WO2001075035A2 - A novel polypeptide, human peroxydase protein 9 and the polynucleotide encoding the polypeptide - Google Patents
A novel polypeptide, human peroxydase protein 9 and the polynucleotide encoding the polypeptide Download PDFInfo
- Publication number
- WO2001075035A2 WO2001075035A2 PCT/CN2001/000410 CN0100410W WO0175035A2 WO 2001075035 A2 WO2001075035 A2 WO 2001075035A2 CN 0100410 W CN0100410 W CN 0100410W WO 0175035 A2 WO0175035 A2 WO 0175035A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- polynucleotide
- protein
- sequence
- human peroxidase
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0065—Oxidoreductases (1.) acting on hydrogen peroxide as acceptor (1.11)
Definitions
- the present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide ⁇ ⁇ peroxidase protein 9 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide.
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxidase is widely distributed in bacteria, fungi, plants and vertebrates.
- the heme prosthetic group of peroxidase is protoporphyrin IX
- the fifth ligand of the heme iron atom is the imidazole group of the proximal histidine
- the distal histidine residue serves as the acid for the peroxidation , Alkali catalyst.
- sequences of these two Hi s and nearby residues are more or less conserved.
- the conserved sequence of peroxidase is: (DET)-(LIVMTA) -X (2)-(LI VM)-(LI VMSTAG)-(SAG)-(LIVMSTAG) -H- (STA)-(LIVMFY) ( H is the proximal heme binding site), LPO and Phlebia radiata do not have this sequence; (SGATV) -X (3)-(LIVMA) -X- (FW) -HX- (SAC) (H Is the distal active site), and vertebrate peroxidases (MP0, TP0, LP0, and EP0) do not have this sequence.
- MP0 Myeloperoxidase
- TP0 another animal peroxidase-thyroid Peroxidase
- human peroxidase protein 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so the identification of more involved in these Process of human peroxidase protein 9 protein, 'especially identified The amino acid sequence of this protein. Isolation of the new human peroxidase protein 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Object of the invention
- Another object of the invention is to provide a polynucleotide encoding the polypeptide.
- Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human peroxidase protein 9. .
- Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human peroxidase protein 9.
- Another object of the present invention is to provide a method for producing human peroxidase protein 9.
- Another object of the present invention is to provide an antibody against the polypeptide-human peroxidase protein 9 of the present invention.
- Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the polypeptide-human peroxidase protein 9 of the present invention.
- Another object of the present invention is to provide a method for diagnosing and treating a disease associated with an abnormality of human peroxidase protein 9. Summary of invention
- the present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof.
- the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:-
- sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 169-426 in SEQ ID NO: 1; and (b) having a sequence of 1-1292 in SEQ ID NO: 1 Sequence of bits.
- the invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention;
- a host cell genetically engineered with the vector including a transformed, transduced or transfected host cell; a method for preparing a polypeptide of the present invention comprising culturing the host cell and recovering an expression product.
- the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
- the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human peroxidase protein 9 protein, which comprises using the polypeptide of the invention.
- the invention also relates to compounds obtained by this method.
- the invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human peroxidase protein 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting The amount or biological activity of a polypeptide of the invention in a biological sample.
- the invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
- the present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the manufacture of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human peroxidase protein 9.
- FIG. 1 is a comparison diagram of gene chip expression profiles of human peroxidase protein 9 and human peroxidase protein 11 of the present invention.
- the upper graph is a graph of the expression profile of human peroxidase protein 9, and the lower graph is the graph of the expression profile of human peroxidase protein 11.
- ECV304 PMA- 10 means ECV304 PMA +, 11 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 means spleen, 20 is the prostate, 21 is the fetal heart, 22 is the heart, 23 is the muscle, 24 is the testis, 25 is the fetal thymus, and 26 is the thymus.
- Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated human peroxidase protein 9.
- Da is the molecular weight of the protein.
- the arrows indicate the protein bands from the birds. Summary of the invention.
- Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DM or RM, they can be single-stranded or double-stranded, representing the sense or antisense strand.
- amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
- amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide” or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
- a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or the nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
- “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
- “Insertion” or “addition” means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement” refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides. ⁇
- Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
- immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.
- An "agonist” refers to a molecule that, when combined with human peroxidase protein 9, causes a change in the protein to regulate the activity of the protein.
- An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human peroxidase protein 9.
- Antagonist refers to a molecule that, when combined with human peroxidase protein 9, can block or regulate the biological or immunological activity of human peroxidase protein 9.
- Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human peroxidase protein 9.
- Regular refers to a change in the function of human peroxidase protein 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human peroxidase protein 9. change.
- substantially pure means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify human peroxidase protein 9 using standard protein purification techniques. Substantially pure human peroxidase protein 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxidase protein 9 polypeptide can be analyzed by amino acid sequence.
- Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
- sequence C-T-G-A
- complementary sequence G-A-C-T.
- the complementarity between two single-stranded molecules may be partial or complete.
- the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
- “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
- Partial homology refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency.
- Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
- Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. Percent identity can be determined electronically, such as through the MEGALIGN program
- the MEGALIGN program can compare two or more sequences (Hi gg ins, D. G. and
- Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
- Amino acids used for conservative substitution for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
- Antisense refers to a nucleotide sequence that is complementary to a particular DM or RM sequence.
- Antisense strand refers to a nucleic acid strand that is complementary to the “sense strand”.
- Derivative refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
- Antibody refers to a complete antibody molecule and its fragments, such as Fa,? ( ⁇ ') 2 and? It can specifically bind to the epitope of human peroxidase protein 9.
- a “humanized antibody” refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.
- isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
- a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
- Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
- isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
- polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
- isolated human peroxidase protein 9 means that human peroxidase protein 9 is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated with it. Those skilled in the art can purify human peroxidase protein 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human peroxidase protein 9 peptide can be analyzed by amino acid sequence.
- the present invention provides a new polypeptide, human peroxidase protein 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2.
- the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, and preferably a recombinant polypeptide.
- the polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.
- the invention also includes fragments, derivatives and analogs of human peroxidase protein 9.
- fragment refers to a polypeptide that substantially retains the same biological function or activity of the human peroxidase protein 9 of the present invention.
- a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are conserved or non-conserved Substitution of amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may or may not be encoded by a genetic codon; or 11) such a type in which one or more of the amino acid residues A group is substituted by another group to include a substituent; or (II) a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a type A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protein sequence) formed by merging additional amino acid sequences into a mature polypeptide.
- such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.
- the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
- the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide of the present invention is found from a CDM library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1292 bases, and its open reading frames 169-426 encode 85 amino acids.
- this peptide has a similar expression profile to human peroxidase protein 11, and it can be inferred that the human peroxidase protein 9 has a similar function to human peroxidase protein 11.
- the polynucleotide of the present invention may be in the form of DNA or RNA.
- DNA forms include cDNA, genomic DNA, or synthetic DNA.
- DNA can be single-stranded or double-stranded.
- DNA can be coding or non-coding.
- the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
- a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.
- the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
- polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
- the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
- Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
- an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
- the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
- the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
- "strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add a denaturant such as 50 when hybridizing. /. ( ⁇ / ⁇ ) formamide, 0.1% calf serum / 0.1. /.
- the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
- nucleic acid fragments that hybridize to the sequences described above.
- a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human peroxidase protein 9.
- polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
- the specific polynucleotide sequence encoding the human peroxidase protein 9 of the present invention can be obtained by various methods.
- polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
- the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) separating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
- genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the separation of cDM sequences.
- the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
- the construction of cDNA library is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989).
- Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
- genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of the transcript of human peroxidase protein 9; ( 4) Detecting gene-expressed protein products by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.
- the probe used for hybridization is any part of the polynucleotide of the present invention Homologous, at least 10 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, most preferably at least 100 nucleotides.
- the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
- the probe used here is generally a DM sequence chemically synthesized based on the gene sequence information of the present invention.
- the genes or fragments of the present invention can of course be used as probes.
- DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
- immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product expressed by the human peroxidase protein 9 gene.
- ELISA enzyme-linked immunosorbent assay
- a method for amplifying DM / RNA by PCR is preferably used to obtain the gene of the present invention.
- the RACE method RACE-Rapid Amplification of cDNA Ends
- the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods.
- the amplified DNA / RM fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
- polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.
- the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using the human peroxidase protein 9 coding sequence, and a recombinant technology to produce the polypeptide of the present invention method.
- a polynucleotide sequence encoding the human peroxidase protein 9 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
- vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
- Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
- any plasmid and vector can be used to construct a recombinant expression vector.
- An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
- Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human peroxidase protein 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DM Technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, Cold Harbor Harbor Laboratory. New York, 1989).
- the DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.
- the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for MA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.
- the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and Green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
- a polynucleotide encoding human peroxidase protein 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector.
- the term "host cell” refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E.
- coli Streptomyces
- bacterial cells such as Salmonella typhimurium
- fungal cells such as yeast
- plant cells such as fly S2 or Sf9
- animal cells such as CH0, COS or Bowes melanoma cells.
- Transformation of a host cell with a DNA sequence according to the present invention or a recombinant vector containing the DM sequence can be performed using conventional techniques well known to those skilled in the art.
- the host is a prokaryote such as E. coli
- competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl ⁇ .
- the steps used are well known in the art.
- MgCl 2 is used.
- transformation can also be performed by electroporation.
- the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.
- the polynucleotide sequence of the present invention can be used to express or produce recombinant human peroxidase protein 9 (Science, 1984; 224: 1431). Generally there are the following steps: (1) using the polynucleotide (or variant) encoding human human peroxidase protein 9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;
- the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
- a suitable method such as temperature conversion or chemical induction
- the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.
- conventional renaturation treatment protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid
- polypeptides of the present invention as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immune diseases.
- Peroxidase is a heme-binding enzyme that performs a series of biosynthesis and degradation by using hydrogen peroxide as an electron acceptor. Peroxide and microperoxide contain a large amount of peroxidase. In some pathological processes of the human body, such as viral hepatitis, Borrelia infection, increased peroxisomes can occur. Studies have found that myeloperoxidase (MP0) is mainly present in granulocytes and monocytes, and MP0 plays an important role in neutrophil-dependent bactericidal systems. It has also been found that peroxidase-thyroid peroxidase (TP0) is involved in the biosynthesis of thyroid hormones.
- MP0 myeloperoxidase
- TP0 peroxidase-thyroid peroxidase
- human peroxidase protein 9 of the present invention will produce various diseases, especially various inflammations, immune system diseases, and thyroid diseases. These diseases include, but are not limited to:
- inflammatory abnormalities caused by various infections and traumas such as viral hepatitis, Borrelia infection, tuberculosis, HIV, syphilis, allergic reactions, bronchial asthma, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, Osteoarthritis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, Addison's disease, Grating Reeves's disease, chronic active hepatitis, intestinal emergency syndrome, atrophic gastritis, systemic lupus erythematosus, cerebral spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granulomatosis, Wegener granulomatosis, autologous Immune thyroiditis, autoimmune interstitial nephritis, ulcerative
- Immune system diseases antibody-based primary specific immunodeficiency disease, combined immunodeficiency disease, immunodeficiency disease of phagocytic cells deficiency, complement system deficiency disease, Down syndrome, biotin-dependent carboxylase deficiency, Dun Can syndrome, thymoma, chronic cutaneous mucosal candidiasis, aplastic anemia, Di George syndrome, Wiscot t-Aidr ich syndrome, immunodeficiency disease with ataxia capillary dilatation, acquired immunodeficiency syndrome Disease
- Thyroid disease Toxic glandular adenoma, non-toxic goiter, cretinism, myxedema, sacral adenitis
- the abnormal expression of the human peroxidase protein 9 of the present invention will also produce certain hereditary, hematological and immune system diseases.
- the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human peroxidase protein 9.
- Agonists enhance human peroxidase protein 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers.
- mammalian cells or membrane preparations expressing human peroxidase protein 9 can be cultured with labeled human peroxidase protein 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then measured.
- Antagonists of human peroxidase protein 9 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human peroxidase protein 9 can bind to human peroxidase protein 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot exert its biology Features.
- human peroxidase protein 9 When screening compounds as antagonists, human peroxidase protein 9 can be added to bioanalytical assays to determine whether a compound is a compound by measuring its effect on the interaction between human peroxidase protein 9 and its receptor. Antagonist. Receptor deletions and analogs that function as antagonists can be screened in the same manner as described above for screening compounds.
- Polypeptide molecules capable of binding to human peroxidase protein 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, the human peroxidase protein 9 molecule should generally be labeled.
- the present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen.
- These antibodies can be polyclonal or monoclonal antibodies.
- the invention also provides antibodies against human peroxidase protein 9 epitopes. These antibodies include (but are not limited to): many Cloned antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
- Polyclonal antibodies can be produced by injecting human peroxidase protein 9 directly into immunized animals (such as rabbits, mice, rats, etc.).
- immunized animals such as rabbits, mice, rats, etc.
- adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc.
- Techniques for preparing monoclonal antibodies to human peroxidase protein 9 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridoma technology , EBV-hybridoma technology, etc.
- Antibodies against human peroxidase protein 9 can be used in immunohistochemistry to detect human peroxidase protein 9 in biopsy specimens.
- Monoclonal antibodies that bind to human peroxidase protein 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
- Antibodies can also be used to design immunotoxins that target a particular part of the body.
- human peroxidase protein 9 high affinity monoclonal antibodies can covalently bind to bacterial or phytotoxins (such as diphtheria toxin, ricin, ormosine, etc.).
- a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
- This hybrid antibody can be used to kill human peroxidase protein 9 positive cell.
- the antibodies of the present invention can be used to treat or prevent diseases related to human peroxidase protein 9.
- Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human peroxidase protein 9.
- the invention also relates to a diagnostic test method for quantitative and localized detection of human peroxidase protein 9 levels.
- tests are well known in the art and include FISH assays and radioimmunoassays.
- the level of human peroxidase protein 9 detected in the test can be used to explain the importance of human peroxidase protein 9 in various diseases and to diagnose diseases in which human peroxidase protein 9 plays a role.
- polypeptide of the present invention can also be used for peptide mapping analysis.
- the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
- human peroxidase protein 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human peroxidase protein 9.
- Recombinant gene therapy vectors (such as viral vectors) can be designed for expression Mutated human peroxidase protein 9 to inhibit endogenous human peroxidase protein 9 activity.
- a mutated human peroxidase protein 9 may be a shortened human peroxidase protein 9 that lacks a signaling domain. Although it can bind to a downstream substrate, it lacks signaling activity.
- recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human peroxidase protein 9.
- Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human peroxidase protein 9 into a cell.
- Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human peroxidase protein 9 can be found in the existing literature (Sambrook, et al.).
- a recombinant polynucleotide encoding human peroxidase protein 9 can be packaged into liposomes and transferred into cells.
- Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.
- a vector such as a virus, phage, or plasmid
- Oligonucleotides including antisense RNA and DNA
- ribozymes that inhibit human peroxidase protein 9 mRNA are also within the scope of the present invention.
- a ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific MA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RM to perform endonucleation.
- Antisense RNA, DM, and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase phosphoramidite chemical synthesis to synthesize oligonucleotides.
- Antisense MA molecules can be obtained by in vitro or in vivo transcription of the DM sequence encoding the RM.
- This DM sequence has been integrated downstream of the RNA polymerase promoter of the vector.
- it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphorothioate or peptide bonds instead of phosphodiester bonds.
- the polynucleotide encoding human peroxidase protein 9 can be used for the diagnosis of diseases related to human peroxidase protein 9.
- the polynucleotide encoding human peroxidase protein 9 can be used to detect the expression of human peroxidase protein 9 or the abnormal expression of human peroxidase protein 9 in a disease state.
- the DM sequence encoding human peroxidase protein 9 can be used to hybridize biopsy specimens to determine the expression of human peroxidase protein 9.
- Hybridization techniques include Southern blotting ⁇ Nor thern blotting, in situ hybridization, and so on. These techniques and methods are publicly available and mature, and related kits are commercially available.
- polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also referred to as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissue.
- Human peroxidase protein 9 specific primers can also be used to detect the transcription products of human peroxidase protein 9 by RNA-polymerase chain reaction (RT-PCR) in vitro amplification.
- RT-PCR RNA-polymerase chain reaction
- Human peroxidase protein 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human peroxidase protein 9 DM sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
- sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.
- a PCR primer (preferably 15-35bp) is prepared from the cDNA, and the sequence can be located on the chromosome. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.
- PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes.
- oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
- Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
- Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
- FISH Fluorescent in situ hybridization
- the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the CDM that is accurately mapped to a chromosomal region associated with a disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20kb corresponds to a gene).
- the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
- suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
- the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
- the invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention.
- these containers there may be instructional instructions given by government regulatory agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts the government regulatory agency that manufactures, uses, or sells them to permit their administration on the human body.
- the polypeptides of the invention can be used in combination with other therapeutic compounds.
- the pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
- Human peroxidase protein 9 is administered in an amount effective to treat and / or prevent a specific indication.
- the amount and range of human peroxidase protein 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples
- Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
- Poly (A) mRNA was isolated from total RM using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA.
- the Smart cDNA Cloning Kit purchased from Clontech was used to insert the cDM fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5 ⁇ .
- the bacteria formed a cDNA library.
- Dye terminate cycle react ion sequencing kit Perkin-Elmer
- ABI 377 automatic sequencer Perkin-Elmer
- the determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of 0646gll of one of the clones was a new DM.
- a series of primers were synthesized to perform bidirectional determination of the inserted CDM fragments contained in this clone.
- CDNA was synthesized using fetal brain total RM as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, the following primers were used for PCR amplification:
- Primerl 5'- GGGGAATCACTTTCATTGGCCAGA -3, (SEQ ID NO: 3)
- Pr imer2 5'- ATTTTTGAACAGCTTTATTGAGAT -3 '(SEQ ID NO: 4)
- Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;
- Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
- Amplification reaction conditions A reaction volume of 50 ⁇ 1 contains 50 mmo l / L KC1, 10 mmol / L Tris-HCl, pH 8. 5, 1.5 mg / L MgCl 2 , 20 ( ⁇ mol / L dNTP, l Opmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. Set ⁇ -act in as a positive control and template blank as a negative control at the same time during RT-PCR.
- the amplified product was purified using a QIAGEN kit and connected to a pCR vector using a TA cloning kit (Invitrogen product).
- DM sequence analysis results show that the DNA sequence of the PCR product is exactly the same as the 1 to 1292bp shown in SEQ ID NO: 1.
- Example 3 Northern blot analysis of human peroxidase protein 9 gene expression
- RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] 0
- This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1), centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
- a 32P-labeled probe (approximately 2 x 10 6 cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH 2 P0 4 (P H7. 4) -5 ⁇ SSC- 5 ⁇ Denhardt's solution, and 2 00 ⁇ ⁇ / ⁇ 1 salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C was washed 30niin. Then, Phosphor Imager was used for analysis and quantification.
- Example 4 In vitro expression, isolation and purification of recombinant human peroxidase protein 9 Based on the sequence of the coding region shown in SEQ ID NO: 1 and FIG. 1, a pair of specific amplification primers were designed, the sequence is as follows:
- Primer3 5'- CATGCTAGCATGCGAAGTTTCCCTCTTCAGGGT -3 '(Seq ID No: 5)
- Pr imer4 5'- CATGGATCCTTATTGCTGTATATTTACATCTCT -3, (Seq ID No: 6)
- the 5' ends of these two primers contain Nhel and BamHI restriction sites, respectively , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
- the Nhel and BamHI restriction sites correspond to the expression vectors on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). Selective endonuclease site.
- PCR reaction was performed using pBS-0646gll plasmid containing the full-length target gene as a template.
- PCR reaction conditions were: 1 in a total volume of 50 ⁇ containing pBS - 0646gll plasmid 10pg, Primer-3 and Primer Primer- 4 are lOpmol, Advantage polymerase Mix (Clontech Products) 1 ⁇ 1.
- Cycle parameters 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles.
- Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
- the ligation product was transformed into coliform bacteria DH50 using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 ⁇ 1), positive clones were selected by colony PCR method and sequenced. A positive clone (PET-0646gll) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
- the following peptides specific for human peroxidase protein 9 were synthesized using a peptide synthesizer (product of PE): NH2- Met-Arg- Ser- Phe-Pro- Leu- Gln-Gly- Asn-Leu-Val-Ala- Gln-Asn- Gly- C00H (SEQ ID NO: 7).
- the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
- Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways.
- the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected.
- the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.
- the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method.
- Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to hybridize the fixed polynucleotide sample to the filter.
- the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
- the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
- the unhybridized probes are removed by a series of membrane washing steps.
- This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
- the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
- the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
- the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
- oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:
- the preferred range of probe size is 18-50 nucleotides
- Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences
- the column and its complementary region are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used in general; ... ..
- Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):
- Probe 2 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
- PBS phosphate buffered saline
- step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
- NC membrane nitrocellulose membrane
- the 32 P-Pr 0 be (the second peak is free ⁇ - 32 P- dATP) to be prepared.
- the sample membrane was placed in a plastic bag and 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)) was added. After closing the bag, 68. C water bath for 2 hours.
- prehybridization solution lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DM)
- probe 1 can be used for qualitative and quantitative analysis.
- the presence and differential expression of the polynucleotide of the present invention in different tissues are analyzed.
- Gene chip or gene microarray is a new technology currently being developed by many national laboratories and large pharmaceutical companies.
- the data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information.
- the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
- the specific method steps have been reported in the literature. , M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
- a total of 4,000 polynucleotide sequences of various full-length cDM are used as target DM, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500 ng / ul after purification, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ 1 . The spotted slides were hydrated and dried, cross-linked in a UV cross-linker, and dried after elution to fix the DNA on the glass slide to prepare a chip. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:
- Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen), and separated by reverse transcription! ] Labeled with fluorescent reagent Cy3dUTP (5-Amino-propargyl-2--deoxyuridine 5--triphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech) MRM of human mixed tissues, using Cy5dUTP (5-Amino- propargyl-2'-deoxyuridine 5'-triphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamacia Biotech) to label specific tissues (or stimulated cell lines) ) MRNA, probes were prepared after purification. For specific steps and methods, see:
- the probes from the above two tissues and the chip were respectively hybridized in a UniHyb TM Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, and the washing solution (1> ⁇ SSC, 0.2% SDS) was used at room temperature. ) After washing, scan with a ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned images are analyzed by Imagene software (Biodi scovery, USA), and the Cy3 / Cy5 ratio of each point is calculated.
- the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU58156/01A AU5815601A (en) | 2000-03-24 | 2001-03-23 | A novel polypeptide, human peroxydase protein 9 and the polynucleotide encoding the polypeptide |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 00115118 CN1315359A (en) | 2000-03-24 | 2000-03-24 | Polypeptide-human peroxidase protein 9 and polynucleotide for coding it |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2001075035A2 true WO2001075035A2 (en) | 2001-10-11 |
WO2001075035A3 WO2001075035A3 (en) | 2007-12-13 |
Family
ID=4584587
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/CN2001/000410 WO2001075035A2 (en) | 2000-03-24 | 2001-03-23 | A novel polypeptide, human peroxydase protein 9 and the polynucleotide encoding the polypeptide |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN1315359A (en) |
AU (1) | AU5815601A (en) |
WO (1) | WO2001075035A2 (en) |
-
2000
- 2000-03-24 CN CN 00115118 patent/CN1315359A/en active Pending
-
2001
- 2001-03-23 AU AU58156/01A patent/AU5815601A/en not_active Abandoned
- 2001-03-23 WO PCT/CN2001/000410 patent/WO2001075035A2/en active Application Filing
Non-Patent Citations (4)
Title |
---|
GARDAS A. ET AL. J. CLIN. ENDOCRINOL. METAB. vol. 82, no. 11, November 1997, pages 3752 - 3757, XP008091599 * |
GUO J. ET AL. ENDOCRINOLOGY vol. 139, no. 3, March 1998, pages 999 - 1005, XP008090582 * |
SILVA R.C. ET AL. BRAZ. J. MED. BIOL. RES. vol. 31, no. 9, September 1998, pages 1141 - 1148, XP008090422 * |
STAPLETON P.P. ET AL. ADV. EXP. MED. BIOL. no. 442, 1998, pages 183 - 192, XP008090507 * |
Also Published As
Publication number | Publication date |
---|---|
WO2001075035A3 (en) | 2007-12-13 |
CN1315359A (en) | 2001-10-03 |
AU5815601A (en) | 2001-10-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2001072786A1 (en) | A novel polypeptide - tumor suppressor protein 63 and the polynucleotide encoding said polypeptide | |
WO2001079490A1 (en) | A novel polypeptide- prostate specific membrane antigen 16 and the polynucleotide encoding said polypeptide | |
WO2001092514A1 (en) | A novel polypeptide-human interleukin-13 (il-13) receptor 11 and the polynucleotide encoding said polypeptide | |
WO2001046240A1 (en) | A novel polypeptide - human mariner transposase 19 and the polynucleotide encoding said polypeptide | |
WO2001075035A2 (en) | A novel polypeptide, human peroxydase protein 9 and the polynucleotide encoding the polypeptide | |
WO2001072815A1 (en) | A novel polypeptide - human iron-sulfur protein 12 and a polynucleotide sequence encoding the same | |
WO2001083538A1 (en) | A novel polypeptide, a human k-ras gene protein 36 and the polynucleotide | |
WO2001075103A1 (en) | A novel polypeptide, human protein 9 of short-chain scorpion toxin and the polynucleotide encoding the polypeptide | |
WO2001046430A1 (en) | A novel polypeptide, peroxidase 12 and the polynucleotide encoding the polypeptide | |
WO2001075117A1 (en) | A novel polypeptide- human tryosinase 12 and the polynucleotide encoding said polypeptide | |
WO2001072980A1 (en) | A new polypeptide- human peroxydase 18 and the polynucleotide encoding it | |
WO2001075016A2 (en) | A novel polypeptide, a human tyrosinase 16, and the polynucleotide encoding the polypeptide | |
WO2001074870A1 (en) | A novel polypeptide-human alpha-galactosidase a-11 and the polynucleotide encoding said polypeptide | |
WO2001094593A1 (en) | A novel polypeptide - human glyceraldehyde-3-phosphate dehydrogenase 11 and the polynucleotide encoding said polypeptide | |
WO2001088158A1 (en) | A novel polypeptide- human triose-phosphate isomerase 10 and the polynucleotide encoding said polypeptide | |
WO2001074880A1 (en) | A novel polypeptide - homo peroxidase protein 10 and polynucleotide encoding said polypeptide | |
WO2001092541A1 (en) | Novel polypeptide - a human hydrogen peroxidase 12 and polynucleotide encoding it | |
WO2001068873A1 (en) | Novel polypeptide---a human linker adhesion molecule 12 and polynucleotide encoding it | |
WO2001072983A1 (en) | A new polypeptide- human peroxydase 11 and the polynucleotide encoding it | |
WO2001085752A1 (en) | A novel peptide-human myosin heavy chain 12-14 and the polynucleotide coding this novel peptide | |
WO2001090376A1 (en) | Novel polypeptide - a human triose phosphate isomerase 11 and polynucleotide encoding it | |
WO2001085923A1 (en) | A novel polypeptide, a human atp dependent serine hydrolase 9.2 and the polynucleotide encoding the polypeptide | |
WO2001064734A1 (en) | A novel polypeptide - human cathepsin 18 and a polynucleotide sequence encoding the same | |
WO2001075034A2 (en) | A novel polypeptide, human peroxydase protein 15 and the polynucleotide encoding the polypeptide | |
WO2001070792A1 (en) | A novel polypeptide, a human tyrosinase 12 and the polynucleotide encoding the polypeptide |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
NENP | Non-entry into the national phase in: |
Ref country code: DE |
|
WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |