and X58454 for D5. While there are a number of splice variants of the dopamine receptors, a person of ordinary skill in the art can readily account for such variations and utilize conventional hydropathy modeling programs to identify the transmembrane domains of any given dopamine receptor.
  • the third TM domain begins at about amino acid number 109 and the sixth TM domain ends at about amino acid number 397.
  • the seventh TM domain ends at about amino acid number 428, and the entire sequence ends at about amino acid number 443.
  • An exemplary 4TMHR derivative of this GPCR can begin at about amino acid number 109 and end at amino acid 397.
  • An exemplary 5TMHR derivative of this GPCR can begin at about amino acid number 109 and end after the seventh TM, at about amino acid number 428.
  • a biologically active 5TMHR can begin, for example at about amino acid number 109 and end at the end ofthe native sequence, at about amino acid number 443.
  • the 4TMHRs and 5TMHRs can include a predominantly hydrophilic sequence of amino acids at the N-terminus, which sequence is not expected to insert into the membrane.
  • This N-terminal sequence of amino acids can be (i) from the native GPCR, for example amino acids 1 through 24 of D2-443, (ii) from another GPCR, or (ii) designed de novo.
  • the polypeptides ofthe invention can contain an additional sequence(s) of amino acids to permit facile detection, purification, and/or secretion.
  • the polynucleotides that encode the polypeptides of the invention may include: only the coding sequence for the 4TMHR or 5TMHR polypeptide; the coding sequence for the 4TMHR or 5TMHR polypeptide and additional coding sequence; the coding sequence for the 4TMHR or 5TMHR polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns, or non-coding sequence located 5' and/or 3' of the coding sequence for the polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide, as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA.
  • the coding sequence which encodes the 4TMHR polypeptide may be identical to the coding sequence for a portion of a naturally- occurring GPCR (e.g., amino acids 25-231 shown in FIG. 2 or amino acids 1 -231 shown in FIG. 2).
  • the coding sequence may be a different coding sequence which, as a result ofthe redundancy or degeneracy ofthe genetic code, encodes the same polypeptide as the naturally-occurring DNA.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode fragments, analogs and derivatives (including semi-synthetic variants) of the polypeptides of the invention.
  • "Variant,” as the term is used herein is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, respectively, but retains essential properties.
  • a typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide.
  • Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
  • a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
  • a variant of a polynucleotide or polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally.
  • Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis.
  • the variant ofthe polynucleotide may be a naturally occurring allelic variant ofthe polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the variant retains the naturally-occurring Cysteine residues found in the transmembrane helices.
  • the present invention includes, for example, polynucleotides encoding amino acid residues 25-231 of the polypeptide shown in FIG. 2, or, optionally, amino acids 1-231 of the polypeptide shown in FIG. 2, as well as variants of such polynucleotides which variants encode a fragment, derivative or analog ofthe polypeptides of FIG. 2.
  • nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the sequence encoding a polypeptide ofthe invention.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function ofthe encoded polypeptide.
  • the polypeptide may be engineered to contain a site for palmitation to increase expression ofthe polypeptide or increase stability ofthe receptor through membrane anchoring.
  • residues Ala 335 through Leu 347 of the wild-type ⁇ 2 AR can be inserted between helices 5 and 6 in the 4TMHR or 5TMHR.
  • the inserted polypeptide contains determinants for palmitation at Cys 341.
  • a band on an SDS gel can be visualized by Ponceau staining, and the band containing 4TMHR can be analyzed for its lipid composition.
  • the palmitation sequence can be inserted elsewhere in the 4TMHR gene, e.g. , at the N-terminus, C-terminus, or between helices 3 and 4. If desired, additional residues can be added to the N-terminus or C-terminus to facilitate recognition ofthe sequence by the palmitation machinery.
  • SeMet selenomethionine residues
  • Labeling the polypeptide with SeMet permits the use of multiple anomalous dispersion phasing methods to be used in solving the crystal structure of the polypeptide (Hendrickson (1990) EMBOJ. 9: 1665-72).
  • SeMet labeling can be carried out by producing the protein in E. coli, e.g., in the methionine auxotroph strain B834(D ⁇ 3) (Novagen), using conventional methods for SeMet substitution.
  • the polynucleotides may also encode a non-glycosylated polypeptide to facilitate the growth of crystals for X-ray diffraction.
  • the polynucleotide can be mutated to encode Glutamine residues in lieu of Asparagine residues, particularly at amino acid residues Asn 6 and/or Asn 15 of ⁇ 2 AR.
  • polynucleotides that can be used in the invention include variants of the 4TMHRs and 5TMHRs of ⁇ 2 AR that increase the affinity of ⁇ 2 AR for ligands.
  • Asparagine or Glutamine residues can be substituted for Isoleucine 111, Val 114, He 291, and/or Val 292.
  • Threonine 123 and/or Leucine 124 can be replaced with Aspartate or Glutamate.
  • the polynucleotides ofthe present invention may also have the coding sequence fused in frame to a marker sequence which allows for detection of purification of the polypeptide of the present invention.
  • the marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for purification ofthe mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g., COS-7 cells, is used.
  • the HA tag corresponds to an epitope, or another tag, derived from the influenza hemagglutinin protein (Wilson, I., et al, Cell 37:767 (1984)).
  • the term "gene” means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). It may further include regulatory elements, such as promoters, enhancers, operators, and repressors, as are well known in the art, useful in promoting, regulating, and repressing expression ofthe gene.
  • Fragments ofthe polynucleotides ofthe present invention may be used as hybridization probes for a cDNA library to isolate the full length cDNA and to isolate other cDNAs which have a high sequence similarity to the polynucleotides or similar function to the encoded polypeptides.
  • Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases.
  • the probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promoter regions, exons, and introns.
  • An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe.
  • Labeled oligonucleotides having a sequence complementary to that ofthe gene ofthe present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members ofthe library the probe hybridizes to.
  • Identity is a measure ofthe identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. “Identity” per se has an art-recognized meaning and can be calculated using published techniques. See, e.g.
  • identity is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codifiedin computer programs.
  • Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al, Nucleic Acids Research (1984) 12(1):387), BLASTP, BLASTN. FASTA (Altschul, S.F. et al, JMolec Biol (1990) 215:403).
  • nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence is intended that the nucleotide sequence ofthe polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence.
  • nucleotide having a nucleotide sequence at least 95%) identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% ofthe total nucleotides in the reference sequence may be inserted into the reference sequence.
  • mutations ofthe reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • a polypeptide having an amino acid sequence having at least, for example, 95% "identity" to a reference amino acid sequence is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids ofthe reference amino acid.
  • the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids ofthe reference amino acid.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% ofthe total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • These alterations of the reference sequence may occur at the amino or carboxyl terminal positions ofthe reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • the present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 25%, e.g., at least 50 % or 70% identity, preferably at least 90%), and more preferably at least 95% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove- described polynucleotides.
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • the polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same function or biological activity as the 4TMHRs and 5TMHRs ofthe invention.
  • the polynucleotide may have at least 20 bases, preferably
  • polynucleotide of the present invention 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity.
  • polynucleotides may be employed as probes for the polynucleotides described herein, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
  • the present invention is directed to polynucleotides having at least
  • identity e.g., at least 50% or 70% identity, preferably at least 90% identity and more preferably at least a 95% identity to a polynucleotide which encodes a 4TMHR or 5TMHR, e.g., the polypeptide of SEQ ID NO: 2 (which can be encoded by the polynucleotide of SEQ ID NO: 1), as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases, and to polypeptides encoded by such polynucleotides.
  • the present invention further relates to a 4TMHR polypeptide which has the amino acid sequence of amino acidresidues 25-231, or, optionally, 1-231 of FIG. 2, as well as fragments, analogs and derivatives of such polypeptides.
  • Polypeptide refers to any peptide or protein comprising two or more amino acids j oined to each other by peptide bonds or modified peptide bonds, i. e. , peptide isosteres.
  • Polypeptide refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene- encoded amino acids.
  • Polypeptides include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from posttranslational natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • fragment when referring to the polypeptides of the invention mean a polypeptide which either retains substantially the same function as a reference polypeptide, e.g. , retains the ability to bind a ligand for the receptor, or which retains a biological activity of the reference polypeptide, e.g., retains the ability to transduce signal across cell membranes.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, or a semi-synthetic polypeptide, preferably a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide of the invention may be (i) one in which one or more ofthe amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more ofthe amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which additional amino acids are fused to the polypeptide which are employed for purification of the polypeptide, or (v) one which contains a proprotein sequence, or (vi) one in which a signal sequence is fused to the polypeptide, or (vii) one in which a fragment of the polypeptide is soluble, i.e., not membrane bound, yet still binds ligands
  • polypeptides ofthe present invention include amino acids 25-231 or
  • polypeptides which have at least 25% similarity (preferably at least 15% identity), e.g., 50% or 70% similarity (preferably at least 50 or 70%> identity) and more preferably at least 90%> similarity (more preferably at least 90%> identity) to such polypeptides, and still more preferably at least 95 > similarity (still more preferably at least 95% identity) to such polypeptides. Also included are portions of such polypeptides with such portions ofthe polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
  • Receptor Activity or "Biological Activity ofthe Receptor” refers to the ability of a receptor or 5TMHRto transduce signal across a cell membrane so as to initiate a second messenger response. Included are similar activities or improved activities or these activities with decreased undesirable side-effects.
  • the polypeptides of the invention may also have antigenic, i.e., immunogenic activity.
  • Fragments or portions ofthe polypeptides ofthe present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides ofthe present invention.
  • Preferred fragments ofthe polypeptide of the present invention or fragments of the nucleotide sequence coding therefore, include, for example, truncation polypeptides having the amino acid sequence of 4TMHR polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus.
  • fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta- sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions.
  • Other preferred fragments are biologically active fragments, such as biologically active fragments of 5TMHRs.
  • Biologically active fragments are those that transduce signal across cell membranes, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.
  • the present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs ofthe present invention.
  • Host cells are genetically engineered (transduced or transformed or fransfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art, such as Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)(the disclosure of which is hereby incorporated by reference).
  • the DNA sequence in the expression vector is operatively linlced to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoters there may be mentioned: LTR or SN40 promoter, the E. coli. lac or trp, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate D ⁇ A sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al, BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • bacterial cells such as Streptococci, Staphylococci, E.
  • coli Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Aspergillus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 or S£21 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells.
  • chromosomal, episomal and virus-derived systems e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses
  • vectors derived from combinations thereof such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • the expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used.
  • the appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL (supra).
  • the present invention also includes recombinant constructs comprising one or more ofthe sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence ofthe invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDlO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT
  • bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and trp.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DE AE-Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, L, Basic Methods in Molecular Biology, (1986)).
  • the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides ofthe invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs ofthe present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side ofthe replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side ofthe replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation ofthe host cell, e.g. , the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences, and, preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein, such as a protein that includes an identification peptide (e.g., a hexahistidine tag) imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • an identification peptide e.g., a hexahistidine tag
  • desired characteristics e.g., stabilization or simplified purification of expressed recombinant product.
  • the 4TMHR or 5TMHR is fused to a globular, soluble polypeptide.
  • the polypeptide can be fused to the GPCR's natural cytoplasmic ligand, e.g., G s ⁇ , or to a portion of an antibody, e.g., F v .
  • a fusion protein containing a 4TMHR or 5TMHR fused to a G s ⁇ would increase the amount of hydrophilic surface area on the polypeptide, facilitating crystallization of the polypeptide.
  • the polypeptide can be fused to an Arc repressor (e.g., using the plasmid pSA700). Soluble fusion proteins containing the Arc polypeptide then can be selected for by using conventional methods.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance ofthe vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements ofthe well known cloning vector pBR322 (ATCC 37017).
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and G ⁇ M1 (Promega Biotech, Madison, Wis., USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • the polypeptides ofthe invention may be solublized from plasma membranes in digitonin using conventional techniques.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa, HEK and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non- transcribed genetic elements.
  • polypeptides of the invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, metal affinity chromatogaphy (e.g., Ni-NTA), and lectin chromatography.
  • high performance liquid chromatography HPLC
  • Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. For example, protein refolding can be carried out in the presence of protein disulfide isomerase (PDI).
  • PDI protein disulfide isomerase
  • Refolding can also be carried out in the presence of a high affinity ligand, e.g., alprenolol (e.g., at 1 ⁇ M).
  • a high affinity ligand e.g., alprenolol (e.g., at 1 ⁇ M).
  • the alprenolol can subsequently be removed by dialysis.
  • hydrostatic pressure can be used as a mild denaturant to facilitate protein refolding.
  • refolding can be carried out by incubating the polypeptide in 3M urea at 2.5 lcbar, then slowly releasing pressure.
  • alprenolol affinity chromatography can be used, typically as a final purification step.
  • purification of ⁇ 2 AR can be carried out as follows: inactive ⁇ 2 AR is purified from E. coli inclusion bodies by Ni-NTA affinity chromatography, then bound to heparin-sepharose resin via an Arg 6 tail in a buffer containing GuCl. The concentration of GuCl is lowered from 6 to 0M in the presence of PDI and a mixture of reduced and oxidized glutathione. Thus, the efficiency of protein refolding was greater in the presence of PDI than in the absence of PDI. The efficiency of refolding of ⁇ 2 AR could be further increased by deleting residues 355-413 to delete two Cysteine residues.
  • polypeptides of the present invention may be naturally purified products, or products of chemical synthetic procedures (including, for example, complete synthesis as polypeptides), or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides ofthe present invention may be glycosylated or may be non-glycosylated. Polypeptides ofthe invention may also include an initial methionine amino acid residue.
  • polypeptides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease.
  • the polypeptides can be used in structure-based drug design methods. Conventional methods can be used to crystallize the polypeptides ofthe invention and to solve their crystal structures. Suitable techniques are described in Methods in ⁇ nzymology, vol. 276, Macromolecular Crystallography part A ( 1997), Academic Press, eds. Charles W. Carter, Jr. and Robert M. Sweet.
  • the polypeptides can be crystallized in lipid cubic phases formed by mixing lipids such as monoolein with aqueous buffer containing detergents and protein, then centrifuging the mixtures (e.g., for 2 hours at 10,000 rpm).
  • Crystals of the 4TMHRs and 5TMHRs of the invention can be used in conventional molecular replacement methods to solve the structures of wild-type 7TMHRs (see, e.g., Hoppe, Acta Crystal 10:750-751 (1957) and Rossman and Blow, ActaCrystal 15:24-31 (1962)).
  • molecular replacement methods use a polypeptide having a Icnown 3 -dimensional structure to build a model of a second polypeptide.
  • the model is structurally similar to all or a fragment ofthe second polypeptide.
  • the model is rotated then translated into the unit cell ofthe target crystal of unknown structure to search for a fit between the observed and calculated X-ray diffraction data. If the model provides a good fit, the model can be used for subsequent model refinement and rebuilding of the model.
  • Crystals containing apolypeptide ofthe invention bound to a ligand can also be used in X-ray diffraction studies. Examination of a high-resolution structure of a polypeptide-ligand complex can be useful in improving the potency of a drug (i.e., a lead compound) through art-known structure-based drug design methods.
  • the present invention also relates to the use of 4TMHR or 5TMHR polynucleotides for use as diagnostic reagents. Detection of a mutated form of a GPCR gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of GPCR. Mutations in the GPCR gene may be detected at the DNA level by a variety of techniques.
  • Nucleic acids for diagnosis may be obtained from a subject's cells or bodily fluids, such as from blood, urine, saliva, tissue biopsy or autopsy material.
  • the genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis.
  • RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled 4TMHR or 5TMHR nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures.
  • DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g. , Myers etal, Science (1985) 230:1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method. See Cotton et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401.
  • an array of oligonucleotides probes comprising 4TMHR or 5TMHR nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of, e.g., genetic mutations.
  • the polypeptides ofthe present invention may be employed in a process for screening for antagonists and/or agonists for G-protein coupled receptors.
  • G- protein coupled receptors are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate the G- protein coupled receptors on the one hand or which can antagonize a G-protein coupled receptor on the other hand, when it is desirable to inhibit the G-protein coupled receptor.
  • such screening procedures involve providing appropriate cells which express the receptor on the surface thereof.
  • a polynucleotide encoding the receptor ofthe present invention is employed to transfect cells to thereby express the 4TMHRs or 5TMHRs
  • Such transfection may be accomplished by procedures as hereinabove described.
  • Functional 4TMHRs or functional 5TMHRs can be used in methods for determining whether a compound binds the 4TMHR or 5TMHR.
  • Biologically active 5TMHRs can be used in methods for determining whether a compound induces signal or inhibits signal transduction.
  • One such screening procedure involves the use of melanophores that are fransfected to express a biologically active 5TMHRs of the present invention. Such a screening technique is described in PCT WO 92/01810 published Feb. 6, 1992. Screening methods can also be carried out using cell membrane preparations.
  • such assay may be employed for screening for a receptor antagonist by contacting the melanophore cells which express the biologically active 5TMHR with both the receptor ligand and a compound to be screened. Inhibition ofthe binding ofthe receptor ligand, or inhibition of a signal generated by the ligand, indicates that a compound is a potential antagonist for the receptor and for the corresponding 7TMHR, i.e., inhibits binding to and/or activation ofthe receptor.
  • This method may also be employed to identify an agonist by contacting the melanophore cells that express a biologically active 5TMHR with compounds to be screened.
  • Compounds that induce signal across the cell membrane are agonists for the receptor.
  • 5TMHR for example, transfected CHO cells
  • 5TMHR in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181-296 (October 1989).
  • potential agonists or antagonists may be contacted with a cell which expresses the biologically active 5TMHR, and a second messenger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential agonist or antagonist is effective.
  • Another such screening technique involves introducing RNA encoding the biologically active 5TMHR into Xenopus oocytes to transiently express the receptor.
  • the oocytes may then be contacted (in the case of antagonist screening) with the receptor ligand and a compound to be screened, followed by detection of inhibition of a calcium signal.
  • the oocyte is contacted with the compound, and the induction of a calcium signal is detected.
  • Another screening technique involves expressing a 5TMHR in which the receptor is linked to a phospholipase C or D. Endothelial cells, smooth muscle cells, embryonic kidney cells, etc. may be used in this method.
  • the screening for an antagonist or agonist may be accomplished by detecting activation of the receptor or inhibition of activation ofthe receptor from the phospholipase second signal.
  • Another method involves screening for antagonists by detecting inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding the 4TMHR or 5TMHR such that the cell expresses the receptor on its surface and contacting the cell with a potential antagonist in the presence of a labeled form of a known ligand.
  • the ligand can be labeled, e.g. , by radioactivity or with a fluorescent or enzymatic tag.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound is an antagonist, the binding of labeled ligand to the receptor is inhibited.
  • Another method involves screening for antagonists or agonists by detecting inhibition or stimulation of receptor-mediated cAMP and/or adenylate cyclase accumulation.
  • Such a method involves transfecting a eukaryotic cell with a biologically active 5TMHR of this invention to express the receptor on the cell surface. The cell is then exposed to potential antagonists in the presence of a ligand ofthe receptor. The amount of cAMP accumulation is then measured. If the potential antagonist binds the receptor, and thus inhibits ligand binding, the levels of receptor-mediated cAMP, or adenylate cyclase, activity will be reduced. Alternatively, the cell is exposed to a potential agonist.
  • Another method for detecting agonists or antagonists of the receptors ofthe present invention is the yeast-based technology as described in U.S. Patent No. 5,482,835.
  • the assays may simply include the steps of mixing a candidate compound with a solution containing a biologically active 5TMHR polypeptide to form a mixture, measuring 5TMHR activity in the mixture, and comparing the 5TMHR activity ofthe mixture to a standard.
  • the 5TMHR may be in any of a variety of suitable forms for measuring activity, e.g. , it may be purified, partially purified, on whole cells, on cell membranes, in liposomes, or in detergent micelles.
  • Other assays may simply determine whether a compound binds a functional 4TMHR or 5TMHR, wherein binding ofthe compound to cells bearing the receptor is detected by means of a label that is directly or indirectly associated with the compound.
  • binding can be detected in an assay involving competition with a labeled competitor compound, using detection systems appropriate to the cells bearing the receptor at their surfaces.
  • Inhibitors of activation are generally assayed in the presence of a known agonist, and the inhibition of binding ofthe agonist in the presence ofthe compound is observed. Numerous such assays are known to those of ordinary skill in the art.
  • an intact 7TMHR can subsequently be used to confirm that the compound binds to and activates the receptor, or inhibits activation.
  • the present invention also provides a method for determining whether a ligand not known to be capable of binding to a 4TMHR or 5TMHR can bind to such receptor, which method includes contacting a mammalian cell that expresses a 4TMHR or 5TMHR with the ligand under conditions permitting binding of ligands to the 4TMHR or 5TMHR, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the 4TMHR.
  • the systems hereinabove described for detecting agonists and/or antagonists may also be employed for determining ligands which bind to the receptor.
  • an agonist or antagonist that binds to a 4TMHR or 5TMHR will also bind to a G-protein coupled receptor, and therefore the 4TMHR or 5TMHR provides a model for study of binding of agonists and antagonists to full-length G-protein coupled receptors.
  • polypeptides ofthe invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures.
  • substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics. See Coligan et al, Current Protocols in Immunology 7(2j:Chapter 5 (1991).
  • antagonists for 4TMHRs, 5TMHRs, and G-protein coupled receptors which are identified by screening procedures may be employed for a variety of therapeutic purposes.
  • such antagonists can be used in the treatment of hypertension, angina pectoris, myocardial infarction, ulcers, allergies, psychoses, depression, migraine, vomiting, benign prostatic hypertrophy, and psychotic and neurological disorders, including schizophrenia, manic excitement, depression, delirium, dementia or severe mental retardation, dyskinesias, such as Huntington's disease or Gilles de la Tourett's syndrome, among others.
  • G-protein coupled receptor antagonists can also be used in reversing endogenous anorexia and in the control of bulimia.
  • Examples of 4TMHR, 5TMHR and G-protein coupled receptor antagonists include an antibody, or in some cases an oligopeptide, which binds to the biologically active 5TMHRs or G-protein coupled receptors but does not elicit a second messenger response such that the activity of the 5TMHR or G- protein coupled receptor is inhibited.
  • Antibodies include anti-idiotypic antibodies which recognize unique determinants generally associated with the antigen- binding site of an antibody.
  • Potential antagonists also include small molecules, e.g., biogenic amines, that are closely related to a ligand ofthe G-protein coupled receptor and 4TMHR or 5TMHR, e.g., a fragment ofthe ligand, which has lost biological function and when binding to the G-protein coupled receptor or biologically active 5TMHR, elicits no response.
  • a potential antagonist ' also includes an antisense construct prepared through the use of antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion ofthe polynucleotide sequence which encodes the polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region ofthe gene involved in transcription (triple helix - see Lee et al, Nucl. Acids Res. (5:3073 (1979); Cooney et al, Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991)), thereby preventing transcription and the production of GPCR.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the GPCR (antisense — Olcano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inliibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)).
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of GPCRs.
  • Another potential antagonist is a small molecule which binds to the G- protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented.
  • small molecules include but are not limited to biogenic amines, small organic molecules, or peptides or peptide-like molecules.
  • Potential antagonists also include a soluble form of a 4TMHR or 5TMHR, which binds to the ligand and prevents the ligand from interacting with membrane-bound GPCRs.
  • the antagonists may be used to treat hypertension by controlling ⁇ -adrenergic receptors from stimulating cardiac contractility and lowering heart rate.
  • the antagonists may also be used to prevent vasoconstriction controlled by ⁇ -adrenergic receptors.
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • the agonists identified by the screening method as described above may be employed to stimulate the ⁇ -adrenergic receptor for the treatment of upper respiratory conditions, e.g., allergic rhinitis, hay fever, acute coryzaand sinusitis.
  • Stimulating the ⁇ -adrenergic receptors constricts the nasal mucosal blood vessels, lessening secretions, and edema, ⁇ -adrenergic receptors also control pupil dilation and uterine inhibition; therefore, the agonists may also be used to stimulate those actions.
  • Agonists for 4TMHRs, 5TMHRs and G-protein coupled receptors are also useful for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis.
  • agonists are employed for therapeutic and prophylactic purposes for such conditions as infections such as bacterial, fungal, protozoan and viral infections, particularly infections caused by HIV-1 or HIV-2; pain; cancers; diabetes, obesity; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; angina pectoris; myocardial infarction; ulcers; asthma; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease or Gilles de la Tourett's syndrome.
  • ⁇ -Adrenergic receptors mediate vasorelaxation.
  • Stimulating ⁇ -adrenergic receptors by the administration of an agonist may be used to treat bronchial asthma by causing bronchial smooth muscle relaxation and modulating mediator release, at least in part by stimulating the adenylyl cyclase-cAMP system.
  • Stimulating ⁇ -adrenergic receptors and consequent vasorelaxation may also be used to treat coronary artery disease, atherosclerosis and arteriosclerosis.
  • This invention additionally provides a method of treating an abnormal condition related to an excess of G-protein coupled receptor activity which comprises administering to a subject the antagonist as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to block binding of ligands to the G-protein coupled receptors and thereby alleviate the abnormal conditions.
  • the invention also provides a method of treating abnormal conditions related to an under-expression of G-protein coupled receptor activity which comprises administering to a subject a therapeutically effective amount of the agonist described above in combination with a pharmaceutically acceptable carrier, in an amount effective to enhance binding of ligands to the G-protein coupled receptor and thereby alleviate the abnormal conditions.
  • polypeptides, antagonists, or agonists may be employed in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof.
  • the formulation should suit the mode of administration.
  • Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions ofthe invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions ofthe invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the compounds of the present invention may be employed in conjunction with other therapeutic compounds.
  • the pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes.
  • the pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication.
  • the pharmaceutical compositions will be administered in an amount of at least about 10 ⁇ g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 ⁇ g/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
  • the 4TMHR or 5TMHR polypeptides, and antagonists or agonists that are polypeptides may be employed in accordance with the present invention by expression of such polypeptides in vivo (see, e.g., Chapter 20, "Gene Therapy and Other Molecular Genetic-based Therapeutic Approaches,” (and references cited therein) in Human Molecular Genetics, T. Strachan and A. P. Read, BIOS Scientific Publishers Ltd. (1996)).
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be provided with the polypeptide.
  • a polynucleotide DNA or RNA
  • Such methods are well-known in the art.
  • cells may be engineered by procedures Icnown in the art by use of a retroviral particle containing RNA encoding a polypeptide ofthe present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo.
  • the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses suchasRous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques 7(9):980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and ⁇ -actin promoters).
  • Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvo virus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • the nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter.
  • suitable promoters which may be employed include, but are not limited to, adeno viral promoters, such as the adeno viral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the ⁇ -actin promoter; and human growth hormone promoters.
  • the promoter also may be the native promoter which controls the genes en
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ⁇ -2, ⁇ -AM, PA12, T19-14X, VT-19-17-H2, ⁇ CRE, ⁇ CRIP, GP+E-86, GP+envAml2, andDAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • soluble, functional forms of 4TMHR or 5TMHR polypeptides capable of binding the ligand in competition with endogenous 7TMHR may be administered to a patient.
  • Typical embodiments of such competitors comprise fragments of the 4TMHR polypeptide.
  • expression of the gene encoding the endogenous GPCR can be inhibited using expression blocking techniques.
  • antisense sequences either internally generated or separately administered. See, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inliibitors of Gene Expression, CRC Press, Boca Raton, FL ( 1988) .
  • oligonucleotides which form triple helices with the gene can be supplied. See, for example, Lee et al, Nucleic Acids Res (1979) 3:173; Cooney et al, Science (1988) 241 :456; Dervan et al, Science (1991) 251 :1360. These oligomers can be administered per se or the relevant oligomers can be expressed in vivo.
  • the present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention.
  • These related receptors may be identified by homology to a receptor polypeptide ofthe present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the receptor polypeptides of the present invention.
  • the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g. , Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
  • restriction enzymes e.g. , Restriction Fragment Length Polymorphisms (RFLP)
  • genes of the present invention can be used as a reference to identify individuals expressing a decrease of functions associated with receptors of this type.
  • sequences ofthe present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis ofthe cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment. [0158] PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome.
  • mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow- sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • FISH Fluorescence in situ hybridization
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 lcb).
  • polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures Icnown in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtaine'd will then bind the polypeptides itself In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature 256:495- 497), the trioma technique, the human B-cell hybridoma technique (Kozbor etal, 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, etal, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R Liss, Inc., pp. 77-96).
  • Pat. No. 4,946,778 can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
  • Plasmids are designated by a lower case p preceded and/or followed by capital letters and/or numbers.
  • the starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures.
  • equivalent plasmids to those described are Icnown in the art and will be apparent to the ordinarily skilled artisan.
  • “Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA.
  • the various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used in accordance with conventional methods.
  • For analytical purposes typically 1 ⁇ g of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 ⁇ l of buffer solution.
  • For the purpose of isolating DNA fragments for plasmid construction typically 5 to 50 ⁇ g of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer.
  • Oligonucleotides refers to either a single stranded polydeoxyribonucleotide or two complementary poly deoxyribonucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
  • Ligase refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al, Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 ⁇ g of approximately equimolar amounts ofthe DNA fragments to be ligated.
  • ligase T4 DNA ligase
  • Molecular biology reagents were purchased from Fisher unless otherwise indicated. Oligonucleotides were purchased from Genosys. Restriction enzymes, DNA ligase, and polymerases were purchased from New England Biolabs. Transfection reagents, pCEP4 vector, and HEK293E cell lines were purchased from Invitrogen. Radiolabeled 1 5 I-C YP was purchased from NEN. Other ⁇ 2 AR effectors were purchased from Sigma. Design and Construction of ⁇ 2 AR-4TMHR
  • N-terminal extracellular region fused to helices 3-6 (residues Thr 100-Glu 306), as depicted in FIG. 1.
  • This design retains the two N-linked glycosylation sites at Asn 6 and Asn 15, and the majority of residues implicated in ligand-bonding, located on transmembrane helices 3-6 (Kolakowski, 1994; Schwartz, 1994; Dixon, etal., 1987).
  • the gene for wild-type ⁇ 2 AR was digested with Kpnl and Xbal, and ligated into a pCEP4 mammalian expression plasmid (Invitrogen) digested with Kpnl and Nhe , to produce plasmid pKR184.
  • 4TMHR- IF (5 ' -CCAGACGTCACTTTTGGCAACTTCTGGTGCGAG-3 ') (SEQ ID NO: 6) and 4TMHR-2R (5'- AAGCTTACTTGTCATCGTCATCCTT GTAGTCCCCGGGGTCGACGTGGTGATGATGGTGGTGCCGCCCCTCGA TTCTCGATTCCTTACGGATGAGGTTATCCTGG-3') (SEQ ID NO: 7) as primers, and the ⁇ 2 AR gene as a template.
  • the resulting product was placed in a TOPO-TA vector (Invitrogen).
  • This reaction produced a fragment ofthe ⁇ 2 AR gene coding for residues Thr 100-Glu 306 followed by a Factor-Xa cleavage site, a six histidine tag and a flag tag, with an Aatll site at the 5 ' end and a Hindlll site at the 3 ' end.
  • the fragment was digested with Aatll and a Hindlll, and subcloned into the TOPO-TA vector containing full-length ⁇ 2 AR between the Aatll and Hindlll sites.
  • the desired ⁇ 2 AR-4TMHR gene was digested with Kpnl and Hindlll, and subcloned into vector pKR184 into the same sites.
  • the ⁇ 2 AR-5TMHR construct was built using the 4TMHR-1F oligonucleotide as the forward primer and 5TMHR-2R (5 ' -AAG CTT ACT TGT CAT CGT CAT CCT TG -3 ') (SEQ ID NO: 8) as the reverse primer in a PCR reaction to amplify 5TMHR from the full length ⁇ 2 AR gene.
  • This reaction produced a fragment of the ⁇ 2 AR gene coding for residues Thr 100-Leu 413 followed by a Factor-Xa cleavage site, a six histidine tag and a flag tag, with an Aatll site at the 5' end and a Hindlll site at the 3' end.
  • This PCR fragment was digested with Aatll and Hindlll and ligated into the TOPO-TA vector containing full-length ⁇ 2 AR between the Aatll and Hindlll sites. This step was followed by another digestion with Kpnl and Hindlll to isolate the ⁇ 2 AR-5TMHR gene which was subcloned into pKR184 at the Kpnl and Hindlll sites. All constructs were confirmed by DNA sequencing.
  • Vectors harboring the ⁇ 2 AR-4TMHR and ⁇ 2 AR-5TMHR genes were transfected using LIPOFECTAMINE 2000TM (Life Technologies) into human embryonic kidney cells (HEK293 cells) growing at about 80%o confluence in T 75 flasks.
  • LIPOFECTAMINE 2000TM Life Technologies
  • HEK293 cells human embryonic kidney cells
  • Duplicate samples of a pCEP4 plasmid harboring the wild-type ⁇ 2 AR gene and an empty control vector were transfected at the same time.
  • the DNA concentration was -0.2 ⁇ g/ ⁇ l for each vector.
  • 13 ⁇ g of DNA, 45 ⁇ l of LIPOFECTAMINE 2000TM, and 780 ⁇ l of Opti-MEM were used. Two sets of transformations were carried out: one for transient expression, and one for generation of stable cell lines.
  • ligand binding assays can be performed using radiolabeled 125 I-cyanopindolol ( 125 ICYP) (NEN).
  • ICYP is an antagonist for ⁇ 2 AR and binds with a K d of ⁇ 50 pM.
  • the first set of assays is designed to measure total expression level. Increasing concentrations of l25 ICYP can be incubated for 2 hours with cell extract samples from each cell line ( ⁇ 2 AR- 4TMHR, ⁇ 2 AR-5TMHR, wild-type ⁇ 2 AR, and control plasmid) in 96-well filter plates.
  • the samples are washed extensively, and the radioactive counts quantitated using a Wallach MicroBeta Scintillation Top Counter.
  • the moles of 125 ICYP bound can be determined by dividing the counts retained by the total counts added to each well, and multiplying by the specific activity of 125 ICYP. The maximum value for moles 125 ICYP bound is taken to be equal to the moles of active receptor.
  • membranes can be prepared containing the expressed receptor, as previously described. The membranes can be resuspended in assay buffer and placed in mini dialysis units (PIERCE Chemicals) and dialyzed against buffer containing 3 H-alprenolol (NEN). Alprenolol is a well characterized ⁇ 2 AR antagonist with reported affinities for the wild-type receptor ranging from 5-20 nM. This equilibrium dialysis method allows the accurate determination of equilibrium constants for radioligands having low affinities. This method is suitable for affinities from 5- 5000 nM.
  • the receptor can be solubilized in detergent and then partially purified from the membrane preparation. Digitonin or dodecyl- ⁇ -maltoside, for example, can be used for solubilization. Solubilized receptor can be applied to a Ni-NTA resin, and the protein will be eluted with an increasing concentration of imidazole. The protein-containing material can then be applied to a flag peptide affinity resin. The resin can be washed, and the protein can eluted with an anti-flag specific peptide. These two sequential purification steps will increase the specific activity ofthe protein preparation, and the equilibrium dialysis protocol will be repeated.
  • the ranking order ofthe ligands can be determined.
  • the values for the dissociation constants range from 1 fold to 1000 fold (e.g., 1-100 or 1-10 fold) ofthe values for wild-type ⁇ 2 AR.
  • the ranking order for antagonists is (-) iodo- cyanopindolol > (-) alprenolol > (-) propranolol > (+) alprenolol > (+) propranolol, and for agonist (-) isopreterenol > (+) isopreterenol > (-)epinephrine > (+) epinephrine.
  • the ranking order for all ligands is (antagonist and agonist) iodo-cyanopindolol > (-) alprenolol > (-) propranolol > (+) alprenolol > (+) propranolol > (-) isopreterenol > (+) isopreterenol > (-) epinephrine > (+) epinephrine, as is observed for the wild-type receptor.
  • Equilibrium ligand dissociation constants (Kd) for wild-type ⁇ 2 AR (average values reported in the literature) are set forth in Table 1. Table 1 Equilibrium ligand dissociation constants (KJ) for wild-type ⁇ 2 AR
  • cells can be homogenized in a physiologically relevant buffer containing sucrose. Nuclei and unlysed cells can be removed by centrifugation at 1000 x g. The supernatant can be applied to a discontinuous sucrose gradient and centrifuged at high speed (e.g., 100,000 xg for 12 hours). Gradient fractions can be collected and "bookkeeping" enzymes can be assayed to identify the organelle and plasma membrane fractions. All fractions can be tested, as previously described, for their ability to bind to ligands. The presence of the ⁇ 2 AR polypeptides can be confirmed by Western blot analysis, using anti- ⁇ 2 AR and anti-flag antibodies.
  • N-Glyc-F a deglycosylating enzyme
  • G-protein coupled receptors that are expressed in HEK293E cells are functionally coupled to (i) the activation of PLC and calcium immobilization, (ii) stimulation or inhibition of adenylate cyclase; and (iii) coupling to G-proteins , which results in the uptake of GTP- ⁇ - 35 S.
  • Expression of wild-type ⁇ 2 AR in HEK293E cells in the presence of a ⁇ 2 AR agonist results in a transient increase of intracellular calcium levels, cAMP elevation, and uptake of GTP- ⁇ - 35 S by coupling ofthe receptor through the corresponding signal transduction pathways.
  • HEK293E cells expressing a 5TMHR or 4TMHR can be assayed for G-protein coupling.
  • the 4TMHR polypeptides are engineered to lack most ofthe components for G-protein binding and preferably do not result in G- protein coupling.
  • the 5TMHR polypeptides are engineered to retain the G-protein binding motifs and preferably result in G-protein coupling.
  • basal cAMP levels can be quantified to determine whether the
  • 5TMHR and 4TMHR are constitutively active forms ofthe receptor.
  • calcium transients, cAMP elevation and GTP- ⁇ - 35 S uptake are detected in the presence of agonist.
  • (-) isopreterenol preferably binds with greater affinity than does (-) epinephrine.
  • the EC 50 values for these agonists preferably will be 1 fold to 1000 (e.g., 1-100 or 1-10) fold for those observed for the wild- type ⁇ 2 -AR.
  • a high throughput screening method can be used to assay proper refolding ofthe isolated polypeptides ofthe invention.
  • such a method can be used to determine whether a compound binds to a polypeptide ofthe invention.
  • Such screening can be carried out using the fluorescence microplate thermal shift assay disclosed in U.S. Patent No. 6,020,141; U.S. Patent No. 6,036,920; and international patent publication no. WO 97/42500, each of which is incorporated herein by reference.
  • this method is based upon the observation that hydrophobic dyes bind to proteins when the proteins are in a partially denatured state.
  • the invention provides a fluorescent indicator of stability for virtually any purified protein of interest.
  • the stability of proteins to thermal denaturation is measured by monitoring dye fluorescence in a 96- or 384-well format.
  • Test compounds can be included in each well, with compounds that bind to the polypeptides with high affinity producing large changes in the stability of the polypeptides.
  • radioligand binding assays using whole cells, membrane preparations or purified receptors can provide a method for screening a library of compounds.
  • calcium transients, fluctuations of cAMP levels and uptalce of GTP- ⁇ - 35 S in functional assays can be used in high throughput screening applications.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

This invention relates to protein-based ligand receptor molecules. In particular, this invention relates to novel 4-helix and 5-helix derivatives of seven transmembrane helix G-protein coupled receptors. Such 4-helix and 5-helix polypeptides are diagnostically and/or therapeutically useful, and also are useful for screnning for receptor antagonists and/or agonists and/or receptor ligands. Additionally, such 4-helix and 5-helix molecules are useful as substrates for the simplified production of crystals suitable for X-ray crystallographic analysis of G-protein coupled receptors.

Description

GPCR 4-HELIX AND 5-HELIX BUNDLES
STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH AND DEVELOPMENT
[0001] Part ofthe work performed during development of this invention utilized
U.S. Government funds awarded by the Small Business Innovation Research Program under grant nos. 1 R43 GM59850-01 and 2 R44 GM59850-02. The U.S. Government has certain rights in this invention.
BACKGROUND OF THE INVENTION
Field ofthe Invention
[0002] This invention relates to protein-based ligand receptor molecules. In particular, this invention relates to novel derivatives of seven transmembrane (TM) helix G-protein coupled receptors.
Background Art
[0003] Throughout this application various publications are referred to. The disclosures of these publications, in their entireties, are hereby incorporated by reference into this application in order to more fully describe the state ofthe art to which this invention pertains.
[0004] G-protein coupled receptors (GPCRs, otherwise known as 7TM receptors) are members of a super-family of proteins that are responsible for transducing signals across a cell membrane so as to initiate a second messenger response. All G-protein coupled receptors have been characterized as having seven membrane- spanning domains (conserved hydrophobic stretches of about 20 to 30 amino acids which have been postulated to be transmembrane α-helices) connected by hydrophilic extracellular and intracellular loops (also referred to herein as "connector polypeptides"), an extracellular amino terminus, and a cytoplasmic carboxyl terminus.
[0005] Many biological processes are mediated by signal transduction pathways that involve GPCRs, G-proteins, and/or second messengers. To this end, the G- protein coupled receptors bind a variety of ligands ranging from small biogenic amines to peptides, small proteins and large glycoproteins (C. D. Strader et al, (1994) Ann. Rev. Biochem. 63: 101-132). The G-protein superfamily of coupled receptors are sensitive to a wide variety of hormonal, viral, neurochemical, metabolic, and regulatory stimuli, and includes, but is not limited to, adrenergic, muscarinic, cholinergic, dopaminergic, serotonergic, andhistaminergic receptors, numerous peptide receptors, including glucagon, somatostatin, and vasopressin receptors, as well as sensory receptors for vision (rhodopsin), taste, and olfaction. Specific examples include dopamine, calcitonin, endothelin, cAMP, adenosine, acetylcholine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, and cytomegalovirus receptors.
[0006] The GPCR protein superfamily now contains over 250 types of paralogues, receptors that represent variants generated by gene duplications (or other processes), as opposed to orthologues, the same receptor from different species. The superfamily can be broken down into five families: Family I, receptors typified by rhodopsin and the β2-adrenergic receptor and currently represented by over 200 unique members (reviewed by Dohlman et al. (1991) Annu. Rev. Biochem. 60:653-688 and references therein); Family II, the parathyroid hormone/calcitonin/secretin receptor family (Juppner et al. (1991) Science 254:1024-1026; met al (1991) Science 254:1022-1024);Familylϊl,the metabotropic glutamate receptor family in mammals (Nakanishi (1992) Science 258:597-603); Family IV, the cAMP receptor family, important in the chemotaxis and development of D. discoideum (Klein etαl. (1988) Science 241:1467-1472); and Family V, the fungal mating pheromone receptors such as STE2 (reviewed by Kurjan (1992) ^rø. Rev. Biochem. W.1097-1129). [0007] The adrenergic receptors are a pharmaceutically prominent subfamily due to the many related illnesses associated with defective adrenergic receptor mechanisms. Although adrenergic receptors (ARs) bind the same endogenous catecholamines (epinephrine and norepinephrine) their physiological as well as pharmacological specificity is markedly diverse. This diversity is due primarily to the existence of at least nine different proteins encoding distinct adrenergic receptors types (α,, α2, and β β2, β3). While all the receptors ofthe adrenergic type are recognized by epinephrine, they are pharmacologically distinct and are encoded by separate genes. These receptors are generally coupled to different second messenger pathways that are linlced through G-proteins. Among the adrenergic receptors, β, and β2 receptors activate the adenylate cyclase, α2 receptors inhibit adenylate cyclase and α, receptors activate phospholipase C pathways, stimulating breakdown of polyphosphoinositides (Chung, F. Z. etal, J. Biol. Chem. 263:4052 (1988)).
[0008] Adrenergic receptors were initially classified as either α or β by
Ahlquist, who demonstrated that the order of potency for a series of agonists to evoke a physiological response was distinctly different at the 2 receptor subtypes (Ahlquist, 1948). α- Adrenergic receptors were first classified based on their anatomical location, as either pre or post-synaptic (α2 and α,, respectively) (Langer et al, 1974). This classification scheme was confounded, however, by the presence of α2 receptors in distinctly non-synaptic locations, such as platelets (Berthelsen and Pettinger, 1977). Functionally, α adrenergic receptors were shown to control vasoconstriction, pupil dilation and uterine inhibition, while β adrenergic receptors were implicated in vasorelaxation, myocardial stimulation and bronchodilation (Regan et al, 1990). Eventually, pharmacologists realized that these responses resulted from activation of several distinct adrenergic receptor subtypes β adrenergic receptors in the heart were defined as βb while those in the lung and vasculature were termed β2 (Lands et al, 1967). The molecular cloning of three genes encoding α,-ARs supports the existence of pharmacologically and anatomically distinct αrreceptor subtypes. [0009] With the development of radio ligand binding techniques, α adrenergic receptors could be distinguished pharmacologically based on their affinities for the antagonists prazosin or yohimbine (Stark, 1981). Definitive evidence for adrenergic receptor subtypes, however, awaited purification and molecular cloning of adrenergic receptor subtypes. In 1986, the genes for the hamster β2 (Dickson et al, 1986) and turkey β, adrenergic receptors (Yarden et al, 1986) were cloned and sequenced. Hydropathy analysis revealed that these proteins contain 7 hydrophobic domains similar to rhodopsin, the receptor for light. Since that time the adrenergic receptor family has expanded to include 3 subtypes of β receptors (Emorine et al, 1989), 3 subtypes of α, receptors (Schwinn et al, 1990), and 3 distinct types of β2 receptors (Lomasney el al, 1990).
[0010] In addition to these groups of GPCRs, there are a small number of other proteins which present seven putative hydrophobic segments and appear to be unrelated to GPCRs; however, they have not been shown to couple to G-proteins. Drosophila express a photoreceptor-specific protein bride of sevenless (boss), a seven-transmembrane-segment protein which has been extensively studied and does not show evidence of being a GPCR (Hart el al. (1993) Proc. Natl. Acad. Sci. USA 0.5O47-5O51 (1993)). The gene frizzled (fz) in Drosophila is also thought to be a protein with seven transmembrane segments. Like boss, fz has not been shown to couple to G-proteins (Vinson et al. (1989) Nature 338:263-264).
[0011] Many medically significant processes are mediated by signal transduction pathways that involve the sequential interaction of plasma membrane receptors (GPCRs), with guanine nucleotide exchange proteins (G-proteins), various cellular effectors (intracellular enzymes and channels which are modulated by G-proteins), and/or second messengers. Some examples of these proteins and second messengers include: the GPCRs, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al, Proc. Natl Acad. Sci, USA, 1987, 84:46-50; Kobilka, B.K., et al, Science, 1987, 238:650-656; Bunzow, J.R., et al, Nature, 1988, 336:783-787); G-proteins themselves; effector proteins, such as phospholipase C, adenylyl cyclase, andphosphodiesterase; actuator proteins, such as protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8), and second messengers such as cAMP (Lefkowitz, Nature, 1991, 351:353-354). These basic molecular components generate a wide diversity of signal transduction pathways due to (1) the size and ligand recognition diversity ofthe GPCR superfamily, (2) the number of heterotrimeric combinations of G- proteins, and (3) the diversity of effector proteins, e.g. phospholipases, adenylyl cyclases, phosphodiesterases, channels, and protein kinases.
[0012] These genes and gene-products are potential causative agents of disease
(Spiegel et al. (1993) J Clin. Invest. 92:1119-1125; McKusick and Amberger (1993) J Med. Genet. 30:1 -26). GPCRs are major targets for new drug discovery a d development. Over 50% of commercially available drugs interact with a GPCR (Gudermann, et al, J. Mol. Med. 73:51-63 (1995)). Thus far, more than 250 GPCRs have been identified, and the functions of about 100 are known. It is estimated that 2000-5000 GPCRs may exist in the human genome (Marchese, et al, TIPS 20:370-375 (1999)). This indicates that these receptors have an established, proven history as therapeutic targets. Clearly there is a need for identification and characterization of further receptors which can play a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, infections such as bacterial, fungal, protozoan and viral infections, particularly infections caused by HIV-1 or HIV-2; pain; cancers; diabetes, obesity; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; angina pectoris; myocardial infarction; ulcers; asthma; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease or Gilles de la Tourett's syndrome. Accordingly, it is valuable to the field of pharmaceutical development to characterize known, as well as previously unknown, GPCRs.
[0013] As noted above, the GPCR superfamily of proteins are characterized as having seven transmembrane domains. The domains are believed to represent transmembrane α-helices connected by hydrophilic extracellular or cytoplasmic loops, the whole protein terminated by hydrophilic amino and carboxyl-terminal tails. The 7 transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. Most GPCRs have single conserved cysteine residues in each of the first two extracellular loops which are believed to form disulfide bonds that stabilize a functional protein structure. Phosphorylation and lipidation (palmitation or farnesylation) of cysteine residues can influence signal transduction of some GPCRs. Most GPCRs contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxyl terminus. For several GPCRs, such as the β-adrenergic receptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization.
[0014] For some receptors, the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic pockets formed by several G- protein coupled receptor transmembrane domains, said pockets being surrounded by hydrophobic residues ofthe G-protein coupled receptors. The hydrophilic side of each G-protein coupled receptor transmembrane helix is postulated to face inward and form a polar ligand binding site. TM3 has been implicated in several G -protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue. TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.
[0015] The molecular diversity of GPCR-mediated signal transduction pathways complicates the configuration of functional assays. In the past, functional GPCR assays quantitated cAMP or guanine nucleotide exchange by radioimmunoassay, production of radiolabeled inositol phosphates, or changes in intracellular Ca levels. Although these assays provide a direct measure ofthe intracellular second messenger, they generally require large numbers of cells, the use of radioisotopes, and involve multiple liquid transfer steps. Therefore, as currently formatted, these assays are not generally amenable to automated, high through-put execution.
[0016] Despite their importance, a major gap exists in understanding the molecular mechanisms of ligand discrimination and agonist/antagonist activity in GPCRs. The primary bottleneck is a lack of detailed structural information: no three-dimensional structure of a GPCR has been determined. Because of their complexity and biomedical importance, multipass transmembrane proteins such as those ofthe GPCR family represent the chief challenge in molecular medicine, and the next frontier in structural biology (Pebay-Peyroula, E., et al, Science 277:1676-1681 (1997)).
BRIEF SUMMARY OF THE INVENTION
[0017] The development of high throughput functional assays for GPCRs would greatly enhance the ability to discover and develop novel agonists and antagonists to this important superfamily of pharmaceutical targets. The identification and characterization of novel agonists and antagonists would be facilitated by an improved and simplified assay system that had removed from it the needless complexity ofthe native receptor transduction pathways.
[0018] The discovery of novel agonists and antagonists for GPCRs would also be greatly facilitated by an improved means of determining the three dimensional (3-D) structure ofthe ligand binding site ofthe receptor. With full and accurate knowledge of the 3-D structure of a binding site, novel ligands may be created tlirough rational drug design processes. Unfortunately, high quality crystals of 7TM GPCRs (i.e., 7TMHRs) are difficult to produce for study by X-ray diffraction. A protein containing a minimal binding site with similar specificity for ligands to that ofthe native GPCR would be easier to crystallize, and would therefore enable rapid analysis ofthe 3-D structure ofthe ligand binding site for rational design purposes.
[0019] This invention relates to newly identified polypeptides, polynucleotides encoding such polypeptides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides ofthe present invention are novel 4-helix or 5-helix derivatives of 7-transmembrane G-protein coupled receptors (4- or 5- transmembrane helix receptor polypeptides, or 4TMHRs or 5TMHRs).
[0020] In accordance with one aspect ofthe present invention, there are provided novel polypeptides which are functional 4-transmembrane helix receptor polypeptides. By "functional" is meant that a polypeptide is able to bind to the same ligands as does the wild-type 7-transmembrane version (7TMHR) of the polypeptide. Preferably, the 4TMHR derivative binds to ligands with the same hierarchy of affinities as does the wild-type 7TMHR. Preferably, such 4TMHRs also bind to ligands with the same relative affinities as exhibited by a wild-type 7-transmembrane version of the polypeptide. More preferably, the 4TMHR exhibits KJ s for ligands within two orders of magnitude ofthe KJ s obtained with the wild-type 7TMHR. Such functional 4TMHRs need not be able to transduce signal across cell membranes, i.e., they need not be "biologically active." Typically, 4TMHRs include transmembrane helices 3, 4, 5, and 6 (TM3, TM4, TM5, and TM6) of a 7TMHR. Alternatively, a4TMHRmay contain TM3, TM5, TM6, and TM7 of a 7TMHR.
[0021] In a related aspect ofthe present invention, there are provided functional
5 -transmembrane helix receptor polypeptides. Typically, 5TMHRs include TM3 , TM4, TM5, TM6, and TM7 of a 7TMHR. Such functional 5TMHRs need not be biologically active. Optionally, such 5TMHRs may contain all or a portion ofthe C-terminus of a GPCR. Preferably, the 5TMHRs containing a C-terminus are "biologically active," i.e., able to transduce signal across a cell membrane so as to initiate a second messenger response. Preferably, the 5TMHR derivative binds to ligands with the same hierarchy of affinities as does the wild-type 7TMHR. Preferably, such 5TMHRs also bind to ligands with the same relative affinities as exhibited by a wild-type 7-transmembrane version ofthe polypeptide. More preferably, the 5TMHR exhibits KJs for ligands within two orders of magnitude ofthe KJs obtained with the wild-type 7TMHR.
[0022] Diagnostically or therapeutically useful fragments and derivatives ofthe aforementioned 4TMHRs and 5TMHRs also are provided. [0023] In accordance with another aspect of the present invention, there are provided nucleic acid molecules encoding 4- or 5 -transmembrane helix receptor polypeptides, including mRNAs, DNAs, cDNAs, genomic DNA as well as antisense analogs thereof and biologically active and diagnostically or therapeutically useful fragments thereof.
[0024] In accordance with a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques which comprises culturing recombinant prokaryotic and/or eukaryotic host cells, containing a 4- or 5 -transmembrane helix receptor polypeptide nucleic acid sequence, under conditions promoting expression of said protein and subsequent recovery of said protein.
[0025] In accordance with yet a further aspect ofthe present invention, there are provided antibodies that specifically bind to such polypeptides.
[0026] In accordance with another embodiment, there is provided a process for using the receptors to screen for receptor ligands (e.g., agonists and/or antagonists).
[0027] In accordance with still another embodiment ofthe present invention there is provided a process of using such agonists to stimulate the endogenous 7- transmembrane helix receptor polypeptides for the treatment of conditions related to the under-expression ofthe G-protein coupled receptors.
[0028] In accordance with another aspect of the present invention there is provided a process of using such antagonists for inhibiting the action of the endogenous 7-transmembrane helix receptor polypeptides for treating conditions associated with over-expression ofthe G-protein coupled receptors.
[0029] In a related aspect ofthe invention, there is provided a method for treating an illness caused by faulty expression (e.g., overexpression or underexpression) of a GPCR. The method includes administering to a patient suffering from an illness caused by underexpression of a GPCR a polynucleotide encoding a biologically active GPCR (e.g., a 5TMHR containing a C-terminal domain), and allowing expression of the polynucleotide to produce the polypeptide on cell membranes ofthe patient. Similarly, a patient suffering from a illness caused by overexpression of a GPCR can be treated with a functional, but biologically inactive, 4TMHR or 5TMHR by administering a polynucleotide encoding such a polypeptide, or by administering such a polypeptide, to the patient. Alternatively, a soluble, biologically active 5TMHR polypeptide can be administered to the patient (without expression of the 5TMHR on cell membranes) to block activity of an endogenous GPCR.
[0030] In accordance with yet another aspect ofthe present invention there are provided non-naturally occurring synthetic, isolated and/or recombinant 4TMHRs and 5TMHRs which are fragments, consensus fragments and/or sequences having conservative amino acid substitutions such that 4TMHRs or 5TMHRs of the present invention may bind G-protein coupled receptor ligands, or which may also modulate, quantitatively or qualitatively, G-protein coupled receptor ligand binding.
[0031] In accordance with still another aspect ofthe present invention there are provided synthetic or recombinant G-protein coupled receptor polypeptides, conservative substitution and derivatives thereof, antibodies, anti-idiotype antibodies, compositions and methods that can be useful as potential modulators of G-protein coupled receptor function, by binding to ligands or modulating ligand binding, due to their expected biological properties, which may be used in diagnostic, therapeutic and/or research applications.
[0032] The present invention also provides synthetic or recombinant 4- transmembrane helix receptor polypeptides or 5 -transmembrane helix receptor polypeptides which are designed to inhibit or mimic various G-protein coupled receptors or fragments thereof.
[0033] In accordance with yet a further aspect ofthe present invention, there are also provided diagnostic probes comprising nucleic acid molecules of sufficient length to specifically hybridize to the G-protein coupled receptor nucleic acid sequences. [0034] In accordance with yet another object of the present invention, there is provided a diagnostic assay for detecting a disease or susceptibility to a disease related to a mutation in a G-protein coupled receptor nucleic acid sequence.
[0035] In accordance with an even further aspect of the invention, there is provided a 4-transmembrane helix receptor polypeptide having a ligand binding site essentially identical with the ligand binding site of a 7TMHR, suitable for use in determining the three dimensional structure ofthe ligand binding site ofthe 7TMHR by X-ray crystallographic analysis, and means for using such a 4- transmembrane helix receptor polypeptide in the design of novel agonists and antagonists for the 7TMHR. Similarly, there is provided a 5 -transmembrane helix receptor polypeptide having a ligand binding site essentially identical to the ligand binding site of a 7TMHR. Such 4TMHRs and 5TMHRs can be used in molecular replacement methods and in structure-based drug design methods.
[0036] These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0037] FIG. 1 A is a schematic representation of the wild-type β2 adrenergic receptor (B2AR). The seven transmembrane helices are shown as rectangles, labeled TM1-TM7. Regions of the sequence that are incorporated into an exemplary β2AR-4THMR construct are shown with thick lines (Met 1- Val 24 and Thr 100-Glu 306). Regions that are not included in β2AR-4THMR are shown with thin lines. FIG. IB is a schematic representation of an exemplary β2AR- 4TMHR. The N-terminal residue (Met 1) and the C-terminal residue (Glu 231) are indicated. The shaded box at the C-terminus (adjacent to Glu 231) represents the position at which peptide "tags" (e.g., His6, flag, or Arg6) can be added to facilitate purification using affinity resins, or to facilitate detection (e.g., with antibodies and Western blotting). [0038] FIG. 2A is a schematic representation of the wild-type β2 adrenergic receptor (B2AR). The seven transmembrane helices are shown as rectangles, labeled TM1-TM7. Regions of the sequence that are incorporated into an exemplary β2AR-5THMR construct are shown with thick lines (Met 1 - Leu 413). Regions that are not included in β2AR-5THMR are shown with thin lines. FIG. 2B is a schematic representation of an exemplary β2AR-5TMHR. The N-terminal residue (Met 1) and the C-terminal residue" (Leu 413) are indicated. The shaded box at the C-terminus (adjacent to Leu 413) represents the position at which peptide "tags" (e.g., His6, flag, or Arg6) can be added to facilitate purification using affinity resins, or to facilitate detection (e.g., with antibodies and Western blotting).
[0039] FIGS. 3 A and 3B are a listing ofthe nucleotide and amino acid sequence of an exemplary β2AR-4TMHR. The numbers identify the linear amino acid sequence from the N- to C-termini. Amino acids 1 to 24 are identical to wild- type β2AR. Amino acids 25 to 231 of 4TMHR correspond to amino acids 100- 306 of wild-type β2AR.
[0040] FIGS. 4A and 4B are a listing ofthe nucleotide and amino acid sequence of an exemplary β2AR-5TMHR. The numbers identify the linear amino acid sequence from the N- to C-termini. Amino acids 1 to 24 are identical to wild- type β2AR.
[0041] FIG. 5 is a histogram showing the relative expression levels of β2AR-
4TMHR and β2AR-5TMHR.
DETAILED DESCRIPTION OF THE INVENTION
[0042] As used herein, "polynucleotide" generally refers to any polyribonucleotide or polydeoxyribonucleotide, which may be unmodified RNA or DNA, including cDNA, genomic DNA, and synthetic DNA, or modified RNA or DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double- stranded RNA, and RNA that is mixture of single-and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides. A 4TMHR of the invention is a polypeptide that consists essentially of four transmembrane helices of a 7TMHR and three connector polypeptides, with the three connector polypeptides linking the transmembrane helices in tandem. "Connector polypeptides" are polypeptides that link transmembrane regions of a GPCR. Connector polypeptides may be located intracellularly or extracellulaiiy. Preferably, at least one of the connector polypeptides is hydrophilic; more preferably, all ofthe connector polypeptides are hydrophilic. The lengths ofthe connector polypeptides may vary, and such polypeptides need only be long enough to permit re-insertion of the transmembrane region of the polypeptide into the membrane (preferably 10-200 amino acid residues, more preferably 10-100 amino acid residues). The amino acid sequences of the connectors will typically, although not necessarily, correspond to the amino acid sequences of naturally-occurring connector polypeptides (i.e., intracellular or extracellular loops) of GPCRs. If desired, the connector polypeptides can be mutagenized to increase their hydrophilicity.
[0044] A variety of GPCRs can be used to make the 4TMHRs and 5TMHRs of the invention. GPCRs can be categorized by the ligand to which they bind. For example, the polypeptides ofthe invention can include transmembrane domains ofthe families of GPCRs that bind to the following families of ligands:
[0045] (i) Purines, nucleotides, and melatonin, e.g., receptors for adenosine, cAMP, melatonin, ATP, UTP, ADP, and other NTPs;
[0046] (ii) Toxins, e.g., latrotoxin;
[0047] (iii) Lipids and Lipid-Based Compounds, e.g., cannabinoids, anandamide,
Lysophosphatidic acid, platelet activating factor, leukotrienes, excitatory amino acids and ions, glutamate, calcium, and GAB A;
[0048] (iv) Biogenic amines and related natural ligands, e.g., adrenaline, dopamine, histamine, acetylcholine, noradrenaline, octopamine/tyramine, serotonin (5-hydroxytryptamine), peptides, angiotensin, bradykinin, bombesin/neuromedin, C3a, C5a, calcitonin, calcitonin gene related peptide, chemokine, cholecystokinin, conopressin, corticotropin releasing factor (CRF), CD55 - decay accelerating factor (DAF), diuretic hormone receptors, endothelin, fMLP, FSH glycoprotein hormone, fungal mating pheremones, galanin, growth hormone releasing hormone (GHRH), growth hormone secretagogue (GHS), gastric inhibitory peptide, glucagon-like peptide, glucagon, gonadotropin releasing hormone, LH glycoprotein hormone, melanocortin receptors, neuropeptide Y, neurotensin, opioid, oxytocin, thrombin and protease activated pituitary adenylyl cyclase activating peptide (PACAP), PTH/PTHrP, secretin, somatostatin, tachykinin, thyrotropin releasing hormone, TSH glycoprotein hormone, vasopressin, vasotocin, and vasoactive intestinal peptide (VIP). Other suitable polypeptides of the invention include 4TMHRs and 5TMHRs of olfactory receptors. Preferably, the polypeptides ofthe invention are 4TMHRs or 5TMHRs of receptors that bind to biogenic amines. [0049] Conventional hydropathy modeling methods can be used to identify hydrophobic regions of the polypeptides and thus predict the transmembrane domains, as well as the intracellular and extracellular domains. Suitable modeling programs can be found at http://www.expasy.ch/ and at http://www.expasy.ch cgi-bin siri-gpcr.pl.
[0050] An exemplary polynucleotide of the present invention encodes a polypeptide that is a 4TMHR, and is structurally related to the β2 adrenergic receptor family. The polynucleotide contains an open reading frame encoding a polypeptide of 207 amino acid residues, shown in FIGS. 3 A, and 3B as amino acidresidues 25-231 (corresponding to amino acids 100-306 of wild-type β2AR). Optionally, the polypeptide may include all or a portion of anon-transmembrane polypeptide, such as the extracellular N-terminus ofthe β2 adrenergic receptor, e.g., amino acid residues 1-24 (corresponding to amino acids 1-24 of wild-type β2AR), as illustrated in FIGS. 3A and 3B as SEQ ID NOs: 1 and 2. If desired, the polypeptide may include an N-terminal or C-terminal "tag" such as His or flag.
[0051] An exemplary polynucleotide encoding a 5TMHR polypeptide of the invention contains an open reading frame encoding a polypeptide corresponding to amino acid residues 100 to 413 of wild-type β2AR, as shown in FIGS. 4A and 4B as SEQ ID NOs: 3 and 4. Such a polypeptide can be made biologically active by covalently linking it to all or a portion of the intracellular C-terminus of a GPCR. Optionally, the portion ofthe C-terminus does not include amino acid residues 355-413 of wild-type β2AR, thus removing two Cysteine residues normally located in this region, as these Cysteine residues can inhibit protein refolding. Optionally, the polypeptide may include all or a portion of a non- transmembrane polypeptide, such as the extracellular N-terminus of the β2 adrenergic receptor, e.g., amino acidresidues 1-24 (corresponding to amino acids 1-24 of wild-type β2AR), as illustrated in FIGS. 4A and 4B as SEQ ID NOs.: 3 and 4. If desired, the polypeptide may include an N-terminal or C-terminal "tag" such as His or flag. [0052] Another preferred polynucleotide ofthe invention encodes a 4TMHR or
5TMHR that is structurally related to an angiotensin II receptor. Angiotensin II is an octapeptide (D-R-V-Y-V-H-P-F (SEQ ID NO: 5)) that mediates blood pressure and water-electrolyte homeostasis via interactions with type I and type II angiotensin receptors - both of which are GPCRs. Unregulated, elevated levels of angiotensin II can result in hypertension, coronary ischemia, congestive heart failure, and renal insufficiency. As a consequence, the receptors for angiotensin are targets for drug discovery and intervention. Angiotensin II interacts with its cognate GPCR through specific interactions with residues found on extracellular loops and residues found in transmembrane TM helices three through seven.
[0053] The sequence for the type 1 and type 2 angiotensin receptors is available tlirough GenBank at accession numbers Z11162, M93394 and X65699, respectively. The third TM domain begins at about amino acid number 103 , and the sixth TM domain ends at about amino acid number 266. The seventh TM ends at about amino acid number 300 and the entire sequence ends at about amino acid number 363. An exemplary 4TMHR variant of this GPCR can begin at amino acid number about 103 and end at amino acid 266 to encompass TM helices 3 through 6. An exemplary 5TMHR variant of this GPCR can begin at about amino acid number 103 and end after the seventh TM, at about amino acid number 300. A biologically active 5TMHR can begin at about amino acid number 103 and end at the end of the native sequence, at about amino acid number 363.
[0054] Optionally, the polypeptides ofthe invention can include a predominantly hydrophilic sequence of amino acids at the N-terminus, which sequence is not expected to insert into the membrane. If desired, this N-terminal sequence of amino acids can be (i) from the native GPCR, e.g., amino acids 1 through 27 of the angiotensin receptor; (ii) from another GPCR; or (iii) designed de novo. The polypeptide can contain an additional sequence of amino acids to permit facile detection and/or purification, e.g., a stretch of 6 or more histidine residues. In addition, the N-terminal sequence may contain a signal sequence that may be native to the receptor or from another protein known to use a signal sequence to direct an expressed protein to the plasma membrane of a typical eukaryotic cell for membrane insertion or secretion outside ofthe cell. Alternatively, the signal sequence may be prokaryotic in origin to direct an expressed protein to the outer membrane of a typical prokaryotic cell.
[0055] An additional exemplary polynucleotide of the invention encodes a
4TMHR or a 5TMHR that is structurally related to a dopamine receptor (e.g., as described by Jackson and Westlind-Danielsson, Pharmac. Ther. 64:291-369 (1994)). Dopamine is a neurofransmitter found both in the Central Nervous system (CNS) and the periphery. In the CNS, dopamine interacts with a cognate GPCR to mediate a variety of biological functions including locomotor function, cardiovascular homeostasis, sexual function, endocrine regulation and cognition. Several disease states have been associated with defective dopamine neurotransmission, including schizophrenia, Parkinson's disease and various endocrine and cardiovascular abnormalities. As such, GPCRs for dopamine are targets for drug discovery. Examples of ligands that bind to the dopamine receptor include N-methylspiperone (NEN) and dopamine, and tritiated versions of these compounds can be used in ligand binding assays.
[0056] At least 5 distinct receptor subtypes have been identified for dopamine.
The DNA sequences for the human dopamine receptors can be found in GenBank under the following accession numbers: X58987, X59308 and X55760 for Dl ; M30625 and X51362 for D2; L20469 for D3; X58497 for D4; and X58454 for D5. While there are a number of splice variants of the dopamine receptors, a person of ordinary skill in the art can readily account for such variations and utilize conventional hydropathy modeling programs to identify the transmembrane domains of any given dopamine receptor.
[0057] In an exemplary splice variant ofthe D2 dopamine receptor, D2-443, the third TM domain begins at about amino acid number 109 and the sixth TM domain ends at about amino acid number 397. The seventh TM domain ends at about amino acid number 428, and the entire sequence ends at about amino acid number 443. An exemplary 4TMHR derivative of this GPCR can begin at about amino acid number 109 and end at amino acid 397. An exemplary 5TMHR derivative of this GPCR can begin at about amino acid number 109 and end after the seventh TM, at about amino acid number 428. A biologically active 5TMHR can begin, for example at about amino acid number 109 and end at the end ofthe native sequence, at about amino acid number 443.
[0058] Optionally, the 4TMHRs and 5TMHRs can include a predominantly hydrophilic sequence of amino acids at the N-terminus, which sequence is not expected to insert into the membrane. This N-terminal sequence of amino acids can be (i) from the native GPCR, for example amino acids 1 through 24 of D2-443, (ii) from another GPCR, or (ii) designed de novo. As described above, the polypeptides ofthe invention can contain an additional sequence(s) of amino acids to permit facile detection, purification, and/or secretion.
[0059] The polynucleotides that encode the polypeptides of the invention may include: only the coding sequence for the 4TMHR or 5TMHR polypeptide; the coding sequence for the 4TMHR or 5TMHR polypeptide and additional coding sequence; the coding sequence for the 4TMHR or 5TMHR polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns, or non-coding sequence located 5' and/or 3' of the coding sequence for the polypeptide.
[0060] Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide, as well as a polynucleotide which includes additional coding and/or non-coding sequence.
[0061] The polynucleotide of the present invention may be in the form of RNA or in the form of DNA. The coding sequence which encodes the 4TMHR polypeptide may be identical to the coding sequence for a portion of a naturally- occurring GPCR (e.g., amino acids 25-231 shown in FIG. 2 or amino acids 1 -231 shown in FIG. 2). Alternatively, the coding sequence may be a different coding sequence which, as a result ofthe redundancy or degeneracy ofthe genetic code, encodes the same polypeptide as the naturally-occurring DNA.
[0062] The present invention further relates to variants of the hereinabove described polynucleotides which encode fragments, analogs and derivatives (including semi-synthetic variants) of the polypeptides of the invention. "Variant," as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide, respectively, but retains essential properties. A typical variant of a polynucleotide differs in nucleotide sequence from another, reference polynucleotide. Changes in the nucleotide sequence of the variant may or may not alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below. A typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polynucleotide or polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally. Non-naturally occurring variants of polynucleotides and polypeptides may be made by mutagenesis techniques or by direct synthesis. The variant ofthe polynucleotide may be a naturally occurring allelic variant ofthe polynucleotide or a non-naturally occurring variant of the polynucleotide. Preferably, the variant retains the naturally-occurring Cysteine residues found in the transmembrane helices.
[0063] Thus, the present invention includes, for example, polynucleotides encoding amino acid residues 25-231 of the polypeptide shown in FIG. 2, or, optionally, amino acids 1-231 of the polypeptide shown in FIG. 2, as well as variants of such polynucleotides which variants encode a fragment, derivative or analog ofthe polypeptides of FIG. 2. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
[0064] As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the sequence encoding a polypeptide ofthe invention. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function ofthe encoded polypeptide.
[0065] Optionally, the polypeptide may be engineered to contain a site for palmitation to increase expression ofthe polypeptide or increase stability ofthe receptor through membrane anchoring. For example, residues Ala 335 through Leu 347 of the wild-type β2AR can be inserted between helices 5 and 6 in the 4TMHR or 5TMHR. The inserted polypeptide contains determinants for palmitation at Cys 341. A band on an SDS gel can be visualized by Ponceau staining, and the band containing 4TMHR can be analyzed for its lipid composition. If desired, the palmitation sequence can be inserted elsewhere in the 4TMHR gene, e.g. , at the N-terminus, C-terminus, or between helices 3 and 4. If desired, additional residues can be added to the N-terminus or C-terminus to facilitate recognition ofthe sequence by the palmitation machinery.
[0066] If desired, selenomethionine (SeMet) residues can be substituted for methionine residues throughout the polypeptide. Labeling the polypeptide with SeMet permits the use of multiple anomalous dispersion phasing methods to be used in solving the crystal structure of the polypeptide (Hendrickson (1990) EMBOJ. 9: 1665-72). SeMet labeling can be carried out by producing the protein in E. coli, e.g., in the methionine auxotroph strain B834(DΕ3) (Novagen), using conventional methods for SeMet substitution.
[0067] The polynucleotides may also encode a non-glycosylated polypeptide to facilitate the growth of crystals for X-ray diffraction. For example, the polynucleotide can be mutated to encode Glutamine residues in lieu of Asparagine residues, particularly at amino acid residues Asn 6 and/or Asn 15 of β2AR.
[0068] Other polynucleotides that can be used in the invention include variants of the 4TMHRs and 5TMHRs of β2AR that increase the affinity of β2AR for ligands. For example, Asparagine or Glutamine residues can be substituted for Isoleucine 111, Val 114, He 291, and/or Val 292. Similarly, Threonine 123 and/or Leucine 124 can be replaced with Aspartate or Glutamate.
[0069] The polynucleotides ofthe present invention may also have the coding sequence fused in frame to a marker sequence which allows for detection of purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag supplied by a pQE-9 vector to provide for purification ofthe mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g., COS-7 cells, is used. The HA tag corresponds to an epitope, or another tag, derived from the influenza hemagglutinin protein (Wilson, I., et al, Cell 37:767 (1984)).
[0070] The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). It may further include regulatory elements, such as promoters, enhancers, operators, and repressors, as are well known in the art, useful in promoting, regulating, and repressing expression ofthe gene.
[0071] Fragments ofthe polynucleotides ofthe present invention may be used as hybridization probes for a cDNA library to isolate the full length cDNA and to isolate other cDNAs which have a high sequence similarity to the polynucleotides or similar function to the encoded polypeptides. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete gene including regulatory and promoter regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that ofthe gene ofthe present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members ofthe library the probe hybridizes to.
[0072] "Identity" is a measure ofthe identity of nucleotide sequences or amino acid sequences. In general, the sequences are aligned so that the highest order match is obtained. "Identity" per se has an art-recognized meaning and can be calculated using published techniques. See, e.g. : (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A.M., ed., Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D.W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991). Wliile there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J Applied Math (1988) 48:1073. Methods to determine identity and similarity are codifiedin computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program package (Devereux, J., et al, Nucleic Acids Research (1984) 12(1):387), BLASTP, BLASTN. FASTA (Altschul, S.F. et al, JMolec Biol (1990) 215:403).
[0073] As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence, is intended that the nucleotide sequence ofthe polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95%) identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% ofthe total nucleotides in the reference sequence may be inserted into the reference sequence. These mutations ofthe reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
[0074] Similarly, by a polypeptide having an amino acid sequence having at least, for example, 95% "identity" to a reference amino acid sequence, is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids ofthe reference amino acid. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% ofthe total amino acid residues in the reference sequence may be inserted into the reference sequence. These alterations of the reference sequence may occur at the amino or carboxyl terminal positions ofthe reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
[0075] The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 25%, e.g., at least 50 % or 70% identity, preferably at least 90%), and more preferably at least 95% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove- described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same function or biological activity as the 4TMHRs and 5TMHRs ofthe invention.
[0076] Alternatively, the polynucleotide may have at least 20 bases, preferably
30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotides described herein, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.
[0077] Thus, the present invention is directed to polynucleotides having at least
25%) identity, e.g., at least 50% or 70%) identity, preferably at least 90%) identity and more preferably at least a 95% identity to a polynucleotide which encodes a 4TMHR or 5TMHR, e.g., the polypeptide of SEQ ID NO: 2 (which can be encoded by the polynucleotide of SEQ ID NO: 1), as well as fragments thereof, which fragments have at least 30 bases and preferably at least 50 bases, and to polypeptides encoded by such polynucleotides.
[0078] The present invention further relates to a 4TMHR polypeptide which has the amino acid sequence of amino acidresidues 25-231, or, optionally, 1-231 of FIG. 2, as well as fragments, analogs and derivatives of such polypeptides.
[0079] "Polypeptide" refers to any peptide or protein comprising two or more amino acids j oined to each other by peptide bonds or modified peptide bonds, i. e. , peptide isosteres. "Polypeptide" refers to both short chains, commonly referred to as peptides, oligopeptides or oligomers, and to longer chains, generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene- encoded amino acids. "Polypeptides" include amino acid sequences modified either by natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from posttranslational natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F., Posttranslational Protein Modifications : Perspectives and Prospects, pgs. 1 - 12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter et al, "Analysis for protein modifications and non-protein cofactors," Meth Enzymol (1990) 182:626- 646 and Rattan et al, "Protein Synthesis: Posttranslational Modifications and Aging", ,4/w NY Acad Sci (1992) 663 :48-62. [0080] The terms "fragment," "derivative" and "analog" when referring to the polypeptides of the invention mean a polypeptide which either retains substantially the same function as a reference polypeptide, e.g. , retains the ability to bind a ligand for the receptor, or which retains a biological activity of the reference polypeptide, e.g., retains the ability to transduce signal across cell membranes.
[0081] The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, or a semi-synthetic polypeptide, preferably a recombinant polypeptide.
[0082] The fragment, derivative or analog of the polypeptide of the invention may be (i) one in which one or more ofthe amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more ofthe amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which additional amino acids are fused to the polypeptide which are employed for purification of the polypeptide, or (v) one which contains a proprotein sequence, or (vi) one in which a signal sequence is fused to the polypeptide, or (vii) one in which a fragment of the polypeptide is soluble, i.e., not membrane bound, yet still binds ligands to the membrane bound receptor. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
[0083] The polypeptides ofthe present invention include amino acids 25-231 or
1-231 of SEQ ID NO: 2 as well as polypeptides which have at least 25% similarity (preferably at least 15% identity), e.g., 50% or 70% similarity (preferably at least 50 or 70%> identity) and more preferably at least 90%> similarity (more preferably at least 90%> identity) to such polypeptides, and still more preferably at least 95 > similarity (still more preferably at least 95% identity) to such polypeptides. Also included are portions of such polypeptides with such portions ofthe polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.
[0084] "Receptor Activity" or "Biological Activity ofthe Receptor" refers to the ability of a receptor or 5TMHRto transduce signal across a cell membrane so as to initiate a second messenger response. Included are similar activities or improved activities or these activities with decreased undesirable side-effects. The polypeptides of the invention may also have antigenic, i.e., immunogenic activity.
[0085] As known in the art, "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.
[0086] Fragments or portions ofthe polypeptides ofthe present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides ofthe present invention. Preferred fragments ofthe polypeptide of the present invention or fragments of the nucleotide sequence coding therefore, include, for example, truncation polypeptides having the amino acid sequence of 4TMHR polypeptides, except for deletion of a continuous series of residues that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus. Also preferred are fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta- sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions. Other preferred fragments are biologically active fragments, such as biologically active fragments of 5TMHRs. Biologically active fragments are those that transduce signal across cell membranes, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also included are those that are antigenic or immunogenic in an animal, especially in a human.
[0087] The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs ofthe present invention.
[0088] Host cells are genetically engineered (transduced or transformed or fransfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
[0089] The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.. [0090] The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art, such as Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)(the disclosure of which is hereby incorporated by reference).
[0091] The DNA sequence in the expression vector is operatively linlced to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SN40 promoter, the E. coli. lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.
[0092] In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
[0093] The vector containing the appropriate DΝA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein. Introduction of polynucleotides into host cells can be effected by methods described in many standard laboratory manuals, such as Davis et al, BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989) such as calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection. [0094] As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 or S£21 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells.
[0095] A great variety of expression systems can be used. Such systems include, among others, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector suitable to maintain, propagate or express polynucleotides to produce a polypeptide in a host may be used. The appropriate nucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL (supra).
[0096] More particularly, the present invention also includes recombinant constructs comprising one or more ofthe sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence ofthe invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pDlO, phagescript, psiX174, pBluescript SK, pBSKS, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
[0097] Promoter regions can be selected from any desired gene using CAT
(chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
[0098] For secretion ofthe translated protein into the lumen ofthe endoplasmic reticulum, into the periplasmic space or into the extracellular environment, appropriate secretion signals may be incorporated into the desired polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
[0099] In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DE AE-Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, L, Basic Methods in Molecular Biology, (1986)).
[0100] The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides ofthe invention can be synthetically produced by conventional peptide synthesizers. [0101] Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs ofthe present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).
[0102] Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side ofthe replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side ofthe replication origin, and adenovirus enhancers.
[0103] Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation ofthe host cell, e.g. , the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences, and, preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein, such as a protein that includes an identification peptide (e.g., a hexahistidine tag) imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product. In an exemplary fusion protein, the 4TMHR or 5TMHR is fused to a globular, soluble polypeptide. For example, the polypeptide can be fused to the GPCR's natural cytoplasmic ligand, e.g., Gsα, or to a portion of an antibody, e.g., Fv. A fusion protein containing a 4TMHR or 5TMHR fused to a Gsα would increase the amount of hydrophilic surface area on the polypeptide, facilitating crystallization of the polypeptide. Alternatively, the polypeptide can be fused to an Arc repressor (e.g., using the plasmid pSA700). Soluble fusion proteins containing the Arc polypeptide then can be selected for by using conventional methods.
[0104] ' Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance ofthe vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
[0105] As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements ofthe well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GΕM1 (Promega Biotech, Madison, Wis., USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
[0106] Following transformation of a suitable host strain and growth ofthe host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
[0107] Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art. If desired, the polypeptides ofthe invention may be solublized from plasma membranes in digitonin using conventional techniques.
[0108] Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa, HEK and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking non-transcribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required non- transcribed genetic elements.
[0109] The polypeptides of the invention can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, metal affinity chromatogaphy (e.g., Ni-NTA), and lectin chromatography. Optionally, high performance liquid chromatography (HPLC) can be employed in the purification steps. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. For example, protein refolding can be carried out in the presence of protein disulfide isomerase (PDI). Refolding can also be carried out in the presence of a high affinity ligand, e.g., alprenolol (e.g., at 1 μM). The alprenolol can subsequently be removed by dialysis. In an alternative method, hydrostatic pressure can be used as a mild denaturant to facilitate protein refolding. For example, refolding can be carried out by incubating the polypeptide in 3M urea at 2.5 lcbar, then slowly releasing pressure. If desired, alprenolol affinity chromatography can be used, typically as a final purification step.
[0110] In an exemplary method, purification of β2AR can be carried out as follows: inactive β2AR is purified from E. coli inclusion bodies by Ni-NTA affinity chromatography, then bound to heparin-sepharose resin via an Arg6 tail in a buffer containing GuCl. The concentration of GuCl is lowered from 6 to 0M in the presence of PDI and a mixture of reduced and oxidized glutathione. Thus, the efficiency of protein refolding was greater in the presence of PDI than in the absence of PDI. The efficiency of refolding of β2AR could be further increased by deleting residues 355-413 to delete two Cysteine residues.
[0111] The polypeptides of the present invention may be naturally purified products, or products of chemical synthetic procedures (including, for example, complete synthesis as polypeptides), or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides ofthe present invention may be glycosylated or may be non-glycosylated. Polypeptides ofthe invention may also include an initial methionine amino acid residue.
[0112] The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics to human disease. For example, the polypeptides can be used in structure-based drug design methods. Conventional methods can be used to crystallize the polypeptides ofthe invention and to solve their crystal structures. Suitable techniques are described in Methods in Εnzymology, vol. 276, Macromolecular Crystallography part A ( 1997), Academic Press, eds. Charles W. Carter, Jr. and Robert M. Sweet. If desired, the polypeptides can be crystallized in lipid cubic phases formed by mixing lipids such as monoolein with aqueous buffer containing detergents and protein, then centrifuging the mixtures (e.g., for 2 hours at 10,000 rpm). [0113] Crystals of the 4TMHRs and 5TMHRs of the invention can be used in conventional molecular replacement methods to solve the structures of wild-type 7TMHRs (see, e.g., Hoppe, Acta Crystal 10:750-751 (1957) and Rossman and Blow, ActaCrystal 15:24-31 (1962)). Generally, molecular replacement methods use a polypeptide having a Icnown 3 -dimensional structure to build a model of a second polypeptide. Preferably, the model is structurally similar to all or a fragment ofthe second polypeptide. The model is rotated then translated into the unit cell ofthe target crystal of unknown structure to search for a fit between the observed and calculated X-ray diffraction data. If the model provides a good fit, the model can be used for subsequent model refinement and rebuilding of the model.
[0114] Crystals containing apolypeptide ofthe invention bound to a ligand (e.g., a drug, such as an agonist or antagonist) can also be used in X-ray diffraction studies. Examination of a high-resolution structure of a polypeptide-ligand complex can be useful in improving the potency of a drug (i.e., a lead compound) through art-known structure-based drug design methods.
[0115] The present invention also relates to the use of 4TMHR or 5TMHR polynucleotides for use as diagnostic reagents. Detection of a mutated form of a GPCR gene associated with a dysfunction will provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from under-expression, over-expression or altered expression of GPCR. Mutations in the GPCR gene may be detected at the DNA level by a variety of techniques.
[0116] Nucleic acids for diagnosis may be obtained from a subject's cells or bodily fluids, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled 4TMHR or 5TMHR nucleotide sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence differences may also be detected by alterations in electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing. See, e.g. , Myers etal, Science (1985) 230:1242. Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method. See Cotton et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401. In another embodiment, an array of oligonucleotides probes comprising 4TMHR or 5TMHR nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of, e.g., genetic mutations. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability. (See for example: M. Chee et al, Science 274:610-613 (1996)).
[0117] The polypeptides ofthe present invention may be employed in a process for screening for antagonists and/or agonists for G-protein coupled receptors. G- protein coupled receptors are ubiquitous in the mammalian host and are responsible for many biological functions, including many pathologies. Accordingly, it is desirous to find compounds and drugs which stimulate the G- protein coupled receptors on the one hand or which can antagonize a G-protein coupled receptor on the other hand, when it is desirable to inhibit the G-protein coupled receptor.
[0118] In general, such screening procedures involve providing appropriate cells which express the receptor on the surface thereof. In particular, a polynucleotide encoding the receptor ofthe present invention is employed to transfect cells to thereby express the 4TMHRs or 5TMHRs Such transfection may be accomplished by procedures as hereinabove described. Functional 4TMHRs or functional 5TMHRs can be used in methods for determining whether a compound binds the 4TMHR or 5TMHR. Biologically active 5TMHRs can be used in methods for determining whether a compound induces signal or inhibits signal transduction.
[0119] One such screening procedure involves the use of melanophores that are fransfected to express a biologically active 5TMHRs of the present invention. Such a screening technique is described in PCT WO 92/01810 published Feb. 6, 1992. Screening methods can also be carried out using cell membrane preparations.
[0120] Thus, for example, such assay may be employed for screening for a receptor antagonist by contacting the melanophore cells which express the biologically active 5TMHR with both the receptor ligand and a compound to be screened. Inhibition ofthe binding ofthe receptor ligand, or inhibition of a signal generated by the ligand, indicates that a compound is a potential antagonist for the receptor and for the corresponding 7TMHR, i.e., inhibits binding to and/or activation ofthe receptor.
[0121] This method may also be employed to identify an agonist by contacting the melanophore cells that express a biologically active 5TMHR with compounds to be screened. Compounds that induce signal across the cell membrane are agonists for the receptor.
[0122] Other screening techniques include the use of cells which express the
5TMHR (for example, transfected CHO cells) in a system which measures extracellular pH changes caused by receptor activation, for example, as described in Science 246:181-296 (October 1989). For example, potential agonists or antagonists may be contacted with a cell which expresses the biologically active 5TMHR, and a second messenger response, e.g. signal transduction or pH changes, may be measured to determine whether the potential agonist or antagonist is effective.
[0123] Another such screening technique involves introducing RNA encoding the biologically active 5TMHR into Xenopus oocytes to transiently express the receptor. The oocytes may then be contacted (in the case of antagonist screening) with the receptor ligand and a compound to be screened, followed by detection of inhibition of a calcium signal. To determine whether a compound is an agonist, the oocyte is contacted with the compound, and the induction of a calcium signal is detected.
[0124] Another screening technique involves expressing a 5TMHR in which the receptor is linked to a phospholipase C or D. Endothelial cells, smooth muscle cells, embryonic kidney cells, etc. may be used in this method. The screening for an antagonist or agonist may be accomplished by detecting activation of the receptor or inhibition of activation ofthe receptor from the phospholipase second signal.
[0125] Another method involves screening for antagonists by detecting inhibition of binding of labeled ligand to cells which have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding the 4TMHR or 5TMHR such that the cell expresses the receptor on its surface and contacting the cell with a potential antagonist in the presence of a labeled form of a known ligand. The ligand can be labeled, e.g. , by radioactivity or with a fluorescent or enzymatic tag. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound is an antagonist, the binding of labeled ligand to the receptor is inhibited.
[0126] Another method involves screening for antagonists or agonists by detecting inhibition or stimulation of receptor-mediated cAMP and/or adenylate cyclase accumulation. Such a method involves transfecting a eukaryotic cell with a biologically active 5TMHR of this invention to express the receptor on the cell surface. The cell is then exposed to potential antagonists in the presence of a ligand ofthe receptor. The amount of cAMP accumulation is then measured. If the potential antagonist binds the receptor, and thus inhibits ligand binding, the levels of receptor-mediated cAMP, or adenylate cyclase, activity will be reduced. Alternatively, the cell is exposed to a potential agonist. If the potential agonist binds the receptor, receptor-mediated cAMP and/or adenylate cyclase accumulation increases. Another method for detecting agonists or antagonists of the receptors ofthe present invention is the yeast-based technology as described in U.S. Patent No. 5,482,835.
[0127] Further, the assays may simply include the steps of mixing a candidate compound with a solution containing a biologically active 5TMHR polypeptide to form a mixture, measuring 5TMHR activity in the mixture, and comparing the 5TMHR activity ofthe mixture to a standard. The 5TMHR may be in any of a variety of suitable forms for measuring activity, e.g. , it may be purified, partially purified, on whole cells, on cell membranes, in liposomes, or in detergent micelles.
[0128] Other assays may simply determine whether a compound binds a functional 4TMHR or 5TMHR, wherein binding ofthe compound to cells bearing the receptor is detected by means of a label that is directly or indirectly associated with the compound. Alternatively, binding can be detected in an assay involving competition with a labeled competitor compound, using detection systems appropriate to the cells bearing the receptor at their surfaces. Inhibitors of activation are generally assayed in the presence of a known agonist, and the inhibition of binding ofthe agonist in the presence ofthe compound is observed. Numerous such assays are known to those of ordinary skill in the art. Optionally, an intact 7TMHR can subsequently be used to confirm that the compound binds to and activates the receptor, or inhibits activation.
[0129] The present invention also provides a method for determining whether a ligand not known to be capable of binding to a 4TMHR or 5TMHR can bind to such receptor, which method includes contacting a mammalian cell that expresses a 4TMHR or 5TMHR with the ligand under conditions permitting binding of ligands to the 4TMHR or 5TMHR, detecting the presence of a ligand which binds to the receptor and thereby determining whether the ligand binds to the 4TMHR. The systems hereinabove described for detecting agonists and/or antagonists may also be employed for determining ligands which bind to the receptor. It is to be understood that an agonist or antagonist that binds to a 4TMHR or 5TMHR will also bind to a G-protein coupled receptor, and therefore the 4TMHR or 5TMHR provides a model for study of binding of agonists and antagonists to full-length G-protein coupled receptors.
[0130] Thus, polypeptides ofthe invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. These substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics. See Coligan et al, Current Protocols in Immunology 7(2j:Chapter 5 (1991).
[0131] In general, antagonists for 4TMHRs, 5TMHRs, and G-protein coupled receptors which are identified by screening procedures may be employed for a variety of therapeutic purposes. For example, such antagonists can be used in the treatment of hypertension, angina pectoris, myocardial infarction, ulcers, allergies, psychoses, depression, migraine, vomiting, benign prostatic hypertrophy, and psychotic and neurological disorders, including schizophrenia, manic excitement, depression, delirium, dementia or severe mental retardation, dyskinesias, such as Huntington's disease or Gilles de la Tourett's syndrome, among others. G-protein coupled receptor antagonists can also be used in reversing endogenous anorexia and in the control of bulimia.
[0132] Examples of 4TMHR, 5TMHR and G-protein coupled receptor antagonists include an antibody, or in some cases an oligopeptide, which binds to the biologically active 5TMHRs or G-protein coupled receptors but does not elicit a second messenger response such that the activity of the 5TMHR or G- protein coupled receptor is inhibited. Antibodies include anti-idiotypic antibodies which recognize unique determinants generally associated with the antigen- binding site of an antibody. Potential antagonists also include small molecules, e.g., biogenic amines, that are closely related to a ligand ofthe G-protein coupled receptor and 4TMHR or 5TMHR, e.g., a fragment ofthe ligand, which has lost biological function and when binding to the G-protein coupled receptor or biologically active 5TMHR, elicits no response. [0133] A potential antagonist ' also includes an antisense construct prepared through the use of antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion ofthe polynucleotide sequence, which encodes the polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region ofthe gene involved in transcription (triple helix - see Lee et al, Nucl. Acids Res. (5:3073 (1979); Cooney et al, Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991)), thereby preventing transcription and the production of GPCR. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the GPCR (antisense — Olcano, J. Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inliibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of GPCRs.
[0134] Another potential antagonist is a small molecule which binds to the G- protein coupled receptor, making it inaccessible to ligands such that normal biological activity is prevented. Examples of small molecules include but are not limited to biogenic amines, small organic molecules, or peptides or peptide-like molecules.
[0135] Potential antagonists also include a soluble form of a 4TMHR or 5TMHR, which binds to the ligand and prevents the ligand from interacting with membrane-bound GPCRs.
[0136] The antagonists may be used to treat hypertension by controlling β-adrenergic receptors from stimulating cardiac contractility and lowering heart rate. The antagonists may also be used to prevent vasoconstriction controlled by α-adrenergic receptors. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described. [0137] The agonists identified by the screening method as described above, may be employed to stimulate the α-adrenergic receptor for the treatment of upper respiratory conditions, e.g., allergic rhinitis, hay fever, acute coryzaand sinusitis. Stimulating the α-adrenergic receptors constricts the nasal mucosal blood vessels, lessening secretions, and edema, α-adrenergic receptors also control pupil dilation and uterine inhibition; therefore, the agonists may also be used to stimulate those actions.
[0138] Agonists for 4TMHRs, 5TMHRs and G-protein coupled receptors are also useful for therapeutic purposes, such as the treatment of asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis. In general, agonists are employed for therapeutic and prophylactic purposes for such conditions as infections such as bacterial, fungal, protozoan and viral infections, particularly infections caused by HIV-1 or HIV-2; pain; cancers; diabetes, obesity; anorexia; bulimia; asthma; Parkinson's disease; acute heart failure; hypotension; hypertension; urinary retention; osteoporosis; angina pectoris; myocardial infarction; ulcers; asthma; allergies; benign prostatic hypertrophy; and psychotic and neurological disorders, including anxiety, schizophrenia, manic depression, delirium, dementia, severe mental retardation and dyskinesias, such as Huntington's disease or Gilles de la Tourett's syndrome.
[0139] β-Adrenergic receptors mediate vasorelaxation. Stimulating β-adrenergic receptors by the administration of an agonist may be used to treat bronchial asthma by causing bronchial smooth muscle relaxation and modulating mediator release, at least in part by stimulating the adenylyl cyclase-cAMP system. Stimulating β-adrenergic receptors and consequent vasorelaxation may also be used to treat coronary artery disease, atherosclerosis and arteriosclerosis.
[0140] This invention additionally provides a method of treating an abnormal condition related to an excess of G-protein coupled receptor activity which comprises administering to a subject the antagonist as hereinabove described along with a pharmaceutically acceptable carrier in an amount effective to block binding of ligands to the G-protein coupled receptors and thereby alleviate the abnormal conditions.
[0141] The invention also provides a method of treating abnormal conditions related to an under-expression of G-protein coupled receptor activity which comprises administering to a subject a therapeutically effective amount of the agonist described above in combination with a pharmaceutically acceptable carrier, in an amount effective to enhance binding of ligands to the G-protein coupled receptor and thereby alleviate the abnormal conditions.
[0142] The polypeptides, antagonists, or agonists may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration. Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
[0143] The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions ofthe invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the compounds of the present invention may be employed in conjunction with other therapeutic compounds.
[0144] The pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
[0145] The 4TMHR or 5TMHR polypeptides, and antagonists or agonists that are polypeptides, may be employed in accordance with the present invention by expression of such polypeptides in vivo (see, e.g., Chapter 20, "Gene Therapy and Other Molecular Genetic-based Therapeutic Approaches," (and references cited therein) in Human Molecular Genetics, T. Strachan and A. P. Read, BIOS Scientific Publishers Ltd. (1996)).
[0146] Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be provided with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures Icnown in the art by use of a retroviral particle containing RNA encoding a polypeptide ofthe present invention.
[0147] Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a subject for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide ofthe present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovirus, for example, an adenovirus which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
[0148] Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses suchasRous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
[0149] The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques 7(9):980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and β-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvo virus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
[0150] The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adeno viral promoters, such as the adeno viral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described) ; the β-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the genes encoding the polypeptides.
[0151] The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP+E-86, GP+envAml2, andDAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP04 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
[0152] The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
[0153] In another approach, soluble, functional forms of 4TMHR or 5TMHR polypeptides capable of binding the ligand in competition with endogenous 7TMHR may be administered to a patient. Typical embodiments of such competitors comprise fragments of the 4TMHR polypeptide. In still another approach, expression of the gene encoding the endogenous GPCR can be inhibited using expression blocking techniques. Known such techniques involve the use of antisense sequences, either internally generated or separately administered. See, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inliibitors of Gene Expression, CRC Press, Boca Raton, FL ( 1988) . Alternatively, oligonucleotides which form triple helices with the gene can be supplied. See, for example, Lee et al, Nucleic Acids Res (1979) 6:3073; Cooney et al, Science (1988) 241 :456; Dervan et al, Science (1991) 251 :1360. These oligomers can be administered per se or the relevant oligomers can be expressed in vivo.
[0154] The present invention also provides a method for identifying receptors related to the receptor polypeptides of the present invention. These related receptors may be identified by homology to a receptor polypeptide ofthe present invention, by low stringency cross hybridization, or by identifying receptors that interact with related natural or synthetic ligands and or elicit similar behaviors after genetic or pharmacological blockade of the receptor polypeptides of the present invention. The detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g. , Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.
[0155] In addition, some diseases are a result of, or are characterized by changes in gene expression which can be detected by changes in the mRNA. Alternatively, the genes of the present invention can be used as a reference to identify individuals expressing a decrease of functions associated with receptors of this type.
[0156] The sequences ofthe present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
[0157] Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis ofthe cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment. [0158] PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow- sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
[0159] Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases. For a review of this technique, see Verma et al, Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).
[0160] Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
[0161] Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all ofthe affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent ofthe disease.
[0162] With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 lcb).
[0163] The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures Icnown in the art may be used for the production of such antibodies and fragments.
[0164] Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtaine'd will then bind the polypeptides itself In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
[0165] For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature 256:495- 497), the trioma technique, the human B-cell hybridoma technique (Kozbor etal, 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, etal, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R Liss, Inc., pp. 77-96).
[0166] Techniques described for the production of single chain antibodies (U.S.
Pat. No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
[0167] The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography. Antibodies against 4TMHR polypeptides may also be employed for treatment and therapy. [0168] The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
[0169] In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.
[0170] "Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are Icnown in the art and will be apparent to the ordinarily skilled artisan.
[0171] "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used in accordance with conventional methods. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37 ° C are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction may electrophoresed directly on a polyacrylamide gel to isolate the desired fragment. Size separation ofthe cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al, Nucleic Acids Res. 8:4057 (1980).
[0172] "Oligonucleotides" refers to either a single stranded polydeoxyribonucleotide or two complementary poly deoxyribonucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
[0173] "Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al, Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts ofthe DNA fragments to be ligated.
[0174] Unless otherwise stated, transformation was performed as described inthe method of Sambrook et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).
[0175] The following examples illustrate the present invention and the advantages thereof.
EXAMPLES
[0176] The following examples are set forth to illustrate the invention, not limit the scope ofthe invention.
Materials
[0177] Molecular biology reagents were purchased from Fisher unless otherwise indicated. Oligonucleotides were purchased from Genosys. Restriction enzymes, DNA ligase, and polymerases were purchased from New England Biolabs. Transfection reagents, pCEP4 vector, and HEK293E cell lines were purchased from Invitrogen. Radiolabeled 1 5I-C YP was purchased from NEN. Other β2AR effectors were purchased from Sigma. Design and Construction of β2AR-4TMHR
[0178] The initial β2AR-4TMHR construct was designed to incorporate the
N-terminal extracellular region (residues Met 1- Val 24) fused to helices 3-6 (residues Thr 100-Glu 306), as depicted in FIG. 1. This design retains the two N-linked glycosylation sites at Asn 6 and Asn 15, and the majority of residues implicated in ligand-bonding, located on transmembrane helices 3-6 (Kolakowski, 1994; Schwartz, 1994; Dixon, etal., 1987). The gene for wild-type β2AR was digested with Kpnl and Xbal, and ligated into a pCEP4 mammalian expression plasmid (Invitrogen) digested with Kpnl and Nhe , to produce plasmid pKR184.
[0179] The β2AR-4TMHR sequence was PCR amplified using oligonucleotides
4TMHR- IF (5 ' -CCAGACGTCACTTTTGGCAACTTCTGGTGCGAG-3 ') (SEQ ID NO: 6) and 4TMHR-2R (5'- AAGCTTACTTGTCATCGTCATCCTT GTAGTCCCCGGGGTCGACGTGGTGATGATGGTGGTGCCGCCCCTCGA TTCTCGATTCCTTACGGATGAGGTTATCCTGG-3') (SEQ ID NO: 7) as primers, and the β2AR gene as a template. The resulting product was placed in a TOPO-TA vector (Invitrogen). This reaction produced a fragment ofthe β2AR gene coding for residues Thr 100-Glu 306 followed by a Factor-Xa cleavage site, a six histidine tag and a flag tag, with an Aatll site at the 5 ' end and a Hindlll site at the 3 ' end. The fragment was digested with Aatll and a Hindlll, and subcloned into the TOPO-TA vector containing full-length β2AR between the Aatll and Hindlll sites. Subsequently, the desired β2AR-4TMHR gene was digested with Kpnl and Hindlll, and subcloned into vector pKR184 into the same sites.
[0180] The β2AR-5TMHR construct was built using the 4TMHR-1F oligonucleotide as the forward primer and 5TMHR-2R (5 ' -AAG CTT ACT TGT CAT CGT CAT CCT TG -3 ') (SEQ ID NO: 8) as the reverse primer in a PCR reaction to amplify 5TMHR from the full length β2AR gene. This reaction produced a fragment of the β2AR gene coding for residues Thr 100-Leu 413 followed by a Factor-Xa cleavage site, a six histidine tag and a flag tag, with an Aatll site at the 5' end and a Hindlll site at the 3' end. This PCR fragment was digested with Aatll and Hindlll and ligated into the TOPO-TA vector containing full-length β2AR between the Aatll and Hindlll sites. This step was followed by another digestion with Kpnl and Hindlll to isolate the β2AR-5TMHR gene which was subcloned into pKR184 at the Kpnl and Hindlll sites. All constructs were confirmed by DNA sequencing.
Expression in Mammalian Cells
Vectors harboring the β2AR-4TMHR and β2AR-5TMHR genes were transfected using LIPOFECTAMINE 2000™ (Life Technologies) into human embryonic kidney cells (HEK293 cells) growing at about 80%o confluence in T 75 flasks. Duplicate samples of a pCEP4 plasmid harboring the wild-type β2AR gene and an empty control vector were transfected at the same time. The DNA concentration was -0.2 μg/μl for each vector. For each culture, 13 μg of DNA, 45 μl of LIPOFECTAMINE 2000™, and 780 μl of Opti-MEM were used. Two sets of transformations were carried out: one for transient expression, and one for generation of stable cell lines. After 48 hours, one set of cells was harvested to check the expression, and the second set was placed under Hygromycin selection to generate stably transfected cell lines. The cells were lysed with NP-40 lysis buffer (25 mM Tris, 137 mMNaCl, protease inhibitor cocktail, and 1% NP-40) by vortexing on ice twice for 1 minute (with 15 minutes of incubation on ice between each vortex). After lysis, cells were centrifuged for 5 minutes at 250 x g. Expression levels of 4TMHR, 5TMHR, and wild-type β2ARwere determined by SDS-PAGE and Western blot analysis of 20 μg of protein from a total cell lysate. The pCEP4 vector was used as a control. The Western blots were probed with antibodies specific to β2AR and/or the C-terminal flag tag. Relative expression levels are set forth in Fig. 5. Ligand Binding
[0182] To test expression levels and ligand affinities, ligand binding assays can be performed using radiolabeled 125I-cyanopindolol (125ICYP) (NEN). ICYP is an antagonist for β2AR and binds with a Kd of ~50 pM. The first set of assays is designed to measure total expression level. Increasing concentrations of l25ICYP can be incubated for 2 hours with cell extract samples from each cell line (β2AR- 4TMHR, β2AR-5TMHR, wild-type β2AR, and control plasmid) in 96-well filter plates. The samples are washed extensively, and the radioactive counts quantitated using a Wallach MicroBeta Scintillation Top Counter. The moles of 125ICYP bound can be determined by dividing the counts retained by the total counts added to each well, and multiplying by the specific activity of 125ICYP. The maximum value for moles 125ICYP bound is taken to be equal to the moles of active receptor.
[0183] Alternatively, if the expression levels ofthe receptors are reduced relative to the expression levels of wild-type β2AR (<0.1%>), and/or the affinity of the receptors for 125ICYP is reduced (Kd > 20 nM), other ligand binding techniques can be employed to measure expression levels. Briefly, membranes can be prepared containing the expressed receptor, as previously described. The membranes can be resuspended in assay buffer and placed in mini dialysis units (PIERCE Chemicals) and dialyzed against buffer containing 3H-alprenolol (NEN). Alprenolol is a well characterized β2AR antagonist with reported affinities for the wild-type receptor ranging from 5-20 nM. This equilibrium dialysis method allows the accurate determination of equilibrium constants for radioligands having low affinities. This method is suitable for affinities from 5- 5000 nM.
[0184] The amounts of free and bound ligand can be quantitated using a Wallach
MicroBeta Top Counter. Conventional methods can be used to analyze the data and generate Scatchard plots. If desired, the receptor can be solubilized in detergent and then partially purified from the membrane preparation. Digitonin or dodecyl-β-maltoside, for example, can be used for solubilization. Solubilized receptor can be applied to a Ni-NTA resin, and the protein will be eluted with an increasing concentration of imidazole. The protein-containing material can then be applied to a flag peptide affinity resin. The resin can be washed, and the protein can eluted with an anti-flag specific peptide. These two sequential purification steps will increase the specific activity ofthe protein preparation, and the equilibrium dialysis protocol will be repeated. Competition experiments with other β2AR ligands can be performed, and the ranking order ofthe ligands can be determined. Preferably, the values for the dissociation constants range from 1 fold to 1000 fold (e.g., 1-100 or 1-10 fold) ofthe values for wild-type β2AR. The ranking order for antagonists preferably is (-) iodo-cyanopindolol > (-) alprenolol = (+) alprenolol = (-) propranolol = (+) propranolol, and for agonist (-) isopreterenol = (+) isopreterenol > (-)epinephrine = (+) epinephrine. More preferably, the ranking order for antagonists is (-) iodo- cyanopindolol > (-) alprenolol > (-) propranolol > (+) alprenolol > (+) propranolol, and for agonist (-) isopreterenol > (+) isopreterenol > (-)epinephrine > (+) epinephrine. Most preferably, the ranking order for all ligands is (antagonist and agonist) iodo-cyanopindolol > (-) alprenolol > (-) propranolol > (+) alprenolol > (+) propranolol > (-) isopreterenol > (+) isopreterenol > (-) epinephrine > (+) epinephrine, as is observed for the wild-type receptor. Equilibrium ligand dissociation constants (Kd) for wild-type β2AR (average values reported in the literature) are set forth in Table 1. Table 1 Equilibrium ligand dissociation constants (KJ) for wild-type β2AR
Figure imgf000059_0001
Membrane Localization
[0186] To confirm that the polypeptides of the invention are exported to the plasma membrane, cells can be homogenized in a physiologically relevant buffer containing sucrose. Nuclei and unlysed cells can be removed by centrifugation at 1000 x g. The supernatant can be applied to a discontinuous sucrose gradient and centrifuged at high speed (e.g., 100,000 xg for 12 hours). Gradient fractions can be collected and "bookkeeping" enzymes can be assayed to identify the organelle and plasma membrane fractions. All fractions can be tested, as previously described, for their ability to bind to ligands. The presence of the β2AR polypeptides can be confirmed by Western blot analysis, using anti-β2AR and anti-flag antibodies. Once the mature form of β2AR is identified in the plasma membrane, treatment with N-Glyc-F, a deglycosylating enzyme, can be used to confirm glycosylation ofthe truncated receptor by observing changes in electrophoretic mobility by SDS-PAGE.
Measurement of G-protein Coupling
[0187] G-protein coupled receptors that are expressed in HEK293E cells are functionally coupled to (i) the activation of PLC and calcium immobilization, (ii) stimulation or inhibition of adenylate cyclase; and (iii) coupling to G-proteins , which results in the uptake of GTP-γ-35S. Expression of wild-type β2AR in HEK293E cells in the presence of a β2AR agonist results in a transient increase of intracellular calcium levels, cAMP elevation, and uptake of GTP-γ-35S by coupling ofthe receptor through the corresponding signal transduction pathways.
[0188] If desired, HEK293E cells expressing a 5TMHR or 4TMHR can be assayed for G-protein coupling. The 4TMHR polypeptides are engineered to lack most ofthe components for G-protein binding and preferably do not result in G- protein coupling. In contrast, the 5TMHR polypeptides are engineered to retain the G-protein binding motifs and preferably result in G-protein coupling.
[0189] To assay for G-protein coupling, cells can be loaded with Fluo-4, a fluorescent calcium chelator (Molecular Probes). A calcium influx assay is performed in 96-well plates by incubating 100,000-200,000 cells with increasing concentrations of antagonist and agonist. An increase in fluorescence will be observed in the presence of agonist, indicating that the receptor is able to couple to G-proteins and activate the appropriate signal transduction pathways. Similarly, an elevation of intracellular cAMP levels and an increase in GTP-γ-35S uptake are expected in the presence of agonist, indicating coupling of the engineered receptor to G-proteins and downstream effectors. cAMP levels can be quantified using conventional methods, and GTP-γ-35S can be quantified using a Wallach MicroBeta Top Counter.
[0190] If desired, basal cAMP levels can be quantified to determine whether the
5TMHR and 4TMHR are constitutively active forms ofthe receptor. Preferably, calcium transients, cAMP elevation and GTP-γ-35S uptake are detected in the presence of agonist. Also, (-) isopreterenol preferably binds with greater affinity than does (-) epinephrine. The EC50 values for these agonists preferably will be 1 fold to 1000 (e.g., 1-100 or 1-10) fold for those observed for the wild- type β2-AR. High Throughput Screening
[0191] A high throughput screening method can be used to assay proper refolding ofthe isolated polypeptides ofthe invention. In addition, such a method can be used to determine whether a compound binds to a polypeptide ofthe invention. Such screening can be carried out using the fluorescence microplate thermal shift assay disclosed in U.S. Patent No. 6,020,141; U.S. Patent No. 6,036,920; and international patent publication no. WO 97/42500, each of which is incorporated herein by reference. Generally, this method is based upon the observation that hydrophobic dyes bind to proteins when the proteins are in a partially denatured state. Thus, the invention provides a fluorescent indicator of stability for virtually any purified protein of interest. The stability of proteins to thermal denaturation is measured by monitoring dye fluorescence in a 96- or 384-well format. Test compounds can be included in each well, with compounds that bind to the polypeptides with high affinity producing large changes in the stability of the polypeptides.
[0192] If desired, radioligand binding assays using whole cells, membrane preparations or purified receptors can provide a method for screening a library of compounds. Also, calcium transients, fluctuations of cAMP levels and uptalce of GTP-γ-35S in functional assays can be used in high throughput screening applications.

Claims

WHAT IS CLAIMED IS:
1. A polypeptide consisting essentially of four transmembrane helices of a seven transmembrane helix G-protein coupled receptor (GPCR) and three connector polypeptides, said four transmembrane helices being linlced in tandem by said three connector polypeptides, and said four transmembrane helices collectively defining a ligand binding site for the seven transmembrane helix GPCR, wherein said polypeptide binds to the same ligands as does the seven transmembrane helix GPCR.
2. A polynucleotide encoding the polypeptide of claim 1.
3. A gene comprising the polynucleotide of claim 2.
4. A vector comprising the gene of claim 3.
5. A host cell comprising the vector of claim 4.
6. A method of producing the polypeptide of claim 1 comprising inserting a vector containing a polynucleotide sequence encoding said polypeptide into a host cell, maintaining said host cell under conditions such that said polypeptide is expressed, then collecting the polypeptide.
7. A host cell comprising the polypeptide of claim 1.
8. A method of measuring ligand binding to a GPCR comprising bringing a ligand into contact with a polypeptide of claim 1, and measuring binding ofthe ligand to said polypeptide.
9. A method of treating an illness caused by faulty expression of a GPCR comprising treating a patient in need thereof with an effective amount of the polypeptide of claim 1.
10. A method of treating an illness caused by faulty expression of a GPCR comprising treating a patient in need thereof with an effective amount of the polynucleotide of claim 2.
11. The polypeptide of claim 1, wherein the seven transmembrane helix GPCR binds to a biogenic amine.
12. The polypeptide of claim 1, wherein the seven transmembrane helix GPCR is selected from the group consisting of an adrenergic receptor, a dopamine receptor, an angiotensin receptor, an adenosine receptor, and a histamine receptor.
13. The polypeptide of claim 1 , wherein the polypeptide has relative binding affinities for ligands substantially similar to the relative binding affinities for the same ligands to the seven transmembrane helix GPCR.
14. The polypeptide of claim 1, wherein at least one of said three connector polypeptides is hydrophilic.
15. The polypeptide of claim 1, wherein at least one of said 3 connector polypeptides is identical in sequence to a naturally occurring connector polypeptide.
16. A fusion polypeptide comprising
(i) the polypeptide of claim 1 covalently linlced to (ii) a second polypeptide, wherein said second polypeptide is a non-transmembrane polypeptide.
17. The fusion polypeptide of claim 16, wherein the second polypeptide comprises all or a portion ofthe extracellular N-terminus of a GPCR.
18. The fusion polypeptide of claim 16, wherein the second polypeptide comprises a signal sequence.
19. The fusion polypeptide of claim 16, wherein the second polypeptide comprises a marker sequence.
20. A macromolecular complex comprising the polypeptide of claim 1 and a ligand of a seven transmembrane helix GPCR.
21. The polypeptide of claim 1, wherein said four transmembrane helices consist of transmembrane helices 3, 4, 5, and 6 of said seven transmembrane helix GPCR.
22. The polypeptide of claim 1, wherein said four transmembrane helices consist of transmembrane helices 3, 5, 6, and 7 of said seven transmembrane helix GPCR.
23. A polypeptide consisting essentially of five transmembrane helices of a seven transmembrane helix G-protein coupled receptor (GPCR) and four connector polypeptides, said five transmembrane helices being linlced in tandem by said four connector polypeptides, and said five transmembrane helices collectively defining a ligand binding site for the seven transmembrane helix GPCR, wherein said polypeptide binds to the same ligands as does the seven transmembrane helix GPCR.
24. A polynucleotide encoding the polypeptide of claim 23.
25. The polypeptide of claim 23, wherein said five transmembrane helices consist of transmembrane helices 3, 4, 5, 6, and 7 of said seven transmembrane helix GPCR.
26. A fusion polypeptide comprising
(i) the polypeptide of claim 23 covalently linked to (ii) a second polypeptide, wherein said second polypeptide is a non-transmembrane polypeptide.
27. The fusion polypeptide of claim 26, wherein the second polypeptide comprises all or a portion ofthe extracellular N-terminus of a GPCR.
28. The fusion polypeptide of claim 26, wherein the second polypeptide comprises all or a portion ofthe intracellular C-terminus of a GPCR.
29. The fusion polypeptide of claim 28, wherein the fusion polypeptide is biologically active.
30. A method for measuring ligand binding to a GPCR comprising bringing a ligand into contact with a biologically active polypeptide of claim 29, and measuring the ability of the biologically active polypeptide to transduce signal.
31. A method of treating an illness caused by faulty expression of a GPCR comprising treating a patient in need thereof with an effective amount of the polypeptide of claim 23.
32. A method of treating an illness caused by faulty expression of a GPCR comprising treating a patient in need thereof with an effective amount of the polynucleotide of claim 24.
33. A crystal comprising the polypeptide of claim 1.
34. A crystal comprising the polypeptide of claim 23.
35. The polypeptide of claim 1, wherein the polypeptide has the same hierarchy of binding affinities for ligands as the hierarchy of binding affinities for the same ligands to the seven transmembrane helix GPCR.
36. The polypeptide of claim 23 , wherein the polypeptide has the same hierarchy of binding affinities for ligands as the hierarchy of binding affinities for the same ligands to the seven transmembrane helix GPCR.
PCT/US2001/015262 2000-05-12 2001-05-11 Gpcr 4-helix and 5-helix bundles WO2001087976A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001259743A AU2001259743A1 (en) 2000-05-12 2001-05-11 Gpcr 4-helix and 5-helix bundles

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US20379800P 2000-05-12 2000-05-12
US60/203,798 2000-05-12

Publications (2)

Publication Number Publication Date
WO2001087976A2 true WO2001087976A2 (en) 2001-11-22
WO2001087976A3 WO2001087976A3 (en) 2002-05-23

Family

ID=22755362

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/015262 WO2001087976A2 (en) 2000-05-12 2001-05-11 Gpcr 4-helix and 5-helix bundles

Country Status (2)

Country Link
AU (1) AU2001259743A1 (en)
WO (1) WO2001087976A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130190254A1 (en) * 2006-06-30 2013-07-25 The Trustees Of The University Of Pennsylvania Polypeptides that bind membrane proteins

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000739A1 (en) * 1994-06-29 1996-01-11 Merck & Co., Inc. Modified g-protein coupled receptors
WO1996005225A1 (en) * 1994-08-10 1996-02-22 Human Genome Sciences, Inc. Adrenergic receptor
WO1999053033A1 (en) * 1998-04-16 1999-10-21 Vanderbilt University Methods and compositions for high yield production of eukaryotic proteins

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996000739A1 (en) * 1994-06-29 1996-01-11 Merck & Co., Inc. Modified g-protein coupled receptors
WO1996005225A1 (en) * 1994-08-10 1996-02-22 Human Genome Sciences, Inc. Adrenergic receptor
WO1999053033A1 (en) * 1998-04-16 1999-10-21 Vanderbilt University Methods and compositions for high yield production of eukaryotic proteins

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BOCKAERT JOEL ET AL: "Molecular tinkering of G protein-coupled receptors: An evolutionary success." EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 18, no. 7, 1 April 1999 (1999-04-01), pages 1723-1729, XP002187419 ISSN: 0261-4189 *
MARCHESE ADRIANO ET AL: "Novel GPCRs and their endogenous ligands: Expanding the boundaries of physiology and pharmacology." TRENDS IN PHARMACOLOGICAL SCIENCES, vol. 20, no. 9, 1999, pages 370-375, XP002187420 ISSN: 0165-6147 *
PALCZEWSKI KRZYSZTOF ET AL: "Crystal structure of rhodopsin: A G protein-coupled receptor." SCIENCE (WASHINGTON D C), vol. 289, no. 5480, 4 August 2000 (2000-08-04), pages 739-745, XP002187421 ISSN: 0036-8075 *
ROBINSON C R (REPRINT) ET AL: "Determinants of stability and assembly of the G-protein coupled receptor beta(2)AR" BIOPHYSICAL JOURNAL, (JAN 1999) VOL. 76, NO. 1, PART 2, PP. A277-A277. PUBLISHER: BIOPHYSICAL SOCIETY, 9650 ROCKVILLE PIKE, BETHESDA, MD 20814-3998. , XP002187418 *
ROBINSON C R (REPRINT) ET AL: "Determinants of structure, stability, and assembly of the beta(2) adrenergic receptor" BIOPHYSICAL JOURNAL, (JAN 2000) VOL. 78, NO. 1, PART 2, PP. PLA23-PLA23. PUBLISHER: BIOPHYSICAL SOCIETY, 9650 ROCKVILLE PIKE, BETHESDA, MD 20814-3998. , XP001052899 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130190254A1 (en) * 2006-06-30 2013-07-25 The Trustees Of The University Of Pennsylvania Polypeptides that bind membrane proteins

Also Published As

Publication number Publication date
WO2001087976A3 (en) 2002-05-23
AU2001259743A1 (en) 2001-11-26

Similar Documents

Publication Publication Date Title
WO1998056820A1 (en) Hm74a receptor
EP1104440A1 (en) A g-protein coupled 7tm receptor (axor-1)
EP1154019A2 (en) G-protein coupled receptor (HFGAN72X)
EP1077996A1 (en) HUMAN EDG3sb GENE
US6221627B1 (en) cDNA clone HDPB130 that encodes a novel human 7-transmembrane receptor
EP0897980A2 (en) CXCR4B: A human splice variant of CXCR4 chemokine receptor
JP2003524370A (en) Method for searching for human receptor GPR14 and agonists and antagonists for human and rat GPR14
WO1999042484A1 (en) Fishboy, a g-protein coupled receptor
US6344342B1 (en) Human G protein coupled lysophosphatidic acid receptor
WO1999046296A1 (en) Ecr673: a 7-transmembrane g-protein coupled receptor
WO1999055733A1 (en) Cloning of a novel 7tm receptor axor-2
EP1084142A1 (en) Gpr35a receptor
WO2000028083A1 (en) Mouse 7-transmembrane receptor gpr43
US6428982B1 (en) Polynucleotides encoding mouse urotensin-II Receptor (UTB-R)
WO2000004045A1 (en) Axor10, a g-protein coupled receptor
WO2001087976A2 (en) Gpcr 4-helix and 5-helix bundles
WO1999054351A1 (en) Edg family gene, human h218
EP1071766A1 (en) HUMAN G-PROTEIN COUPLED RECEPTOR GPR6sb
WO2000031107A1 (en) 7tm receptor hlwar77
EP1129101A1 (en) A novel g-protein coupled 7tm receptor (axor15)
EP1054966A1 (en) Ammaid, a g protein coupled receptor
EP1104483A1 (en) Molecular cloning of a 7tm receptor (gpr31a)
WO1999064021A1 (en) hCEPR RECEPTOR
EP1109565A1 (en) Gabab1aa receptor
EP1054904A1 (en) Mucilage, a g-protein-coupled receptor

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP