WO2001085986A2 - Phosphatidyl inositol 3-kinase delta binding partner - Google Patents

Abstract

There is identified a functional interaction between the catalytic subunit of phosphatidyl inositol 3-kinase delta (P13Kδ) and SH3 domain-containing polypeptides such as LASP-1. The invention provides methods of assaying the observed interaction, methods of exploiting the interaction to identify compounds that modulate the interaction, and methods of employing such modulators in the treatment of medical disorders characterized by P13Kδactivity mediated by the interaction.

Description

I

PHOSPHATIDYL INOSITOL 3-KINASE DELTA BINDING PARTNER

The present invention relates generally to phosphatidylinositol 3-kinase delta (PI3Kδ) enzyme, and more particularly to binding partners of PI3Kδ, and to methods of using such materials.

BACKGROUND OF THE INVENTION

Cell signaling via 3 '-phosphorylated phosphoinositides has been implicated in a variety of cellular processes, e.g., malignant transformation, growth factor signaling, inflammation, and immunity [see Rameh et al., JBiol Chem 274:8347-

8350 (1999) for a review]. The enzyme responsible for generating these phosphorylated signaling products, phophatidyl inositol 3-kinase (PI 3-kinase; PI3K), was originally identified as an activity associated with viral oncoproteins and growth factor receptor tyrosine kinases that phosphorylates phosphatidyl inositol (PI) and its phosphorylated derivatives at the 3'-hydroxyl of the inositol ring [Panayotou et al.,

Trends Cell Biol 2:358-60 (1992)].

The levels of phophatidyl inositol-3,4,5-triphosphate (PIP₃), the primary product of PI 3-kinase activation, increase upon treatment of cells with a variety of agonists. PI 3-kinase activation is, therefore, believed to be involved in a range of cellular responses including cell growth, differentiation, and apoptosis [Parker et al.,

Current Biology 5:577-99 (1995); Yao et al, Science 267:2003-05 (1995)]. Though the downstream targets of phosphorylated lipids generated following PI 3-kinase activation have not been well characterized, emerging evidence suggests that pleckstrin-homology domain- and FYVE-fmger domain-containing proteins are activated upon binding to various phosphatidylinositol lipids [Stemmark et al., J Cell

Sci 112:4175-83 (1999); Lemmon et al., Trends Cell Biol 7:237-42 (1997)]. In vitro, some isoforms of protein kinase C (PKC) are directly activated by PIP₃, and the PKC- related protein kinase, PKB, has been shown to be activated by PI 3-kinase [Burgering et al., Nature 3 '6:599-602 (1995)]. Presently, the PI 3-kinase enzyme family has been divided into three classes based on their substrate specificities. Class I PI3Ks can phosphorylate phosphatidyl inositol (PI), phosphatidyl inositol-4-phosphate, and phosphatidyl inositol-4,5- bipliosphate (P∑P₂) to produce phosphatidyl inositol-3 -phosphate (PIP), phosphatidyl inositol-3,4-biphosphate, and phosphatidyl inositol-3,4,5-triphosphate, respectively. Class π PI3Ks phosphorylate PI and phosphatidyl inositol-4-phosphate, whereas Class m PI3Ks can only phosphorylate PI.

The initial purification and molecular cloning of PI 3-kinase revealed that it was a heterodimer consisting of p85 and pi 10 subunits [Otsu et al., Cell 65:91-104

(1991); Hiles et al., Cell 70:419-29 (1992)]. Since then, four distinct Class I PBKs have been identified, designated PI3K , β, δ, and γ, each consisting of a distinct 110 kDa catalytic subunit and a regulatory subunit. More specifically, three of the catalytic subunits, i.e., pi 10a, pi lOβ and pi lOδ, each interact with the same regulatory subunit, p 85 ; whereas p 11 Oγ interacts with a distinct regulatory subunit, pi 01. As described below, the patterns of expression of each of these PBKs in human cells and tissues are also distinct. Though a wealth of information has been accumulated in recent past on the cellular functions of PI 3-kinases in general, the roles played by the individual isoforms are largely unknown. Cloning of bovine pi 10a was described in Hiles et al. {supra]. This protein was identified as related to the Saccharomyces cerevisiae protein: Vps34p, a protein involved in vacuolar protein processing [Id.]. The recombinant pi 10a product was also shown to associate with p85α, to yield a PI3K activity in transfected COS-1 cells [Hiles et al., supra]. The cloning of a second human pi 10 isoform, designated pi lOβ, is described by Hu et al. [Mol Cell Biol 13:7677-88 (1993)]. This isoform is said to associate with p85 in cells, and to be ubiquitously expressed, as pi lOβ mRNA has been found in numerous human and mouse tissues as well as in human umbilical vein endothelial cells, Jurkat human leukemic T cells, 293 human embryonic kidney cells, mouse 3T3 fibrob lasts, HeLa cells, and NBT2 rat bladder carcinoma cells [Id.]. Such wide expression suggests that this isoform is broadly important in signaling pathways.

Identification of the pi lOδ isoform of PI 3-kinase is described in Chantry et al, JBiol Chem 272:19236-41 (1997). It was observed that the human pi lOδ isoform is expressed in a tissue-restricted fashion; it is expressed at high levels in lymphocytes and lymphoid tissues, suggesting that the protein might play a role in PI

3-kinase-mediated signaling in the immune system. Details concerning the PI lOδ isoform may also be found in U.S. Patent Nos. 5,858,753, 5,822,910, and 5,985,589. See also, Vanhaesebroeck et al, Proc Natl Acad Sci USA 94:4330-5 (1997), and international publication WO 97/46688.

In each of the PI3Kα, β, and δ subtypes, the p85 subunit acts to localize PI 3- kinase to the plasma membrane by the interaction of its SH2 domain with phosphorylated tyrosine residues (present in an appropriate sequence context) in target proteins [Rameh et al., Cell 83:821-30 (1995)]. Two isoforms of p85 have been identified, p85α, which is ubiquitously expressed, and p85β, which is primarily found in the brain and lymphoid tissues [Volinia et al., Oncogene 7:789-93 (1992)]. Association of the p85 subunit to the PI 3-kinase pi 10a, β, or δ catalytic subunits appears to be required for the catalytic activity and stability of these enzymes. In addition, the binding of Ras proteins also upregulates PI 3-kinase activity.

The cloning of pi lOγ revealed still further complexity within the PI3K family of enzymes [Stoyanov et al., Science 269:690-93 (1995)]. The pllOγ isoform is closely related to pi 10a and pi lOβ (45-48% identity in the catalytic domain), but as noted does not make use of p85 as a targeting subunit. Instead, pi lOγ contains an additional domain termed a "pleckstrin homology domain" near its amino terminus. This domain allows interaction of pi lOγ with the βγ subunits of heterotrimeric G proteins and this interaction appears to regulate its activity [Stoyanov et al., supra]. The plOl regulatory subunit for PDKgamma was originally cloned in swine, and the human ortholog identified subsequently [Krugmann et al., JBiol Chem

274:17152-8 (1999)]. Interaction between the N-terminal region of plOl with the N- terminal region of pi lOγ appears to be critical for the PI3Kγ activation through Gβγ mentioned above.

A constitutively active PI3K polypeptide is described in international publication WO 96/25488. This document describes preparation of a chimeric fusion protein in which a 102-residue fragment of p85 known as the inter-SH2 (iSH2) region is fused through a linker region to the N-terminus of murine pi 10. The p85 iSH2 domain apparently is able to activate PI3K activity in a manner comparable to intact p85 [Klippel et al., Mol Cell Biol 14:2675-85 (1994)]. Thus, PI 3-kinases may be defined by their amino acid identity or by their activity. Additional members of this growing gene family include more distantly related lipid and protein kinases including Vps34 TORI, and TOR2 of Saccharomyces cerevisiae (and their mammalian homologs such as FRAP and mTOR), the ataxia telangiectasia gene product (ATR) and the catalytic subunit of DNA-dependent protein kinase (DNA-PK). See generally, Hunter, Cell 83:1-4 (1995). PI 3-kinase also appears to be involved in a number of aspects of leukocyte activation. A p85-associated PI 3-kinase activity has been shown to physically associate with the cytoplasmic domain of CD28, which is an important costimulatory molecule for the activation of T-cells in response to antigen [Pages et al., Nature 369:327-29 (1994); Rudd, Immunity 4:527-34 (1996)]. Activation of T cells through CD28 lowers the threshold for activation by antigen and increases the magnitude and duration of the proliferative response. These effects are linked to increases in the transcription of a number of genes including interleukin-2 (IL2), an important T cell growth factor [Fraser et al., Science 251:313-16 (1991)]. Mutation of CD28 such that it can no longer interact with PI 3-kinase leads to a failure to initiate IL2 production, suggesting a critical role for PI 3-kinase in T cell activation [Pages et al., supra].

Specific inhibitors against individual members of a family of enzymes provide invaluable tools for deciphering function(s) of each enzyme. Two compounds, LY294002 and wortmannin, have been widely used as PI 3-kinase inhibitors. These compounds, however, are non-specific PI3K inhibitors, as they do not distinguish among the four members of Class I PI 3-kinases. For example, the IC₅₀'s of wortmannin against the each of the various Class I PI 3-kinases are in the range of 1- 10 nM. Similarly, the IC₅₀ for LY294002 against each of these PI 3-kinases is about 1 μM [Fruman et al., Ann Rev Biochem 67:481-507 (1998)]. Hence, the utility of these compounds in studying the roles of individual Class I PI 3-kinases is limited. Based on studies using the wortmannin, there is evidence that PI 3-kinase function is also required for some aspects of leukocyte signaling through G-protein coupled receptors [Thelen et al., Proc Natl Acad Sci USA 91 :4960-64 (1994)] . Moreover, it has been shown that wortmannin and LY294002 block neutrophil migration and superoxide release. However, inasmuch as these compounds do not distinguish among the various isoforms of PI3K, it remains unclear which particular

PI3K isoform or isoforms are involved in these phenomena. In view of the above considerations, it is clear that existing knowledge is lacking with respect to structural and functional features of the PI 3-kinase enzymes, including sub-cellular localization, activation states, substrate affinities, and the like. Moreover, the functions that these enzymes perform in both normal and diseased tissues remains to be elucidated. In particular, the function of PI3Kδ in leukocytes has not previously been characterized, and knowledge concerning its function in human physiology remains limited. The coexpression in these tissues of other PI3K isoforms has heretofore confounded efforts to segregate the activities of each enzyme. Furthermore, separation of the activities of the various PI3K isozymes may not be possible without identification of inhibitors that demonstrate selective inhibition characteristics.

Thus, there exists a need in the art for further structural and functional characterization of the PI3Kδ enzyme. Furthermore, our understanding of PI3Kδ requires further elaboration of the structural interactions of pi lOδ, both with its regulatory subunit and with other proteins in the cell. There also remains a need for selective or specific inhibitors of PI3K isozymes, in order that the functions and structural interactions of each isozyme may be better characterized.

One of the purposes of the present invention is to provide methods for identifying compounds that can inhibit PI3Kδ activity, and preferably compounds that inhibit interaction ofPBKδ with its binding partners. Another purpose of the invention is to provide compounds that inhibit PBKδ selectively while having relatively low inhibitory potency against the other PBK isoforms. Another purpose of the invention is to provide methods of characterizing the function of human PBKδ. Another purpose of the invention is to provide methods of selectively modulating human PBKδ activity, and thereby to promote medical treatment of diseases mediated by PBKδ dysfunction. Other purposes and advantages of the invention will be readily apparent to the artisan having ordinary skill in the art. SUMMARY OF THE INVENTION

It has now been discovered that these and other purposes can be achieved by the present invention, which, in one aspect, is a method of identifying a modulator of pi 10δ binding to LASP-1, comprising the steps of: (a) providing a pi lOδ polypeptide and a LASP-1 polypeptide having specific binding affinity for one another;

(b) measuring binding between the p 11 Oδ polypeptide and the LASP- 1 polypeptide in the presence and absence of a test compound; and

(c) identifying the test compound as a modulator of p 11 Oδ binding to LASP- 1 when a different amount of binding of the p 11 Oδ polypeptide to the LASP-1 polypeptide is detected in the presence of the test compound than in the absence of the test compound.

The pi lOδ polypeptide and the LASP-1 polypeptide can be provided in a system free of cellular components, or may be recombinantly expressed or coexpressed in host cells. In some embodiments, the pi 1 Oδ polypeptide comprises the proline rich region of pi lOδ. Likewise, in some embodiments, the LASP-1 polypeptide comprises the SH3 region of LASP-1. Either or both of the polypeptides may be provided as fusion proteins to impart desirable properties to the polypeptides, e.g., to permit secretion or cell surface expression of the polypeptides. The method may be employed to identify modulators that inhibit binding of pi lOδ to LASP-1 or modulators that enhance binding of pi lOδ to LASP-1.

In another aspect, the invention is a compound having activity as a modulator of interaction between pi lOδ and LASP-1, wherein the compound is identified according to the method described herein. For example, the compound may be a compound that inhibits binding of p 11 Oδ to LASP- 1 , or a compound that enhances binding of pllOδ to LASP-1.

In another aspect, the invention is a method of treating a disease state characterized by undesirable or excessive activity of PBKδ, comprising administering to a subject in need thereof a compound that modulates interaction of pi lOδ with LASP-1 in an amount effective to modulate interaction of pi lOδ with

LASP-1. Preferably, the compound inhibits pi 10δ:LASP-l interaction. Compounds suitable for use in this method may be identified using screening methods described herein, or may be derived analogs thereof.

In still another aspect, the invention is a method of modulating pi lOδ binding to LASP-1, comprising the step of contacting pi lOδ or LASP-1 with a modulator of pi lOδ binding to LASP-1. Preferably, the method employs a modulator that inhibits binding of pllOδ to LASP-1.

In yet another aspect, the invention is a method of treating a disease state associated withpllOδ binding to LASP-1, comprising the step of administering to a subject in need thereof an effective amount of a modulator of pi lOδ binding to LASP-1. It is preferred that the method employs a modulator that inhibits binding of pl lOδ to LASP-1.

As noted in the examples herein, LASP-1 comprises an SH3 domain that interacts with the proline rich sequence of pllOδ (aa 288-314 of SEQ ID NO: 2).

This proline rich sequence is contemplated as a site of interaction with other polypeptides comprising one or more SH3 domains, for example, Src family kinases, adapter proteins vav and cbl, the p47-phox component of NADPH oxidase, Bruton's tyrosine kinase (Btk) and the p85 component of PI3 kinase. Therefore, in another aspect, the invention is a method of identifying a modulator of pi lOδ binding to a polypeptide comprising an SH3 domain, comprising the steps of: (a) providing a pi lOδ polypeptide and an SH3 domain-containing polypeptide having specific binding affinity for one another;

(b) measuring binding between the p 11 Oδ polypeptide and the SH3 domain-containing polypeptide in the presence and absence of a test compound; and

(c) identifying the test compound as a modulator of p 11 Oδ binding to the SH3-domain containing polypeptide when a different amount of binding of the pi lOδ polypeptide to the SH3 domain-containing polypeptide is detected in the presence of the test compound than in the absence of the test compound.

The pi lOδ polypeptide and the SH3 domain-containing polypeptide can be provided in a system free of cellular components, or may be recombinantly expressed or coexpressed in host cells. In these embodiments, the pi lOδ polypeptide comprises the proline rich region of pi lOδ. Either or both of the polypeptides may be provided as fusion proteins to impart desirable properties to the polypeptides, e.g., to permit secretion or cell surface expression of the polypeptides. The method may be employed to identify modulators that inhibit binding of pi lOδ to SH3 domain- containing polypeptides or modulators that enhance binding of pi lOδ to SH3 domain- containing polypeptides.

In another aspect, the invention is a compound having activity as a modulator of interaction between pi lOδ and an SH3 domain-containing polypeptide, wherein the compound is identified according to the method described herein. For example, the compound may be a compound that inhibits binding of pi lOδ to an SH3 domain- containing polypeptide, or a compound that enhances binding of pi lOδ to an SH3 domain-containing polypeptide.

In another aspect, the invention is a method of treating a disease state characterized by undesirable or excessive activity of PBKδ, comprising administering to a subject in need thereof a compound that modulates interaction of pi lOδ with an SH3 domain-containing polypeptide in an amount effective to modulate interaction of pllOδ with an SH3 domain-containing polypeptide. Preferably, the compound inhibits pll0δ:SH3 domain-containing polypeptide interaction. Compounds suitable for use in this method may be identified using screening methods described herein, or may be derived analogs thereof. In still another aspect, the invention is a method of modulating pi lOδ binding to an SH3 domain-containing polypeptide, comprising the step of contacting pllOδ or the SH3 domain-containing polypeptide with a modulator of pi lOδ binding to the SH3 domain-containing polypeptide. Preferably, the method employs a modulator that inhibits binding of p 11 Oδ to the SH3 domain-containing polypeptide. In yet another aspect, the invention is a method of treating a disease state associated with pi lOδ binding to an SH3 domain-containing polypeptide, comprising the step of administering to a subject in need thereof an effective amount of a modulator of pi lOδ binding to the SH3 domain-containing polypeptide. It is preferred that the method employs a modulator that inhibits binding of pi 1 Oδ to the SH3 domain-containing polypeptide. These and other features and advantages of the present invention will be appreciated from the detailed description and examples that are set forth herein. The detailed description and examples are provided to enhance the understanding of the invention, but are not intended to limit the scope of the invention. In particular, while the following detailed description and examples focus on the interaction of pi lOδ and

LASP-1, the detailed description and examples are intended to be illustrative of interaction of pllOδ with other polypeptides comprising SH3 domains. Thus, for example, in the detailed description below discussion of LASP-1 is applicable to SH3 domain-containing polypeptides such as Src family kinases, adapter proteins vav and cbl, the p47-phox component of NADPH oxidase, Bruton's tyrosine kinase (Btk) and the p85 component of PB kinase.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The invention provides methods of characterizing an interaction between the pllOδ subunit of phosphatidyl inositol 3-kinase delta (PBKδ), i.e., pllOδ, and LASP-

1. There are further provided methods of identifying modulators, e.g., inhibitors and enhancers, of pllOδ:LASP-l binding. Also provided are methods of employing modulators of PBKδ activity associated with or mediated by pi 10δ:LASP-l binding, including methods of modulating the activity of the PBKδ isozyme in cells, especially leukocytes, osteoclasts, and cancer cells. The methods include in vitro, in vivo, or ex vivo applications. Of particular benefit are methods of selectively modulating pi 10δ:LASP-l interactions in the clinical setting, to treat disease states mediated by PBKδ activity. Thus, disease states characterized by excessive or inappropriate PBKδ activity may be treated through use of selective modulators of pi 10δ:LASP-l binding according to the invention. Other methods enabled by the invention include methods necessary for further characterization of the pi 10δ:LASP- 1 interaction in vivo. Details of these and other useful embodiments of the invention are now described.

The methods described herein benefit from the use of compounds that selectively inhibit pi 10δ:LASP-l interaction in cells in vitro, in vivo, or ex vivo.

Cells useful in the methods include those that express endogenous pi lOδ and LASP- 1. By "endogenous" it is meant that the cells express pi lOδ and/or LASP-1 absent recombinant introduction into the cells of one or more polynucleotides encoding the polypeptide(s) or biologically active fragments thereof. Methods also encompass use of host cells that have been modified recombinantly to express exogenous pi lOδ and/or LASP-1, wherein one or more polynucleotides encoding pi lOδ or LASP-1, or biologically active fragments thereof, have been introduced into the cell using recombinant procedures. Host cells coexpressing a pi lOδ polypeptide and a LASP-1 polypeptide are provided, as are recombinant expression vectors enabling such coexpression, e.g., vectors comprising DNAs encoding the polypeptides arranged in tandem. Of particular advantage, the cells may be in vivo, i.e., in a living subject, e.g., an animal or human, wherein a modulator of pi 10δ:LASP-l binding may be used as a therapeutic to modulate PBKδ activity in the subject. Alternatively, the cells may be isolated as discrete cells or in a tissue, for ex vivo or in vitro methods.

In vitro methods also comprehended by the invention can comprise the step of contacting an isolated pi lOδ polypeptide or LASP-1 polypeptide with a modulator of ρl 10δ:LASP-l binding. In such "biochemical" methods, the pi lOδ and LASP-1 polypeptides are provided as purified and isolated polypeptides, i.e., the polypeptides are isolated from a natural source (e.g., cells or tissues that normally express at least one of the polypeptides absent modification by recombinant technology) or isolated from cells modified by recombinant techniques to express at least one of the polypeptides.

Compounds of any type that selectively modulate pi 10δ:LASP-l binding may be used as modulators in the methods of the invention. Moreover, compounds of any type that modulate, preferably inhibit, pi 10δ:LASP-l binding and that possess acceptable pharmacological properties may be used as modulators in the therapeutic methods of the invention.

The relative efficacies of compounds as modulators of a biological activity may be established by determining the concentrations at which each compound affects the activity to a predefined extent and then comparing the results. Typically, the preferred determination is the concentration that inhibits 50% of the activity in a biochemical assay, i.e., the 50% inhibitory concentration or "IC₅₀." IC₅₀ determinations may be accomplished using conventional techniques known in the art. In general, IC₅₀ may be determined by measuring the given biological activity in the presence of a range of concentrations of the inhibitor under study. The experimentally obtained values of enzyme activity are then plotted against the inhibitor concentrations used. The concentration of the inhibitor that shows 50% activity (as compared to the activity in the absence of any inhibitor) is taken as the IC₅₀. Analogously, other inhibitory concentrations may be defined through appropriate determinations of activity. For example, in some settings it may be desirable to establish a 90% inhibitory concentration, i.e., IC₉₀, etc.

Methods for Identifying Modulators of p!10δ:LASP-l Binding The pi lOδ and LASP-1 polypeptides, as well as fragments thereof possessing biological activity, can be used for screening putative modulator compounds in any of a variety of drug screening techniques. A modulator of pi 10δ:LASP-l binding is a compound that increases or decreases the ability of pi lOδ and LASP-1 to interact with one another, with the consequence of affecting the ability of pi lOδ to carry out any of its biological functions. An example of such a compound is an agent that, through affecting pi 10δ:LASP-l binding, increases or decreases the ability of PBKδ to phosphorylate phosphatidyl inositol or to target to appropriate structures within a cell.

The selectivity of a compound that modulates pi 10δ:LASP-l binding can be evaluated by comparing its activity on pi 10δ:LASP-l binding to its activity on other related proteins or the interactions on other related binding pairs of proteins. To illustrate, selective modulators of pi 10δ:LASP-l binding may include, for example, antibodies and other proteins or peptides that specifically bind to a pi lOδ polypeptide or a LASP-1 polypeptide, oligonucleotides that specifically bind to a pllOδ polypeptide or a LASP-1 polypeptide, and other non-peptide compounds (e.g., isolated or synthetic organic molecules) that specifically interact with a pi lOδ polypeptide or a LASP-1 polypeptide.

Accordingly, the invention provides methods of characterizing the potency of a test compound as a modulator of pi 10δ:LASP-l binding, said method comprising the steps of (a) measuring activity of a PBKδ polypeptide in the presence of a test compound; (b) comparing the activity of the PBKδ polypeptide in the presence of the test compound to the activity of the PBKδ polypeptide in the presence of an equivalent amount of a reference compound; wherein a lower activity of the PBKδ polypeptide in the presence of the test compound than in the presence of the reference indicates that the test compound is a more potent inhibitor than the reference compound, and a higher activity of the PBKδ polypeptide in the presence of the test compound than in the presence of the reference indicates that the test compound is a less potent inhibitor than the reference compound.

The invention further provides methods of characterizing the potency of a test compound as an inhibitor of pllOδ:LASP-l binding, comprising the steps of (a) determining an amount of a control compound that inhibits p 11 Oδ :LASP- 1 binding by a reference percentage of inhibition, thereby defining a reference inhibitory amount for the control compound; (b) determining an amount of a test compound that inhibits pi 10δ:LASP-l binding by a reference percentage of inhibition, thereby defining a reference inhibitory amount for the test compound; (c) comparing the reference inhibitory amount for the test compound to the reference inhibitory amount for the control compound, wherein a lower reference inhibitory amount for the test compound than for the control compound indicates that the test compound is a more potent inhibitor than the control compound, and a higher reference inhibitory amount for the test compound than for the control compound indicates that the test compound is a less potent inhibitor than the control compound. In one aspect, the method uses a reference inhibitory amount that is the amount of the compound than inhibits pi 10δ:LASP-l binding by 50%, 60%, 70%, 80%. In another aspect, the method employs a reference inhibitory amount that is the amount of the compound that inhibits pi 10δ:LASP-l binding by 90%, 95%, or 99%. These methods may comprise determining the reference inhibitory amount of the compounds in an in vitro biochemical assay, in an in vitro cell-based assay, or in an in vivo assay.

The invention therefore provides a method for screening for candidate modulators of PBKδ activity and/or to confirm the mode of action of candidate such negative regulators, i.e., to determine whether such compound operate through modulation of pi 10δ:LASP-l binding. Such methods may be employed against other pi 10 isoforms (e.g., pi 10a, pi lOβ, and pi lOγ) in parallel to establish comparative activity of the test compound across the isoforms. In these methods, the pi lOδ polypeptide may be a full-length pi lOδ polypeptide, e.g., human pi lOδ having the sequence set forth in SEQ ID NO:2, or it may be a pi lOδ fragment, provided that the fragment exhibits binding activity for LASP-1. An exemplary pi lOδ polypeptide is a fragment of pi lOδ comprising the proline-rich region that has been identified hereunder as interacting with LASP-1.

The pi lOδ fragment may further comprise the catalytic site of pi lOδ and/or the p85 binding domain of pi lOδ.

Likewise, the LASP-1 polypeptide maybe a full-length LASP-1 polypeptide, e.g., human LASP-1 having the sequence set forth in SEQ ID NO:4, or it maybe a LASP-1 fragment, provided that the fragment exhibits binding activity for pi lOδ. An exemplary LASP-1 polypeptide is a fragment of LASP-1 comprising the SH3 region that has been identified hereunder as interacting with pi lOδ. The LASP-1 polypeptide may further comprise other domains of the LASP-1 protein, e.g., the LIM region. The methods may be employed in cells expressing cells expressing pi lOδ or fragments thereof, either endogenously or exogenously. Accordingly, the polypeptide employed in such methods may be free in solution, affixed to a solid support, modified to be displayed on a cell surface (e.g., as a fusion protein), or located intracellularly. The modulation of activity or the formation of binding complexes between the pi lOδ polypeptide, the LASP-1 polypeptide, and the agent being tested may then be measured.

LASP-1 and pi lOδ polypeptides, and the interactions thereof, are amenable to biochemical or cell-based high throughput screening (HTS) assays according to methods known and practiced in the art, including melanophore assay systems to investigate receptor-ligand interactions, yeast-based assay systems, and mammalian cell expression systems. For a review, see Jayawickreme and Kost, Curr Opin Biotechnol 8:629-34 (1997). Automated and miniaturized HTS assays are also comprehended as described, for example, in Houston and Banks, Curr Opin Biotechnol 8:734-40 (1997). Such HTS assays are used to screen libraries of compounds to identify particular compounds that exhibit a desired property. Any library of compounds may be used, including chemical libraries, natural product libraries, and combinatorial libraries comprising random or designed oligopeptides, oligonucleotides, or other organic compounds.

Chemical libraries may contain known compounds, proprietary structural analogs of known compounds, or compounds that are identified from natural product screening.

Natural product libraries are collections of materials isolated from naturals sources, typically, microorganisms, animals, plants, or marine organisms. Natural products are isolated from their sources by fermentation of microorganisms followed by isolation and extraction of the fermentation broths or by direct extraction from the microorganisms or tissues (plants or animal) themselves. Natural product libraries include polyketides, non-ribosomal peptides, and variants (including non-naturally occurring variants) thereof. For a review, see Cane et al., Science 282:63-68 (1998).

Combinatorial libraries are composed of large numbers of related compounds, such as peptides, oligonucleotides, or other organic compounds as a mixture. Such compounds are relatively straightforward to design and prepare by traditional automated synthesis protocols, PCR, cloning or proprietary synthetic methods. Of particular interest are peptide and oligonucleotide combinatorial libraries.

Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. For a review of combinatorial chemistry and libraries created thereby, see Myers, Curr Opin Biotechnol 8:701-07 (1997). Once compounds have been identified that show activity as modulators of pi 10δ:LASP-l binding (i.e., "hits"), a program of optimization can be undertaken in an effort to improve the potency and/or selectivity of the activity. Analysis of structure-activity relationships (SAR) typically involves of iterative series of selective modifications of compound structures and their correlation to biochemical or biological activity. Families of related compounds can be designed that all exhibit the desired activity, with certain members of the family, namely those possessing suitable pharmacological profiles, potentially qualifying as therapeutic candidates. Compounds obtained using such medicinal chemistry methods may be referred to a "derived analogs" of the original "hit" compounds. Related to methods of identifying modulators of pi 10δ:LASP-l binding, the invention enables tools that facilitate such methods. For example, containers can be manufactured that contain a pi lOδ polypeptide and a LASP-1 polypeptide. To illustrate, the polypeptides may be provided in a kit, such as a kit in which the polypeptides are contained in separate containers, and optionally further comprising an instruction sheet providing guidance on performance of the assay. The contents can then be employed for measuring the pi 10δ:LASP-l interaction in a modulator identification assay. For HTS assays, the invention provides multi-well (e.g., 96- or 384- well) plates in which at least one well contains a pi lOδ polypeptide and a LASP- 1 polypeptide in amounts suitable for screening small quantities of a test compound. Alternatively, for cell-based assays, the invention provides containers (e.g., multi- well plates) containing host cells recombinantly modified to express, preferably cells modified to coexpress, a pi lOδ polypeptide and a LASP-1 polypeptide. Therapeutic Uses of Inhibitors of p!10δ:LASP-l Binding

As described herein, the invention provides a method for identifying compounds capable of selectively modulating pi 10δ:LASP-l binding, or modulating PBKδ activity mediated thereby. Thus, the invention may provide the basis for development of methods of treatment of PBKδ-mediated disease states. Such treatment methods can include administering an modulator, most probably an inhibitor, of pll0δ:LASP-l binding in an amount effective for this purpose. These methods may be employed in treating humans or animals that are or may be subject to any disease state whose symptoms or pathology is characterized by PBKδ activity as it may be mediated by pi 10δ:LASP-l binding. Among other things, as PBKδ expression is predominantly limited to leukocytes, the invention enables methods of inhibiting PBKδ function in these cells. Thus, disease states in which leukocyte function is excessive or undesirable may be amenable to treatment using p 11 Oδ :LASP- 1 binding modulators as described hereinbelow in greater detail.

In one aspect, the invention provides methods of treating disease states characterized by functions of neufrophils. It has been observed that inhibition of PBKδ activity inhibits certain functions of neufrophils such as stimulated superoxide release, stimulated exocytosis, and chemotactic migration. Superoxide is released by neufrophils in response to any of a variety of stimuli including signals of infection, as a mechanism of cell killing. For example, superoxide release is known to be induced by tumor necrosis factor alpha (TNFα), which is released by macrophages, mast cells, and lymphocytes upon contact with bacterial cell wall components such as lipopofysaccharide (LPS). TNFα is an extraordinarily potent and promiscuous activator of inflammatory processes, being involved in activation of neufrophils and various other cell types, induction of leukocyte/endothelial cell adhesion, pyrexia, enhanced MHC class I production, and stimulation of angiogenesis. Alternatively, superoxide release may be stimulated by formyl-Met-Leu-Phe (fMLP) or other peptides blocked at the N-terminus by formylated methionine. Such peptides are not normally found in eukaryotes, but are fundamentally characteristic of bacteria, and signal the presence of bacteria to the immune system. Leukocytes expressing the fMLP receptor, e.g., neufrophils and macrophages, are stimulated to migrate up gradients of these peptides (i.e., chemotaxis) toward loci of infection. In general, these functions may be collectively termed "inflammatory functions," as they are typically related to neutrophil response to inflammation. Such functions may further include, without limitation, stimulated degranulation, adhesion to vascular endothelium (e.g., tethering/rolling of neutrophils, triggering of neutrophil activity, and/or latching of neutrophils to endothelium), transmural diapedesis or emigration through the endothelium to peripheral tissues. The inflammatory functions of neutrophils may be distinguished from the bacterial killing functions exhibited by these cells, e.g., phagocytosis and killing of bacteria. Without intending to be bound by any one theory, it is believed that, because inflammation involves processes are typically mediated by leukocyte (e.g., neutrophil, lymphocyte, etc.) activation and chemotactic transmigration, and because PBKδ may mediate such phenomena, antagonists of PBKδ activity mediated by pi 10δ:LASP-l binding may be used to suppress injury associated with inflammation. Accordingly, the invention further includes methods of treating disease states in which one or more of the inflammatory functions of neutrophils are abnormal or undesirable. Neutrophil functions suitable for inhibition according to the method include any function that is characterized by PBKδ activity mediated by pi 10δ:LASP-l binding.

It has further been observed that PBKδ plays a role in the stimulated proliferation of lymphocytes, including B cells and T cells. Moreover, PBKδ appears to play a role in stimulated secretion of antibodies by B cells. Thus, the invention includes methods for inhibiting lymphocyte proliferation, and methods for inhibiting antibody production by B lymphocytes through the use of modulators of pi 10δ:LASP-l binding. Other methods enabled by the invention include methods of treating disease states in which one or more of these lymphocyte functions are abnormal or undesirable.

In another aspect, the invention includes a method for suppressing a function of basophils and or mast cells, and thereby enabling treatment of disease states characterized by excessive or undesirable basophil and/or mast cell activity. According to the method, a compound of the invention may be used that selectively inhibits pi 10δ:LASP-l binding and associated activity of phosphatidylinositol 3- kinase delta (PBKδ) in basophils and/or mast cells. Preferably, the method employs a pi 10δ:LASP-l inhibitor in an amount sufficient to inhibit stimulated histamine release by the basophils and/or mast cells. Accordingly, the use of such compounds and other PBKδ selective inhibitors may be of value in treating diseases characterized by histamine release, i.e., allergic disorders, including disorders such as chronic obstructive pulmonary disease (COPD), asthma, ARDS, emphysema, and related disorders.

In another aspect, selective inhibitors of PBKδ activity mediated by pi 10δ:LASP-l binding may be employed in methods of treating diseases of bone, especially diseases in which osteoclast function is abnormal or undesirable. Accordingly, the use of such compounds may be of value in treating osteoporosis,

Paget's disease, and related bone resorption disorders.

In a further aspect, the invention includes methods of using modulators of pi 10δ:LASP-l binding to inhibit the growth or proliferation of cancer cells of hematopoietic origin, preferably cancer cells of lymphoid origin, and more preferably cancer cells related to or derived from B lymphocytes or B lymphocyte progenitors.

Cancers potentially amenable to treatment using the method of the invention include, without limitation, lymphomas, i.e., malignant neoplasms of lymphoid and reticuloendothelial tissues, such as Burkitt's lymphoma, Hbdgkins' lymphoma, non- Hodgkins lymphomas, lymphocytic lymphomas and the like; multiple myelomas; as well as leukemias such as lymphocytic leukemias, chronic myeloid (myelogenous) leukemias, and the like. In a preferred embodiment, pi 10δ:LASP-l modulatory compounds may be used to inhibit or control the growth or proliferation of chronic myeloid (myelogenous) leukemia cells.

"Treating" as used herein refers to preventing a disease state from occurring in an animal that may be predisposed to the disease state, but has not yet been diagnosed as having it; inhibiting the disease state, i.e., arresting its development; relieving the disease state, i.e., causing its regression; or ameliorating the disease state, i.e., reducing the severity of symptoms associated with the disease state.

"Disease state" as used herein is intended to encompass pathological disorders, diseases, conditions, syndromes, and the like, without limitation.

"Inflammatory disease" as used herein can refer to any disease state in which an excessive or unregulated inflammatory response leads to excessive inflammatory symptoms, host tissue damage, or loss of tissue function. "Inflammatory disease" also refers to a pathological state mediated by influx of leukocytes and/or neutrophil chemotaxis.

"Inflammation" as used herein refers to a localized, protective response elicited by injury or destruction of tissues, which serves to destroy, dilute, or wall off

(sequester) both the injurious agent and the injured tissue. Inflammation is notably associated with influx of leukocytes and/or neutrophil chemotaxis. Inflammation may result from infection with pathogenic organisms and viruses and from noninfectious means such as trauma or reperfusion following myocardial infarction or stroke, immune response to foreign antigen, and autoimmune responses. Accordingly, inflammatory diseases amenable to the invention encompass disease states associated with reactions of the specific defense system as well as with reactions of the nonspecific defense system.

"Specific defense system" as used herein refers to the component of the immune system that reacts to the presence of specific antigens. Examples of inflammation resulting from a response of the specific defense system include the classical response to foreign antigens, autoimmune diseases, and delayed type hypersensitivity response mediated by T-cells. Chronic inflammatory diseases, the rejection of solid transplanted tissue and organs, e.g., kidney and bone marrow transplants, and graft versus host disease (GVHD), are further examples of inflammatory reactions of the specific defense system.

"Non-specific defense system" as used herein refers to the cells systems involved in inflammatory processes that are mediated by leukocytes that are incapable of immunological memory (e.g., granulocytes, and macrophages). Examples of inflammation that result, at least in part, from a reaction of the non-specific defense system include inflammation associated with conditions such as adult (acute) respiratory distress syndrome (ARDS) or multiple organ injury syndromes; reperfusion injury; acute glomerulonephritis; reactive arthritis; dermatoses with acute inflammatory components; acute purulent meningitis or other central nervous system inflammatory diseases such as stroke; thermal injury; inflammatory bowel disease; granulocyte transfusion associated syndromes; and cytokine-induced toxicity. "Autoimmune disease" as used herein refers to any group of disease states in which tissue injury is associated with humoral or cellmediated responses to the body's own constituents. "Allergic disease" as used herein refers to any disease state in which symptoms, tissue damage, or loss of tissue function result from allergy. "Arthritic disease" as used herein refers to any disease state that is characterized by inflammatory lesions of the joints attributable to a variety of etiologies. "Dermatitis" as used herein refers to any of a large family of diseases of the skin that are characterized by inflammation of the skin attributable to a variety of etiologies. "Transplant rejection" as used herein refers to any immune reaction directed against grafted tissue, such as organs or cells (e.g., bone marrow), characterized by a loss of function of the grafted and surrounding tissues, pain, swelling, leukocytosis, and thrombocytopenia.

The therapeutic methods of the present invention include methods for the treatment of disease states associated with inflammatory cell activation. "Inflammatory cell activation" refers to the induction by a stimulus (including, but not limited to, cytokines, antigens or autoantibodies) of a proliferative cellular response, the production of soluble mediators (including but not limited to cytokines, oxygen radicals, enzymes, prostanoids, or vasoactive amines), or cell surface expression of new or increased numbers of mediators (including, but not limited to, major histocompatability antigens or cell adhesion molecules) in inflammatory cells

(including but not limited to monocytes, macrophages, T lymphocytes, B lymphocytes, granulocytes (i.e., polymorphonuclear leukocytes such as neutrophils, basophils, and eosinophils), mast cells, dendritic cells, Langerhans cells, and endothelial cells). It will be appreciated by persons skilled in the art that the activation of one or a combination of these phenotypes in these cells can contribute to the initiation, perpetuation, or exacerbation of an inflammatory disease.

The present invention enables methods of treating such diseases as arthritic diseases, such as rheumatoid arthritis, monoarticular arthritis, osteoarthritis, gouty arthritis, spondylitis; Behcet disease; sepsis, septic shock, endotoxic shock, gram negative sepsis, gram positive sepsis, and toxic shock syndrome; multiple organ injury syndrome secondary to septicemia, trauma, or hemorrhage; ophthalmic disorders such as allergic conjunctivitis, vernal conjunctivitis, uveitis, and thyroid- associated ophthalmopathy; eosinophilic granuloma; pulmonary or respiratory disorders such as asthma, chronic bronchitis, allergic rhinitis, ARDS, chronic pulmonary inflammatory disease (e.g., chronic obstructive pulmonary disease), silicosis, pulmonary sarcoidosis, pleurisy, alveolitis, vasculitis, emphysema, pneumonia, bronchiectasis, and pulmonary oxygen toxicity; reperfusion injury of the myocardium, brain, or extremities; fibrosis such as cystic fibrosis; keloid formation or scar tissue formation; atherosclerosis; autoimmune diseases such as systemic lupus erythematosus (SLE), autoimmune thyroiditis, multiple sclerosis, some forms of diabetes, and Reynaud's syndrome; and transplant rejection disorders such as GVHD and allo graft rejection; chronic glomerulonephritis; inflammatory bowel diseases such as chronic inflammatory bowel disease (CIBD), Crohn's disease, ulcerative colitis, and necrotizing enterocolitis; inflammatory dermatoses such as contact dermatitis, atopic dermatitis, psoriasis, or urticaria; fever and myalgias due to infection; central or peripheral nervous system inflammatory disorders such as meningitis, encephalitis, and brain or spinal cord injury due to minor trauma; Sjδgren's syndrome; diseases involving leukocyte diapedesis; alcoholic hepatitis; bacterial pneumonia; antigen- antibody complex mediated diseases; hypovolemic shock; Type I diabetes mellitus; acute and delayed hypersensitivity; disease states due to leukocyte dyscrasia and metastasis; thermal injury; granulocyte transfusion-associated syndromes; and cytokine-induced toxicity.

The method can have utility in treating subjects that are or may be subject to reperfusion injury, i.e., injury resulting from situations in which a tissue or organ experiences a period of ischemia followed by reperfusion. The term "ischemia" refers to localized tissue anemia due to obstruction of the inflow of arterial blood. Transient ischemia followed by reperfusion characteristically results in neutrophil activation and transmigration through the endothelium of the blood vessels in the affected area. Accumulation of activated neutrophils in turn results in generation of reactive oxygen metabolites, which damage components of the involved tissue or organ. This phenomenon of "reperfusion injury" is commonly associated with conditions such as vascular stroke (including global and focal ischemia), hemorrhagic shock, myocardial ischemia or infarction, organ transplantation, and cerebral vasospasm. To illustrate, reperfusion injury occurs at the termination of cardiac bypass procedures or during cardiac arrest when the heart, once prevented from receiving blood, begins to reperfuse. It is expected that inhibition of PBKδ activity will result in reduced amounts of reperfusion injury in such situations.

With respect to the nervous system, global ischemia occurs when blood flow to the entire brain ceases for a period. Global ischemia may result from cardiac arrest. Focal ischemia occurs when a portion of the brain is deprived of its normal blood supply. Focal ischemia may result from thromboembolic occlusion of a cerebral vessel, traumatic head injury, edema, or brain tumor. Even if transient, both global and focal ischemia can cause widespread neuronal damage. Although nerve tissue damage occurs over hours or even days following the onset of ischemia, some permanent nerve tissue damage may develop in the initial minutes following the cessation of blood flow to the brain.

Ischemia can also occur in the heart in myocardial infarction and other cardiovascular disorders in which the coronary arteries have been obstructed as a result of atherosclerosis, thrombus, or spasm. Accordingly, the invention is believed to be useful for treating cardiac tissue damage, particularly damage resulting from cardiac ischemia or caused by reperfusion injury in mammals.

The methods of the invention embrace various modes of treating an animal, preferably a mammal, more preferably a primate, and still more preferably a human. Among the mammals that may be treated are, for example, companion animals (pets) including dogs and cats; farm animals including cattle, horses, sheep, pigs, and goats; laboratory animals including rats, mice, rabbits, guinea pigs, and non-human primates. Non-mammalian animals include, for example, birds, fish, reptiles, and amphibians.

Methods of Administration of Modulators of p! 10δ:LASP-l Interaction

Pharmaceutical compositions comprising a modulator of pllOδ:LASP-l binding activity may be administered to the subject by any conventional method, including parenteral and enteral techniques. Parenteral administration modalities include those in which the composition is administered by a route other than through the gastrointestinal tract, for example, intravenous, intraarterial, intraperitoneal, intramedullary, intramuscular, intraarticular, intrathecal, and intraventricular injections. Enteral administration modalities include, for example, oral (including buccal and sublingual) and rectal administration. Transepithelial administration modalities include, for example, transmucosal administration and transdermal administration. Transmucosal administration includes, for example, enteral administration as well as nasal, inhalation, and deep lung administration; vaginal administration; and rectal administration. Transdermal administration includes passive or active transdermal or transcutaneous modalities, including, for example, patches and iontophoresis devices, as well as topical application of pastes, salves, or ointments. Parenteral administration can also be accomplished using a high-pressure technique, e.g., POWDERJECT®. Surgical techniques include implantation of depot (reservoir) compositions, osmotic pumps, and the like. A preferred route of administration for treatment of inflammation can be local or topical delivery for localized disorders such as arthritis, or systemic delivery for distributed disorders, e.g., intravenous delivery for reperfusion injury or for systemic conditions such as septicemia. For other diseases, including those involving the respiratory tract, e.g., chronic obstructive pulmonary disease, asthma, emphysema, etc., administration may be accomplished by inhalation or deep lung administration of sprays, aerosols, powders, and the like.

For the treatment of neoplastic diseases, especially leukemias and other distributed cancers, parenteral administration is typically preferred. Formulations of the compounds to optimize them for biodistribution following parenteral administration would be desirable. The PBKδ inhibitor compounds may be administered before, during, or after administration of chemotherapy, radiotherapy, and/or surgery. Moreover, the therapeutic index of the pi 10δ:LASP-l modulator compounds may be enhanced by modifying or derivatizing the compounds for targeted delivery to cancer cells expressing a marker that identifies the cells as such. For example, the compounds may be linked to an antibody that recognizes a marker that is selective or specific for cancer cells, so that the compounds are brought into the vicinity of the cells to exert their effects locally, as previously described [see for example, Pietersz et al., Immunol Rev 129:57 (1992); Trail et al., Science 261:212 (1993); and Rowlinson-Busza et al., Curr Opin Oncol 4:1142 (1992)]. Tumor-directed delivery of these compounds would enhance the therapeutic benefit by, inter alia, minimizing potential non-specific toxicities that can result from radiation treatment or chemotherapy. In another aspect, pi 10δ:LASP- 1 inhibitor compounds and radioisotopes or chemotherapeutic agents may be conjugated to the same anti-tumor antibody.

For the treatment of bone resorption disorders or osteoclast-mediated disorders, the pi 10δ:LASP-l modulators can be delivered by any suitable method.

Focal administration may be desirable, such as by intraarticular injection. In some cases, it may be desirable to couple the compounds to a moiety that can target the compounds to bone. For example, a pi 10δ:LASP-l modulator may be coupled to compounds with high affinity for hydroxyapatite, which is a major constituent of bone. This may be accomplished, for example, by adapting a tetracycline-coupling method developed for targeted delivery of estrogen to bone [Orme et al., Bioorg Med Chem Lett 4(l l):1375-80 (1994)].

To be effective therapeutically in modulating central nervous system targets, the agents used in the methods of the invention should readily penetrate the blood brain barrier when peripherally administered. Compounds that cannot penetrate the blood brain barrier, however, can still be effectively administered by an intravenous route.

As noted above, the characteristics of the agent itself and the formulation of the agent can influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the administered agent. Such pharmacokinetic and pharmacodynamic information can be collected through pre-clinical in vitro and in vivo studies, later confirmed in humans during the course of clinical trials. Thus, for any compound used in the method of the invention, a therapeutically effective dose can be estimated initially from biochemical and/or cell-based assays. Then, dosage can be formulated in animal models to. achieve a desirable circulating concentration range that modulates pi 10δ:LASP-l binding. As human studies are conducted, further information will emerge regarding the appropriate dosage levels and duration of treatment for various diseases and conditions.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the "therapeutic index," which is typically expressed as the ratio LD₅₀/ED₅₀. Compounds that exhibit large therapeutic indices are preferred. The data obtained from such cell culture assays and additional animal studies can be used in formulating a range of dosage for human use. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity.

For the method of the invention, any effective administration regimen regulating the timing and sequence of doses may be used. Doses of the agent preferably include pharmaceutical dosage units comprising an effective amount of the agent. As used herein, "effective amount" refers to an amount of a pll0δ:LASP-l modulator compound sufficient to modulate PBKδ activity and/or derive a measurable change in a physiological parameter of the subject through administration of one or more of the pharmaceutical dosage units.

Exemplary dosage levels for a human subject are of the order of from about 0.001 milligram of active agent per kilogram body weight (mg/kg) to about 100 mg/kg. Typically, dosage units of the active agent comprise from about 0.01 mg to about 10,000 mg, preferably from about 0.1 mg to about 1,000 mg, depending upon the indication, route of administration, etc. Depending on the route of administration, a suitable dose may be calculated according to body weight, body surface area, or organ size. The final dosage regimen will be determined by the attending physician in view of good medical practice, considering various factors that modify the action of drugs, e.g., the agent's specific activity, the severity of the disease state, the responsiveness of the patient, the age, condition, body weight, sex, and diet of the patient, the severity of any infection, etc. Additional factors that may be taken into account include time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Further refinement of the dosage appropriate for treatment involving any of the formulations mentioned herein is done routinely by the skilled practitioner without undue experimentation, especially in light of the dosage information and assays disclosed, as well as the pharmacokinetic data observed in human clinical trials. Appropriate dosages may be ascertained through use of established assays for determining concentration of the agent in a body fluid or other sample together with dose response data.

The frequency of dosing will depend on the pharmacokinetic parameters of the agent and the route of administration. Dosage and administration are adjusted to provide sufficient levels of the active moiety or to maintain the desired effect. Accordingly, the pharmaceutical compositions can be administered in a single dose, multiple discrete doses, continuous infusion, sustained release depots, or combinations thereof, as required to maintain desired minimum level of the agent. Short-acting pharmaceutical compositions (i.e., short half-life) can be administered once a day or more than once a day (e.g., two, three, or four times a day). Long acting pharmaceutical compositions might be administered .every 3 to 4 days, every week, or once every two weeks. Pumps, such as subcutaneous, intraperitoneal, or subdural pumps, may be preferred for continuous infusion.

The following Examples are provided to further aid in understanding the invention, and presuppose an understanding of conventional methods well-known to those persons having ordinary skill in the art to which the examples pertain, e.g., the construction of vectors and plasmids, the insertion of genes encoding polypeptides into such vectors and plasmids, or the introduction of vectors and plasmids into host cells. Such methods are described in detail in numerous publications including, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994); and Ausubel et al. (Eds.), Short

Protocols in Molecular Biology, 4^th ed., John Wiley & Sons, Inc. (1999). The particular materials and conditions described hereunder are intended to exemplify particular aspects of the invention and should not be construed to limit the reasonable scope thereof.

EXAMPLE 1. Identification and Verification of a pllOδ-Interacting Partner

The yeast di-hybrid technique was used in an effort to identify proteins that interact with the 110 kDa subunit of PI3 kinase delta (pi lOδ). The di-hybrid method is described by Fields et al. [Nature 340(6230):245-6 (1989)]. [See also, e.g., U.S. Patent No. 5,959,079; Hollenberg et al., Mol Cell Biol 15:3813-22 (1995)].

Construction of Bait Plasmid and Yeast Strains

As shown in Table 1, a comparison of the amino acid sequence of human pllOδ to those of the other three pi 10 subunit types reveals that the amino acid sequence of the Ras-binding domain is a less conserved region than the catalytic domain.

Table 1

Identity

PI3K Isoform Overall Catalytic Ras-Binding

pll0α (SEQ ID O:6) 41 49 26 pll0β (SEQ ID NO:8) 58 72 35.5 pll0γ (SEQ ID NO:10) 35 45 20

To increase the probability of identifying proteins that specifically interact with pi lOδ, we took advantage of the low level of homology in the Ras-binding domains. The Ras-binding region of pi lOδ (aa 134 to 350 of SEQ JD NO:2) was amplified by

PCR using 100 ng of template pi lOδ DNA (SEQ ID NO:l) and 500 ng each of the following primers. pl lOdelta 5': 5'-GATCGAATTCCCAGAAGTGAACGACTTTCGC-3'

(SEQ ID NO: 11) pl lOdelta 3': 5'-GATCGTCGACGCCGTGGAAAAGCCCGGCCTG-3'

(SEQ ID NO: 12)

The amplification reaction was performed using Taq polymerase and buffer provided by the supplier (Perkin Elmer, Foster City CA) according to the following temperature cycling protocol: 94°C for 5 min; followed by 25 cycles of 94°C for 30 sec, 68° C for 3 min, and 72° for 7 min. The amplified product was then digested with EcoRl and Sα/1 and subcloned in the EcoRl-Sα/1 sites of the yeast di-hybrid vector pBTMl 16 such that the pi lOδ sequence was in frame with the Lex A sequence.

We also cloned the corresponding region of pi lOβ (aa 143 to 360) in frame with the LexA sequence for use as a specificity control. The following oligonucleotides were used to amplify the Ras-binding domain of pi lOβ sequence (SΕQ JD NO:8).

pl lObeta 5 : 5 -GATCGAATTCCCTGAAGTAAATGAATTTCGA-3

(SEQ ID NO: 13) pl lObeta 3 : 5 -GATCGTCGACACCATGAAAAAGACCAGCCCT-3 (SEQ ID NO: 14)

The pBTMl 16 plasmid DNAs containing the pi 10δ or pi lOβ sequences were then introduced into yeast cells by the lithium acetate treatment, generally in accordance with the method of Ito et al. [JBacteriol 153:163-8 (1983)].

Screening for pi lOδ-Interacting Clones

One yeast colony containing the pllOδ Ras-binding sequence was grown and the cells were transformed with a mouse embryonic cDNA library in the yeast vector pVP16. hi this vector, the mouse cDNAs are cloned in frame with the VP16 sequence so that the resulting fusion protein can recognize RNA polymerase using the VP16 sequence to help initiate transcription. The cells were plated on appropriate selection medium lacking leucine, tryptophan and histidine. The ability of the yeast transformants to survive and propagate on this medium suggests an interaction between pi lOδ and the protein coded by the mouse cDNA sequence. As a further test of proteimprotein interaction, replicas of the yeast colonies on the selection plates were made on membranes and assayed for β-galactosidase activity by a standard method [Breeden et al. Cold Spring Harbor Symp Quant Biol 50:643-50 (1985)] . Several hundred blue colonies were observed. The colonies that did not turn blue were considered false positive and discarded.

We selected 40 of the colonies that turned blue most rapidly and isolated plasmid DNA from each of them. E. coli cells that require leucine for growth were transformed with each of these 40 plasmid DNAs and plated on medium lacking leucine so that the cells carrying VP16 based plasmids would be selected. Plasmid

DNAs were isolated from the E. coli transformants and re-introduced into the yeast cells carrying pBTMl 16-pl lOδ Ras-binding domain. The resulting yeast transformants were again tested for the interaction with pi lOδ by growth on medium lacking leucine, tryptophan, and histidine, and also assayed for β-galactosidase activity. Only those colonies that reproducibly tested positive for the interaction were selected for further characterization.

Characterization of pi lOδ- teracting Clones Sequence Analysis We determined the DNA sequences of 39 clones that were reproducibly positive for interaction with the pi lOδ region of interest (aa 134 to 350 of SΕQ ID NO:2). All of the DNA sequences were used to search the GenBank® database for any related proteins. Our searches revealed that the DNA sequence of Clone 32 (SΕQ JD NO: 15) is highly homologous with portions of the human and mouse LASP-1 DNAs (GenBank® Accession Nos. NM_006148 (human; SΕQ ID NO:3) and

NM_010688 (mouse; SΕQ ID NO:17). The LASP-1 proteins of rabbit, human and mouse contain 2 domains: one LIM motif and one domain of Src homology region 3 (SH3), hence its name "LIM and SH3 Protein" [Tomasetto et al, FEBSLett 373:245- 9 (1995); Chew et al., AmerJPhysiol 275 (Cell Physiol 44):C56-C57 (1998)]. The amino acid sequence of the SH3 domain of Clone 32 (aa 4-60 of SΕQ ID NO:16) was identical to the SH3 domain of both the human and mouse LASP-1 proteins (aa 205- 261 of SΕQ ID NO:4 and aa 207-263 of SΕQ ID NO:18, respectively), which are identical to one another. Moreover, the amino acid sequences of the Ras-binding domains of mouse and human pi 10 are 95% conserved. In particular, the amino acid sequences of the proline-rich segments within the Ras-binding domains of both the human and mouse pi lOδ protein are identical. Since the mouse and human LASP-1 SH3 domain amino acid sequences are identical, and since the mouse and human pi lOδ proline-rich segments are identical, we surmise that human LASP-1 is capable of binding to the human pi lOδ proline-rich segment as does clone 32 which is derived from mouse LASP-1.

The DNA sequence of the Clone 32 is given below (note that the Notl sites (underlined) at the 5 ' and 3 ' ends are from the vector).

GCGGCCGCTCAAACGGTACCGTGCAGTGTATGACTACAGCGCTGCCGACGAGGACGA GGTCTCCTTCCAGGATGGGGACACCATCGTCAA.TGTGCAGCAGATCGATGACGGCTG GATGTACGGGACCGTAGAGCGCACCGGTGACACGGGGATGCTGCCAGCCAACTACGT GGAGGCCATCTGAACCCTGTGCCGCCCCGCCCTGTCTTCAATGCATTCCATGGCATC ACATCTGTCCTGGGGCCTGACCCGTCCACCCTACAGTGTCTCTGTCTTTTAAGATCT TCAACTGCTTCTTTATCCCCGCCCCTCCAGCTTATTTTACCATCCCAAGCCTTGTTC TGCCCCCTGAGCGGCCGC

(SEQ ID NO: 15)

Since the mouse cDNAs are fused to the coding sequence of VP16, we deduced that the polypeptide sequence encoded by Clone 32 (below) was in the same reading frame as VP16. As noted above, amino acids 4-60 of SEQ ID NO.T6 correspond to the amino terminal region of LASP-1.

RPLKRYRAVYDYSAADEDEVSFQDGDTIV VQQIDDG MYGTVERTGDTGMLPANY¥ EAI

(SEQ ID NO: 16) Test for Specificity of Interaction of pllOδ with Clone 32

To check for the specificity of interaction of Clone 32 with the PB kinases, we introduced the Clone 32 plasmid DNA into the yeast cells carrying the pi lOβ Ras- binding domain, since the pi lOβ sequence is closest to the pi lOδ sequence. After selection on appropriate growth medium, the yeast transformants were assayed for β- galactosidase activity. The cells carrying the pi lOβ sequence did not show any β- galactosidase activity whereas the pi lOδ-carrying cells again showed positive activity, suggesting an absence of interaction between Clone 32 and pi lOβ Ras- binding domain (Table 2).

Clone 32 Interacts with the Proline (Pro) Rich Region of pi lOδ

As determined by sequence analysis, Clone 32 comprises an SH3 domain.

Since SH3 domains are known to bind proline rich sequences, we tested whether Clone 32 binds to the proline rich sequence of pi lOδ. We created 3 individual clones, each carrying one of the following mutations: 1) P304/A, 2) P307/A, and 3) deletion of 51 amino acids (aa 300-350 of SEQ ID NO:2) into our original pBTM116- pl 1 Oδ Ras-binding domain construct using standard recombinant DNA techniques.

Sequences of the proline-rich segments of pi lOβ and pi lOδ are given below, hi the pi lOδ sequence, the proline residues mutated to provide the P304/A and P307/A clones are identified.

pllOδ: EQSNPAPQVQKPRAK PPPIPAKKPSSV

(aa 288-314 ofSEQ ID NO:2) pllOβ: EQEMIAIEAAINR SSNLPLPLPPKKTRIIS

(aa 294-324 ofSEQ ID NO:8)

The three mutant plasmids were introduced into yeast cells and tested for interaction with Clone 32 by growth on selective medium and β-galactosidase activity. Growth of the cells containing Clone 32 or mutant plasmids were poor.

Moreover, as shown in Table 2, change of any of the proline residues to alanine resulted in a reduction of β-galactosidase activity. Deletion of the proline rich segment eliminated β-galactosidase activity. These results suggest that the Clone 32 (which encodes an SH3 domain) product interacts with pi lOδ (aa 134-350 of SEQ ID NO:2) through the proline rich segment of pi lOδ.

Table 2 Bait β-Galactosidase Activity pl lOβ piioδ ++ pll0δ (P304/A) pl l0δ (P307/A) +/- p 11 Oδ (Pro Rich Segment Deletion)

Further Verification of Interaction of pi lOδ Ras-Binding Domain with Clone 32 Since the yeast di-hybrid technique can produce proteimprotein interactions that are not always reproducible in mammalian cells, we tested whether Clone 32 can interact with pi lOδ within a mammalian cell environment. We generated a fusion of GFP (Green Florescent Protein) with Clone 32 in the vector pcDNA3.1 NT-GFP- TOPO (Invitrogen, San Diego, CA) according to the procedure recommended by the supplier. The resulting fusion plasmid, designated "GFP-32," was co-transfected in triplicate with a FLAG-pl lOδ-containing plasmid [Chantry et al., JBiol Chem 272:19236-41 (1997)] into the human embryonic kidney cell line HEK293. (The FLAG® N-terminal peptide identification system is described e.g., in US Patent Nos. 4,851,341 and 5,011,912.) Forty-eight hours after transfection the cells were lysed and immunoprecipitated using anti-FLAG® antibody M2-coated agarose beads. The bound proteins were separated by SDS-PAGE, blotted on nylon membrane, and probed with a rabbit anti-GFP antibody (Clontech, Palo Alto CA) and rabbit anti- pl lOδ antibodies (prepared using the method described in US Patent No. 5,882,910). A horseradish peroxidase (HRP)-linked goat anti-rabbit antibody (Clontech) was used according to the manufacturerAs protocol to develop the blot. Examination of the developed blot showed a band at about 33 kDa in the lanes containing lysates of cells transfected with the plasmid pcDNA3.1/NT-GFP, indicating expression of the GFP protein only.. In the lanes in which lysates from FLAG-pl lOδ and pcDNA3.1/NT-GFP-clone32 co-transfected cells were applied, both the FLAG-pl lOδ band (at about 110 kDa) and the GFP-clone32 band (at about

40 kDa) were observed, indicating expression of both proteins.

We also analyzed the supernatant and pellet of anti-FLAG® i munoprecipitated samples for the presence of FLAG-pl lOδ and GFP-clone32. As expected, the supernatants contained very little FLAG-pl lOδ signal, indicating successful precipitation of FLAG-pl 10δ. Complementing the absence of FLAG- pl lOδ in the supernatant, there was a large increase in the FLAG-pl lOδ signal in the pellets. In addition to the FLAG-pl lOδ signal, another band was observed in the pellet. This band comigrated with the GFP-clone32 band. These results indicate that Clone 32 can associate with pi lOδ within the mammalian cellular environment. LASP-1 has been shown to be phosphorylated in response to extracellular signals such as forskolin, and the phosphorylation is correlated to the secretory response of the cells [Chew et al., Am JPhysiol 275 (Cell Physiol 44-.C56-C57) (1998)]. In addition, LASP-1 has been shown to be tyrosine phosphorylated by c-Src and binds to actin [Schreiber et al., Mol Med 4:675-687 (1998)]. Since pi lOδ is involved in cellular signal fransduction pathways, we surmise that the LASP- 1 : p 11 Oδ interaction may facilitate secretion and/or cytoskeletal reorganization. Disruption of the interaction between pi lOδ proline rich sequence and SH3 domains may prevent pi lOδ activation in response to specific stimulus in a given cell type and thereby prevent unwanted signaling through the pi lOδ pathway. Disease states mediated by excessive or undesirable pi lOδ activity, therefore, may be expected to be susceptible to treatment using modulator compounds that disrupt binding or interaction of pi lOδ with LASP-1.

EXAMPLE 2. Functional Significance of the Proline-rich Sequence in pllOδ SH3 domains are approximately sixty amino acid residues long and are found in many signaling proteins, enzymes, and cytoskeletal proteins. Despite their amino acid sequence diversity, all SH3 domains bind to a short stretch of polyproline sequences of 8 to 10 amino acid residues. Even though several hundred distinct SH domains are known in human, they seem to bind polyproline sequences with a remarkable degree of specificity. The interaction between a polyproline sequence and a SH3 domain may be intramolecular or intermolecular. In the foπner case, the polyproline sequence and the SH3 domain of the same polypeptide chain bind to each other. In case of intermolecular, interactions the polyproline sequence and the SH3 domain from different proteins interact.

Polyproline sequences serve as ligands for many protein domains such as the EVH1 (Enabled, VASP Homolgy 1), WW and SH3 (Src Homology 3) for example.

These protein domains and their ligand polyproline sequences have been observed in many species suggesting their evolutionary conserved role in cellular functions. Among the different domains that bind polyproline sequences, the SH3 domain has been studied most of all. SH3 binding has been shown to activate signaling enzymes as well as in the formation of active signaling complexes [Pleiman et al., Science 263:1609-1612 (1994); Pawson, Nature 373:573-580 (1995)]. The present study shows that the proline-rich segment of pi lOδ can function as an SH3 binding sequence. Hence, it is possible that binding of SH3 domain-containing proteins leads to the activation of the kinase activity of pi lOδ. For example, Src family kinases and adapter proteins (e.g., vav, cbl) having one or more SH3 domains may bind to pi 10δ through the proline- rich domain.

Due to the important roles of polyproline sequences in the regulation of cellular activation, small molecule inhibitors are being developed to prevent the interaction between polyproline sequences and their cognate binding partners.

Proline is the only amino acid where the amido N is substituted. Based on this unique feature of proline, Nguyen et al., Science, 282: 2088-2092 (1998) designed a set of N-substituted analogs that can inhibit SH3 -polyproline interaction.

Indications for pi lOδ Activity Requirement in Neutrophils

Treatment of neutrophils with a pi lOδ-specific inhibitor (such as disclosed in U.S.S.N. 09/841,341 filed April 24, 2001, the disclosure of which is-hereby incorporated by reference) results in the inhibition of neutrophil functions such as superoxide production. NADPH oxidase, the enzyme responsible for superoxide production, is a multicomponent enzyme, and p47-phox is an essential constituent of the complex. P47-phox is described in Volpp et.al., PNAS, 86: 7195-7199 (1989). The p47-phox protein contains two SH3 domains. Human mutations of p47-phox have been discovered that result in defects in superoxide production by neufrophils. Most of these p47-phox mutations cause premature truncation and as a result the SH3 domains are not synthesized. These observations establish that in addition to pi lOδ, p47-phox is also necessary for superoxide production. Since, both pi 1 Oδ and p47- phox are required, it is contemplated that the polyproline sequence of pi lOδ functions in superoxide synthesis through an interaction with SH3 domain of p47-phox.

Indication for pi lOδ Activity Requirement in B cells

In addition to inhibiting neutrophil function, pi lOδ-specific inhibitor blocks B cell proliferation. This suggests that pi lOδ plays an important role in B cell function.

Bruton's tyrosine kinase (Btk) is another kinase that plays a crucial role in B cell function. Btk is described in Vetri et al., Nature, 361: 226-233 (1993) and Tsukata et al., Cell, 72: 279-290 (1993). Btk is preferentially expressed in B cells, mast cells and platelets. Btk is an X-linked gene, and defects in Btk activity results in X-linked agammaglobulinemia (XLA). Primary symptoms of XLA are low numbers of peripheral B cells and cosequently low antibody titer. Similar to the defects in human B cells, in mice loss of Btk results in defective B cell development and function. A remarkably similar defect in B cell compartment was observed in PI kinase subunit p85 knock out mice. Since p85 is an essential component of class IA PB kinases, in addition to Btk, PB kinase(s) are apparently required for B cell function. Since Btk has an SH3 domain, it is contemplated that pi lOδ interacts with the SH3 domain of Btk through its polyproline sequence.

In neutrophils and B cells therefore, it is contemplated that the polyproline sequence of pi lOδ is involved in interactions with the SH3 domains of p47-phox and Btk respectively. However, in addition to interacting with other proteins, the polyproline sequence of pi lOδ can interact with components of PB kinase itself. It maybe recalled that class IA kinases consist of a catalytic subunit (plO) and a regulatory subunit (p85). P85 is described in Escobedo et al., Cell, 65: 75-82 (1991); Skolnik et al., Cell, 65: 83-90 (1991) and Otsu et al, Cell, 65: 91-104 (1991). Association of p85 is essential for the catalytic activity of pi 10. Though the regions responsible for the binding of p85 subunit to pi 10 subunit have been mapped, it is contemplated that the pi 10 subunit of PB kinase delta provides an additional binding site to the SH3 domain of p85 through its unique polyproline region, thereby further enhancing the interaction between p85 and pi lOδ.

/

In summary the above example illustrates binding of the proline-rich sequence of pi lOδ to SH3 domains of other proteins (e.g., p47-phox, Btk) or a component of

PI3 kinase itself (e.g., p85) and regulation of cellular activity.

All publications and patent documents cited in this specification are incorporated herein by reference for all that they disclose. While the present invention has been described with specific reference to certain preferred embodiments for purposes of clarity and understanding, it will be apparent to the skilled artisan that further changes and modifications may be practiced within the scope of the invention as it is defined in the claims set forth below. Accordingly, no limitations should be placed on the invention other than those specifically recited in the claims.

Claims

WHAT IS CLAIMED IS:

1. A method of identifying a modulator of p 11 Oδ binding to LASP- 1 , comprising the steps of:

(a) providing a p 11 Oδ polypeptide and a LASP- 1 polypeptide having specific binding affinity for one another;

(b) measuring binding between the p 110δ polypeptide and the LASP-1 polypeptide in the presence and absence of a test compound; and

(c) identifying the test compound as a modulator of pi 1 Oδ binding to LASP-1 when a different amount of binding of the pi lOδ polypeptide to the LASP- 1 polypeptide is detected in the presence of the test compound than in the absence of the test compound.

2. A method according to Claim 1, wherein the pi lOδ polypeptide comprises the proline rich region of pi lOδ.

3. A method according to Claim 1, wherein the LASP-1 polypeptide comprises the SH3 region of LASP-1.

4. A method according to Claim 1 , wherein the p 11 Oδ polypeptide is provided as a fusion protein.

5. A method according to Claim 1, wherein the LASP-1 polypeptide is provided as a fusion protein.

6. A method according to Claiml , wherein the p 11 Oδ polypeptide is expressed by a host cell.

7. A method according to Claim 1, wherein the LASP-1 polypeptide is expressed by a host cell.

8. A method according to Claim 1, wherein the pi lOδ polypeptide and the LASP-1 polypeptide are recombinantly coexpressed by a host cell.

9. A method according to Claim 1 , wherein the modulator inhibits binding of pi lOδ to LASP-1.

10. A method according to Claim 1 , wherein the modulator enhances binding of pi lOδ to LASP-1.

11. A compound having activity as a modulator of interaction between pi lOδ and LASP-1, wherein the compound is identified according to the method of Claim 1.

12. A compound according to Claim 11, wherein the compound inhibits binding of pllOδ to LASP-1. 3. A method of treating a disease state characterized by undesirable or excessive activity of PBKδ, comprising administering to a subject in need thereof a compound according to Claim 11 or a derived analog thereof in an amount effective to inhibit interaction of pllOδ with LASP-1.

14. A method according to Claim 13, wherein the modulator inhibits binding of pi lOδ to LASP-1.

15. A method of modulating p 11 Oδ binding to LASP- 1 , comprising the step of contacting pi lOδ or LASP-1 with a modulator of pi lOδ binding to LASP-1.

16. A method according to Claim 15, wherein the modulator inhibits binding of pi lOδ to LASP-1.

17. A method of treating a disease state associated with pi lOδ binding to LASP-1, comprising the step of administering to a subject in need thereof an effective amount of a modulator of pi lOδ binding to LASP-1.

18. A method according to Claim 17, wherein the modulator inhibits binding of pl lOδ to LASP-1.

19. A method of identifying a modulator of p 11 Oδ binding to a polypeptide comprising an SH3 domain, comprising the steps of:

(a) providing a pi lOδ polypeptide and an SH3 domain-containing polypeptide having specific binding affinity for one another;

(b) measuring binding between the p 11 Oδ polypeptide and the SH3 domain-containing polypeptide in the presence and absence of a test compound; and

(c) identifying the test compound as a modulator of pi lOδ binding to the SH3 domain-containing polypeptide when a different amount of binding of the pi lOδ polypeptide to the SH3 domain-containing polypeptide is detected in the presence of the test compound than in the absence of the test compound.

^'20. A method according to Claim 19, wherein the pi lOδ polypeptide is provided as a fusion protein.

21. A method according to Claim 19, wherein the SH3 domain-containing polypeptide is provided as a fusion protein.

22. A method according to Claim 19, wherein the p 11 Oδ polypeptide is expressed by a host cell.

23. A method according to Claim 19, wherein the SH3 domain-containing polypeptide is expressed by a host cell.

24. A method according to Claim 19, wherein the p 11 Oδ polypeptide and the SH3 domain-containing polypeptide are recombinantly coexpressed by a host cell.

25. A method according to Claim 19, wherein the modulator inhibits binding of pllOδ to the SH3 domain-containing polypeptide.

26. A method according to Claim 19, wherein the modulator enhances binding of pllOδ to the SH3 domain-containing polypeptide.

27. A compound having activity as a modulator of interaction between pi lOδ and an SH3 domain-containing polypeptide, wherein the compound is identified according to the method of Claim 19.

28. A compound according, to Claim 28, wherein the compound inhibits binding of pllOδ to the SH3 domain-containing polypeptide.

29. A method of treating a disease state characterized by undesirable or excessive activity of PBKδ, comprising administering to a subject in need thereof a compound according to Claim 27.

30. A method according to Claim 29, wherein the compound inhibits binding of pi lOδ to the SH3 domain-containing polypeptide.

31. A method of modulating p 11 Oδ binding to an SH3 domain-containing polypeptide, comprising the step of contacting pi lOδ or the SH3 domain-containing polypeptide with a modulator of pi lOδ binding to the SH3 domain-containing polypeptide.

32. A method according to Claim 31 , wherein the modulator inhibits binding of pllOδ to the SH3 domain-containing polypeptide.

33. A method of treating a disease state associated with pi lOδ binding to an SH3 domain-containing polypeptide, comprising the step of administering to a subject in need thereof an effective amount of a modulator of pi lOδ binding to the SH3 domain-containing polypeptide.

34. A method according to Claim 33, wherein the modulator inhibits binding of pi lOδ to the SH3 domain-containing polypeptide.

35. The method of claim 19, 29, 31 or 33 wherein the SH3 domain- containing polypeptide is p 85.

36. The method of claim 19, 29, 31 or 33 wherein the SH3 domain- containing polypeptide is p47-phox.

37. The method of claim 19, 29, 31 or 33 wherein the SH3 domain- containing polypeptide is Btk.