WO2001072765A1 - ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING - Google Patents
ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING Download PDFInfo
- Publication number
- WO2001072765A1 WO2001072765A1 PCT/US2000/008174 US0008174W WO0172765A1 WO 2001072765 A1 WO2001072765 A1 WO 2001072765A1 US 0008174 W US0008174 W US 0008174W WO 0172765 A1 WO0172765 A1 WO 0172765A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antisense compound
- mrna target
- mrna
- antisense
- oligonucleotides
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/33—Chemical structure of the base
- C12N2310/334—Modified C
- C12N2310/3341—5-Methylcytosine
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Definitions
- the present invention provides compositions and methods for controlling a cellular behavior by antisense modulation of messenger RNA (mRNA) processing.
- this invention relates to antisense compounds, particularly oligonucleotides, which modulate RNA splicing, polyadenylation, or stability in order to affect the behavior of a cell.
- mRNA messenger RNA
- this invention relates to antisense compounds, particularly oligonucleotides, which modulate RNA splicing, polyadenylation, or stability in order to affect the behavior of a cell.
- Newly synthesized eukaryotic mRNA molecules known as primary transcripts or pre-mRNA, made in the nucleus, are processed before or during transport to the cytoplasm for translation.
- a methylated cap structure consisting of a terminal nucleotide, 7-methylguanylate, is added to the 5' end of the mRNA in a 5' -5' linkage with the first nucleotide of the mRNA sequence.
- poly (A) An approximately 200-250-base sequence of adenylate residues, referred to as poly (A) , is added posttranscriptionally to a site that will become the 3 ' terminus of the mRNA, before entry of the mRNA into the cytoplasm.
- poly (A) "tail This is a multistep process which involves assembly of a processing complex, then site-specific endonucleolytic cleavage of the precursor transcript, and addition of a poly (A) "tail."
- the polyadenylation signal sequence is a hexamer, AAUAAA, located 10 to 30 nucleotides in the 5' direction (upstream) from the site of cleavage (5'-CA-3') in combination with a U or G-U rich element 3' to the cleavage site.
- Multiple poly (A) sites may be present on a given transcript, of which only one is used per transcript, but more than one species of mature mRNA transcript can be produced from a given pre-mRNA via use of different poly (A) sites.
- the next step in mRNA processing is splicing of the mRNA, which occurs in the maturation of 90-95% of mammalian mRNAs .
- Introns or intervening sequences
- Exons are regions of a primary transcript that remain in the mature mRNA when it reaches the cytoplasm. The exons are "spliced" together to form the mature mRNA sequence.
- Intron-exon junctions are also referred to as "splice sites" with the 5' side of the junction often called the “5' splice site,” or “splice donor site” and the 3' side the “3' splice site” or “splice acceptor site.”
- “Cryptic” splice sites are those which are less often used but may be used when the "usual" splice site is blocked or unavailable.”
- Alternative splicing i.e., the use of various combinations of exons, often results in multiple mRNA transcripts from a single gene.
- RNA processing is turnover or degradation of the mRNA.
- Differential mRNA stabilization is one of several factors in the rate of synthesis of any protein. mRNA degradation rates seem to be related to presence or absence of poly (A) tails and also to the presence of certain sequences in the 3' end of the mRNA. For example, many mRNAs with short half-lives contain several A(U) n A sequences in their 3 ' -untranslated regions. When a series of AUUUA sequences was inserted into a gene not normally containing them, the half life of the resulting mRNA decreased by 80%. Shaw and Kamen, Cell , 1986, 46, 659.
- mediators of mRNA stability are also known, such as hormones, translation products (autoregulation/feedback) , and low-molecular weight ligands .
- Antisense compounds have generally been used to interfere with protein expression, either by interfering directly with translation of the target molecule or, more often, by RNAse-H-mediated degradation of the target mRNA. Antisense interference with 5' capping of mRNA and prevention of translation factor binding to the mRNA by oligonucleotide masking of the 5 ' cap have been disclosed by Baker et al . (WO 91/17755) .
- Antisense oligonucleotides have been used to modulate splicing, particularly aberrant splicing or splicing of mutant transcripts, often in cell-free reporter systems.
- a luciferase reporter plasmid system has been used to test the ability of antisense oligonucleotides targeted to the 5' splice site, 3' splice site or branchpoint to inhibit splicing of mutated or wild-type adenovirus pre-mRNA sequences in a reporter plasmid.
- Phosphorothioate oligodeoxynucleotides that can support RNAse H cleavage were found to be better inhibitors of expression of the wild-type adenovirus construct than the 2 ' -methoxy phosphorothioates that cannot support RNase H, although the reverse was true for oligonucleotides targeted to an adenovirus construct containing human ⁇ -globin splice site sequences. Hodges and Crooke, Mol . Pharmacol . , 1995, 48, 905-918.
- Antisense oligonucleotides have been used to target mutations that lead to aberrant splicing in several genetic diseases. Use of antisense compounds to correct aberrant processing of mutated mRNA sequences is not comprehended by the present invention. Altering, i.e., controlling, the behavior of a cell, particularly the response of a cell to a stimulus, by antisense modulation of "wild-type" or native mRNA processing, the subject of the present invention, has not been described previously.
- Phosphorothioate 2 ' -O-methyl oligoribonucleotides have been used to target the aberrant 5' splice site of the mutant ⁇ -globin gene found in patients with ⁇ -thalassemia, a genetic blood disorder.
- Aberrant splicing of mutant ⁇ - globin mRNA was blocked in vi tro in vector constructs containing thalassemic human ⁇ -globin pre-mRNAs using 2 ' -0- methyl-ribo-oligonucleotides targeted to the branch point sequence in the first intron of the mutant human ⁇ -globin pre mRNAs.
- oligonucleotides are used because they are stable to RNAses and form stable hybrids with RNA that are not degraded by RNAse H. Dominski and Kole, Proc . Natl . Acad. Sci . USA, 1993, 90, 8673-8677.
- a review article by Kole discusses use of antisense oligonucleotides targeted to aberrant splice sites created by genetic mutations such as ⁇ -thalassemia or cystic fibrosis. It was hypothesized that blocking a splice site with an antisense oligonucleotide will have similar effect to mutation of the splice site, i.e., redirection of splicing.
- Patent 5,627,274 discloses and WO 94/26887 discloses and claims compositions and methods for combating aberrant splicing in a pre-mRNA molecule containing a mutation, using antisense oligonucleotides which do not activate RNAse H.
- 2 ' -O-methyl oligoribonucleotides were subsequently used to correct dystrophin deficiency in myoblasts from the mdx mouse.
- An antisense oligonucleotide targeted to the 3' splice site of murine dystrophin intron 22 caused skipping of the mutant exon and created a novel in-frame dystrophin transcript with a novel internal deletion. This mutated dystrophin was expressed in 1-2% of antisense treated mdx myotubes.
- Use of other oligonucleotide modifications such as 2 ' -O-methoxyethyl phosphodiesters are disclosed. Dunckley et al . (Human Mol . Genetics, 1998, 5, 1083-90) .
- Phosphorothioate oligodeoxynucleotides have been used to selectively suppress the expression of a mutant ⁇ 2(I) collagen allele in fibroblasts from a patient with osteogenesis imperfecta, in which a point mutation in the splice donor site produces mRNA with exon 16 deleted.
- the oligonucleotides were targeted either to the point mutation in the pre-mRNA or to the defectively spliced transcript. In both cases mutant mRNA was decreased by half but the normal transcript is also decreased by 20%. This was concluded to be fully accounted for by an RNAse H-dependent mechanism. Wang and Marini , J. Clin Invest . , 1996, 57, 448- 454.
- a microinjection assay was used to test the antisense effects on SV40 large T antigen (TAg) expression of oligonucleotides containing C-5 propynylpyrimidines , either as 2 ' -0-allyl phosphodiester oligonucleotides, which do not elicit RNAse H cleavage of the target, or as 2 ' -deoxy phosphorothioates, which do elicit RNAse H cleavage. Oligonucleotides targeted to the 5' untranslated region, translation initiation site, 5' splice junction or polyadenylation signal of the TAg transcript were injected into the nucleus or cytoplasm of cultured cells.
- TAg SV40 large T antigen
- the only 2 ' -O-allyl (non-RNAse H) oligonucleotides which were effective at inhibiting T-antigen were those targeted to the 5' untranslated region and the 5' splice junction.
- Biotinylated 2 ' -O- allyloligoribonucleotides incorporating 2-aminoadenine bases were targeted to the U2 small nuclear RNA (snRNA) , a component of the spliceosome, in HeLa nuclear extracts. These inhibited mRNA production with a concomitant accumulation of splicing intermediates .
- the present invention is directed to antisense compounds targeted to mRNA.
- compositions and methods for altering the behavior of a cell, particularly the response of a cell to a stimulus, by modulation of normal mRNA processing can be used in therapeutics, including prophylaxis, and as research tools.
- the present invention provides methods for controlling the behavior of a cell through modulation of the processing of a selected wild-type mRNA target within said cell, by binding to the mRNA target an antisense compound which is specifically hybridizable to the mRNA target and which does not support cleavage of the mRNA target upon binding.
- Compositions and therapeutic methods are also provided.
- the mRNA processing may be splicing, polyadenylation or degradation of the mRNA.
- the cellular behavior to be controlled may be apoptosis and/or the response of the cell to a stimulus.
- the present invention employs oligomeric antisense compounds, particularly oligonucleotides, for use in modulating the processing of mRNA within a cell, ultimately controlling the behavior of the cell, especially the response of the cell to an external or internal stimulus .
- oligomeric antisense compounds particularly oligonucleotides
- Examples of cellular behaviors include mitosis, apoptosis or programmed cell death, quiescence, and differentiation.
- Examples of external stimuli are stress (including chemical stressors) hormones, cytokines and other signaling molecules .
- Modulation of mRNA processing is accomplished by providing antisense compounds which specifically modulate one or more mRNA processing events, such as RNA splicing, polyadenylation, capping, and degradation.
- target nucleic acid and “nucleic acid encoding a target” encompass DNA encoding a given molecular target (i.e., a protein or polypeptide) , RNA (including pre-mRNA and mRNA) transcribed from such DNA, and also cDNA derived from such RNA.
- a given molecular target i.e., a protein or polypeptide
- RNA including pre-mRNA and mRNA
- cDNA derived from such RNA RNA
- the specific hybridization of an antisense compound with its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of function of a target nucleic acid by compounds which specifically hybridize to it is generally referred to as "antisense".
- the functions of DNA to be interfered with include replication and transcription.
- modulation means a quantitative change, either an increase (stimulation) or a decrease (inhibition) , for example in the frequency of an RNA processing event or in the expression of a gene.
- modulation can also mean "redirection,” for example redirection of splicing which results in an increase in one splice product of a target RNA and concomitant decrease in another splice product with no significant change in the total target RNA levels.
- Targeting an antisense compound to a particular nucleic acid is a ultistep process.
- the process usually begins with the identification of a nucleic acid sequence whose function is to be modulated. This may be, for example, a cellular gene (or mRNA transcribed from the gene) whose expression is associated with a particular disorder or disease state, or a nucleic acid molecule from an infectious agent.
- the targeting process also includes determination of a site or sites within this gene for the antisense interaction to occur such that the desired effect, e.g., modulation of expression of RNA processing, will result.
- preferred target site(s) depend on the aspect of RNA processing to be modulated.
- splice donor sites or splice acceptor sites collectively also known as intron-exon junctions, are preferred target sites.
- Splicing branch points and exons are also preferred target sites for modulation of mRNA splicing .
- polyadenylation a polyadenylation signal or polyadenylation site is a preferred target site.
- stabilizing or destabilizing sequences are preferred target sites.
- oligonucleotides are chosen which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect .
- hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases.
- adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds .
- oligonucleotide and the DNA or RNA are considered to be complementary to each other at that position.
- the oligonucleotide and the DNA or RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other.
- “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the oligonucleotide and the DNA or RNA target.
- an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
- An antisense compound is specifically hybridizable when binding of the compound to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vi tro assays, under conditions in which the assays are performed.
- Antisense compounds are commonly used as research reagents and diagnostics. For example, antisense oligonucleotides, which are able to inhibit gene expression with seventeen specificity, are often used by those of ordinary skill to elucidate the function of particular genes. Antisense compounds are also used, for example, to distinguish between functions of various members of a biological pathway. Antisense modulation has, therefore, been harnessed for research use.
- Antisense oligonucleotides have been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligonucleotides have been safely and effectively administered to humans and numerous clinical trials are presently underway.
- An antisense drug, VitraveneTM has been approved by the U.S. Food and Drug Administration for the treatment of cytomegalovirus retinitis (CMVR) , a cause of blindness, in AIDS patients. It is thus established that oligonucleotides can be useful therapeutic modalities that can be configured to be useful in treatment regimes for treatment of cells, tissues and animals, especially humans.
- oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof.
- RNA ribonucleic acid
- DNA deoxyribonucleic acid
- oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly.
- Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases .
- antisense oligonucleotides are a preferred form of antisense compound
- the present invention comprehends other oligomeric antisense compounds, including but not limited to oligonucleotide mimetics such as are described below.
- the antisense compounds in accordance with this invention preferably comprise from about 8 to about 30 nucleobases .
- Particularly preferred are antisense oligonucleotides comprising from about 8 to about 30 nucleobases (i.e. from about 8 to about 30 linked nucleosides) .
- a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base.
- Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside.
- the phosphate group can be linked to either the 2', 3' or 5' hydroxyl moiety of the sugar.
- the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn the respective ends of this linear polymeric structure can be further joined to form a circular structure, however, open linear structures are generally preferred.
- the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide.
- the normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.
- oligonucleotides containing modified backbones or non-natural internucleoside linkages include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
- modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides .
- Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl- phosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates , thionoalkylphosphonates , thionoalkylphosp otriesters, and boranophosphates having normal 3' -5' linkages, 2' -5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3' -5' to 5' -3' or 2' -5' to 5 '-2'.
- Various salts, mixed salts and free acid forms are also
- Preferred modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones siloxane backbones
- sulfide, sulfoxide and sulfone backbones formacetyl and thioformacetyl backbones
- methylene formacetyl and thioformacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH 2 component parts.
- both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups.
- the base units are maintained for hybridization with an appropriate nucleic acid target compound.
- an oligomeric compound an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA) .
- PNA peptide nucleic acid
- the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
- nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
- Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al . , Science, 1991, 254, 1497-1500.
- Most preferred embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH 2 -NH-0-CH 2 - , -CH 2 -N (CH 3 ) -0-CH 2 - [known as a methylene (methylimino) or MMI backbone], -CH 2 -0-N(CH 3 ) -CH 2 - , -CH 2 -N(CH 3 ) -N(CH 3 ) -CH 2 - and -O-N (CH 3 ) -CH 2 -CH 2 - [wherein the native phosphodiester backbone is represented as -0-P-0-CH 2 - ] of the above referenced U.S.
- Patent 5,489,677 and the amide backbones of the above referenced U.S. Patent 5,602,240.
- Modified oligonucleotides may also contain one or more substituted sugar moieties.
- Preferred oligonucleotides comprise one of the following at the 2' position: OH; F; 0- , S-, or N-alkyl; 0- , S-, or N-alkenyl; O- , S- or N- alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C-_ to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl .
- n and m are from 1 to about 10.
- oligonucleotides comprise one of the following at the 2' position: C- L to C 10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or 0- aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , S0CH 3 , S0 2 CH 3/
- NH 2 heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, acetamide, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- a preferred modification includes 2 ' -methoxyethoxy (2 ' -0-CH 2 CH 2 OCH 3 , also known as 2 ' -0- (2-methoxyethyl) or 2 ' -MOE) (Martin et al . , Helv. Chim . Acta, 1995, 78 , 486-504) i.e., an alkoxyalkoxy group.
- a further preferred modification includes 2'- dimethylaminooxyethoxy, i.e., a O (CH 2 ) 2 ON (CH 3 ) 2 group, also known as 2'-DMAOE, and 2 ' -dimethylamino-ethoxyethoxy (2 ' - DMAEOE) , i.e., 2' -0-CH 2 -0-CH 2 -N(CH 2 ) 2 .
- Other preferred modifications include 2 ' -methoxy (2 1 - 0-CH 3 ) , 2 ' -aminopropoxy (2 ' -OCH 2 CH 2 CH 2 NH 2 ) and 2 ' -fluoro (2 1 - F) .
- oligonucleotide Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3 ' terminal nucleotide or in 2' -5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S.
- Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
- nucleobases include the purine bases adenine (A) and guanine (G) , and the pyrimidine bases thymine (T) , cytosine (C) and uracil (U) .
- Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine , 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8 -substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoro
- nucleobases include those disclosed in United States Patent 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al . , Angewandte Chemie, International Edition, 1991, 30 , 613, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. , ed. , CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention.
- 5-substituted pyrimidines include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine.
- 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds . , Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2 ' -O-methoxyethyl sugar modifications.
- oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide.
- moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al . , Proc . Natl . Acad. Sci . USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al . , Bioorg. Med. Chem . Let .
- a thioether e.g., hexyl- S-tritylthiol (Manoharan et al . , Ann . N. Y. Acad. Sci . , 1992, 660, 306-309; Manoharan et al . , Bioorg. Med. Chem . Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl . Acids Res . , 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison- Behmoaras et al .
- a phospholipid e.g., di- hexadecyl-rac-glycerol or triethylammonium 1,2-di-O- hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al . , Tetrahedron Lett . , 1995, 36, 3651-3654; Shea et al . , Nucl . Acids Res .
- the present invention also includes antisense compounds which are chimeric compounds.
- "Chimeric” antisense compounds or “chimeras,” in the context of this invention, are antisense compounds, particularly oligonucleotides, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound.
- oligonucleotides typically contain at least one region wherein the oligonucleotide is modified so as to confer upon the oligonucleotide increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid.
- Chimeric antisense compounds of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids, gapped oligonucleotides or gapmers . Representative United States patents that teach the preparation of such hybrid structures include, but are not limited to, U.S.
- Patent 5,013,830 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety.
- Gapped oligonucleotides in which a region of 2 ' - deoxynucleotides, usually 5 contiguous nucleotides or more, often 10 contiguous deoxynucleotides, is present along with one or two regions of 2 ' -modified oligonucleotides are often used in antisense technology because uniformly 2 ' - modified oligonucleotides do not support RNAse H cleavage of the target RNA molecule. Enhanced binding affinity is provided by the 2 ' modifications and the deoxy gap region allows RNAse H cleavage of the target.
- RNAse H cleavage of the target RNA is not desired.
- a functional RNA product, albeit with altered function, rather than an ablated RNA product is the goal of the present invention.
- the present invention therefore, is limited to use of oligonucleotides that do not elicit cleavage, via RNAse H or otherwise, of the RNA target. Consequently, uniformly modified oligonucleotides, i.e., oligonucleotides modified identically at each nucleotide or nucleoside position, are preferred embodiments.
- a particularly preferred embodiment is an oligonucleotide which is uniformly modified at the 2 ' position of the nucleotide sugar, for example with a 2' MOE, 2" DMAOE, or 2' acetamide modification at each position, or a combination of these.
- Other preferred modifications are backbone modifications, including MMI, morpholino and PNA modifications, which may be uniform or may be alternated with other linkages, particularly phosphodiester or phosphorothioate linkages, as long as RNAse H cleavage is not supported.
- the antisense compounds used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis.
- Equipment for such synthesis is sold by several vendors including, for example, Applied Biosystems (Foster City, CA) . Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives .
- the antisense compounds of the invention are synthesized in vi tro and do not include antisense compositions of biological origin, or genetic vector constructs designed to direct the in vivo synthesis .of antisense molecules.
- the compounds of the invention may be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, receptor targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
- Representative United States patents that teach the preparation of such uptake, distribution and/or absorption assisting formulations include, but are not limited to, U.S.
- antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such • esters, or any other compound which, upon administration to an animal including a human, is capable of providing
- the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents .
- prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
- prodrug versions of the oligonucleotides of the invention are prepared as SATE [ (S-acetyl-2-thioethyl) phosphate] derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al . , published December 9, 1993 or in WO 94/26764 to Imbach et al .
- pharmaceutically acceptable salts refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
- Pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali and alkaline earth metals or organic amines.
- metals used as cations are sodium, potassium, magnesium, calcium, and the like.
- suitable amines are N,N' -dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, dicyclohexylamine, ethylenediamine, N-methylglucamine, and procaine (see, for example, Berge et al . , "Pharmaceutical Salts," J. of Pharma Sci . , 1977, 66, 1-19) .
- the base addition salts of said acidic compounds are prepared by contacting the free acid form with a sufficient amount of the desired base to produce the salt in the conventional manner.
- the free acid form may be regenerated by contacting the salt form with an acid and isolating the free acid in the conventional manner.
- the free acid forms differ from their respective salt forms somewhat in certain physical properties such as solubility in polar solvents, but otherwise the salts are equivalent to their respective free acid for purposes of the present invention.
- a "pharmaceutical addition salt” includes a pharmaceutically acceptable salt of an acid form of one of the components of the compositions of the invention. These include organic or inorganic acid salts of the amines.
- Preferred acid salts are the hydrochlorides, acetates, salicylates, nitrates and phosphates.
- Other suitable pharmaceutically acceptable salts are well known to those skilled in the art and include basic salts of a variety of inorganic and organic acids, such as, for example, with inorganic acids, such as for example hydrochloric acid, hydrobromic acid, sulfuric acid or phosphoric acid; with organic carboxylic, sulfonic, sulfo or phospho acids or N-substituted sulfamic acids, for example acetic acid, propionic acid, glycolic acid, succinic acid, maleic acid, hydroxymaleic acid, methylmaleic acid, fumaric acid, malic acid, tartaric acid, lactic acid, oxalic acid, gluconic acid, glucaric acid, glucuronic acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, 4-aminosalicylic
- amino acids such as the 20 alpha-amino acids involved in the
- Pharmaceutically acceptable salts of compounds may also be prepared with a pharmaceutically acceptable cation.
- Suitable pharmaceutically acceptable cations are well known to those skilled in the art and include alkaline, alkaline earth, ammonium and quaternary ammonium cations . Carbonates or hydrogen carbonates are also possible.
- salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine, etc.
- acid addition salts formed with inorganic acids for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like
- salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid
- the antisense compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits.
- an animal preferably a human, suspected of having a disease or disorder which can be treated by modulating the behavior of a cell can be treated by administering antisense compounds in accordance with this invention.
- the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of an antisense compound to a suitable pharmaceutically acceptable diluent or carrier.
- Use of the antisense compounds and methods of the invention may also be useful prophylactically, e.g., to prevent or delay infection, inflammation or tumor formation, for example.
- the antisense compounds of the invention are useful for research and diagnostics, because these compounds hybridize to nucleic acids encoding a selected mRNA target, enabling sandwich and other assays to easily be constructed to exploit this fact.
- Hybridization of the antisense oligonucleotides of the invention with a nucleic acid encoding the selected mRNA target can be detected by means known in the art. Such means may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide or any other suitable detection means.
- Kits using such detection means for detecting the level of target in a sample may also be prepared.
- the present invention also includes pharmaceutical compositions and formulations which include the antisense compounds of the invention.
- the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to raucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal) , oral or parenteral .
- Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
- Oligonucleotides with at least one 2 ⁇ -O-methoxyethyl modification including chimeric molecules or molecules which may have a 2 ' -O- methoxyethyl modification of every nucleotide sugar, are believed to be particularly useful for oral administration.
- compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Coated condoms, gloves and the like may also be useful .
- Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
- compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
- Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
- the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier (s) or excipient (s) . In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product .
- compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, liquid syrups, soft gels, suppositories, and enemas.
- the compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media.
- Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- the pharmaceutical compositions may be formulated and used as foams.
- Pharmaceutical foams include formulations such as, but not limited to, emulsions, microemulsions, creams, jellies and liposomes. While basically similar in nature these formulations vary in the components and the consistency of the final product.
- the preparation of such compositions and formulations is generally known to those skilled in the pharmaceutical and formulation arts and may be applied to the formulation of the compositions of the present invention.
- Emulsions The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter.
- Emulsions are often biphasic systems comprising of two immiscible liquid phases intimately mixed and dispersed with each other.
- emulsions may be either water-in-oil (w/o) or of the oil-in-water (o/w) variety.
- w/o water-in-oil
- o/w oil-in-water
- an oily phase when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase the resulting composition is called an oil-in-water (o/w) emulsion.
- Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
- Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed.
- compositions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions.
- Such complex formulations often provide certain advantages that simple binary emulsions do not.
- Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion.
- a system of oil droplets enclosed in globules of water stabilized in an oily continuous provides an o/w/o emulsion.
- Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion.
- Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199) .
- Synthetic surfactants also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y. , volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y. , 1988, volume 1, p. 199).
- Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion.
- HLB hydrophile/lipophile balance
- surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).
- Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia.
- Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations .
- polar inorganic solids such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.
- non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).
- Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth) , cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose) , and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers) . These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.
- polysaccharides for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth
- cellulose derivatives for example, carboxymethylcellulose and carboxypropylcellulose
- synthetic polymers for example, carbomers,
- emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives.
- preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid.
- Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation.
- Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite
- antioxidant synergists such as citric acid, tartaric acid, and lecithin.
- Emulsion formulations for oral delivery have been very widely used because of reasons of ease of formulation, efficacy from an absorption and bioavailability standpoint. (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p.
- the compositions of oligonucleotides and nucleic acids are formulated as microemulsions .
- a microemulsion may be defined as a system of water, oil and araphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245).
- microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system.
- microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs : Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215) .
- Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte.
- microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington ' s Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 1985, p. 271).
- the phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y.
- microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.
- Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non- ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310) , tetraglycerol monooleate (MO310) , hexaglycerol monooleate (PO310) , hexaglycerol pentaoleate (PO500) , decaglycerol monocaprate (MCA750) , decaglycerol monooleate (MO750) , decaglycerol sequioleate (SO750) , decaglycerol decaoleate (DAO750) , alone or in combination with cosurfactants .
- ionic surfactants non- ionic surfactants
- Brij 96 polyoxyethylene oleyl ethers
- the cosurfactant usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules.
- Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self- emulsifying microemulsion systems are known in the art.
- the aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol .
- the oil phase may include, but is not limited to, materials such as Captex 300, Captex 355,
- Capmul MCM fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils and silicone oil.
- Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs.
- Lipid based microemulsions both o/w and w/o have been proposed to enhance the oral bioavailability of drugs, including peptides
- Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al . , Pharmaceutical ' Research, 1994, 11 , 1385; Ho et al . , J. Pharm . Sci . , 1996, 85, 138-143).
- microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or oligonucleotides.
- Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of oligonucleotides and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of oligonucleotides and nucleic acids within the gastrointestinal tract, vagina, buccal cavity and other areas of administration.
- Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3) , Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the oligonucleotides and nucleic acids of the present invention.
- Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories - surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92) . Each of these classes has been • discussed above . Liposomes
- liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.
- Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non- cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.
- liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical
- Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes . As the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.
- Liposomes present several advantages over other formulations. Such advantages include reduced side- effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.
- Liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex.
- the positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al . , Biochem. Biophys . Res . Commun . , 1987, 147, 980-985).
- Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al . , Journal of Controlled Release, 1992, 19, 269-274) .
- liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine.
- Neutral liposome compositions can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC) .
- Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE) .
- Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC.
- Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.
- Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means ( e . g. as a solution or as an emulsion) were ineffective (Weiner et al . , Journal of Drug Targeting, 1992, 2, 405-410) .
- Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol.
- Non-ionic liposomal formulations comprising NovasomeTM I (glyceryl dilaurate/cholesterol/ polyoxyethylene-10-stearyl ether) and NovasomeTM II (glyceryl distearate/ cholesterol/polyoxyethylene-10- stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non- ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al . S . T. P. Pharma . Sci .
- Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
- sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside G M1 , or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
- PEG polyethylene glycol
- liposomes comprising (1) sphingomyelin and (2) the ganglioside G M1 or a galactocerebroside sulfate ester.
- U.S. Patent 5,543,152 discloses liposomes comprising sphingomyelin. Liposomes comprising 1, 2-sn-dimyristoylphosphatidylcholine are disclosed in WO 97/13499 (Lim et al . ) .
- liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art.
- Sunamoto et al . (Bull . Chem . Soc . Jpn . , 1980, 53 , 2778) described liposomes comprising a nonionic detergent, 2C 12 15G, that contains a PEG moiety.
- Ilium et al . FEBS Lett . , 1984, 167, 79
- hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives.
- Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols e. g.
- DSPE-PEG formed from the combination of distearoylphosphatidyl- ethanolamine (DSPE) and PEG.
- DSPE distearoylphosphatidyl- ethanolamine
- PEG distearoylphosphatidyl- ethanolamine
- Liposomes having covalently bound PEG moieties on their external surface are described in European Patent EP 0 445 131 Bl and WO 90/04384 to Fisher.
- Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Patents 5,013,556 and 5,356,633) and Martin et al. (U.S. Patent 5,213,804 and European Patent EP 0 496 813 Bl) .
- Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Patent 5,225,212 (both to Martin et al . ) and in WO 94/20073 (Zalipsky et al . ) .
- Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al . ) .
- U.S. Patents 5,540,935 (Miyazaki et al . ) and 5,556,948 (Tagawa et al . ) describe PEG- containing liposomes that can be further derivatized with functional moieties on their surfaces.
- a limited number of liposomes comprising nucleic acids are known in the art.
- WO 96/40062 to Thierry et al discloses methods for encapsulating high molecular weight nucleic acids in liposomes.
- U.S. Patent 5,264,221 to Tagawa et al discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an antisense RNA.
- U.S. Patent 5,665,710 to Rahman et al . describes certain methods of encapsulating oligodeoxynucleotides in liposomes.
- WO 97/04787 to Love et al is a limited number of liposomes comprising nucleic acids.
- Transfersomes comprising antisense oligonucleotides targeted to the raf gene.
- Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e . g. they are self-optimizing (adaptive to the shape of pores in the skin) , self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge- activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.
- HLB hydrophile/lipophile balance
- Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure.
- Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters.
- Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class.
- the polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.
- Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates.
- the most important members of the anionic surfactant class are the alkyl sulfates and the soaps.
- Cationic surfactants include quaternary ammonium salts and ethoxylated amines .
- the quaternary ammonium salts are the most used members of this class .
- amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N- alkylbetaines and phosphatides .
- the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly oligonucleotides, to the skin of animals.
- nucleic acids particularly oligonucleotides
- Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.
- Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non- surfactants (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92) . Each of the above mentioned classes of penetration enhancers are described below in greater detail.
- surfactants are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of oligonucleotides through the mucosa is enhanced.
- these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al . , J " . Pharm . Pharmacol . , 1988, 40 , 252).
- Fatty acids Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid) , myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1- monooleoyl-rac-glycerol) , dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1- dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C x consider 10 alkyl esters thereof ( e . g.
- Bile salts The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al . Eds., McGraw-Hill, New York, 1996, pp. 934-935) .
- the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives.
- the bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate) , dehydrocholic acid (sodium dehydrocholate) , deoxycholic acid (sodium deoxycholate) , glucholic acid (sodium glucholate) , glycholic acid (sodium glycocholate) , glycodeoxycholic acid (sodium glycodeoxycholate) , taurocholic acid (sodium taurocholate) , taurodeoxycholic acid (sodium taurodeoxycholate) , chenodeoxycholic acid (sodium chenodeoxycholate) , ursodeoxycholic acid (UDCA) , sodium tauro-24 , 25-dihydro- fusidate (STDHF) , sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al . , Cri tical Reviews
- Chelating agents can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of oligonucleotides through the mucosa is enhanced.
- chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J " . Chromatogr . , 1993, 618, 315-339).
- Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA) , citric acid, salicylates (e . g. , sodium salicylate, 5- methoxysalicylate and homovanilate) , jY-acyl derivatives of collagen, laureth-9 and 2 ⁇ F-amino acyl derivatives of beta- diketones (enamines) (Lee et al . , Cri tical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Cri tical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al . , J. Control Rel . , 1990, 14 , 43-51).
- EDTA disodium ethylenediaminetetraacetate
- citric acid citric acid
- salicylates e . g. , sodium salicylate, 5- methoxysalicylate and homovanilate
- Non-chelating non-surfactants can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of oligonucleotides through the alimentary mucosa (Muranishi, Cri tical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33).
- This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo- alkanone derivatives (Lee et al .
- non- steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al . , J. Pharm . Pharmacol . , 1987, 39, 621-626).
- Agents that enhance uptake of oligonucleotides at the cellular level may also be added to the pharmaceutical and other compositions of the present invention.
- cationic lipids such as lipofectin (Junichi et al , U.S. Patent No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al . , PCT Application WO 97/30731) , are also known to enhance the cellular uptake of oligonucleotides.
- nucleic acids may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.
- glycols such as ethylene glycol and propylene glycol
- pyrrols such as 2-pyrrol
- azones such as 2-pyrrol
- terpenes such as limonene and menthone.
- compositions of the present invention also incorporate carrier compounds in the formulation.
- carrier compound or “carrier” can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation.
- nucleic acid and a carrier compound can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor.
- the recovery of a partially phosphorothioate oligonucleotide in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-
- a "pharmaceutical carrier” or “excipient” is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal.
- the excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc. , when combined with a nucleic acid and the other components of a given pharmaceutical composition.
- Typical pharmaceutical carriers include, but are not limited to, binding agents (e . g. , pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers ( e. g. , lactose and other sugars, raicrocrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants ( e . g.
- compositions of the present invention can also be used to formulate the compositions of the present invention.
- suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases.
- the solutions may also contain buffers, diluents and other suitable additives.
- Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.
- Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- Other Components include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.
- compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels.
- the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- additional materials useful in physically formulating various dosage forms of the compositions of the present invention such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers.
- auxiliary agents e . g.
- Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
- the suspension may also contain stabilizers.
- compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism.
- chemotherapeutic agents include, but are not limited to, anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mitomycin, nitrogen mustard, chlorambucil, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA) , 5-fluorouracil (5-FU) , floxuridine (5-FUdR) , methotrexate (MTX) , colchicine, vincristine, vinblastine, etoposide, teniposide, cisplatin and diethylstilbestrol (DES) .
- anticancer drugs such as daunorubicin, dactinomycin, doxorubicin, bleomycin, mito
- Anti-inflammatory drugs including but not limited to nonsteroidal anti- inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al . , eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively) .
- Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
- compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid and one or more additional antisense compounds targeted to a second nucleic acid target.
- antisense compounds particularly oligonucleotides
- additional antisense compounds targeted to a second nucleic acid target Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
- compositions and their subsequent administration is believed to be within the skill of those in the art. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. Persons of ordinary skill can easily determine optimum dosages, dosing methodologies and repetition rates. Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC 50 s found to be effective in in vi tro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years.
- N6-benzoyl-2 ' -deoxy-2 ' -fluoroadenosine was synthesized utilizing commercially available 9-beta-D- arabinofuranosyladenine as starting material and by modifying literature procedures whereby the 2' -alpha-fluoro atom is introduced by a S N 2-displacement of a 2 ' -beta-trityl group.
- N6-benzoyl-9-beta-D-arabinofuranosyladenine was selectively protected in moderate yield as the 3 ' , 5 ' - ditetrahydropyranyl (THP) intermediate.
- THP and N6-benzoyl groups were accomplished using standard methodologies and standard methods were used to obtain the 5 ' -dimethoxytrityl- (DMT) and 5'-DMT-3'- phosphoramidite intermediates .
- 2' -Fluorodeoxyguanosine The synthesis of 2 ' -deoxy-2 ' -fluoroguanosine was accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-beta-D-arabinofuranosylguanine as starting material, and conversion to the intermediate diisobutyryl- arabinofuranosylguanosine.
- TPDS tetraisopropyldisiloxanyl
- 2 ' -deoxy-2 ' -fluorocytidine was synthesized via amination of 2 ' -deoxy-2 ' -fluorouridine, followed by selective protection to give N4-benzoyl-2 ' -deoxy-2 ' - fluorocytidine. Standard procedures were used to obtain the 5' -DMT and 5 ' -DMT-3 'phosphoramidites .
- 2' -0- (2-Methoxyethyl) modified amidites 2 ' -O-Methoxyethyl-substituted nucleoside amidites are prepared as follows, or alternatively, as per the methods of Martin, P., Helvetica Chimica Acta, 1995, 78, 486-504. 2,2 ' -Anhydro [1- (beta-D-arabinofuranosyl) -5- methyluridine]
- the solution was poured into fresh ether (2.5 L) to yield a stiff gum.
- the ether was decanted and the gum was dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid that was crushed to a light tan powder (57 g, 85% " crude yield) .
- the NMR spectrum was consistent with the structure, contaminated with phenol as its sodium salt (ca. 5%) .
- the material was used as is for further reactions (or it can be purified further by column chromatography using a gradient of methanol in ethyl acetate (10-25%) to give a white solid, mp 222-4°C) .
- HPLC showed the presence of approximately 70% product .
- the solvent was evaporated and triturated with CH 3 CN (200 mL) .
- the residue was dissolved in CHC1 3 (1.5 L) and extracted with 2x500 mL of saturated NaHC0 3 and 2x500 mL of saturated NaCl .
- the organic phase was dried over Na 2 S0 4 , filtered and evaporated. 275 g of residue was obtained.
- the residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/hexane/acetone (5:5:1) containing 0.5% Et 3 NH.
- the pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%) .
- Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH 3 CN (1 L) , cooled to -5°C and stirred for 0.5 h using an overhead stirrer.
- P0C1 3 was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours.
- the first solution was added dropwise, over a 45 minute period, to the latter solution.
- the resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration.
- the dioxane solution was evaporated and the residue azeotroped with MeOH (2x200 mL) .
- the residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel.
- MeOH (400 mL) saturated with NH 3 gas was added and the vessel heated to 100°C for 2 hours (TLC showed complete conversion) .
- the vessel contents were evaporated to dryness and the residue was dissolved in EtOAc (500 mL) and washed once with saturated NaCl (200 mL) .
- the organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.
- N4-Benzoyl-2 ' -0-methoxyethyl-5 ' -O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) was dissolved in CH 2 C1 2 (1 L) .
- Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra- (isopropyl) phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (TLC showed the reaction to be 95% complete) .
- the reaction mixture was extracted with saturated NaHC0 3 (1x300 mL) and saturated NaCl (3x300 mL) .
- 2 ' - (Dimethylaminooxyethoxy) nucleoside amidites [also known in the art as 2 ' -0- (dimethylaminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
- Adenosine, cytidine and guanosine nucleoside amidites are prepared similarly to the thymidine (5- methyluridine) except the exocyclic amines are protected with a benzoyl moiety in the case of adenosine and cytidine and with isobutyryl in the case of guanosine.
- reaction vessel was cooled to ambient and opened.
- TLC Rf 0.67 for desired product and Rf 0.82 for ara-T side product, ethyl acetate
- the reaction was stopped, concentrated under reduced pressure (10 to 1mm Hg) in a warm water bath (40-100°C) with the more extreme conditions used to remove the ethylene glycol.
- the remaining solution can be partitioned between ethyl acetate and water.
- the product will be in the organic phase.
- the residue was purified by column chromatography (2kg silica gel, ethyl acetate-hexanes gradient 1:1 to 4:1).
- Residue obtained was placed on a flash column and eluted with ethyl acetate :hexane (60:40), to get 2 ' -O- ( [2-phthalimidoxy) ethyl] -5 ' - - butyldiphenylsilyl-5-methyluridine as white foam (21.819 g, 86%) .
- Triethylamine trihydrofluoride (3.91mL, 24.0mmol) was dissolved in dry THF and triethylamine (1.67mL, 12mmol, dry, kept over KOH) .
- This mixture of triethylamine-2HF was then added to 5 ' -O- tert-butyldiphenylsilyl-2 ' -O- [N,N- dimethylaminooxyethyl] -5-methyluridine (1.40g, 2.4mmol) and stirred at room temperature for 24 hrs . Reaction was monitored by TLC (5% MeOH in CH 2 C1 2 ) . Solvent was removed under vacuum and the residue placed on a flash column and eluted with 10% MeOH in CH 2 C1 2 to get 2'-0-
- reaction mixture was stirred at ambient temperature for 4 hrs under inert atmosphere. The progress of the reaction was monitored by TLC (hexane: ethyl acetate 1:1). The solvent was evaporated, then the residue was dissolved in ethyl acetate (70mL) and washed with 5% aqueous NaHC0 3 (40mL) . Ethyl acetate layer was dried over anhydrous Na 2 S0 4 and concentrated.
- Residue obtained was chromatographed (ethyl acetate as eluent) to get 5'-0-DMT- 2 ' -O- (2-N,N-dimethylaminooxyethyl) -5-methyluridine-3 ' - [ (2- cyanoethyl) -N,N-diisopropylphosphoramidite] as a foam (1.04g, 74.9%) .
- 2 ' - (Aminooxyethoxy) nucleoside amidites 2 ' - (Aminooxyethoxy) nucleoside amidites [also known in the art as 2 ' -0- (aminooxyethyl) nucleoside amidites] are prepared as described in the following paragraphs.
- Adenosine, cytidine and thymidine nucleoside amidites are prepared similarly.
- the 2 ' -0-aminooxyethyl guanosine analog may be obtained by selective 2 ' -O-alkylation of diaminopurine riboside.
- Multigram quantities of diaminopurine riboside may be purchased from Schering AG (Berlin) to provide 2 ' -0- (2-ethylacetyl) diaminopurine riboside along with a minor amount of the 3'-0-isomer.
- 2 ' -0- (2-ethylacetyl) diaminopurine riboside may be resolved and converted to 2 ' - 0- (2-ethylacetyl) guanosine by treatment with adenosine deaminase.
- Standard protection procedures should afford 2 ' -0- (2-ethylacetyl) -5 ' -O- (4 , 4 ' - dimethoxytrityl) guanosine and 2-N-isobutyryl-6-0- diphenylcarbamoyl-2 ' -0- (2-ethylacetyl) -5 ' -0- (4,4' - dimethoxytrityl) guanosine which may be reduced to provide 2-N-isobutyryl-6-0-diphenylcarbamoyl-2 ' -0- (2-ethylacetyl) - 5 ' -0- (4 , 4 ' -dimethoxytrityl) guanosine.
- hydroxyl group may be displaced by N-hydroxyphthalimide via a Mitsunobu reaction, and the protected nucleoside may phosphitylated as usual to yield 2-N-isobutyryl-6-0- diphenylcarbamoyl-2 ' -0- (2-ethylacetyl) -5'-0-(4,4'- dimethoxytrityl) guanosine-3 ' - [ (2-cyanoethyl) -N,N- diisopropylphosphoramidite] .
- Oligonucleotide synthesis Oligonucleotide synthesis
- the thiation wait step was increased to 68 sec and was followed by the capping step.
- the oligonucleotides were purified by precipitating twice with 2.5 volumes of ethanol from a 0.5 M NaCl solution.
- Phosphinate oligonucleotides are prepared as described in U.S. Patent 5,508,270, herein incorporated by reference.
- Alkyl phosphonate oligonucleotides are prepared as described in U.S. Patent 4,469,863, herein incorporated by reference.
- 3 ' -Deoxy-3 ' -methylene phosphonate oligonucleotides are prepared as described in U.S. Patent 5,610,289 or 5,625,050, herein incorporated by reference.
- Phosphoramidite oligonucleotides are prepared as described in U.S. Patent 5,256,775 or 5,366,878, herein incorporated by reference .
- Alkylphosphonothioate oligonucleotides are prepared as described in published PCT applications PCT/US94/00902 and PCT/US93/06976 (published as WO 94/17093 and WO 94/02499, respectively), herein incorporated by reference.
- 3 ' -Deoxy-3 ' -amino phosphoramidate oligonucleotides are prepared as described in U.S. Patent 5,476,925, herein incorporated by reference.
- Phosphotriester oligonucleotides are prepared as described in U.S. Patent 5,023,243, herein incorporated by reference .
- Formacetal and thioformacetal linked oligonucleosides are prepared as described in U.S. Patents 5,264,562 and 5,264,564, herein incorporated by reference.
- Ethylene oxide linked oligonucleosides are prepared as described in U.S. Patent 5,223,618, herein incorporated by reference.
- PNAs Peptide nucleic acids
- PNA Peptide Nucleic Acids
- oligonucleotides or oligonucleosides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol .
- Synthesized oligonucleotides were analyzed by polyacrylamide gel electrophoresis on denaturing gels and judged to be at least 85% full length material.
- the relative amounts of phosphorothioate and phosphodiester linkages obtained in synthesis were periodically checked by 31 P nuclear magnetic resonance spectroscopy, and for some studies oligonucleotides were purified by HPLC, as described by Chiang et al . , J " . Biol . Chem. 1991, 266, 18162-18171. Results obtained with HPLC-purified material were similar to those obtained with non-HPLC purified material .
- Example 6 Antisense modulation of polyadenylation
- E-selectin an adhesion molecule
- the human E- selectin genomic structure includes multiple AATAAA polyadenylation signals and a number of AUUUA transcript destabilizing elements with in the 3' untranslated region. It has been demonstrated that all three polyadenylation signals are functional, resulting in three types of E- selectin transcripts generated by differential use of these signals.
- the three transcripts (Type I, II and III) are differentially expressed in certain disease conditions.
- the Type I transcript lacks six of the transcript destabilizing elements, and has been shown to be more stable than the full-length Type III transcript. Chu et al .
- the three AATAAA polyadenylation signals are located within the 3' untranslated sequence at nucleotides 2823, 2981 and 3816 according to the numbering scheme of Bevilacqua et al . , 1989, Science 243 , 1160-1165; GenBank Accession No. M24736.
- the actual polyadenylation sites are 13-20 bases downstream of each AATAAA signal.
- 2'-MOE 2 ' -methoxyethoxy
- HUVEC human umbilical vascular endothelial cells
- antisense oligonucleotides targeted to E-selectin polyadenylation sites are treated with antisense oligonucleotides targeted to E-selectin polyadenylation sites.
- Anchored-PCR amplification of human E-selectin mRNA 3' ends is performed according to Chu et al . (1994, J. Immunol. 153: 4179-4189) to determine which polyadenylation sites are still functional and in what amounts.
- Direct measurements of the stability of the various transcripts present after oligonucleotide treatment can be performed using the rabbit reticulocyte lysate system described in Chu et al . (1994, J. Immunol. 153: 4179- 4189) .
- the mRNA encoding the membrane form of the mouse IL- receptor ⁇ contains 11 exons.
- the transmembrane domain of the receptor is encoded in exon 9.
- Two mRNAs encoding soluble (secreted) forms of the receptor result from differential splicing events.
- the mRNA encoding soluble form 1 of the receptor is missing exon 9 (exon 8 is spliced to exon 10) and the mRNA encoding soluble form 2 is missing exons 9 and 10 (exon 8 is spliced to exon 11) .
- a series of antisense oligonucleotides were designed to "walk" the entire exon 9 of the coding region of murine IL-5 receptor ⁇ mRNA. Oligonucleotides were targeted to regions starting approximately every 10 nucleobases along the exon 9 sequence, which extends from nucleotides 1288 to 1381 on the sequence given as Genbank accession no. D90205, provided herein as SEQ ID NO: 9.
- Murine BCL cells were chosen for screening antisense oligonucleotides targeted to murine IL-5 receptor ⁇ . These are B-cell leukemia cells derived from a spontaneously arising tumor of BALB/c origin, and proliferate in response to murine or human IL-5.
- CD5+ line This is a CD5+ line which resembles a subset of human chronic lymphocytic leukemia tumors and secretes IgM upon lipopolysaccharide stimulation.
- Cells were obtained from the American Type Culture Collection and cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Sigma Chemical Co., St. Louis, MO), 10 mM Hepes, pH 7.2, 50 ⁇ M 2-ME, 2 mM L-glutamine, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin (Gibco, Grand Island, NY) .
- Total BCLi cellular RNA was isolated using the RNeasyTM kit (Qiagen, Santa Clara CA) . Northern blotting was performed using standard methods . The cDNA probes were generated from oligonucleotides matching the exon sequences of either exons 2, 8, 9 or 10. Signals were quantitated using a Molecular Dynamics Phosphorlmager.
- Additional oligonucleotides were designed to target exon 9 and intron/exon boundaries; these were uniformly 2'- methoxyethoxy modified with phosphorothioate backbones throughout. These are shown in Table 3 below. TABLE 3 Nucleotide Sequences of Mouse IL-5R Oligonucleotides- uniform 2 ' MOE
- MUSIL5R SEQ ID NO : 9. BCL 2 cells were treated with lO ⁇ M of the full-2'- methoxyethoxy, full phosphorothioate oligonucleotides for
- RNAse H-dependent compound the 2' MOE gapmer ISIS 18002
- RNAse H-independent compound the fully- 2' MOE compound 21752
- Oligonucleotides either 2' MOE gapmers or uniform 2' MOE, were designed to target exon-exon boundaries of the mature IL-5 receptor ⁇ mRNA.
- the mRNA encoding the membrane form of the receptor has exons 1-11.
- the mRNA encoding the soluble form of the receptor is missing exon 9 (soluble form 1) or exons 9 and 10 (soluble form 2) .
- the target region designated "E7-E8" indicates that the oligonucleotide is targeted to the exon 7-8 boundary, and so forth.
- Antisense oligonucleotides targeted to splice sites in the human IL-5 receptor ⁇ mRNA mRNA transcripts encoding the membrane form of the human IL-5 receptor ⁇ contain exons 1-10 and 12-14. Exon 11 is spliced out. It is, therefore, possible to target sequences in exons 1-10 which are common to both soluble and membrane forms of the receptor, or to selectively target sequences only present in the membrane form (exons 12-14) . Oligonucleotides were also designed to target various intron/exon boundaries downstream of exon 11, with the intention of preventing successful splicing out of exon 11 and thus redirecting splice products away from the membrane form and in favor of the soluble form of IL-5 receptor ⁇ .
- oligonucleotides were designed to target various splice sites or (intron-exon boundaries) in the IL- 5 receptor mRNA. These are shown in Table 7 and their effect on IL-5 receptor mRNA and cell surface protein levels is shown in Tables 8 and 9. TABLE 7
- 2Target regions refer to intron/exon junctions (splice sites) to which oligonucleotides are targeted.
- I13/E14 indicates the junction between the 3 ' end of intron 13 and the 5' end of exon 14.
- E13/I13 indicates the junction between the 3 ' end of exon 13 and the 5 ' end of intron 13.
- I12/E13 indicates the junction between the 3 ' end of intron 12 and the 5' end of exon 13.
- E12/I12 indicates the junction between the 3' end of exon 12 and the 5' end of intron 12.
- I11/E12 indicates the junction between the 3' end of intron 11 and the 5 ' end of exon 12.
- Target sequences are from Figure 2 of Tuypens, T., et al . , Eur. Cytokine Netw. , 1992 , 3, 451-459.
- 2Target regions refer to intron/exon junctions (splice sites) to which oligonucleotides are targeted.
- I13/E14 indicates the junction between the 3' end of intron 13 and the 5' end of exon 14.
- E13/I13 indicates the junction between the 3 ' end of exon 13 and the 5 ' end of intron 13.
- I12/E13 indicates the junction between the 3 ' end of intron 12 and the 5' end of exon 13.
- E12/I12 indicates the junction between the 3' end of exon 12 and the 5' end of intron 12.
- I11/E12 indicates the junction between the 3' end of intron 11 and the 5 ' end of exon 12.
- ISIS 16746, 16748 and 16755 inhibited IL-5 receptor mRNA expression by over 50% and are therefore preferred in this assay.
- ISIS 16755 redirects splicing in favor of the membrane form, as is consistent with data obtained with other non-RNAse H (e.g., uniform 2 ' -methoxyethoxy) oligonucleotides targeted to splice sites.
- 2Target regions refer to intron/exon junctions (splice sites) to which oligonucleotides are targeted.
- I13/E14 indicates the junction between the 3 ' end of intron 13 and the 5' end of exon 14.
- E13/I13 indicates the junction between the 3 ' end of exon 13 and the 5 ' end of intron 13.
- I12/E13 indicates the junction between the 3' end of intron 12 and the 5' end of exon 13.
- E12/I12 indicates the junction between the 3' end of exon 12 and the 5' end of intron 12.
- I11/E12 indicates the junction between the 3' end of intron 11 and the 5 ' end of exon 12.
- ISIS 16746, 16748, 16755 and 16758 inhibited human IL- 5 receptor ⁇ protein by over 50% in this assay and are therefore preferred.
- ISIS 16758 and 16755 were chosen for further study.
- ISIS 16758 was found to have an IC50 of approximately 5 ⁇ M for reduction of IL-5 receptor ⁇ cell surface protein in TF-1 cells.
- a 1-mismatch control had an IC50 of 10 ⁇ M and 3- and 5-mismatch controls did not inhibit IL-5 receptor ⁇ expression.
- ISIS 16758 inhibited IL- 5 receptor ⁇ protein expression without reducing mRNA levels, consistent with an RNAse H-independent mechanism as predicted for a uniformly 2 ' -methoxyethoxy modified oligonucleotide.
- ISIS 16758 an antisense inhibitor of IL-5 receptor ⁇ , greatly reduces cellular response to IL-5, i.e., cell proliferation in response to IL-5.
- Bcl-x is a bcl-2-independent regulator of apoptosis. Boise et al . , 1993, Cell 74,597-608. Two isoforms of bcl-x were reported in humans. Bcl-xl (long) contains the highly conserved BH1 and BH2 domains. When transfected into an IL- 3 dependent cell line, bcl-xl inhibited apoptosis during growth factor withdrawal, in a manner similar to bcl-2.
- bcl-x short isoform bcl-xs
- bcl-xs which is produced by alternative splicing and lacks a 63 -amino acid region of exon 1 containing the BH1 and BH2 domains, antagonizes the anti-apoptotic effect of either bcl-2 or bcl-xl .
- the bcl- x transcript can be categorized into regions described by those of skill in the art as follows: nucleotides 1-134, 5' untranslated region (5' -UTR); nucleotides 135-137, translation initiation codon (AUG) ; nucleotides 135-836, coding region, of which 135-509 are the shorter exon 1 of the bcl-xs transcript and 135-698 are the longer exon 1 of the bcl-xl transcript; nucleotides 699-836 are exon 2 ; nucleotides 834-836, stop codon; nucleotides 837-926, 3' untranslated region (3 ' -UTR) .
- an intron is spliced out of the pre-mRNA when the mature bcl-xl (long) mRNA transcript is produced.
- An alternative splice from position 509 to position 699 produces the bcl-xs (short) mRNA transcript which is 189 nucleotides shorter than the long transcript, encoding a protein product (bcl-xs) which is 63 amino acids shorter than bcl-xl.
- the protein of bcl-xL is similar in size and structure to the anti-apoptotic protein bcl-2, and is believed to have a similar anti-apoptotic function, inhibiting cell death upon growth factor withdrawal.
- the protein of bcl-xs is believed to inhibit the bcl-2 function, thus promoting programmed cell death (apoptosis) .
- oligonucleotides Effect of antisense oligonucleotides on expression of bcl- xs and bcl-xl transcripts
- a series of oligonucleotides were designed to target different regions of human bcl-x RNA, using published sequences (Boise, L.H., et al . , 1993, Cell 74, 597-608; Genbank Accession No. L20121, locus name "HSBCLXL, " incorporated herein as SEQ ID NO: 39) .
- Antisense oligonucleotides were designed to target areas of exon 1 and exon 2 of human bcl-x, particularly around the exon 1/exon 2 splice site and in sequence regions present in bcl-xl but not in bcl-xs. These oligonucleotides are shown in Table 12. All backbone linkages are phosphorothioates; All 2 'MOE cytosines are 5- methylcytosines .
- Residues shown in bold are 2 ' -MOE residues 2 Co-ordinates from Genbank Accession No. L20121, locus name "HSBCLXL,” SEQ ID NO: 39.
- Oligonucleotides were evaluated for their respective effects on bcl-xs and bcl-xl mRNA levels in A549 cells along with total bcl-x mRNA levels, using the RIBOQUANTTM RNase protection kit (Pharmingen, San Diego CA) . All assays were performed according to manufacturer's protocols. Results are shown in Table 13.
- ISIS 22783 a fully 2' -MOE, full-phosphorothioate oligonucleotide targeted to exon 1 of the bcl-xl transcript (not the bcl-xs transcript) , is able to change the ratio of bcl-xs to bcl-xl from 17% to 293%, without reducing the total bcl-x mRNA level in A549 cells. That is, it reduced the bcl-xl form (the anti-apoptotic form of bcl-x) but dramatically increased the bxl-xs form (the pro-apoptotic form) . This result is expected to result in promotion of apoptosis .
- ISIS 22783 was tested by RNAse protection assay for ability to inhibit bax, another apoptotic gene. It had no effect on bax mRNA levels.
- ISIS 22783 is also fully complementary to the murine bcl-x mRNA which makes it useful for animal studies. Treatment of mouse cell lines bEND, AML12 and Hepa all showed induction of bcl-xs mRNA after treatment with ISIS 22783 but not the mismatch control ISIS 26080 (CTGGTTACACGACTCCAGGT; SEQ ID NO: 53) . ISIS 22783 has also been shown in preliminary experiments to cause slight induction of bcl-xs mRNA expression in vivo in mouse liver. Example 15
- ISIS 22783 the most active oligonucleotide for redirection of splicing, is targeted to a region which is 16-35 nucleotides upstream of the 5' splice site of bcl-xl (at nucleotide 699) .
- a "walk” was done in this region with 20mer 2 ' -MOE phosphorothioate oligonucleotides targeted to sequences whose 5' ends were 24, 26, 29, 31, 33, 37, 39, 41, 43, 44, 45 and 47 bases upstream of the splice site.
- oligonucleotides were screened as before at a dose of 200 nM oligonucleotide for effect on short and long bcl-x transcripts.
- the oligonucleotides are shown in Table 14 and results are shown in Table 15.
- oligonucleotides in this region were able to redirect the splice products in favor of bcl- xs.
- Antisense compounds targeting anywhere in the 47 nucleotides upstream of the 5' splice site i.e., from nucleotides 652-699 according to the numbering scheme used in Genbank locus name "HSBCLXL," Accession No. L20121 (also Z23115) are therefore preferred. Many of these compounds were even more effective than ISIS 22783 (i.e., gave bcl- xs/xl ratios of greater than 5.25 in this experiment) . These compounds are highly preferred.
- a dose response can be obtained for oligonucleotide redirection of splice products. This is shown in Table 16.
- ISIS 26080 is a 5-base mismatch of ISIS 22783.
- ISIS 22783 induces bcl-xs mRNA expression over time in A549 cells with concurrent reduction in bcl-xL mRNA beginning 2-4 hours after treatment with oligonucleotide. The identity of these transcripts was confirmed by nucleotide sequencing.
- Example 16 Antisense sensitization of cells to UV-induced cell death
- A549 cells were treated with 100 nM ISIS 22783 or the 5-mismatch ISIS 26080 and exposed to ultraviolet (UV) radiation.
- UV radiation ultraviolet
- the percent apoptotic cells was quantitated by propidium iodide staining according to standard methods Results are shown in Table 17.
- Antisense sensitization of cells to cisplatinum-induced cell death A549 cells were treated with 100 nM ISIS 22783 or the
- A549 cells were treated with 100 nM ISIS 22783 or the
- modifications in addition to 2 ' - methoxyethoxy which provide tight binding of the antisense compound to the target and resistance to nucleases are also particularly useful in targeting splice sites.
- modifications include but are not limited to sugar modifications including 2 ' -dimethylaminooxyethoxy (2'- DMAOE) and 2 ' -acetamides; backbone modifications such as morpholino, MMI and PNA backbones, and base modifications such as C-5 propyne .
- the 2 ' -DMAOE compound showed qualitatively similar, though quantitatively slightly less, ability to alter the ratio of bcl-xs to bcl- xl splice products .
- 2 ' -DMAOE compounds are therefore preferred.
- Preliminary experiments with a morpholino-backbone compound with the 22783 sequence showed good activity using scrape loading.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Saccharide Compounds (AREA)
Abstract
Description
Claims
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CA002400573A CA2400573A1 (en) | 2000-03-28 | 2000-03-28 | Alteration of cellular behavior by antisense modulation of mrna processing |
PCT/US2000/008174 WO2001072765A1 (en) | 2000-03-28 | 2000-03-28 | ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING |
AU2000240366A AU2000240366B2 (en) | 2000-03-28 | 2000-03-28 | Alteration of cellular behavior by antisense modulation of mRNA processing |
JP2001571696A JP2004509604A (en) | 2000-03-28 | 2000-03-28 | Modification of cell behavior by antisense modulation of mRNA processing |
AU4036600A AU4036600A (en) | 2000-03-28 | 2000-03-28 | Alteration of cellular behavior by antisense modulation of mrna processing |
EP00919726A EP1263765A4 (en) | 2000-03-28 | 2000-03-28 | ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PCT/US2000/008174 WO2001072765A1 (en) | 2000-03-28 | 2000-03-28 | ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001072765A1 true WO2001072765A1 (en) | 2001-10-04 |
Family
ID=21741209
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/008174 WO2001072765A1 (en) | 2000-03-28 | 2000-03-28 | ALTERATION OF CELLULAR BEHAVIOR BY ANTISENSE MODULATION OF mRNA PROCESSING |
Country Status (5)
Country | Link |
---|---|
EP (1) | EP1263765A4 (en) |
JP (1) | JP2004509604A (en) |
AU (2) | AU2000240366B2 (en) |
CA (1) | CA2400573A1 (en) |
WO (1) | WO2001072765A1 (en) |
Cited By (32)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP2006519610A (en) * | 2003-03-12 | 2006-08-31 | バスジーン セラピューティクス, インコーポレイテッド | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
JP2006522586A (en) * | 2002-11-13 | 2006-10-05 | アイシス ファーマシューティカルズ インコーポレイテッド | Antisense regulation of apolipoprotein B expression |
JP2010193894A (en) * | 2002-11-13 | 2010-09-09 | Isis Parmaceuticals Inc | Antisense modulation of apolipoprotein b expression |
JP2010207232A (en) * | 2004-01-20 | 2010-09-24 | Isis Parmaceuticals Inc | Modulation of glucocorticoid receptor expression |
US7888012B2 (en) | 2005-02-09 | 2011-02-15 | Avi Biopharma, Inc. | Antisense composition and method for treating muscle atrophy |
US7989608B2 (en) | 2007-12-28 | 2011-08-02 | Avi Biopharma Inc. | Immunomodulatory agents and methods of use |
US8008469B2 (en) | 2003-10-23 | 2011-08-30 | Avi Biopharma Inc. | Antisense compound for inducing immunological tolerance |
US8067569B2 (en) | 2000-05-04 | 2011-11-29 | Avi Biopharma, Inc. | Splice-region antisense composition and method |
US8415313B2 (en) | 2004-01-23 | 2013-04-09 | Avi Biopharma, Inc. | Antisense oligomers and methods for inducing immune tolerance and immunosuppression |
US8592386B2 (en) | 2008-12-17 | 2013-11-26 | Sarepta Therapeutics, Inc. | Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis |
USRE44760E1 (en) | 2002-11-13 | 2014-02-11 | Genzyme Corporation | Antisense modulation of apolipoprotein B-expression |
US8673871B2 (en) | 2006-05-05 | 2014-03-18 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression ApoB |
US8735364B2 (en) | 2001-08-01 | 2014-05-27 | Genzyme Corporation | Antisense modulation of apolipoprotein B expression |
US8916694B2 (en) | 2004-05-05 | 2014-12-23 | Genzyme Corporation | SNPs of apolipoprotein B and modulation of their expression |
US9018368B2 (en) | 2004-06-28 | 2015-04-28 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9107933B2 (en) | 2009-03-16 | 2015-08-18 | Isis Pharmaceuticals, Inc. | Compositions and methods of targeting apolipoprotein B for the reduction of apolipoprotein C-III |
US9217148B2 (en) | 2013-03-14 | 2015-12-22 | Sarepta Therapeutics, Inc. | Exon skipping compositions for treating muscular dystrophy |
US9228187B2 (en) | 2009-11-12 | 2016-01-05 | The University Of Western Australia | Antisense molecules and methods for treating pathologies |
US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
US9234198B1 (en) | 2008-10-24 | 2016-01-12 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US9347061B2 (en) | 2007-03-24 | 2016-05-24 | Genzyme Corporation | Administering antisense oligonucleotides complementary to human apolipoprotein B |
US9506058B2 (en) | 2013-03-15 | 2016-11-29 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
US9683235B2 (en) | 2013-07-19 | 2017-06-20 | Ionis Pharmaceuticals, Inc. | Compositions for modulating Tau expression |
US9918716B2 (en) | 2012-03-28 | 2018-03-20 | Ethicon Llc | Staple cartridge comprising implantable layers |
US10059941B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US10106795B2 (en) | 2011-10-04 | 2018-10-23 | Royal Holloway And Bedford New College | Oligomers |
US10174328B2 (en) | 2013-10-04 | 2019-01-08 | Translate Bio Ma, Inc. | Compositions and methods for treating amyotrophic lateral sclerosis |
US10273474B2 (en) | 2012-03-30 | 2019-04-30 | Washington University | Methods for modulating Tau expression for reducing seizure and modifying a neurodegenerative syndrome |
US10407680B2 (en) | 2016-09-29 | 2019-09-10 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing Tau expression |
US10655128B2 (en) | 2012-05-16 | 2020-05-19 | Translate Bio Ma, Inc. | Compositions and methods for modulating MECP2 expression |
US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US11015200B2 (en) | 2015-03-18 | 2021-05-25 | Sarepta Therapeutics, Inc. | Antisense-induced exon exclusion in myostatin |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
MX2015012621A (en) * | 2013-03-14 | 2016-05-31 | Ionis Pharmaceuticals Inc | Compositions and methods for modulating tau expression. |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993004701A1 (en) * | 1991-09-05 | 1993-03-18 | University Of Connecticut | Targeted delivery of poly- or oligonucleotides to cells |
WO1996040266A1 (en) * | 1995-06-07 | 1996-12-19 | East Carolina University | Method of treatment for asthma |
US5627274A (en) * | 1993-05-11 | 1997-05-06 | The University Of North Carolina At Chapel Hill | Antisense oligonucleotides which combat aberrant splicing and methods of using the same |
US5776905A (en) * | 1996-08-08 | 1998-07-07 | The Board Of Trustees Of The Leland Stamford Junior University | Apoptotic regression of intimal vascular lesions |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6043352A (en) * | 1998-08-07 | 2000-03-28 | Isis Pharmaceuticals, Inc. | 2'-O-Dimethylaminoethyloxyethyl-modified oligonucleotides |
US6214986B1 (en) * | 1998-10-07 | 2001-04-10 | Isis Pharmaceuticals, Inc. | Antisense modulation of bcl-x expression |
-
2000
- 2000-03-28 JP JP2001571696A patent/JP2004509604A/en active Pending
- 2000-03-28 AU AU2000240366A patent/AU2000240366B2/en not_active Expired
- 2000-03-28 EP EP00919726A patent/EP1263765A4/en not_active Withdrawn
- 2000-03-28 CA CA002400573A patent/CA2400573A1/en not_active Abandoned
- 2000-03-28 AU AU4036600A patent/AU4036600A/en active Pending
- 2000-03-28 WO PCT/US2000/008174 patent/WO2001072765A1/en active IP Right Grant
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1993004701A1 (en) * | 1991-09-05 | 1993-03-18 | University Of Connecticut | Targeted delivery of poly- or oligonucleotides to cells |
US5627274A (en) * | 1993-05-11 | 1997-05-06 | The University Of North Carolina At Chapel Hill | Antisense oligonucleotides which combat aberrant splicing and methods of using the same |
WO1996040266A1 (en) * | 1995-06-07 | 1996-12-19 | East Carolina University | Method of treatment for asthma |
US5776905A (en) * | 1996-08-08 | 1998-07-07 | The Board Of Trustees Of The Leland Stamford Junior University | Apoptotic regression of intimal vascular lesions |
Non-Patent Citations (3)
Title |
---|
HODGES ET. AL.: "Inhibition of Splicing of Wild-type and Mutated Luciferase-Adenovirus Pre-mRNAs by Antisense Oligonucleotides", MOLECULAR PHARMACOLOGY, vol. 48, 1995, pages 905 - 918, XP002929709 * |
MOULDS ET. AL.: "Site and Mechanism of Antisense Inhibition by C-5 Propyne Oligonucleotides", BIOCHEMISTRY, vol. 34, no. 15, March 1995 (1995-03-01), pages 5044 - 5053, XP002929710 * |
See also references of EP1263765A4 * |
Cited By (81)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US8067569B2 (en) | 2000-05-04 | 2011-11-29 | Avi Biopharma, Inc. | Splice-region antisense composition and method |
US8436163B2 (en) | 2000-05-04 | 2013-05-07 | Avi Biopharma, Inc. | Splice-region antisense composition and method |
US8895722B2 (en) | 2000-05-04 | 2014-11-25 | Sarepta Therapeutics, Inc. | Splice-region antisense composition and method |
US10533174B2 (en) | 2000-05-04 | 2020-01-14 | Sarepta Therapeutics, Inc. | Splice-region antisense composition and method |
US9416361B2 (en) | 2000-05-04 | 2016-08-16 | Sarepta Therapeutics, Inc. | Splice-region antisense composition and method |
US8735364B2 (en) | 2001-08-01 | 2014-05-27 | Genzyme Corporation | Antisense modulation of apolipoprotein B expression |
USRE44760E1 (en) | 2002-11-13 | 2014-02-11 | Genzyme Corporation | Antisense modulation of apolipoprotein B-expression |
JP2010193894A (en) * | 2002-11-13 | 2010-09-09 | Isis Parmaceuticals Inc | Antisense modulation of apolipoprotein b expression |
JP2017176193A (en) * | 2002-11-13 | 2017-10-05 | ジェンザイム・コーポレーション | Antisense modulation of apolipoprotein b expression |
JP2006522586A (en) * | 2002-11-13 | 2006-10-05 | アイシス ファーマシューティカルズ インコーポレイテッド | Antisense regulation of apolipoprotein B expression |
JP2014087368A (en) * | 2002-11-13 | 2014-05-15 | Genzyme Corp | Antisense modulation of apolipoprotein b expression |
JP2013066488A (en) * | 2002-11-13 | 2013-04-18 | Genzyme Corp | Antisense modulation of apolipoprotein b expression |
JP4762889B2 (en) * | 2003-03-12 | 2011-08-31 | バスジーン セラピューティクス,インコーポレイテッド | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
JP2006519610A (en) * | 2003-03-12 | 2006-08-31 | バスジーン セラピューティクス, インコーポレイテッド | Nucleic acid compounds for inhibiting angiogenesis and tumor growth |
US8008469B2 (en) | 2003-10-23 | 2011-08-30 | Avi Biopharma Inc. | Antisense compound for inducing immunological tolerance |
JP2010207232A (en) * | 2004-01-20 | 2010-09-24 | Isis Parmaceuticals Inc | Modulation of glucocorticoid receptor expression |
US8415313B2 (en) | 2004-01-23 | 2013-04-09 | Avi Biopharma, Inc. | Antisense oligomers and methods for inducing immune tolerance and immunosuppression |
US8916694B2 (en) | 2004-05-05 | 2014-12-23 | Genzyme Corporation | SNPs of apolipoprotein B and modulation of their expression |
USRE47751E1 (en) | 2004-06-28 | 2019-12-03 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9249416B2 (en) | 2004-06-28 | 2016-02-02 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9018368B2 (en) | 2004-06-28 | 2015-04-28 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9024007B2 (en) | 2004-06-28 | 2015-05-05 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9035040B2 (en) | 2004-06-28 | 2015-05-19 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
USRE47691E1 (en) | 2004-06-28 | 2019-11-05 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9175286B2 (en) | 2004-06-28 | 2015-11-03 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9605262B2 (en) | 2004-06-28 | 2017-03-28 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
USRE47769E1 (en) | 2004-06-28 | 2019-12-17 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10995337B2 (en) | 2004-06-28 | 2021-05-04 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10421966B2 (en) | 2004-06-28 | 2019-09-24 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10781451B2 (en) | 2004-06-28 | 2020-09-22 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10968450B2 (en) | 2004-06-28 | 2021-04-06 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9994851B2 (en) | 2004-06-28 | 2018-06-12 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9422555B2 (en) | 2004-06-28 | 2016-08-23 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10266827B2 (en) | 2004-06-28 | 2019-04-23 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9441229B2 (en) | 2004-06-28 | 2016-09-13 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US9447415B2 (en) | 2004-06-28 | 2016-09-20 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US10227590B2 (en) | 2004-06-28 | 2019-03-12 | The University Of Western Australia | Antisense oligonucleotides for inducing exon skipping and methods of use thereof |
US7888012B2 (en) | 2005-02-09 | 2011-02-15 | Avi Biopharma, Inc. | Antisense composition and method for treating muscle atrophy |
US8785410B2 (en) | 2005-02-09 | 2014-07-22 | Sarepta Therapeutics, Inc. | Antisense composition and method for treating muscle atrophy |
US10626396B2 (en) | 2005-02-09 | 2020-04-21 | Sarepta Therapeutics, Inc. | Antisense composition and method for treating muscle atrophy |
US10006031B2 (en) | 2005-02-09 | 2018-06-26 | Sarepta Therapeutics, Inc. | Antisense composition and method for treating muscle atrophy |
US8673871B2 (en) | 2006-05-05 | 2014-03-18 | Isis Pharmaceuticals, Inc. | Compounds and methods for modulating expression ApoB |
US9347061B2 (en) | 2007-03-24 | 2016-05-24 | Genzyme Corporation | Administering antisense oligonucleotides complementary to human apolipoprotein B |
US7989608B2 (en) | 2007-12-28 | 2011-08-02 | Avi Biopharma Inc. | Immunomodulatory agents and methods of use |
US9234198B1 (en) | 2008-10-24 | 2016-01-12 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US9453225B2 (en) | 2008-10-24 | 2016-09-27 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US9447416B2 (en) | 2008-10-24 | 2016-09-20 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US9447417B2 (en) | 2008-10-24 | 2016-09-20 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US9434948B2 (en) | 2008-10-24 | 2016-09-06 | Sarepta Therapeutics, Inc. | Multiple exon skipping compositions for DMD |
US8592386B2 (en) | 2008-12-17 | 2013-11-26 | Sarepta Therapeutics, Inc. | Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis |
US9107933B2 (en) | 2009-03-16 | 2015-08-18 | Isis Pharmaceuticals, Inc. | Compositions and methods of targeting apolipoprotein B for the reduction of apolipoprotein C-III |
US10781450B2 (en) | 2009-11-12 | 2020-09-22 | Sarepta Therapeutics, Inc. | Antisense molecules and methods for treating pathologies |
US9758783B2 (en) | 2009-11-12 | 2017-09-12 | The University Of Western Australia | Antisense molecules and methods for treating pathologies |
US9228187B2 (en) | 2009-11-12 | 2016-01-05 | The University Of Western Australia | Antisense molecules and methods for treating pathologies |
US10287586B2 (en) | 2009-11-12 | 2019-05-14 | The University Of Western Australia | Antisense molecules and methods for treating pathologies |
US11447776B2 (en) | 2009-11-12 | 2022-09-20 | The University Of Western Australia | Antisense molecules and methods for treating pathologies |
US10106795B2 (en) | 2011-10-04 | 2018-10-23 | Royal Holloway And Bedford New College | Oligomers |
US10662431B2 (en) | 2011-10-04 | 2020-05-26 | Royal Holloway And Bedford New College | Oligomers |
US10947536B2 (en) | 2011-10-04 | 2021-03-16 | Royal Holloway And Bedford New College | Oligomers |
US10421969B2 (en) | 2011-10-04 | 2019-09-24 | Royal Holloway And Bedford New College | Oligomers |
US9918716B2 (en) | 2012-03-28 | 2018-03-20 | Ethicon Llc | Staple cartridge comprising implantable layers |
US11781135B2 (en) | 2012-03-30 | 2023-10-10 | Washington University | Methods for treating Alzheimer's disease |
US10273474B2 (en) | 2012-03-30 | 2019-04-30 | Washington University | Methods for modulating Tau expression for reducing seizure and modifying a neurodegenerative syndrome |
US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US10059941B2 (en) | 2012-05-16 | 2018-08-28 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
US11788089B2 (en) | 2012-05-16 | 2023-10-17 | The General Hospital Corporation | Compositions and methods for modulating MECP2 expression |
US10655128B2 (en) | 2012-05-16 | 2020-05-19 | Translate Bio Ma, Inc. | Compositions and methods for modulating MECP2 expression |
US10907154B2 (en) | 2013-03-14 | 2021-02-02 | Sarepta Therapeutics, Inc. | Exon skipping compositions for treating muscular dystrophy |
US11932851B2 (en) | 2013-03-14 | 2024-03-19 | Sarepta Therapeutics, Inc. | Exon skipping compositions for treating muscular dystrophy |
US9217148B2 (en) | 2013-03-14 | 2015-12-22 | Sarepta Therapeutics, Inc. | Exon skipping compositions for treating muscular dystrophy |
US9506058B2 (en) | 2013-03-15 | 2016-11-29 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
US10364431B2 (en) | 2013-03-15 | 2019-07-30 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
US10337003B2 (en) | 2013-03-15 | 2019-07-02 | Sarepta Therapeutics, Inc. | Compositions for treating muscular dystrophy |
US9227956B2 (en) | 2013-04-17 | 2016-01-05 | Pfizer Inc. | Substituted amide compounds |
US10793856B2 (en) | 2013-07-19 | 2020-10-06 | Biogen Ma Inc. | Compositions for modulating Tau expression |
US11591595B2 (en) | 2013-07-19 | 2023-02-28 | Biogen Ma Inc. | Compositions for modulating Tau expression |
US9683235B2 (en) | 2013-07-19 | 2017-06-20 | Ionis Pharmaceuticals, Inc. | Compositions for modulating Tau expression |
US10174328B2 (en) | 2013-10-04 | 2019-01-08 | Translate Bio Ma, Inc. | Compositions and methods for treating amyotrophic lateral sclerosis |
US11015200B2 (en) | 2015-03-18 | 2021-05-25 | Sarepta Therapeutics, Inc. | Antisense-induced exon exclusion in myostatin |
US11053498B2 (en) | 2016-09-29 | 2021-07-06 | Biogen Ma Inc. | Compounds and methods for reducing Tau expression |
US10407680B2 (en) | 2016-09-29 | 2019-09-10 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing Tau expression |
Also Published As
Publication number | Publication date |
---|---|
AU4036600A (en) | 2001-10-08 |
JP2004509604A (en) | 2004-04-02 |
EP1263765A4 (en) | 2005-06-29 |
EP1263765A1 (en) | 2002-12-11 |
CA2400573A1 (en) | 2001-10-04 |
AU2000240366B2 (en) | 2005-08-04 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6210892B1 (en) | Alteration of cellular behavior by antisense modulation of mRNA processing | |
AU2000240366B2 (en) | Alteration of cellular behavior by antisense modulation of mRNA processing | |
EP1325019B1 (en) | Antisense modulation of clusterin expression | |
US20020049173A1 (en) | Alteration of cellular behavior by antisense modulation of mRNA processing | |
AU2000240366A1 (en) | Alteration of cellular behavior by antisense modulation of mRNA processing | |
WO2000061599A1 (en) | Antisense modulation of microtubule-associated protein 4 expression | |
AU6952800A (en) | Antisense modulation of pi3k p85 expression | |
WO2000050583A1 (en) | Antisense modulation of g-alpha-12 expression | |
WO2000061601A1 (en) | ANTISENSE MODULATION OF G-ALPHA-i1 EXPRESSION | |
WO2001006018A1 (en) | Antisense modulation of map kinase kinase 6 expression | |
WO2000032817A1 (en) | Antisense modulation of g-alpha-16 expression | |
WO2000033889A1 (en) | Antisense modulation of g-alpha-13 expression | |
EP1131465A1 (en) | Antisense modulation of interleukin-15 expression | |
AU2382200A (en) | Antisense modulation of ship-2 expression | |
WO2000050092A1 (en) | Antisense modulation of smad1 expression | |
WO2000031111A1 (en) | Antisense modulation of nf-kappa-b p65 subunit expression | |
WO2000034301A1 (en) | Antisense modulation of g-alpha-11 expression | |
US5962673A (en) | Antisense modulation of inhibitor-kappa B kinase-alpha expression | |
EP1131332A1 (en) | Antisense modulation of inhibitor-kappa b kinase-beta expression | |
WO2001029175A2 (en) | Antisense modulation of fra-1 expression | |
AU753245C (en) | Antisense modulation of Cellular Inhibitor of Apoptosis-1 expression | |
AU6260499A (en) | Antisense modulation of cellular inhibitor of apoptosis-2 expression | |
EP1165145A1 (en) | Antisense modulation of mdmx expression | |
WO2001000861A1 (en) | Antisense modulation of g-alpha-s1 expression | |
WO2000050438A1 (en) | Antisense modulation of phospholipase a2 group iv expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2400573 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000919726 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref country code: JP Ref document number: 2001 571696 Kind code of ref document: A Format of ref document f/p: F |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2000240366 Country of ref document: AU |
|
WWP | Wipo information: published in national office |
Ref document number: 2000919726 Country of ref document: EP |
|
WWW | Wipo information: withdrawn in national office |
Ref document number: 2000919726 Country of ref document: EP |
|
WWG | Wipo information: grant in national office |
Ref document number: 2000240366 Country of ref document: AU |