WO2001075005A2 - A novel polypeptide, sub-unit c of vacuolar proton-pumping atpase (v-atpase) 12 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, sub-unit c of vacuolar protein-pumping ATPase 12,the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumor, hemopathy, HIV infection, immunological disease, and various inflammation, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the sub-unit c of vacuolar proton-pumping ATPase 12.

Description

 A new peptide-human vacuolar proton-adenosine triphosphatase C subunit 12

 And a polynucleotide encoding this polypeptide

Technical field

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human vacuolar proton-adenosine triphosphatase C subunit 12, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique

 It is known that human hydrogen ion-adenosine triphosphatase can "pump" ions / protons into the organelles in cells or make ions / protons cross the plasma membrane of certain cells (such as osteoclasts, renal interstitial cells). . The catalytic site of human hydrogen ion-adenosine triphosphatase is a hexamer composed of three A subunits and three B subunits, which has the function of binding and hydrolyzing ATP; and the other three subunits C, D, And E have a regulating effect. The main function of human hydrogen ion-adenosine triphosphatase is to regulate the pH of a local area in the cell, and it plays an important role in receptor-mediated cytotoxicity, intracellular membrane flow, protein degradation, and coupling transport. Therefore, human hydrogen ion-adenosine triphosphatase has the effects of renal acidification, bone resorption, and stabilization of intracellular pH. It can be seen that the human V-ATPase C subunit, as one of the three regulatory subunits, has a role in regulating human hydrogen ion-adenosine triphosphatase activity.

 Recombinant human V-ATPase C subunit proteins or peptides have many uses. These uses include (but are not limited to) direct use as a drug to treat diseases caused by hypofunction or loss of V-ATPase C subunits, and to screen antibodies, peptides or other ligands that promote or counteract V-ATPase C subunit function. For example, antibodies can be used to activate or inhibit the function of the V-ATPa se C subunit. Screening peptide libraries with the expressed recombinant V-ATPase C subunit protein can be used to find therapeutic molecules that can inhibit or stimulate the function of the V-ATPase C subunit.

 Gene chip analysis revealed that in thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv 304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated for 1 hour In the L02 cell line and prostate tissue, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human vacuolar proton-adenosine triphosphatase C subunit 42, so the functions of the two may also be similar. The present invention is named as human vacuolar proton-adenosine triphosphatase C subunit 12.

As mentioned above, the human vacuolar proton-adenosine triphosphatase C subunit 12 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes. More human vacuolar proton-adenosine triphosphatase C subunit 12 proteins need to be identified, especially the amino acid sequence of this protein. Isolation of the new human vacuolar proton-adenosine triphosphatase C subunit 12 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This These proteins may form the basis for the development of diagnostic and / or therapeutic agents for diseases, so it is important to isolate their coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated new polypeptides-human vacuolar proton-adenosine triphosphatase C subunit 12 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human vacuolar proton-adenosine triphosphatase C subunit 12.

 It is another object of the present invention to provide a genetically engineered host cell comprising a polynucleotide encoding a human vacuolar proton-adenosine triphosphatase C subunit 12.

 Another object of the present invention is to provide a method for producing human vacuolar proton-adenosine triphosphatase C subunit 12.

 Another object of the present invention is to provide antibodies against the human vacuolar proton-adenosine triphosphatase C subunit 12 of the polypeptide of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors against the human vacuolar proton-adenosine triphosphatase C subunit 12 of the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormal human vacuolar proton-adenosine triphosphatase C subunit 12.

 The present invention relates to an isolated polypeptide, which is of human origin, and includes: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 935-1255 in SEQ ID NO: 1; and (b) a sequence having 1-1980 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

The present invention also relates to a screened simulation, activation, antagonism or inhibition of human vacuolar proton-adenosine triphosphatase C A method for a subunit 12 protein-active compound comprising utilizing a polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or disease susceptibility related to abnormal expression of human vacuolar proton-adenosine triphosphatase C subunit 12 protein. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.

 The present invention also relates to a pharmaceutical composition comprising a polypeptide of the present invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of a polypeptide and / or polynucleotide of the present invention for treating a developmental disease or a medicament for treating diseases caused by abnormal expression of human vacuolar proton-adenosine triphosphatase C subunit 1 2 the use of.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

"Agonist" refers to a kind of inducible protein when combined with human vacuolar proton-adenosine triphosphatase C subunit 12 A molecule that alters the protein to regulate its activity. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to human vacuolar proton-adenosine triphosphatase C subunit 12.

 "Antagonist" or "inhibitor" refers to an organism that can block or regulate human vacuolar proton-adenosine triphosphatase C subunit 12 when combined with human vacuolar proton-adenosine triphosphatase C subunit 12. Molecularly active or immunologically active molecule. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind human vacuolar proton-adenosine triphosphatase C subunit 12.

 "Regulation" refers to changes in the function of human vacuolar proton-adenosine triphosphatase C subunit 12, including increased or decreased protein activity, changes in binding characteristics, and human vacuolar proton-adenosine triphosphatase C subunit 12 Of any other biological, functional or immune properties.

 "Substantially pure" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human vacuolar proton-adenosine triphosphatase c subunit 12 using standard protein purification techniques. Substantially pure human vacuolar proton-adenosine triphosphatase C subunit 12 produces a single main band on non-reducing polyacrylamide gels. The purity of human vacuolar proton-adenosine triphosphatase C subunit 12 peptides can be analyzed by amino acid sequences.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Sou thern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

 "Percent identity" refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGAUGN program (Lasergene sof twa repackage, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences based on different methods, such as the Cluster method (Higgin, D. G., and P. M. Sharp (1988) Gene 73: 237-244). The C l us ter method arranges each group of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence B

 X l oo number of residues in sequence A-number of spaced residues in sequence A-number of spaced residues in sequence B

Nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jo tun He in. Percentage of identity between them (He in J., (1 99 0) Me t hods in erazumo l ogy 1 8 3: 625-645). "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? ^ It can specifically bind to human epithelial adenosine triphosphatase C subunit 12 antigenic determinants.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated. As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human vacuolar proton-adenosine triphosphatase C subunit 12" means that human vacuolar proton-adenosine triphosphatase C subunit 12 is substantially free of other proteins, lipids, Sugars or other substances. Those skilled in the art can purify human vacuolar proton-adenosine triphosphatase C subunit 12 using standard protein purification techniques. Substantially pure polypeptides produce a single main band on a non-reducing polyacrylamide gel. The purity of the human vacuolar proton-adenosine triphosphatase C subunit 12 polypeptide can be analyzed by amino acid sequence.

The present invention provides a new polypeptide-human vacuolar proton-adenosine triphosphatase C subunit 12, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, Natural polypeptides, synthetic polypeptides, and preferably recombinant polypeptides. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives, and analogs of human vacuolar proton-adenosine triphosphatase C subunit 12. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human vacuolar proton-adenosine triphosphatase C subunit 12 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (II) such a type in which a group on one or more amino acid residues is substituted by other groups to include a substituent; or (III) such One, wherein the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or (IV) such a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide ( Such as the leader sequence or secreted sequence or the sequence used to purify this polypeptide or protease sequence) As explained herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a full-length polynucleotide sequence of 1980 bases, and its open reading frame 935-1255 encodes a 106 amino acid. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human vacuolar proton-adenosine triphosphatase C subunit 42. It can be concluded that the human vacuolar proton-adenosine triphosphatase C subunit 12 has human vacuoles. Proton-adenosine triphosphatase C subunit 42 functions similarly.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DM forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but having a sequence different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence. The term "polynucleotide encoding a polypeptide" is meant to include polynucleotides that encode such polypeptides and polynucleotides that include additional coding and / or noncoding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity, between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 xSSC, 0.1% SDS, 6 (TC; or (2) ) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only in two sequences The hybridization occurs when the identity between at least 95% and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 And active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human vacuolar proton-adenosine triphosphatase C subunit 12.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding human vacuolar proton-adenosine triphosphatase C subunit 12 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the DM of the genome; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Q i agene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human vacuolar proton-adenosine triphosphatase C subunit 12 The level of transcripts; (4) Detecting protein products expressed by genes by immunological techniques or by measuring biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human vacuolar proton-adenosine triphosphatase C subunit 12 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA). Wait.

 A method using PCR to amplify DNA / RNA (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using human vacuolar proton-adenosine triphosphatase C subunit 12 coding sequence, and produced by recombinant technology A method of a polypeptide according to the invention.

In the present invention, a polynucleotide sequence encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be inserted into a vector to form a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses, which are well known in the art. Such as adenovirus, retrovirus or other vectors. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human vacuolar proton-adenosine triphosphatase C subunit 12 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DM synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, tumorigenic enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human vacuolar proton-adenosine triphosphatase C subunit 12 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a polynucleotide containing the polynucleotide or the recombinant vector. Genetically engineered host cells. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells. ' Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with CaC l ₂ method used in steps well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human vacuolar proton-adenosine triphosphatase C subunit 12 (Scence, 1 984; 224: 1431). Generally speaking, there are the following steps:

 (1) Use the polynucleotide (or variant) encoding human human vacuolar proton-adenosine triphosphatase C subunit 12 of the present invention, or transform or transduce a suitable recombinant expression vector containing the polynucleotide Host cell

(2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human vacuolar proton-adenosine triphosphatase C subunit 12 and human vacuolar proton-adenosine triphosphatase C subunit 42 according to the present invention. The upper figure is a graph of the expression profile of human vacuolar proton-adenosine triphosphatase C subunit 12 and the lower sequence is the graph of the expression profile of human vacuolar proton-adenosine triphosphatase C subunit 42.

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of isolated human vacuolar proton-adenosine triphosphatase C subunit 12. 12kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human vacuolar proton-adenosine triphosphatase C subunit 12

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using the Quik mRNA Isolation Kit (Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Use Smart cDNA Cloning Kit (purchased from Clontech). The 0 ^ fragment was inserted into the multiple cloning site of pBSK (+) vector (Clontech), and transformed into DH5cc. The bacteria formed a cDNA library. The Dye terminate cycle reaction ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0044f02 was new DNA. The inserted cDNA fragments contained in this clone were determined in both directions by synthesizing a series of primers. The results showed that the full-length cDNA contained in the 0044f02 clone was 1980 ^ (as shown in Seq ID NO: 1), from 935 to Λ, there is a 321 open reading frame (0RF), which encodes a new protein (such as Seq ID NO: 2). We named this clone pBS-0044f 02 and the protein encoded was human vacuolar proton-adenosine triphosphatase C subunit 12. Example 2: Cloning of a gene encoding human vacuolar proton-adenosine triphosphatase C subunit 12 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primer 1: 5,-ACTATAAAGATGTCACTACTTAAC -3 '(SEQ ID NO: 3)

 Primer2: 5'- ACGGGGTCTCGCTTTGTCGCCCAG —3, (SEQ ID NO: 4)

 Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 leg ol / L KC1, 10 mmol / L Tris-CI, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a 50 μ 1 reaction volume , 1U Taq DNA polymerase (C 1 on te ch). The reaction was performed on a PE 9600 DN A thermal cycler (Pe rki nElmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. Amplification products were purified using QIAGEN kits and TA Cloning kit was ligated to pCR vector (Unvitrogen product). DM sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-1980bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human vacuolar proton-adenosine triphosphatase C subunit 12 gene expression: Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method includes acid thiocyanate Guanidine phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 μ _§ RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-ImM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. Labeled DNA probes were prepared using oc- ³² P dATP by random primers. The DNA probe used was the PCR amplified human vacuolar proton-adenosine triphosphatase C subunit 12 coding region sequence (935bp to 1255bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / rai) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ ( pH7.4)-5 SSC-5 x Denhardt, s solution and

Salmon sperm DNA. After hybridization, the filter was washed in 1 X SSC-0.1% SDS at 55 ° C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human vacuolar proton-adenosine triphosphatase C subunit 12

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

 Primer3: 5,-CATGCTAGCATGAACACATCATCTAAAAATGTA -3, (Seq ID No: 5)

Primer4: 5'-CATGGATCCTTAGATGCAAGCACAGGGTCGGGA-3 '(Seq ID No: 6) The 5' ends of these two primers contain Ndel and BamHI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively. The Ndel and BamHI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). PCR was performed using the pBS_ 0044f02 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μi containing pBS- 0044f 02 plasmid 10 pg, bower I Primer-3 and Primer-4 4 points; j is lpmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60. C 30s, 68. C 2 min, a total of 25 cycles. Nde: [and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. Ligation products were transformed by the calcium chloride method bacteria Escherichia coli DH5cc, after (final concentration 3 (^ g / _m l) LB plates incubated overnight positive clones were screened by colony PCR method containing kanamycin, and sequenced. Selected Positive clone with the correct sequence (ET-0044f 02) The recombinant plasmid was transformed into the large intestine by the calcium chloride method Bacillus BL21 (DE3) plySs (product of Novagen). In containing kanamycin (final concentration 30 μ ₈ / ηι1) in LB liquid medium, host strain BL21 _(P ET-0044f02) incubated at 37 ° C to logarithmic phase, IPTG was added to a final concentration of lmmol / L Continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation, and the layers were layered with His s. Bind Quick Cartr idge (product of Novagen) using an affinity chromatography column capable of binding 6 histidines (6His-Tag). Analysis to obtain purified human vacuolar proton-adenosine triphosphatase C subunit 12. After SDS-PAGE electrophoresis, a single band was obtained at 10 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of antibodies against human vacuolar proton-adenosine triphosphatase C subunit 12

 A peptide synthesizer (product of PE company) was used to synthesize the following human vacuolar proton-adenosine triphosphatase C subunit 12 specific peptides:

 NH2-Met-Asn-Thr-Ser-Ser-Lys-Asn-Val-Asn-Ser-G ln-Phe-Leu-Ser-Ser- COOH CSEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned blue protein complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. 15 Use a 15 g / nil bovine serum albumin peptide complex-coated titer plate for ELI SA to determine antibody titers in rabbit serum. Protein A-Sepharose was used to isolate total IgG from antibody-positive home-immunized serum. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody could specifically bind to human vacuolar proton-adenosine triphosphatase C subunit 12. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by using a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are: The sample-fixed filter is first applied The probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher intensity membrane washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 Selection of probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

 The probe size preferably ranges from 18 to 50 nucleotides;

 The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 There should be no complementary regions inside the probe;

 Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions For homology comparison, if the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary selection probe should generally not be used;

1. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe (Probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5 -TGAACACATCATCTAAAAATGTAAATTCTCAATTCCTTTCA-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5 -TGAACACATCATCTAAAAATCTAAATTCTCAATTCCTTTCA-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Put fresh or freshly thawed normal liver tissue into ice and hold phosphate buffered saline (PBS) In a plate. Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10ml / g) with cold homogenization buffer (0.25mol / L sucrose; 25mmol / L Tris-HCl, pH7.5; 25 surface ol / LnaCl; 25 cryptool / L MgCl ₂ ). 4) at 4. C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (l-5ml per 0.1 g of the initial tissue sample) and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet in lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with l-10ral cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 X 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / mL 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 180 vols of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air-dry for 10-15 minutes to evaporate the surface ethanol. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DM pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix and let stand at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A _28Q to detect DNA purity and yield. 15) Store at -20 ° (;) after packing.

Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are needed for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

2) Pipette and control 15 μl each, spot on the sample film, and dry at room temperature. 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ I inase buffer, 8-10 uCi γ_ ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

 5) Collect the first peak before the Probe is washed out (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

 8) After the collection of the first peak is combined, the "P-Probe (the second peak is free γ--dATP) to be prepared. Pre-hybridization

 The sample membrane was placed in a plastic bag, and 3-10 mg of prehybridization solution (lOxDenhardt's; 6xSSC, 0.1 mg / ml CT was added

DNA (calf thymus DNA). ), After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 4 OX for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS for 15 minutes at 40 ° C (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 4) In 0.1xSSC, 0.1¾SDS, wash at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70X, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

的 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. In The radioactive intensity of the hybridization spot of the other probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 7 DNA Microarray

 Gene microarray or gene microarray (D Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific steps of this method have been reported in the literature. For example, see DeRisi, JL, Lyer, V. & Brown, P.0. (1997) Science 278, 680-686. And Helle, RA, Schema, M. ., Ch i, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were amplified by PCR respectively. After purification, the amplified product was adjusted to a concentration of about 500 ng / ul, and spotted on a glass medium using a Cartesian 7500 spotter (purchased from Cartesian, USA). The distance is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a purple diplomatic coupling instrument. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been reported in the literature in various ways. The post-spot processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP ( 5-Araino-propargy 2'-deoxyuridine 5'-triphate coupled to Cy3 fluorescent dye (purchased from Amersham Phamacia Biotech) was used to label the mRNA of human mixed tissues, and the fluorescent reagent Cy5dUTP (5- Amino- propargyl-2'-deoxyuridine 5 '-triphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech Company, labeled the body's specific tissue (or stimulated cell line) mRNA, and purified the probe to prepare a probe. With See the steps and methods for detailed steps:

Schena,

 M., Sha lon, D., Heller, R. (1996) Proc. Nat l. Acad. Sc i. USA. Vol. 93: 10614- 10619. Schena, M., Sha lon, Dar i., Dav is, RW (1995) Sc ience. 270. (20): 467-480. (3) Hybridization

 The probes from the above two tissues and the chip were respectively hybridized in a UniHyb ™ Hybrid Hydride Solution (purchased from Te LeChem) hybridization solution for 16 hours, and the washing solution (1 x SSC, 0.2 was used at room temperature). % SDS) After washing, scan with a ScanArray 3000 scanner (purchased from Genera Scanning, USA). The scanned images are analyzed by Imagene software (Biod iscovery, USA), and the Cy3 / Cy5 ratio of each point is calculated. .

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Draw a graph based on these 13 Cy3 / Cy5 ratios. (figure 1 ) . It can be seen from the figure that the expression profiles of human vacuolar proton-adenosine triphosphatase C subunit 12 and human vacuolar proton-adenosine triphosphatase C subunit 42 are very similar. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Recombinant human V-ATPase C subunit protein or polypeptide has many uses. These uses include (but are not limited to) direct use as a drug to treat diseases caused by hypofunction or loss of V-ATPase C subunits and to screen antibodies, peptides or other ligands that promote or counteract V-ATPa se C subunit function . For example, antibodies can be used to activate or inhibit the function of the V-ATPase C subunit. Using the expressed recombinant V-ATPase C subunit protein to screen the peptide library can be used to find therapeutic peptide molecules that can inhibit or stimulate the function of V-ATPase C subunit.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist J human vacuolar proton-adenosine triphosphatase C subunit 12). Agonists increase human vacuolar proton-adenosine triphosphatase C subunit 12 stimulates biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or human vacuolar proton-adenosine can be expressed in the presence of drugs Membrane formulations of triphosphatase C subunit 12 are cultured with labeled human vacuolar proton-adenosine triphosphatase C subunit 12. The ability of the drug to increase or block this interaction is then determined.

Antagonists of human vacuolar proton-adenosine triphosphatase C subunit 12 include antibodies, compounds, Receptor deletions and analogs. Antagonists of human vacuolar proton-adenosine triphosphatase C subunit 12 can bind to human vacuolar proton-adenosine triphosphatase C subunit 12 and eliminate its function, or inhibit the production of the polypeptide, or with the polypeptide The active site binding prevents the polypeptide from performing biological functions.

 When screening compounds as antagonists, human vacuolar proton-adenosine triphosphatase C subunit 12 can be added to a bioanalytical assay. The effects of interactions between humans to determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human vacuolar proton-adenosine triphosphatase C subunit 12 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, the human vacuolar proton-adenosine triphosphatase C subunit 12 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human vacuolar proton-adenosine triphosphatase C subunit 12 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human vacuolar proton-adenosine triphosphatase C subunit 12 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including But it is not limited to Freund's adjuvant. Techniques for preparing human vacuolar proton-adenosine triphosphatase C subunit 12 monoclonal antibodies include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-497), triple tumor technology, human B- Cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). Existing techniques for producing single-chain antibodies (US Pat No .4946778) can also be used to produce single chain antibodies against human vacuolar proton-adenosine triphosphatase C subunit 12.

 Antibodies against human vacuolar proton-adenosine triphosphatase C subunit 12 can be used in immunohistochemical techniques to detect human vacuolar proton-adenosine triphosphatase C subunit 12 in biopsy specimens.

 Monoclonal antibodies that bind to human vacuolar proton-adenosine triphosphatase C subunit 12 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human vacuolar proton-adenosine triphosphatase C subunit 12 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human vacuolar proton-adenosine triphosphatase C subunit 12 positive cells. The antibodies in the present invention can be used to treat or prevent diseases related to human vacuolar proton-adenosine triphosphatase C subunit 12. Administration of an appropriate dose of antibody can stimulate or block the production or activity of human vacuolar proton-adenosine triphosphatase C subunit 12.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human vacuolar proton-adenosine triphosphatase C subunit 12 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human vacuolar proton-adenosine triphosphatase C subunit 12 detected in the test can be used to explain the importance of human vacuolar proton-adenosine triphosphatase C subunit 12 in various diseases and to diagnose humans A disease in which vacuolar proton-adenosine triphosphatase C subunit 12 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human vacuolar proton-adenosine triphosphatase C subunit 12. Recombinant gene therapy vectors (such as viral vectors) can be designed to express variant human vacuolar proton-adenosine triphosphatase C subunit 12 to inhibit endogenous human vacuolar proton-adenosine triphosphatase C subunit 12 active. For example, a variant human vacuolar proton-adenosine triphosphatase C subunit 12 may be a shortened human vacuolar proton-adenosine triphosphatase C subunit 12, although it may be related to the downstream Substrate binding, but lacks signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human vacuolar proton-adenosine triphosphatase C subunit 12. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human vacuolar proton-adenosine triphosphatase C subunit 12 to a cell Inside. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human vacuolar proton-adenosine triphosphatase C subunit 12 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes a specific RM. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained by any existing RNA or DNA synthesis technology, such as the technology for the synthesis of oligonucleotides by solid-phase phosphoramidite chemical synthesis has been widely used. Antisense RNA molecules can Obtained by transcription of a DNA sequence encoding the RNA in vitro or in vivo. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be used for diagnosis of diseases related to human vacuolar proton-adenosine triphosphatase C subunit 12. Polynucleotides encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be used to detect the expression of human vacuolar proton-adenosine triphosphatase C subunit 12 or human vacuolar proton-adenosine triad Abnormal Expression of Phosphatase C Subunit 12 For example, a DNA sequence encoding human vacuolar proton-adenosine triphosphatase C subunit 12 can be used to hybridize biopsy specimens to determine the expression status of human vacuolar proton-adenosine triphosphatase C subunit 12. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. Part or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microray ray) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes and genes in tissues diagnosis. Human vacuolar proton-adenosine triphosphatase C subunit 12 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human vacuolar proton-adenosine triphosphatase C subunit 12 transcription products .

 Detection of mutations in the human vacuolar proton-adenosine triphosphatase C subunit 12 gene can also be used to diagnose human vacuolar proton-adenosine triphosphatase C subunit 12-related diseases. Human vacuolar proton-adenosine triphosphatase C subunit 12 mutant forms include point mutations, translocations, deletions, recombinations, and others compared to normal wild-type human vacuolar proton-adenosine triphosphatase C subunit 12 DNA sequences Any exceptions etc. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these D sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ Hybridization, pre-screening of chromosomes using labeled flow sorting, and pre-selection of hybridization, thereby constructing a chromosome-specific cDNA library.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckus ck, Mende l i an Inher i tance in Man (available online with Johns Hopk ins Universe Wet ch Med i ca l L brary). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing diseased and diseased individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human vacuolar proton-adenosine triphosphatase C subunit 12 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human vacuolar proton-adenosine triphosphatase C subunit 12 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Claim

 1. An isolated polypeptide-human vacuolar proton-adenosine triphosphatase C subunit 12, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or an active fragment thereof, similar Thing or derivative.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 7% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of said polynucleotide comprises the sequence of positions 935-1255 in SEQ ID NO: 1 or the sequence of positions 1-1980 in SEQ ID NO: 1 .

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human vacuolar proton-adenosine triphosphatase C subunit 12 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human vacuolar proton-adenosine triphosphatase C subunit 12;

 (b) A peptide having human vacuolar proton-adenosine triphosphatase C subunit 12 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human vacuolar proton-adenosine triphosphatase C subunit 12.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human vacuolar proton-adenosine triphosphatase C subunit 12.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human vacuolar proton-adenosine triphosphatase C subunit 12 in vivo and in vitro.

14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. The use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimetic, agonist, antagonist or antagonist of human vacuolar proton-adenosine triphosphatase C subunit 12. Inhibitors; or for peptide fingerprinting.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human vacuolar proton-adenosine triphosphatase C subunit 12 abnormality.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.