WO2001070962A1 - A novel polypeptide, a human plasminogen activator inhibitor 10 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human plasminogen activator inhibitor 10, the polynucleotide encoding the polypeptide and the method for producing the plypetide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as hemorrhagic illness, thrombopoies, cerebral, infarction, myocardial infarction, various tumour, inflammation, inflammatory repair abnormality relative illness, embryonic development disorder, hemopathy, HIV infection, etc. The invention also discloses the agonists against the polyptide and the therapeutic action tereof. The invention also discloses the uses of the polynucleotide encoding the novel human plasminogen activator inhibitor 10.

Description

 Human plasminogen activator inhibitor 10 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, a human plasminogen activator inhibitor 10, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique

 Plasminogen activator inhibitor 2 is a serine protease inhibitor, which regulates the formation of plasmin by inhibiting the action of urokinase and tissue plasminogen active in vivo. Similar to other serine proteolytic enzyme inhibitors, plasminogen activator inhibitor 2 is combined with corresponding serine proteolytic enzymes at a ratio of 1: 1 to form an inactive proteolytic enzyme complex to inhibit proteolysis Enzyme activity in vivo [Richard D. Ye, Shawn M. Ahern et al., 1989, J Biol Chem, 264: 5495-5502].

 Plasminogen is a common serine proteolytic enzyme that participates in many different physiological processes in the body, including plasminogen activator, tissue remodeling, inflammatory response, and tumor metastasis. 2 By regulating the formation of plasminogen, it is involved in regulating various important physiological processes mentioned above. In vivo, plasminogen activator inhibitor 2 is usually stimulated by the endotoxin of peripheral blood single cells and tumor cells to stimulate its expression and synthesis. Abnormal expression of plasminogen activator inhibitor 1 will usually lead to abnormal expression of the corresponding plasminogen in the organism, thereby affecting the abnormalities of various physiological processes related to it as described above.

 Studies have found that plasminogen activator inhibitor 2 is very similar to chicken's ovalbumin, both of which are secreted in the body without the presence of a signal peptide, and both are highly expressed in the womb during conception. The structure and biological activity are similar, and it is believed that there is a certain correlation between the two in evolution. In 1987, Ye et al. Cloned a plasminogen activator inhibitor 2 protein from humans. The amino acid sequence contains three potential N-glycosylation sites, and its 380-arginine residue site and 381-threonine residue site are a typical serine protease inhibitory center [Ye RD, Ahem SM et al., 1989, J Biol Chem., 264: 5495-502]. The expression of this protein in the body is regulated by a variety of cytokines, hormones and phorbol esters.

From the above, it can be seen that plasminogen activator inhibitors regulate the activities of various related plasminogen proteins in the body, and plasminogen participates in many important physiological processes in the body, such as cell tissue reconstruction Various inflammatory reactions and metastasis of tumor cells. Plasminogen activator inhibitor in organism It is involved in regulating the occurrence of various related processes by regulating the formation of plasminogen protein. Abnormal expression of this protein will lead to abnormal expression of plasminogen, and then affect the occurrence of a series of related physiological processes. . The protein is usually closely related to the occurrence of various related inflammatory reactions, tumors and cancers of related tissues, and disorders of embryonic development.

 Gene chip analysis revealed that in the thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv 304 cell line, PMA-Ecv 304 cell line, starved L 02 cell line, arsenic stimulation 1 L 02 cell line for 1 hour, L 02 cell line stimulated for 6 hours for prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, fetus In the lungs and fetal heart, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human plasminogen activator inhibitor 2, so their functions may also be similar. The invention is named human plasminogen activator inhibitor 10.

 As described above, the human plasminogen activator inhibitor 10 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More human plasminogen activator inhibitor 10 proteins involved in these processes, especially the amino acid sequence of this protein was identified. Isolation of the new human plasminogen activator inhibitor 10 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA.

 It is an object of the present invention to provide isolated novel polypeptides-human plasminogen activator inhibitor 10 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human plasminogen activator inhibitor 10.

 Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human plasminogen activator inhibitor 10.

 Another object of the present invention is to provide a method for producing a human plasminogen activator inhibitor 10.

 Another object of the present invention is to provide an antibody against the polypeptide-human plasminogen activator inhibitor 10 of the present invention.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors directed to the polypeptide of the present invention-human plasminogen activator inhibitor 10.

 Another object of the present invention is to provide a method for diagnosing and treating a disease associated with a human plasminogen activator inhibitor 10 abnormality.

The present invention relates to an isolated polypeptide. The polypeptide is of human origin and comprises: SEQ ID No. 2 Amino acid sequence of a polypeptide, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID D. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 504-785 in SEQ ID NO: 1; and (b) having a sequence of 1-201 in SEQ ID NO: 1 A 2-bit sequence.

 The invention further relates to a vector, in particular an expression vector, containing a polynucleotide of the invention: a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell: a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human plasminogen activator inhibitor 10 protein, which comprises using the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of a human plasminogen activator inhibitor 10 protein, which comprises detecting a polypeptide in a biological sample or its coding polynucleotide sequence. Mutates, or detects the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of hemorrhagic diseases, thrombosis, cerebral infarction, myocardial infarction, various tumors, inflammation, diseases related to inflammatory repair abnormalities, embryonic developmental disorders, blood Disease, HIV infection, or other medicaments for diseases caused by abnormalities in human plasminogen activator inhibitor 10.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, which can be single-stranded or double-stranded, and represent the sense strand or antisense. Similarly, the term "amino acid sequence" refers to oligopeptides, peptides, polypeptides, or protein sequences and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule When listed, such a "polypeptide" or "protein" is not meant to limit the amino acid sequence to the complete natural amino acid associated with the protein molecule.

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with a human plasminogen activator inhibitor 10, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind a human plasminogen activator inhibitor 10.

 "Antagonist" or "inhibitor" refers to a biological activity or immunity that can block or modulate human plasminogen activator inhibitor 10 when combined with human plasminogen activator inhibitor 10 Science active child. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to human plasminogen activator inhibitor 10.

 "Regulation" refers to a change in the function of human plasminogen activator inhibitor 10, including an increase or decrease in protein activity, a change in binding characteristics, and any other organism of human plasminogen activator inhibitor 10 Changes in nature, function, or immunity.

"Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human plasminogen activator inhibition using standard protein purification techniques agent _10,: a substantially purified human plasminogen activator inhibitor 10 can produce a single major band on a non-reducing polyacrylamide gel purity human plasminogen activator inhibitor 10 polypeptide. Available amino acid sequence analysis.

"Complementary" or "complementary" refers to the natural binding of a paired polynucleotide through bases under conditions of acceptable salt concentration and temperature. For example, the sequence "CTGA" can be combined with the complementary sequence "GACT": the complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands 1

The efficiency and strength of hybridization between nucleic acid strands has a significant effect.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern imprinting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percentage identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods, such as the Cluster method (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). _{0 The} Cluster method arranges groups of sequences by checking the distance between all pairs. Into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A The number of spacer residues in a sequence B can also be determined by the Cluster method or using methods known in the art such as Jotun He in. The percent identity between nucleic acid sequences (Hein J., (1990) Methods in emzumology 183: 625-645) .

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

"Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules. "Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitope of human plasminogen activator inhibitor 10.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it was produced naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living organism, but the same polynucleotide or polypeptide is isolated when it is separated from some or all of the substances that coexist in the natural system. Such a polynucleotide may be part of a vector-or it may be such a polynucleotide or polypeptide that is part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not separated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state.

 As used herein, "isolated human plasminogen activator inhibitor 10" means that human plasminogen activator inhibitor 10 is substantially free of other proteins, lipids, sugars, or other substances naturally associated with it. Those skilled in the art can purify human plasminogen activator inhibitor 10 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human plasminogen activator inhibitor 10 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide-a human plasminogen activator inhibitor 10, which is basically 3

Consisting of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polysaccharide, a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptide of the present invention may be a naturally purified product or a chemically synthesized product, or may be produced from a prokaryotic or eukaryotic host (for example, bacteria, yeast, higher plants, Kun S, and mammalian cells) using recombinant technology. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The present invention also includes fragments, derivatives, and analogs of human plasminogen activator inhibitor 10. As used in the present invention, the terms "fragment", "derivative", and "analog" mean substantially maintaining the present invention Human plasminogen activator inhibitor 10 has the same biological function or activity as a polypeptide. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by the genetic code; or (Π) such a A group on one or more amino acid residues is substituted by other groups and contains substituents; or (π ι) such a mature peptide and another compound (such as a compound that extends the half-life of a polypeptide, such as polyethylene Diol) fusion; or (IV) a polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusing additional amino acid sequences into a mature polypeptide It is stated that such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2012 bases in total length, and its open reading frames 504-785 encode 93 amino acids. According to the comparison of gene chip expression profiles, it was found that this polypeptide has a similar expression profile to human plasminogen activator inhibitor 2, and it can be inferred that the human plasminogen activator inhibitor 1 0 has human plasminogen activator. Inhibitor 1 functions similarly.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide J '; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences) ) And non-coding sequences.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to the present invention under strict conditions. The polynucleotide is a polynucleotide that can hybridize. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS. 60 ° C; or (2) hybridization When adding denaturants, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42 ° C, etc .; or (3) only the identity between the two sequences Hybridization occurs at least 95%, more preferably 97%, and the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding human plasminogen activator inhibitor 10.-, The polypeptides and polynucleotides of the present invention are preferably isolated The specific polynucleotide sequence encoding the human plasminogen activator inhibitor 10 of the present invention can be obtained in a variety of ways and is more preferably purified to homogeneity. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDN.A libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the transcript of human plasminogen activator inhibitor 10 Level; (4) detecting protein products of gene expression by immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleosides Acid, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The gene itself or the fragment of the present invention can of course be used as a probe, and the DNA probe can be labeled with a radioisotope, luciferin, or an enzyme (such as alkaline phosphatase).

 In the (4) method, the protein product of human plasminogen activator inhibitor 10 gene expression can be detected by immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method using PCR technology to amplify DNA / RM (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) may be preferably used. The primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Polynucleotide sequence determination can also be performed using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human plasminogen activator inhibitor 10 coding sequence, and to produce the present invention by recombinant technology Said method of polypeptide.

 In the present invention, a polynucleotide sequence encoding the human plasminogen activator inhibitor 10 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human plasminogen activator inhibitor 10 and appropriate transcription / translation regulatory elements. These methods include in vitro weight Group DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989), the DNA sequence can be effectively ligated into an appropriate expression vector Promoter to direct niRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a human plasminogen activator inhibitor 10 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector. Host cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after exponential growth and treated with CaCl. The procedures used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

The polynucleotide sequence of the present invention can be used to express or produce recombinant human plasminogen activator inhibitor 10 by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally, the following steps are taken: (1) Use the polynucleotide (or variant) encoding human human plasminogen activator inhibitor 10 of the present invention, or transform or transduce a suitable host cell with a recombinant expression vector containing the polynucleotide:

 (2) cultivating the host cell in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These parties include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

FIG. 1 is a comparison diagram of gene chip expression profiles of human plasminogen activator inhibitor 10 and human plasminogen activator inhibitor 2 of the present invention. The upper graph is a compromise of the expression profile of human plasminogen activator inhibitor 1 0! 3, and the lower graph is the compromised expression profile of human plasminogen activator inhibitor 2. Among them, 1 indicates fetal kidney, 2 indicates fetal large intestine, 3 indicates fetal small intestine, 4 indicates fetal muscle, 5 indicates fetal brain, 6 indicates fetal bladder, 7 indicates starvation L 02-8 indicates L02 +, lhr, As ³⁺ , 9 means ECV304 PMA-, 1 means ECV304 PMA +, 1 means fetal liver, 12 means normal liver, 13 means thyroid, 14 means skin, 15 means fetal lung, 16 means lung, 17 means lung cancer, 18 means fetal spleen, 19 is the spleen, 20 is the prostate, 21 is the fetal heart, 22 is the heart, 23 is the muscle, 24 is the testis, 25 is the fetal thymus, and 26 is the thymus.

 Figure 2 shows a polyacrylamide gel electrophoresis 23 (SDS-PAGE) of human plasminogen activator inhibitor 10 isolated. OKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods to indicate specific conditions in the following examples The method is usually in accordance with conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

 Example 1: Cloning of human plasminogen activator inhibitor 10

 Total RNA from human fetal brain was extracted by guanidine isothiocyanate / phenol / chloroform method. Using Quik mRNA Isolation Kit

(Qiegene company product) Poly (A) mRNA was isolated from total RNA, 2ug poly (A) mRNA was reverse transcribed to form cDNA. The Smar t cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clomech) to transform DH5a. The bacteria were used to form a cDNA library. The kit (Perkin-Elraer) and the ABI 377 automatic sequencer (Perkin-Elmer) determined the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0456d01 was new DNA. A series of primers were synthesized to perform bidirectional determination of the inserted cDNA sheet β contained in the clone. The results show that the full-length cDNA contained in the 0456d01 clone is 2012bp (as shown in Seq ID NO: 1), and there is a 282bp open reading frame (0RF) from 504bp to 785bp, which encodes a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS 0456d01, and the encoded protein was named human plasminogen activator inhibitor 10. Example 2: Cloning of a gene encoding human plasminogen activator inhibitor 10 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer for reverse transcription reaction. After purification using Qiagene's kit, the following primers were used for PCR amplification:

 Prinierl: 5'- GCCGAGCTTATGCCACTGCACTCC -3 '(SEQ ID NO: 3)

 Primer2: 5'- TTTTCAGAACACTTTAGTAATTTT -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

 Amplification conditions: 50 mmol / L KC1 in a 50 μl reaction volume, 10 μl / L Tris-

Cl, (pH 8.5), 1.5 legs ol / L MgCl · ₂ , 200 μmol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (product of Ciontech). Reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2rain ₀ At the same time, RT-PCR set β-act in as positive Controls and template blanks are negative controls. The amplified product was purified using a QIAGEN kit and ligated to a PCR vector using a TA cloning kit (Invitrogen product). The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as the 1-2012bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human plasminogen activator inhibitor 10 gene expression: Total RNA extraction using a one-shot method [Anal. Biochera 1987, 162, 156-159] ₀ This method includes acid guanidinium thiocyanate -Chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25 mM sodium citrate, 0.2M sodium acetate _(. Ρ Η4 ϋ) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. Using 20 g RNA, 1.2 ^a / in 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5raM sodium acetate-1 mM EDTA-2.2M formaldehyde. Electrophoresis was performed on an agarose gel and then transferred to a nitrocellulose membrane. Preparation cc- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human plasminogen activator inhibitor 10 coding region sequence (504bp to 785bp) shown in FIG. 1. A 32P-labeled probe (about 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM KH ₂ P0 ₄ (pH 7.4) -5 x SSC-5 x Denhardt's solution and 200 μg / ml salmon sperm DNA. After hybridization, filter was placed in 1><SSC-0.1% SDS at 55. C for 30 min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human plasminogen activator inhibitor 10

 According to SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers was designed, the sequence is as follows:

 Primer3: 5'- CCCCATATGATGGAGCAAATCCCAGTTCTTGTC -3, (Seq ID No: 5)

Primer4: 5'- CCCGAATTCCTAGTGCCACTTTCTCTTAGTTTC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5' and 3 'ends of the target gene, respectively. The Ndel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865. 3). PCR was performed using the pBS-0456d01 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: 10 pg of pBS-0456d01 plasmid, Primer-3, and Primer-4 were included in a total volume of 50 μl; j was lOpmol, Advantage polymerase Mix (Ciontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and EcoRI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into coliform bacteria DH5 CC using the calcium chloride method. After being cultured overnight in LB plates containing kanamycin (final concentration 30 μg / ml), positive clones were selected by colony PCR method and sequenced. Selected positive clones with the correct sequence _(P ET-0456d01) the recombinant plasmid by the calcium chloride method to transform E. coli BL21 (DE3) plySs (Novagen Co.). In a LB liquid medium containing kanamycin (final concentration 30 μg / nil), the host bacteria BL21 (pET-0456d01) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 leg ol / L. Continue incubation for 5 hours. Collect the bacterial cells by centrifugation, break the bacteria by ultrasonic, and collect the supernatant by centrifugation. Chromatography was performed using an affinity chromatography column Hi s. Bind Quick Car tr idge (product of Novagen) capable of binding to 6 histidines (6H s-Tag) to obtain purified human plasmin. Pro-activator inhibitor 10 _. After SDS-PAGE electrophoresis, a single band was obtained at 1 OKDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human plasminogen activator inhibitor 10 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human plasminogen activator inhibitor 10-specific 'I "peptides:

 NH2-Met-G 1 u-Gln-I le-Pro-Va 1-Leu-Vabu Leu- G In- A 1 a- Asp- Cy s- A 1 a- 1 1 e-C00H

(SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemi s try, 1969; 6:43. Rabbits were immunized with 4 mg of the hemocyanin peptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin peptide complex plus incomplete Freund's column was used to boost immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used for ELI SA to determine the titer of antibody in serum-free. With Protein A- Sepharose isolated from antibody-positive sera in rabbits with total I _{g G;} polypeptide bound to cyanogen bromide activated Sepharose4B column, separated from the total IgG anti-affinity chromatography using the multi-tie antibodies. The immunoprecipitation method proved that the purified antibody can specifically bind to human plasminogen activator inhibitor 10: Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 The selection of suitable oligonucleotide fragments from the polynucleotides of the present invention for use as hybridization probes has a variety of uses. For example, the probes can be used with genomic or cDNA libraries of normal or pathological tissues from different sources. In order to identify whether it contains the polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe is further used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissues. Or whether the expression in pathological tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods. They all use the same stepwise hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: First, the sample-immobilized filter is first; ί The probe-free hybridization buffer is pre-hybridized so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washes. Off. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred size of the probe is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID D NO: 1 (41Nt):

 5'- TGGAGCAAATCCCAGTTCTTGTCCTACAAGCTGATTGTGCG -3 '(SEQ I D NO: 8)

 Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5'- TGGAGCAAATCCCAGTTCTTCTCCTACAAGCTGATTGTGCG -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DNA PROBES GH Ke ll er; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used manuals of molecular cloning experiments such as "Molecular Cloning Experiment Guide" U 998 Second Edition) [US] Sambrook et al., Science Press.

 Sample Preparation:

1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2 ) The tissue was minced at 1000 g for 10 minutes. 3) Use cold homogenization buffer (0.25raol / L sucrose; 25wol / L Tris-HCl, pH7.5; 25mmol / LnaCl; 25mniol / L MgCl ₂ ) to suspend the precipitate (about 10ml / g). 4) in 4. C Use an electric homogenizer to homogenize the tissue suspension at full speed until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add 1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 1) Resuspend the pelleted cells with cold cell lysate (1 x 10 ⁸ cells / ml). Use a minimum of 100ul lysis buffer. 3) Add SI) S to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes . The two should be clearly separated, otherwise centrifuge again. 7) Transfer the aqueous phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. The DNA was then purified and ethanol precipitated.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 ^D C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or pipette with suction while gradually increasing TE, mix until the DNA is fully dissolved, every 1-5 X 10. Approximately lul was extracted from the cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 1)) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volume of cold ethanol, mix and set-20 ° C 'for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. Step. 14) Measure A ₂₆ . And A _2S . To detect the purity and yield of DNA. 15) Preparation of -20 "_t't sample film after packing:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 raol / L NaCl Allow to dry for 5 minutes (twice).

 4) Caught in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3 μl Probe (0. IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2! 'Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) were collected after the first peak were combined as the Probe (second peak to prepare the desired free γ- "Ρ- dATP) ₀

 Pre-hybridization

 Place the sample film in a plastic bag, add 3-10 mg of prehybridization solution (10xDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, and shake at 68 ° C for 2 hours in a water bath .

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight.

 Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (press time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 7 DNA Microarray

 Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, see the references DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. Schema, M., Cha i, A., Sha l om, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μ ηι. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed to prepare the DNA on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spot processing steps of this embodiment are: 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

Were extracted with a ho method from human mixed structure with body specific tissue (or via stimulated cell line) total mRNA, and treated with Oligotex mRNA Midi Kit (available from QiaGen Inc.) purified mRNA, the other points ¹ J to burn by reverse transcription Photo reagent Cy3dUTP (5-Araino-propargy 1-2 · -deoxyuridine 5'-tr iphate coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech, Division) was used to label the mRNA of human mixed tissue, and the fluorescent reagent Cy5dUTP (5- Amino -propargy 2'-deoxyuridine 5--tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Pharaacia Biotech Company, labeled the specific tissue (or stimulated cell line) mRNA of the body, and purified probes were prepared for specific steps. And methods see:

 Schena, M., Sha Ion, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 3: 10614- 10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science. 270. (20): 467-480. (3) Hybridization

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. The scanner (purchased from General Scanning, USA) was used for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point.

The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, L02 cell line stimulated by arsenic for 1 hour, L02 cell line stimulated by arsenic for 6 hours prostate, heart, lung cancer, fetal bladder, fetal small intestine, fetal large intestine, fetal thymus, fetal muscle, fetal liver, fetal kidney, fetal spleen, fetal brain, Fetal lung and fetal heart. Draw a chart based on these 26 Cy3 / Cy5 ratios. (figure 1) . It can be seen from the figure that the expression profiles of human plasminogen activator inhibitor 10 and human plasminogen activator inhibitor 2 according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, H IV infection, and immune diseases.

 Plasminogen activator inhibitor 2 can regulate the formation of plasmin in vivo by inhibiting the activity of urokinase and tissue plasminogen actives. Plasminogen is involved in many different physiological processes in the body, including fibrinolysis, tissue reconstruction, inflammatory response, and tumor metastasis. Plasminogen activator inhibitor 2 regulates the formation of various plasminogens by regulating plasminogen formation.

 Studies have shown that plasminogen activator inhibitor 2 is highly expressed in the womb during pregnancy and that the expression of the protein in the body is regulated by a variety of cytokines, hormones, and phorbol esters.

 The expression profile of the polypeptide of the present invention is consistent with the expression profile of human plasminogen activator inhibitor 2, and both have similar biological functions. Its coordination and balance to the human fibrinolytic system in the body is of great significance for the normal development of embryos. Its abnormal expression is usually related to the destruction of the human fibrinolytic system, such as hemorrhagic diseases, thrombosis, cerebral infarction, myocardial infarction, and embryonic developmental disorders, which are closely related to the inflammatory process and repair, and produce related diseases.

 It can be seen that the abnormal expression of the human plasminogen activator inhibitor 10 of the present invention will produce various diseases, especially hemorrhagic diseases, thrombosis, cerebral infarction, myocardial infarction, various tumors, inflammation, and abnormal repair of inflammation. Diseases, embryonic development disorders, these diseases include but are not limited to:

 Hemorrhagic diseases: Hereditary capillary dilatation, allergic purpura, aplastic anemia, disseminated intravascular coagulation, sepsis, epidemic hemorrhagic fever, simple purpura, senile purpura, idiopathic thrombocytopenia Purple epilepsy, vascular hemophilia

 Thrombotic diseases: cerebral infarction, myocardial infarction, pulmonary infarction

 Embryonic disorders: congenital abortion, cleft palate, limb loss, limb differentiation disorder, atrial septal defect, neural tube defect, congenital hydrocephalus, congenital glaucoma or cataract, congenital deafness Tumors of various tissues: gastric cancer, Liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, neurofibromatosis, colon cancer, melanoma , Bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma

Inflammation: chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations P N01 73 Diseases related to abnormal inflammation and repair: narrowing of various tissue channels such as pyloric stenosis, tracheal stenosis after injury, mitral valve stenosis, aortic stenosis, pulmonary artery stenosis, constrictive pericarditis, pancreatic cystic fibrosis, renal pelvis Nephritis

 The abnormal expression of the human plasminogen activator inhibitor 10 of the present invention will also produce certain hereditary, hematological diseases and the like.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially bleeding diseases, thrombosis, cerebral infarction, myocardial infarction, various tumors, inflammation , Abnormal diseases related to inflammation and repair, certain hereditary, hematological diseases, etc. The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human plasminogen activator inhibitor 10. Agonists enhance human plasminogen activator inhibitor 10 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing human plasminogen activator inhibitor 10 can be cultured together with labeled human plasminogen activator inhibitor 10 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human plasminogen activator inhibitor 10 include antibodies, compounds, receptor deletions, and the like that have been screened. Antagonists of human plasminogen activator inhibitor 10 can bind to human plasminogen activator inhibitor 10 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Binding prevents the polypeptide from functioning biologically.

 When screening compounds as antagonists, the human plasminogen activator inhibitor 10 plus eight bioanalytical assays can be performed by measuring the compound between the human plasminogen activator inhibitor 10 and its receptor. The effects of interactions determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Human plasminogen activator inhibitor

10 Binding peptide molecules can be obtained by screening random peptide libraries consisting of various possible combinations of amino acids bound to a solid phase. In screening, generally, the molecule of human plasminogen activator inhibitor 10 should be labeled: The present invention provides a method for producing antibodies using polypeptides, fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against a human plasminogen activator inhibitor 10 epitope. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

Polyclonal antibodies can be produced by injecting human plasminogen activator inhibitor 10 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like. Techniques for preparing monoclonal antibodies to human plasminogen activator inhibitor 10 include, but are not limited to, hybridoma technology (Kohler and Milstein. Nature, 1975, 256: 495-49 "), triple / technology, human beta-cells Hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that combine human constant regions and non-human variable regions can be produced using existing techniques (Morrison et al, PNAS, 1985, 81: 6851). The technology for producing single chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against. ', Plasminogen activator inhibitor 10.

 Antibodies against human plasminogen activator inhibitor 10 can be used in immunohistochemistry. Biopsy: human plasminogen activator inhibitor 10 in biopsy specimens.

 Monoclonal antibodies that bind to human plasminogen activator inhibitor 10 can also be labeled with radioactive isotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human fibrinolytic activator inhibitors. 10 High-affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to use a thiol cross-linking agent such as SPDP, J to strike the amino group of the antibody, and toxin is bound to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human plasminogen activation Inhibitor 10 positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human plasminogen activator inhibitor 10. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human plasminogen activator inhibitor 10.

 The invention also relates to an assertion test method for quantitative and localized detection of human plasminogen activator inhibitor 10 levels. These tests are well known in the art and include human plasminogen activator inhibitor 10 levels detected in FISH assays and radioimmunoassay tests, and can be used to explain human plasminogen activator inhibitor 10 levels in various The importance of both diseases and diseases for which human plasminogen activator inhibitor 10 plays a role.

The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical, or enzymatic: and one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably The polynucleotide encoding human plasminogen activator inhibitor 10 by mass spectrometry can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human plasminogen activator inhibitor 10. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human plasminogen activator inhibitor 10 to inhibit endogenous human plasminogen activator inhibitor 10 activity. For example, a variant human plasminogen activator inhibitor 10 could be The shortened human plasminogen activator inhibitor 10 lacking the signaling domain, although it can bind to downstream substrates, lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human plasminogen activator inhibitor 10. Virus-derived expression vectors such as: ¾ transcription virus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer polynucleotides encoding human plasminogen activator inhibitor 10 into cells . Methods for constructing a recombinant viral vector carrying a polynucleotide encoding a human plasminogen activator inhibitor 10 can be found in existing literature (Sambrook, etal.). In addition, a recombinant polynucleotide encoding human plasminogen activator inhibitor 10 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid)-and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human plasminogen activator inhibitor 10 mRNA are also within the scope of the present invention. The core enzyme is an enzyme-like enzyme that specifically breaks down specific RNAs. RA molecule, its mechanism of action is the ribozyme molecule and complementary target RNA after specific hybridization for endonucleation. _ Antisense RNA and DNA and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase The technology of phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of DM sequences encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be decorated in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human plasminogen activator inhibitor 10 can be used for diagnosis of diseases related to human plasminogen activator inhibitor 10. The polynucleotide encoding human plasminogen activator inhibitor 1 0 can be used to detect the expression of human plasminogen activator inhibitor 1 0 or the expression of human plasminogen activator inhibitor 1 0 in a disease state. unusual expression. For example, the DNA sequence encoding human plasminogen activator inhibitor 1 0 can be used to hybridize biopsy specimens to determine the expression status of human plasminogen activator inhibitor 1 0. Hybridization techniques include Southern blotting, Nor t hern blotting Method, in situ hybridization, etc. These techniques and methods are publicly available and mature, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray (Microarr ay) or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis of genes in tissues and genes. diagnosis. Human plasminogen activator inhibitor 10 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect the transcription products of human plasminogen activator inhibitor 10.

Detection of mutations in the human plasminogen activator inhibitor 10 gene can also be used to diagnose human plasminogen activation Inhibitor 10 related diseases. Human plasminogen activator inhibitor 10 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human plasminogen activator inhibitor 10 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression, so Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, the important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared from the cDNA, and the sequences can be located on the chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those hybrid cells containing human genes corresponding to the primers produced amplified fragments.

 The somatic hybrid cell PCR mapping method is a fast method for locating DNA to a specific chromosome. Using the oligonucleotide primers of the present invention, by a similar method, a group of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sub- Positioning. Other similar strategies that can be used for chromosome localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct a chromosome-specific c protocol library.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found, for example, in V. Mckusick, Mendenaii Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is observed in any normal individual, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. Based on the resolution capabilities of current physical mapping and gene mapping technologies, cDNAs that are accurately mapped to disease-related chromosomal regions can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping capability and every 20 kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts the permission of the government agencies that produce, make or sell them to be administered on the human body . In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human plasminogen activator inhibitor 10 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human plasminogen activator inhibitor 10 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnosing physician.

Claims

Request for Profit

1. An isolated polypeptide-human plasminogen activator inhibitor 10, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof Thing.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 5 04-785 in SEQ ID NO: 1 or a sequence of positions 1-2012 in SEQ ID NO: 1 sequence.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is a host cell selected from the group consisting of:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human plasminogen activator inhibitor 10 activity, characterized in that the method includes:

 (a) culturing the engineered host cell of claim 8 under the condition that human plasminogen activator inhibitor 10 is expressed;

 (b) A polypeptide having human plasminogen activator inhibitor 10 activity is isolated from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human plasminogen activator inhibitor 10.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that it is a compound that mimics, promotes, antagonizes or inhibits the activity of human plasminogen activator inhibitor 10.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human plasminogen activator inhibitor 10 in vivo and in vitro.

 14. A method for detecting a disease or disease associated with a polypeptide according to any one of claims 1-3, comprising detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening a mimic, agonist, antagonist or inhibitor of human plasminogen activator inhibitor 10; Or used for peptide fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human plasminogen activator inhibitor 10 abnormality.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.