WO2001070940A1

WO2001070940A1 - Genetic constructs for regulated expression of insulin

Info

Publication number: WO2001070940A1
Application number: PCT/AU2001/000328
Authority: WO
Inventors: Oi Lian Kon; Xiang Chen; Serene Hwee Loon Lok; Jawahar G Patil
Original assignee: National Cancer Centre Of Singapore Pte Ltd; National University Of Singapore
Priority date: 2000-03-24
Filing date: 2001-03-23
Publication date: 2001-09-27

Abstract

The present invention relates generally to a method of treating a condition which manifests itself by the reduction in levels of a proteinaceous product. More particularly, the present invention contemplates a method for treating or otherwise ameliorating the symptoms of diabetes mellitus, said method comprising the administration directly or via bioimplants of a genetic construct to cells such as but not limited to myoblast, myofibre and/or muscle cells as well as hepatocytes, liver cells and liver tissue or progenitor or multipotent cells differentiated into cell types suitable to receive said construct and which genetic construct encodes insulin or a precursor form thereof or a functional derivative or homologue of insulin or its precursor. Another aspect of the present invention provides the use of carbohydrate response elements to enable carbohydrate (e.g. glucose)-mediated regulation of insulin synthesis. The present invention further provides a composition comprising a genetic construct which encodes insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor.

Description

GENETIC CONSTRUCTS FOR REGULATED EXPRESSION OF INSULIN

FIELD OF THE INVENTION

BACKGROUND OF THE INVENTION

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in Australia or any other country.

Bibliographic details of the publications referred to by author in this specification are collected at the end of the description.

The rapidly increasing sophistication of recombinant DNA techniques is greatly facilitating research and development in the medical and allied health fields. However, despite the potential usefulness of recombinant DNA technology to generate genetic compositions, few have been successfully developed to date. In work leading up to the present invention, the inventors sought to develop a genetic composition for use in treating diabetes mellitus.

Diabetes mellitus is a biochemically and genetically complex syndrome characterized by hyperglycemia. Commonly associated metabolic disorders include dyslipidemias, ketoacidosis and hyperosmolar non-ketotic coma. While mortality from the acute metabolic complications of diabetes is now rare, diabetes nonetheless causes substantial morbidity and mortality from target organ damage. The late complications of diabetes, that typically manifest 15-20 years after clinical onset, are micro- and macro vascular abnormalities, retinopathy, nephropathy and neuropathy. Diabetes is consequently a leading cause of renal failure, blindness and non-traumatic lower limb amputation in many countries. It is also a major risk factor for atherosclerosis, ischemic heart disease and cerebro vascular disease.

The prevalence of diabetes mellitus is difficult to ascertain accurately, in part due to different diagnostic criteria. A conservative estimate for many countries is 1-2% of the total population. The American Diabetes Association has estimated a prevalence of 5.9% in the U.S.A., while Singapore's National Health Survey in 1998 identified 9% of the adult population as diabetic and another 15% as having impaired glucose tolerance by World Health Organization criteria. Moreover, certain population subgroups have, an extremely high prevalence, e.g. 40% among Pima Indians in the U.S.A.

The economic cost of diabetes mellitus is even more difficult to determine. The American Diabetes Association estimated total economic costs (direct and indirect) to be US$98 billion in 1997 alone. In the same year, per capita cost for health care in the U.S.A. was US$10,071 for diabetics, compared to US$2,699 for non-diabetics.

Although the diabetic syndromes have many causes (genetic and/or environmental), insulin deficiency - absolute or relative - is the fundamental abnormality, regardless of etiology. Tissue resistance to the actions of insulin is an important inciting factor in type 2 or non- insulin dependent diabetes. Nevertheless, significant insulin deficiency from pancreatic β- cell exhaustion supervenes in many type 2 diabetics, leading to further deterioration of metabolic control.

Present methods of diabetes treatment are aimed at:-

(a) improving insulin action by reducing obesity or through the use of drugs (i.e. metformin and thiazolidinediones);

(b) increasing insulin secretion from the pancreas using the sulfonylurea and meglitinide drugs;

(c) decreasing intestinal absorption of food using inhibitors of digestive enzymes ( - glucosidase and lipase inhibitors); and

(d) providing an exogenous insulin supply by daily self-administered injections of insulin (usually recombinant human insulin).

Non-standard treatment includes insulin pumps that deliver a continuous infusion of insulin with superimposed pre-meal bolus doses, immunosuppression to prevent autoimmune destruction of the pancreatic islets, and whole pancreas or islet cell transplants.

In type 1 or insulin-dependent diabetics mellitus (IDDM), subjects effectively lack all capacity for endogenous insulin production, resulting from near-total pancreatic islet destruction. Subjects are thus completely dependent on daily administration of exogenous insulin, without which death quickly ensues (within days) from diabetic ketoacidosis. The majority of type 1 diabetics are adolescents at the time of diagnosis. Emotional responses to coping with daily self-injection of insulin and dietary discipline not uncommonly overwhelm the medical imperative. Thus, adolescent diabetics are at high risk of acute mortality from ketoacidosis whenever exogenous insulin treatment is omitted for any reason. This hazard would be abolished if type 1 diabetics could re-acquire the capacity for endogenous regulated insulin secretion, thus reducing their complete reliance on self- administered injections of exogenous insulin for survival.

For the more than 90% of diabetics who are non-insulin dependent (type 2), having an extrapancreatic source of endogenous insulin secretion will also bring benefits, not only in supplementing failing islet function but also by improving the efficacy of existing anti- diabetic drugs - especially those whose effect is to improve insulin action. The continuing high prevalence of the late complications of diabetes even after decades of conventional diabetes therapy is compelling evidence that present treatment methods fall short of restoring metabolic normality.

Thus, there is a need to develop a new treatment method that enhances in vivo production and secretion of insulin in a regulated manner,

In accordance with the present invention, the inventors have developed genetic constructs which, when delivered to mammalian cells, enabled the controlled production of insulin or its precursors or functional derivatives or homologues of the insulin or its precursors. The genetic constructs and their method of use represent a major advance in diabetes therapy.

SUMMARY OF THE INVENTION

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Nucleotide and amino acid sequences are referred to by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers <400>1, <400>2, etc. A sequence listing is provided after the claims.

One aspect of the present invention provides a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

Another aspect of the present invention is directed to a genetic construct comprising a nucleotide sequence encoding a precursor of insulin or a functional derivative or homologue thereof which precursor of insulin carries an endoproteolytic site to permit cleavage to insulin, said nucleotide sequence substantially as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

Yet another aspect of the present invention provides a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said precursor form carrying a proteolytic cleavage site to cleave the molecule to insulin, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form of the promoter which promoter is regulatable by one or more metal and/or carbohydrate response elements to provide regulatable insulin/precursor insulin synthesis and secretion from a target cell, said genetic construct optionally further comprising a nucleotide sequence encoding a proteolytic enzyme capable of cleaving the precursor form of insulin to produce insulin.

Still yet another aspect of the present invention contemplates a method for the treatment or prophylaxis of diabetes in a mammal, said method comprising administering to said mammal an effective amount of a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

Even yet another aspect of the present invention is directed to a composition comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with a genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor, said composition further comprising one or more pharmaceutically acceptable carriers and/or diluents.

Still yet another aspect of the present invention contemplates the use of a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor in the manufacture of a medium for the treatment of diabetes.

Still yet another aspect of the present invention is directed to a genetically modified animal which comprises non-pancreatic cells capable of producing insulin or a precursor thereof or a derivative or homologue of insulin or its precursor.

Another aspect of the present invention provides mammalian cells comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

Still another aspect of the present invention contemplates the use of genetically modified cells, said cells comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor in the treatment or the prophylaxis of diabetes mellitus or a related condition.

BRIEF SUMMARY OF THE FIGURES

Figures 1A to 1O are diagrammatic plasmid maps (15 constructs).

Figure 2 A is a diagrammatic representation showing the steps in the assembly of Constructs A, B and C.

Figure 2B is a diagrammatic representation showing the steps in constructing Constructs B and C.

Figure 2C is a diagrammatic representation showing the steps in the assembly of Constructs D, E and F.

Figure 2D is a diagrammatic representation showing the steps in constructing Constructs E and F.

Figure 2E is a diagrammatic representation showing the steps in the assembly of Construct G.

Figure 2F is a diagrammatic representation showing the steps in the assembly of Construct H.

Figure 2G is a diagrammatic representation showing the steps in the assembly of Construct I.

Figure 2H is a diagrammatic representation showing the steps in the assembly of Construct J.

Figure 21 is a diagrammatic representation showing the steps in the assembly of Construct K. Figure 2 J is a diagrammatic representation showing the steps in the assembly of Construct L.

Figure 2K is a diagrammatic representation showing the steps in the assembly of Construct M.

Figure 2L is a diagrammatic representation showing the steps in the assembly of Construct

N.

Figure 2M is a diagrammatic representation showing the steps in the assembly of Construct Z.

Figure 3A is a sequence of metallothionein promoter containing metal response elements, carbohydrates response elements and rabbit globin intron.

Figure 3B is a sequence of human proinsulin modified for endoproteolytic cleavage (SEQ ID NO.l).

Figure 3C is a sequence of actin promoter and carbohydrate response element in the rat proinsulin constructs

Figure 4 is a graphical representation of the dose response of zinc-induced proinsulin secretion. (A) Stably-transfected Chang cells were cultured in serum-free DMEM containing either 5.6 mM or 25 mM glucose, and exposed to a range of zinc concentrations from 0-90 μM. Conditioned media were harvested after 48 hours and radioimmunoassayed for human proinsulin (Linco Research, Inc.). Data points are the means and SEM of duplicate or triplicate assays. (B) Effect of increasing concentrations of zinc on proinsulin secretion in the presence of 25 mM glucose. Other experimental details as in panel A.

Figure 5 is a graphical representation showing time course of zinc-induced proinsulin accumulation. Stably transfected Chang cells grown in serum-free DMEM containing 25 mM glucose were exposed to 60 μM zinc for periods ranging from 0-48 hours. Data are means and SEM of proinsulin levels in conditioned media from duplicate or triplicate wells.

Figure 6 is a graphical representation of glucose induction of proinsulin secretion. Stably transfected Chang cells were grown in zinc- and serum-free DMEM containing either 5.6 mM or 25 mM glucose for 48 hours. Data are means and SEM of proinsulin concentrations of duplicate or triplicate wells. Sets 1-5 are data from five different experiments.

Figure 7 is a graphical representation of dose response of glucose-induced proinsulin secretion. Stably transfected Chang cells were exposed to increasing concentrations (3.5-25 mM) of glucose in zinc- and serum-free DMEM for 48 hours. Data points are means and SEM of proinsulin concentrations in pM in duplicate or triplicate wells.

Figure 8 is a graphical representation showing time course of accumulation of proinsulin in the conditioned medium containing 25 mM glucose. Data are the means and SEM of proinsulin (in fmoles) present in replicate wells of fully confluent and stably transfected Chang cells.

Figure 9 is a graphical representation showing the effects of sugars and leucine on proinsulin secretion. Stably transfected Chang cells were plated in replicate wells of a 24- well plate (300,000-350,000 cells/well). Conditioned media were harvested 48 hours after addition of sugars or leucine. Data are means and SEM of human proinsulin concentrations. (A) Glucose concentration was 5.6 mM glucose in all wells. Each of the sugars indicated was added to a final concentration of 19.4 mM. P values: arabinose (0.0001), fructose (0.0002), galactose (< 0.0001), maltose (0.001), sucrose (0.2231) abd glucose (0.0001). (B) The sugars indicated were added to a final concentration of 25 mM and leucine to 20 mM. Glucose was absent from wells to which mannose, ribose or leucine was added. P values: mannose (0.0052), ribose (0.0004), leucine (0.0002) and glucose (0.0002).

Figure 10 is a graphical representation showing ChoRE mediates glucose effect on proinsulin secretion. Chang cells were transiently transfected with two constructs that were identical except for the absence or presence of ChoRE. Both constructs lacked the 3' metallothionein flanking DNA. Conditioned media (serum- and zinc-free) from replicate wells were harvested after 48 hours. Data are means and SEM of proinsulin concentrations in nM. Chang cells transiently transfected with Construct B (containing the carbohydrate response element) secreted significantly more proinsulin under conditions of high ambient glucose concentration (p = 0.031).

Figure 11 is a graphical representation showing the combined effect of glucose and zinc on proinsulin secretion. Stably transfected Chang cells were exposed to glucose concentrations ranging from 5.6 to 25 mM for 48 hours in the presence of the following concentrations of zinc: (A) none; (B) 20 μM; (C) 40 μM and (D) 60 μM. Data are means and SEM of proinsulin concentrations (pM).

Figure 12 is a graphical representation of C2C12 myoblasts were transiently co-transfected with 0.5 μg of each of the constructs indicated and with 0.5 μg pCMV/3 (encoding β- galactosidase cDNA) in serum- and zinc-free DMEM. Constructs G to J each had a furin cDNA expression cassette, neomycin resistance gene and a rat proinsulin cDNA (mutated for processing to insulin by furin) expression cassette driven by an actin promoter. Construct

G did not contain the carbohydrate response element. In Construct H, the carbohydrate response element was upstream of the actin promoter in the 5' - 3' orientation, hi Construct

I, the carbohydrate response element was upstream of the actin promoter in the 3' - 5' orientation. In Construct J, the carbohydrate response element was downstream of the actin promoter in the 3' - 5' orientation. Twenty- four hours after transfection, conditioned media was harvested from duplicate wells and radioimmunoassayed for rat insulin concentrations (Linco Research, Inc.) p values of the difference in rat insulin concentrations for the same rat proinsulin construct in 5.6 mM and 25 mM glucose were 0.075 (Construct G), 0.074

(Construct H), 0.853 (Construct I) and 0.05 (Construct J).

Figure 13 is a graphical representation Chang cells stably transfected for proinsulin secretion were either mock transfected ("Control cells") or transiently transfected with

Construct Z bearing GLUT2 and glucokinase expression cassettes ("Transfected cells") using LipofectAMINE PLUS according to the supplier's protocol. After transfection, cells were returned to DMEM containing 5.6 mM glucose and 10% v/v FCS for 45 hours and then adapted to glucose- and serum-free DMEM for 3 hours. To determine glucose inducibility, serum-free DMEM containing either 2.5 mM or 25 mM glucose was added to "control" and "transfected" cells. Conditioned media from triplicate wells were harvested after 48 hours. Data are means and SEM of human proinsulin concentrations quantitated by radioimmunoassay. Glucose increased proinsulin secretion from control cells by 1.47-fold (p = 0.0016) and from GLUT2- and glucokinase-transfected cells by 2.39-fold (p= 0.0003).

Figure 14 is a graphical representation of GLUT2 and glucokinase cDNA transfection potentiated glucose-inducible proinsulin expression.

Figure 15 is a graphical representation showing construction of pNTMTChhis. pNTMTChlns (16.9 kb) was assembled using standard molecular biology techniques in the steps shown. The orientation of fragments in the final plasmid construct was verified by multiple restriction enzyme digests and confirmatory DNA sequencing. Salient features of pNTMTChlns are the human MT IIA promoter in a 3 kb genomic fragment (MT 5'), the carbohydrate response element (ChoRE) having the sequence

5'AGTTCTGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGAGTTCTCAC GTGGGGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTAC3' (SEQ ID NO:2); human proinsulin cDNA and rabbit β globin polyA signal (hlns); and a neomycin resistance cassette, pGKNeo. The construct also carried two additional components that were not relevant in these experiments: a 4 kb genomic fragment (MT 3') from the human metallothionein locus downstream of the metallothionein II A coding sequence and herpes simplex thymidine kinase cDNA (hsv-tk). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention is predicated in part on the development of genetic constructs which enable production of insulin or its precursors or functional derivatives or homologues of insulin or their precursors and the surprising use of these constructs particularly but not exclusively in non-pancreatic cells to permit synthesis and secretion of insulin or its precursors or functional derivatives or homologues of insulin or its precursors.

Accordingly, one aspect of the present invention provides a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

The terms "genetic construct" is used in its broadest sense and includes plasmids, vectors or other nucleic acid molecules which comprise a nucleotide sequence which encodes insulin or a precursor thereof or a derivative or homologue of insulin or its precursor. Generally, the genetic construct is in double stranded DNA form but the present invention extends to single stranded, linear or covalently closed forms of DNA or RNA. The latter forms may need to be rendered in double stranded form or in DNA form prior to use. Alternatively, depending on the mode of delivery to a target cell, single stranded, linear or covalently closed forms of RNA or DNA may be useful as components of viral delivery systems.

The genetic construct of the present invention generally further comprises means to maintain itself and/or replicate itself in a target cell. Such means include one or more origins of replication and/or means to segregate upon cell division. The latter may, but not necessarily include, therefore, the presence of elements of human or mammalian artificial chromosomes such as but not limited to a centromere, neocentromere or a functional derivative or homologue thereof.

Preferred target cells include but are not limited to myoblasts, myofibres and muscle tissue cells, hepatocytes, liver cells and liver tissue. The present invention further contemplates progenitor or multipotent cells which have been artificially or naturally induced into cells suitable to receive the genetic constructs. For example, the differentiated cells may become "hepatocyte-like" or "myoblast-like". The insulin or its precursors, derivatives or homologues is then produced and secreted from the myoblast, myofibre and/or muscle tissue cells.

The nucleotide sequence encoding insulin or its precursor or homologue may correspond to a naturally occurring sequence or it may contain one or more nucleotide substitutions, additions and/or deletions relative to the naturally occurring nucleotide sequence. Such nucleotide substitutions, additions and/or deletions are encompassed by the terms "derivative" or "derivatives". Accordingly, a derivative encompasses a part, fragment, portion or region of a nucleotide sequence which nevertheless still encodes a protein having insulin properties. The derivatives are stated, therefore, to be functional derivatives.

The nucleotide sequences of the present invention preferably corresponds to human insulin or its precursor or a humanized form of mammalian insulin or its precursor. By "mammalian" includes a primate, livestock animal (e.g. sheep, cow, horse, pig), laboratory test animal (e.g. rabbit, mouse, rat, guinea pig, hamster), companion animal (e.g. dog, cat) or captive wild animal. A "humanized" molecule comprises a non-human backbone but with sufficient epitopes or other regions substituted for human elements such that the body recognizes the molecule as being a human derived molecule. The preferred target cell is of mammalian origin such as but note limited to a human.

The insulin molecule or its precursor form may also be modified to incorporate proteolytic cleavage sites. This is particularly relevant when the precursor form of insulin is proinsulin or preproinsulin. The proteolytic cleavage site permits cleavage of the precursor form to insulin or a functional derivative thereof. The proteolytic cleavage site is also useful when the insulin molecule is a hybrid or fusion molecule between an insulin portion and a non- insulin portion. The proteolytic cleavage site permits cleavage of the molecule to an insulin portion.

In a particularly prefened embodiment, the nucleotide sequence encodes human proinsulin modified for endoproteolytic cleavage by fusion The nucleotide sequence in this regard is substantially as set forth in SEQ ID NO:l. The present invention extends, however, to a nucleotide sequence having at least about 60% similarity to SEQ ID NO:l after optimal alignment and/or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or its complementary strand under low stringency conditions. Such nucleotide sequences are still required, however, to retain insulin or proinsulin properties.

Accordingly, another aspect of the present invention is directed to a genetic construct comprising a nucleotide sequence encoding a precursor of insulin or a functional derivative or homologue thereof which precursor of insulin carries an endoproteolytic site to permit cleavage to insulin, said nucleotide sequence substantially as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is * capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

As stated above, preferred mammalian cells include myoblasts, myofibres, muscle tissue, hepatocytes, liver cells and liver tissue as well as differentiated progenitor or multipotent cells having similar properties to the aforementioned cells. The term "similarity" as used herein includes exact identity between compared sequences at the nucleotide or amino acid level. Where there is non-identity at the nucleotide level, "similarity" includes differences between sequences which result in different amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels. Where there is non-identity at the amino acid level, "similarity" includes amino acids that are nevertheless related to each other at the structural, functional, biochemical and/or conformational levels, hi a particularly preferred embodiment, nucleotide and sequence comparisons are made at the level of identity rather than similarity.

Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence similarity", "sequence identity", "percentage of sequence similarity", "percentage of sequence identity", "substantially similar" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 or above, such as 30 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides may each comprise (1) a sequence (i.e. only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of typically 12 contiguous residues that is compared to a reference sequence. The comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wl, USA) or by inspection and the best alignment (i.e. resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also may be made to the BLAST family of programs as for example disclosed by Altschul et al. (1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. (1998).

The terms "sequence similarity" and "sequence identity" as used herein refers to the extent that sequences are identical or functionally or structurally similar on a nucleotide-by- nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity", for example, is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g. A, T, C, G, I) or the identical amino acid residue (e.g. Ala, Pro, Ser, Thr, Gly, Nal, Leu, He, Phe, Tyr, Tip, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e. the window size), and multiplying the result by 100 to yield the percentage of sequence identity. For the purposes of the present invention, "sequence identity" will be understood to mean the "match percentage" calculated by the DΝASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA) using standard defaults as used in the reference manual accompanying the software. Similar comments apply in relation to sequence similarity.

Reference herein to a low stringency includes and encompasses from at least about 0 to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridization, and at least about 1 M to at least about 2 M salt for washing conditions. Generally, low stringency is at from about 25-30°C to about 42°C. The temperature may be altered and higher temperatures used to replace formamide and/or to give alternative stringency conditions. Alternative stringency conditions may be applied where necessary, such as medium stringency, which includes and encompasses from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridization, and at least about 0.5 M to at least about 0.9 M salt for washing conditions, or high stringency, which includes and encompasses from at least about 31% v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridization, and at least about 0.01 M to at least about 0.15 M salt for washing conditions. In general, washing is carried out T_m = 69.3 + 0.41 (G+C)% (Marmur and Doty, 1962). However, the T_m of a duplex DNA decreases by 1°C with every increase of 1% in the number of mismatch base pairs (Bonner and Laskey, 1974). Formamide is optional in these hybridization conditions. Accordingly, particularly preferred levels of stringency are defined as follows: low stringency is 6 x SSC buffer, 0.1 % w/v SDS at 25-42°C; a moderate stringency is 2 x SSC buffer, 0.1% w/v SDS at a temperature in the range 20°C to 65°C; high stringency is 0.1 x SSC buffer, 0.1% w/v SDS at a temperature of at least 651°C.

The expression of the nucleotide sequence encoding insulin or its precursor or a derivative or homologue of insulin or its precursor is preferably regulatable. Generally, but not exclusively, this means that the expression of the nucleotide sequence may be upregulated or downregulated or otherwise modulated by a cis or trans acting element. A cis acting element is an element encoded by a nucleotide sequence adjacent or juxtaposed to the nucleotide sequence encoding insulin or its precursor or a derivative or homologue thereof and/or the promoter operably linked to said nucleotide sequence. A trans acting element may be located on the same or another genetic construct or may be located on the genome of the cell into which the genetic construct is introduced. A trans acting element is not generally adjacent or juxtaposed to the promoter or the insulin/precursor insulin-encoding sequence.

Particularly prefened control elements are cis acting elements such as but not limited to a carbohydrate response element, metal ion response element or other hormonal, cytokine or growth factor response elements.

The response elements are conveniently also referred to as regulatory regions and these may be located 5' or 3' of the promoter-nucleotide sequence portion although preferably, they are located adjacent or juxtaposed to the promoter. The prefened location of a cis acting element such as a carbohydrate response element is upstream of a promoter region. Spacer nucleotides may also be included outside the carbohydrate response element and the orientation of the spacer elements relative to the carbohydrate response element may be altered to regulate the function of the regulation element, hi a particularly prefened embodiment, the carbohydrate response elements or other cis acting elements are supplied at a high copy number such as from two copies in tandem to about 30 copies, more preferably from about two copies to about 20 copies and even more preferably from about 2 copies to about 6-10 copies (e.g. 2-6 copies). The present invention contemplates multiple copies, i.e. two or more, of the cis acting regulatory element such as the carbohydrate response elements. A particularly prefened carbohydrate response element comprises a nucleotide sequence set forth in SEQ ID NO:7 or a nucleotide sequence having at least 70% similarity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO:7 or its complementary form under low stringency conditions.

Particular prefened response elements are carbohydrate and metal response elements. For example, the present invention extends to the use of the metallothionein promoter containing metal response elements and carbohydrate response elements. These are outlined in Figure 3A.

Accordingly, in a prefened embodiment, the present invention provides a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said precursor form carrying a proteolytic cleavage site to cleave the molecule to insulin, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form of the promoter which promoter is regulatable by one or more metal and/or carbohydrate response elements to provide regulatable insulin/precursor insulin synthesis and secretion from a target cell, said genetic construct optionally further comprising a nucleotide sequence encoding a proteolytic enzyme capable of cleaving the precursor form of insulin to produce insulin.

Preferably, the precursor insulin is human proinsulin modified to carry an endoprotemase site to cleave the molecules to insulin such as in the presence of furin. Preferably, the nucleotide sequence encoding human proinsulin is substantially as set forth in SEQ ID NO:l or a nucleotide sequence having at least 60% similarity thereto after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l under low stringency conditions. Preferably, the nucleotide sequence encoding insulin or its precursor is expressed using the metallothionein promoter containing a metal or carbohydrate response elements. The genetic construct of the present invention is useful in the treatment of diabetes. Reference herein to "diabetes" includes reference to type 1 or type 2 diabetes or any other form of diabetes which results in a reduced amount of secretable insulin. Most preferably, the diabetes is insulin-dependent diabetes mellitus (IDDM).

Accordingly, another aspect of the present invention contemplates a method for the treatment or prophylaxis of diabetes in a mammal, said method comprising administering to said mammal an effective amount of a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

Preferably, the insulin is in precursor form such as proinsulin or preproinsulin. Preferably, the precursor form of insulin carries a proteolytic cleavage site to generate insulin or a functional derivative thereof.

Preferably, the nucleotide sequence encodes proinsulin modified to include a endoprotemase cleavage site to generate insulin and which nucleotide sequence is substantially as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO:l under low stringency conditions.

The present invention is preferably practised by the administration of the genetic construct to non-pancreatic cells, e.g. myoblast cells, myofibres, muscle cells, hepatocytes, liver cells and liver tissue or progenitor or multipotent precursors of similar cells. However, the subject invention extends to administration to pancreatic cells.

Reference herein to "cells" includes single cells or a suspension of cells or a group of cells such as in tissues or organs.

Administration of the genetic construct may be by any convenient means such as by the administration of naked DNA or mRNA or through the use of bacterial or viral agents.

Accordingly, another aspect of the present invention is directed to a composition comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor, said composition further comprising one or more pharmaceutically acceptable carriers and/or diluents.

Such a composition may also be refened to as a pharmaceutical composition.

The compositions are preferably in a form suitable for administration by injection, infusion, implant, needleless injection, drip, oral intake and/or electrotransfer. The composition may also be in a form suitable for intake via inhalation or nasal spray.

Composition forms suitable for injectable use include sterile aqueous solutions. These must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of micro-organisms such as bacteria and fungi. The carrier can be a solvent or diluent containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol and the like), suitable mixtures thereof and vegetable oils. The preventions of the action of micro-organisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like, h many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin.

Pharmaceutically acceptable carriers and/or diluents include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, use thereof in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

A single dose may be administered or multiple doses over time such as over hours, days, weeks or months. Preferably, the constructs are administered to non-pancreatic cells. Alternatively, cells carrying the genetic constructs may be maintained in in vitro culture prior to transplanting or otherwise introducing the cells into a recipient.

Amounts of construct required will vary depending on the subject and the level of insulin needed. However, dosage generally from about 1 μg to about 100 mg of genetic construct per injection or from about 10 μg to about 10 mg of genetic construct per injection may be employed. Alternatively, the amount administered may be expressed in amounts per kilogram of body weight. Accordingly, the effective amount may be from about 0.01 μg to about 10 mg/kg body weight or more preferably from about 0.1 μg to about 5 mg/kg body weight.

Less construct may be administered where a strong promoter, for example, or other expression enhancers, permit high level production of insulin. Accordingly, the amount of construct may be that which provide from about 0.01 μg to about 10 mg of insulin/kg body weight of recipient. Yet another aspect of the present invention contemplates the use of a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor in the manufacture of a medium for the treatment of diabetes.

The construct may be provided in ready to use form or it may be in component form requiring assembly. Generally, the construct is in a form packaged for sale with instructions for use.

The genetic constructs of the present invention may also be employed to generate transgenic cells capable of producing insulin or a functional derivative or homologue thereof. Genetically modified cells may be employed, for example, in the treatment of diabetes. Accordingly, another aspect of the present invention provides mammalian cells comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

In another embodiment, the invention contemplates the use of genetically modified cells, said cells comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor in the treatment or the prophylaxis of diabetes mellitus or a related condition.

Furthermore, the present invention contemplates transgenic non-human animals capable of producing recombinant insulin or functional derivatives or homologues thereof. Such animals are particularly useful as animal models to investigate the control of insulin production and/or secretion.

Accordingly, another aspect of the present invention is directed to a genetically modified animal which comprises non-pancreatic cells capable of producing insulin or a precursor thereof or a derivative or homologue of insulin or its precursor.

Generally, the genetically modified animal is an animal which, prior to genetic modification, produces no or substantially reduced amounts of insulin or its precursor form.

Preferably, the genetically modified animal is a mouse, rat, rabbit or other laboratory test animal or livestock animal.

In a particularly prefened embodiment, the present invention provides genetic constructs defined by constructs A to N and Z as shown in Figures 1 A to 1O, respectively.

The present invention is further described by the following non-limiting Examples. EXAMPLE 1

Rationale and design of a method for regulated insulin secretion by non-pancreatic cells

Salient features of the genetic constructs

Maps of the genetic constructs A-N and Z appear in Figures 1A to IN and 1Z and the steps in the assembly of the constructs appear in Figures 2A to 2K. The nucleotide sequence encoding the metallothionein promoter containing metal response elements, carbohydrate response elements and rabbit globin intron are shown in Figure 3 A. The nucleotide sequence of human proinsulin modified for endoproteolytic cleavage is shown in Figure 3B. The nucleotide sequence of the actin promoter and carbohydrate response elements in rat proinsulin constructs is shown in Figure 3C.

pNTMTChlns (16.9 kb) was assembled sequentially by standard molecular biology techniques (Ausubel et al, 2000) as shown in Figure 15. It carries (a) a 3 kb genomic fragment, MT 5', specifying the human MT IIA promoter in 3' linkage to (b) the carbohydrate response element, ChoRE, having the sequence

5'AGTTCTGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGAGTTCTCAC GTGGGGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTAC3' [SEQ ID NO:2] (Oligos Etc., USA); (c) human proinsulin cDNA and rabbit β globin polyA signal, hlhs (RIKEN, Japan); and (d) neomycin resistance cassette, pGKNeo.

Glucokinase and glucose transporter type 2 cDNAs (American Type Culture Collection) were cloned downstream of the cytomegalovirus and human elongation factor lα promoters, respectively, of pBUDCE4 (hivitrogen, USA) to form pBUD-GT-GK (7.7 kb).

The constructs, assembled in plasmid DNA, were designed to incorporate the following features: (a) Eukaryotic promoters and DNA regulatory elements capable of mediating regulation of gene expression by zinc and/or glucose.

(b) Human proinsulin cDNA whose base sequence was altered to specify cleavage sites for the endoprotease, furin, at the junction of the insulin B chain and C-peptide, and at the junction of the C-peptide and insulin A chain.

(c) cDNA expression cassette for furin (EC 3.4.21.75). When combined with (b), this feature enables genetically modified cells to proteolytically process proinsulin to the more biologically active hormone, insulin.

(d) cDNA expression cassettes for human glucokinase (EC 2.7.1.1) and human GLUT 2 (a glucose transporter).

Constructs A to N and Z were prepared as outlined in Figures 2A to 2K. For the constructs of D, E and F, human proinsulin cDNA in pUhfris (Construct A-l) was modified to incorporate furin recognition sites at the B-C and C-A junctions as follows:-

(i) Changing cDNA sequence at the C-A junction using QuickChange (trademark) Site- Directed Mutagenesis Kit (Stratagene, U.S.A.):

Primer 1: 5'-gga ggg gtc ccG gcG gaa gcg tgg c-3' (SEQ ID NO:3);

Primer 2: 5'-gcc acg ctt cCg cCg gga ccc etc c-3' (SEQ ID NO:4).

Capitalized letters indicate modified bases.

(ii) Changing cDNA sequence at the B-C junction using QuickChange (trademark) Site- Directed Mutagenesis Kit (Stratagene, U.S.A.):-

Primer 3: 5'-cca aga ccc gcc ggA agC Gag agg ace tgc agg-3' (SEQ ID NO: 5);

Primer 4: 5 '-cct gca ggt cct ctC Get Tec ggc ggg tct tgg-3 ' (SEQ ID NO:6). Capitalized letters indicate modified bases.

(iii) Changes were confirmed by sequencing and the construct was named pUhlnsFurin (Construct D-l).

Salient features of Constructs

Experimental data obtained with Constructs G, H, I, J, K, L, M and N are summarized below:-

Sequence of carbohydrate response element(s) (ChoRE) in Constructs H- N

Single ChoRE in forward orientation:-

5'AGTTCTGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGAGTTCTCACGTGGGG CCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTG 3 ' (SEQ ID NO:7).

Single ChoRE in reverse orientation:-

5 ' CAAGCACGTGGCCACCACGTGAGAACTCAAGCACGTGGCCCCACGTGAGAACTCAAGCAC GTGGCCACCACGTGAGAACTCAAGCACGTGGCAGAACT 3' (SEQIDNO:8). Triple ChoRE in forward orientation: -

5'AGTTCTGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGAGTTCTCACGTGGGG CCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGTGCTGCAAGGGCAATTCTGCAGAT

ATCCAGCACAGTGGCGGCCGCTCGAGACAGTTCTGCCACGTGCTTGAGTTCTCACGTGGTGG CCACGTGCTTGAGTTCTCACGTGGGGCCACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCT TGTGCTGCAAGGGCAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGACAGTTCTGC CACGTGCTTGAGTTCTCACGTGGTGGCCACGTGCTTGAGTTCTCACGTGGGGCCACGTGCTT GAGTTTCTCACGTGGTGGCCACGTGCTTTG 3' (SEQ ID NO:9).

Triple ChoRE in reverse orientation:-

5 ' CAAAGCACGTGGCCACCACGTGAGAAACTCAAGCACGTGGCCCCACGTGAGAACTCAAGC ACGTGGCCACCACGTGAGAACTCAAGCACGTGGCAGAACTGTCTCGAGCGGCCGCCACTGTG

CTGGATATCTGCAGAATTGCCCTTGCAGCACAAGCACGTGGCCACCACGTGAGAACTCAAGC ACGTGGCCCCACGTGAGAACTCAAGCACGTGGCCACCACGTGAGAACTCAAGCACGTGGCAG AACTGTCTCGAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTGCCCTTGCAGCACAAGCA CGTGGCCACCACGTGAGAACTCAAGCACGTGGCCCCACGTGAGAACTCAAGCACGTGGCCAC CACGTGAGAACTCAAGCACGTGGCAGAACT3' (SEQ ID NO:10).

Carbohydrate response element (ChoRE)

Oligonucleotides were synthesized to specify four tandem copies of the following unit sequence: 5' CACGTGnnnnnCACGTG 3' and its complement. This synthetic double- stranded DNA was amplified by PCR, blunt-ended and cloned into pCRScript from which constructs H - N were assembled by standard recombinant DNA techniques. The orientation of ChoRE in each construct and its position relative to the actin promoter was verified by DNA sequencing. The results of insulin synthesis are shown below:-

* Stimulation index = Insulin concentration in 25 mM glucose

Insulin concentration in 5.6 mM glucose

Non-pancreatic cells for regulated proinsulin and insulin expression

Two mammalian cell lines, i.e. Chang and C2C12, purchased from the American Type Culture Collection were transfected with the genetic constructs described above. Chang cells were derived originally from normal human liver while C2C12 is a mouse myoblast cell line.

pNTMTChlns and pBUD-GT-GK were transfected into Chang liver cells with LipofectAMINE PLUS (Life Technologies, USA) using the supplier's recommended protocol. Stable pNTMTChJhs-transfectants were selected with G418 (1.6 mg/ml). Zinc- and/or glucose-induction were performed on completely confluent Chang-hproins-6 cells in 12- or 24-well plates transfened to serum-free medium. Concentrations of zinc, glucose and other inducers are stated in figure and table legends. Conditioned media from replicate wells were harvested 10 minutes to 48 hours after induction.

Scid and Balb/c mice were implanted intraperitoneally with 10⁸ Chang-hproins-6 cells suspended in phosphate-buffered saline (PBS) alone (Table 1, Group B) and received daily intraperitoneal injections of PBS thereafter. Group C mice were implanted intraperitoneally with 10 Chang-hproins-6 cells suspended in PBS containing zinc sulfate or glucose (refer to Table 1 legend for concentrations) on day 1, and thereafter received once daily intraperitoneal injections of zinc sulfate or glucose, respectively (refer to Table 1 legend for zinc and glucose doses administered in vivo). Group A mice were not implanted with cells but received identical daily zinc or glucose injections. All Balb/c mice were pre-treated with daily FK 506 (Fujisawa Ireland) (3 mg/kg, intramuscular) from day -3 (for zinc induction) or day -4 (for glucose induction). Blood was withdrawn on day 3 (5 hours after the last intraperitoneal injection) for serum proinsulin assay.

Conditioned media from triplicate wells and mouse sera were assayed in duplicate for human proinsulin using a radioimmunoassay kit (Linco Research Inc., USA) having a sensitivity of at least 2 x 10^"12M and < 0.1% crossreactivity with insulin.

Significance of difference between mean values was calculated by two-sided Student's t test.

EXAMPLE 2 Proinsulin/insulin secretion by Chang cells

Maintenance and transfection of Chans cells

Chang cells were propagated in 5% CO₂ in Dulbecco's Modified Eagle's Medium (DMEM) at 37°C containing either 25 mM or 5.6 mM glucose, supplemented with 10% v/v fetal calf serum (FCS). Growth medium was renewed every 2-3 days and cultures in 25 mM glucose were split after 5 days at a ratio between 1:10 and 1:20. Cultures in 5.6 mM glucose were split at a ratio between 1:3 and 1:5.

Stable transfection with Construct A (Figure 1A) was performed by plating 90,000 cells in each well of a 12- well plate. Plasmid DNA (0.5 μg) complexed with LipofectAMINE PLUS (Life Technologies, U.S.A.) was used to transfect cells in each well according to the supplier's protocol. Selection for stably transfected cells began after 48 hours when G418 (1.6 mg/ml) was added to the growth medium. Untransfected cells were completely eliminated after five days in this concentration of G418. Single clones of stably transfected cells were picked after 3 weeks of G418 selection and expanded in culture. Cultures derived from these single clones are maintained in DMEM/10% v/v FCS/G418 (0.8 mg/ml), containing either 25 mM or 5.6 mM glucose. Maintenance cultures are re-selected every 2-3 months for 5 days in G418 (1.6 mg/ml).

Transient transfection was performed using Construct B or C (Figures IB and C), according to the same protocol that was adopted for stable transfection described in the preceding paragraph, except that 120,000 cells were plated in each well of a 12-well plate and cells were not selected with G418.

In all experiments to assess the capacity of untransfected and transfected Chang cells to secrete proinsulin/insulin, complete growth medium was replaced with serum-free DMEM and conditioned medium was harvested 10 minutes to 48 hours later. Conditioned media from triplicate wells were assayed in duplicate for proinsulin/insulin by radioimmunoassay (Linco Research Inc., U.S.A.). Statistical significance was determined by Student's unpaired t test.

Zinc inducibility of proinsulin/insulin secretion by Chans cells

Six stably-transfected clonal cultures were tested for proinsulin/insulin secretion. The growth medium was changed to serum-free DMEM/25 mM glucose containing 0 or 50 μM zinc sulfate. Conditioned media from triplicate wells were harvested after 48 hours for proinsulin/insulin assay (Table 2). The most active clone was selected for subsequent studies to characterize proinsulin/insulin secretion from stably-transfected cells.

Inducibility of proinsulin/insulin secretion by zinc from stably-transfected Chang cells was determined by adding varying concentrations of zinc sulfate (0-90 μM) to serum-free DMEM containing either 25 mM glucose or 5.6 mM glucose. Conditioned media from triplicate wells were harvested after 48 hours for proinsulin/insulin assay (Figures 4A and B). The time course of induction by zinc was investigated by harvesting conditioned media from stably-transfected cells exposed to 60 μM zinc sulfate (both in the presence of 25 mM glucose) at intervals from 0 to 48 hours (Figure 5).

Chang cells transiently transfected with Construct B or C were exposed to 0 or 20 μM zinc sulfate in the presence of 25 mM glucose. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Table 3).

Glucose inducibility of proinsulin/insulin secretion by Chans cells

Stably-transfected cells were exposed to either 5.6 mM or 25 mM glucose in serum- and zinc-free DMEM. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Figure 6).

Stably-transfected cells were exposed to glucose concentrations varying from 3.5 mM to 25 mM in serum- and zinc-free DMEM. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Figure 7).

Conditioned media of stably-transfected cells in 25 mM glucose were assayed for accumulation of proinsulin/insulin at time intervals from 10 minutes to 48 hours (Figure 8).

The effect of 19.4 mM arabinose, fructose, galactose, maltose and sucrose in the presence of 5.6 mM glucose on induction of proinsulin/insulin secretion was investigated in stably- transfected cells. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Figure 9).

The effect of 25 mM mannnose, 25 mM ribose and 20 mM leucine on induction of proinsulin/insulin secretion by stably-transfected cells was also investigated in stably- transfected cells. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Figure 10). Glucose-inducibility of proinsulin/insulin secretion by transiently transfected Chang cells was determined by exposure to 5.6 mM or 25 mM glucose. Conditioned media from triplicate wells were harvested 48 hours later for proinsulin/insulin assay (Figure 11).

The capacity of normal hepatocytes and pancreatic β cells to regulate gene expression in response to ambient glucose concentrations is dependent not only on trans- and cw-acting factors and elements but also on a glucose-sensing mechanism. The minimal biochemical components of physiological glucose sensing are two proteins, i.e. GLUT2, a high K_m glucose transporter and glucokinase (EC 2.7.1.1), a high K_m member of the hexokinase family. Figure 13 summarizes data to show that co-expressing GLUT2 and glucokinase in Chang cells stably transfected to secrete proinsulin/insulin further enhances glucose-induced proinsulin/insulin secretion.

Glucose sensins and glucose inducibility

Chang liver cells do not express glucokinase and GLUT2 (RT-PCR data not shown), generally considered to be essential for physiological glucose sensing (Efrat et al, 1994). Chang-hproins-6 cells re-transfected with expression cassettes of human glucokinase and GLUT2 cDNAs were significantly more glucose-responsive than parental Chang-hproins-6 cells (Figure 14).

Combined induction by zinc and slucose

Figures 11-13 show that the extent of glucose-induced proinsulin secretion was progressively greater as increasing concentrations of zinc were also added to the medium. Thus, quantitating the magnitude of induction as the ratio of proinsulin secreted in 25 mM glucose/proinsulin secreted in 5.6 mM glucose, 25 mM glucose alone increased proinsulin secretion 1.8-fold in the absence of zinc, but inductions of 2.2-fold (p = 0.0001), 2.1-fold (p = 0.002) and 3.2-fold (p < 0.0001) were achieved when 20, 40 and 60 μM zinc, respectively, were combined with 25 mM glucose. Furthermore, proinsulin secretion to 25 mM glucose and 60 μ zinc combined was 34-fold higher than in the presence of 5.6 mM glucose alone. In the same experiment, 25 mM glucose alone and 60 μM zinc alone stimulated proinsulin production 2-fold and 13-fold, respectively. Similarly, 25 mM glucose and 60 μM zinc combined induced a 29-fold increase in proinsulin secretion, whereas 25 mM glucose alone and 60 μM zinc alone increased proinsulin secretion 1.8-fold and 9-fold, respectively. Taken together, these data document a highly synergistic effect of combining zinc and glucose in stimulating proinsulin production by Chang-hproins-6 cells.

In vivo secretion

Scid and Balb/c mice implanted with 10⁸ Chang-hproins-6 cells in the peritoneal cavity had increased basal levels of serum proinsulin over control mice. These levels increased 2.0-fold (p = 0.0007) and 1.5-fold (p = 0.005) in scid and Balb/c mice, respectively, that also received daily intraperitoneal injections of 400 μl 75 μM zinc sulfate (scid) or 300 μl 150 μM zinc sulfate (Balb/c) (Table 1). Daily glucose injections (500 μl 50 mM glucose, intraperitoneal) to Balb/c mice implanted with 10⁸ Chang-hproins-6 cells increased serum proinsulin concentrations 1.3-fold (p = 0.04) (Table 1). These results clearly show that the capacity of Chang-hproins-6 cells for regulated proinsulin production in vifro was retained in vivo, unlike all other attempts to date that have failed to demonstrate regulated insulin secretion in vivo by engineered hepatocytes (Tuch et al, 1998; Chen et al, 2000).

TABLE l¹ Zinc- and glucose-induced proinsulin secretion in vivo

Data are means and SEM of proinsulin concentrations (pM) of mouse sera assayed in duplicate, p values refer to the difference in each experiment between Groups B and C.

Group B mice were implanted in the peritoneal cavity with 10 Chang-hproins-6 cells suspended in 400-500 μl phosphate-buffered saline (PBS) on day 1, followed by once daily intraperitoneal injections of PBS (300-500 μl) on days 2 and 3. Group C mice were implanted in the peritoneal cavity with 10⁸ Chang-hproins-6 cells suspended in 400-500 μl zinc- or glucose-containing PBS on day 1 : cells implanted into scid mice (Animal Resources Centre, Western Australia) were suspended in 75 μM zinc sulfate, while cells implanted into Balb/c mice (Laboratory Animals Centre, Singapore) were suspended in either 150 μM zinc sulfate or 50 mM glucose. On days 2 and 3, each mouse in Group C received once daily intraperitoneal injections of one of the following solutions: 400 μl 75 μM zinc sulfate in PBS (scid); 300 μl 150 μM zinc sulfate in PBS (Balb/c); 500 μl 50 mM glucose in PBS (Balb/c). Group B mice received only PBS injections on days 2 and 3. Group A mice received identical treatments as Group C mice except that an identical volume of PBS was injected into the peritoneal cavity instead of Chang-hproins-6 cells on day 1. Balb/c mice received daily intramuscular injections of FK506 (Fujisawa Ireland) (3 mg/kg) throughout beginning on day -3 (zinc induction) or day -4 (glucose induction).

EXAMPLE 3 Maintenance and transfection ofC2C12 cells

C2C12 myoblasts are propagated in DMEM containing 10% v/v FCS. Transfections are performed essentially as described above for Chang cells.

EXAMPLE 4 Proinsulin/insulin secretion by Chang cells

Six clonal cultures of stably transfected Chang cells were studied for proinsulin secretory capacity. The control clonal culture was derived from Chang cells stably transfected with the backbone plasmid DNA canying the same selectable markers, i.e. neomycin resistance and herpes simplex virus thymidine kinase genes but lacking human metallothionein sequences, carbohydrate response element (ChoRE) and human proinsulin cDNA. Table 2 shows that Chang cells transfected with the plasmid backbone alone did not acquire the capacity for proinsulin production (i.e. behaved like untransfected cells). In contrast, five of the six clonal cultures stably transfected with Construct A were proinsulin secreting, among which Clone 6 was most active. This clone was selected for all subsequent studies of stable transfection.

TABLE T

Zinc-induction of proinsulin secretion by clonal cultures of Chang cells. Data are the means and SEM of proinsulin concentrations in pM. Control culture was a clonal expansion of Chang cells stably transfected with a control plasmid, pPNT, that carried selection markers (neomycin resistance and HSV thymidine kinase) only.

Conditioned media were harvested after 48 hours in the stated conditions. The significance of the difference between mean values in the absence and presence of zinc was determined by Student's unpaired t test.

Notwithstanding the different levels of hormone production, all five positive clonal cultures increased proinsulin secretion by 4.5- to 7.4-fold in the presence of 50 μM zinc.

The concentration of zinc for optimal induction of proinsulin secretion was next investigated (Figure 4A). These data clearly showed that while zinc induced proinsulin secretion in conditions of both high (25 mM) and medium (5.6 mM) glucose concentrations in the growth medium, two differences emerged. First, 90 μM zinc was toxic to Chang cells grown in DMEM containing 25 mM glucose leading to a precipitous decline in proinsulin secretion secondary to a severe loss of cell viability. The same concentration of zinc, in contrast, was not cytotoxic when the same cells were grown in DMEM containing 5.6 mM glucose. Under the latter conditions, the data in Figure 4A clearly indicate that proinsulin secretion was not maximally induced even at 90 μM zinc. Second, proinsulin secretion was induced at lower concentrations of zinc in high glucose (25 mM) growth medium compared with the response curve that was shifted to the right (i.e. less sensitive to zinc) under conditions of moderate glucose (5.6 mM) concentration in the growth medium (Figure 4A). Thus, independent of any effect of glucose itself on proinsulin secretion, a high ambient glucose concentration sensitized cells to increase proinsulin output at lower concenfrations of zinc. This sensitizing effect of glucose on zinc induction in this system could clearly be advantageous in gaining better control of hyperglycemia. Moreover, concentrations of zinc (10-20 μM) that stimulated proinsulin secretion when ambient glucose levels were high (i.e. 25 mM) (Figure 4A) are physiological for human subjects in whom the range of normal zinc serum concentrations is 11.5-18.5 μM. The time course of proinsulin accumulation in the conditioned medium was defined (Figure 5). Proinsulin concentration increased progressively even up to 48 hours in the presence of 60 μM zinc. Detectable proinsulin accumulation had occuned by 8 hours, and by 48 hours had increased 54.4-fold over proinsulin accumulated at 4 hours.

TABLE 3³

Induction of proinsulin secretion by zinc in transiently transfected Chang cells. Chang cells transiently transfected with Construct B or C were grown in serum-free DMEM containing 25 mM glucose for 48 hours in the absence or presence of 20 μM zinc. Data are means and SEM of proinsulin concentration in pM from duplicate or triplicate wells. The significance of the difference between mean values in the absence and presence of zinc was determined by Student's unpaired t test.

Table 3 shows that zinc inducible proinsulin secretion was also obtained under conditions of transient expression. A striking feature of transiently transfected Chang cells was their considerably higher proinsulin secretion compared to stably fransfected cells. Possible reasons for this are the expression of multiple copies of the genetic construct under conditions of transient transfection and the absence of genome silencing effects on transiently expressed genes.

The responsiveness of the genetically modified Chang cells to ambient glucose concentrations was investigated under conditions of moderate (5.6 mM) and high (25 mM) glucose concentrations. Figure 6 summarizes data from five separate experiments which consistently showed that high glucose concentration alone induced proinsulin secretion by 1.5 to 1.7-fold in the absence of zinc.

Glucose-inducible cell lines previously reported by laboratories have been generally characterized by a peak response to sub-physiological glucose concentrations. Stably transfected Chang cells were tested at a range of glucose concentrations from 3.5 to 25 mM for induction of proinsulin secretion. Figure 4 shows that all glucose concentrations tested except 5 mM and 10.5 mM induced significant increases in proinsulin secretion over that obtained at 3.5 mM glucose (p<0.03). This profile of glucose-inducible proinsulin expression more closely approximates physiological regulation than any other so far described. Isolated rat islets and perfused rat pancreas was reported to secrete insulin at a threshold glucose concentration of 5-6 mM, and to have half-maximal and maximal responses at 9-11 mM and 15-20 mM, respectively.

The duration for which stably transfected Chang cells were capable of secreting proinsulin into the growth medium was documented by growth in zinc- and serum-free DMEM for 48 hours. Data shown are the mean values of proinsulin (in finoles) secreted by fully confluent cells in each well of a 24-well plate. Significant accumulation had occuned by 40 minutes compared to proinsulin levels after 10 minutes (p<0.036).

Physiological insulin secretagogues apart from glucose are known to stimulate insulin release from pancreatic islets. It was of interest to investigate if non-glucose secretagogues were also active in the modified Chang cells. Figure 9 summarizes data that demonstrate the effect of such secretagogues on stably transfected Chang cells. Sucrose was notably ineffective while all other sugars tested were active in increasing proinsulin secretion although none surpassed the stimulatory effect of glucose itself (Figures 9A and B). Leucine, a known amino acid secretagogue, had a more modest effect in inducing proinsulin secretion compared to the sugars tested.

Figure 11 summarizes a series of experiments that examined the effect on proinsulin secretion of the combined presence of zinc and high glucose concentrations. A synergistic effect was obtained when the magnitude of increase in proinsulin concentration was expressed as a ratio based either on the level of stimulation obtained with 25 mM glucose or on the highest induction of proinsulin obtained (i.e. at any glucose concentration). Table 4 shows the trend to greater stimulation of proinsulin secretion when increasing concentrations of zinc were combined with glucose.

TABLE 4⁴

Synergism of the combined effects of zinc and glucose on proinsulin induction. Experimental details as in the legend to Figure 11.

EXAMPLE 5 Insulin secretion by C2C12 cells

Rat insulin was undetectable in the conditioned media of wild type C2C12 myoblasts (transfected with 0.5 μg pCMV/3 alone) whether cultured in 5.6 mM or 25 mM glucose. 25 mM glucose increased rat insulin secretion slightly in myoblasts transfected with Construct G and to a higher degree with H and J. However, only the increase induced by Construct J reached statistical significance. Staining for /3-galactosidase activity showed comparable efficiencies of transfection in all wells. These preliminary data indicate that the carbohydrate response element is capable of mediating glucose responsiveness when linked to a constitutive promoter and further suggests that its position relative to the promoter (i.e. upstream or downstream) may be functionally important. Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds refened to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

BIBLIOGRAPHY

Altschul et al. (1997) Nucl. Acids Res. 25:3389.

Ausubel et al. (1994-1998) "Cunent Protocols in Molecular Biology" John Wiley & Sons hie, Chapter 15.

Bonner and Laskey (1974) Eur. J. Biochem. 46: 83.

Chen R, Meseck M, McEvoy RC, Woo SLC. Glucose-stimulated and self-limiting insulin production by glucose 6-phosphatase promoter driven insulin expression in hepatoma cells. Gene Ther. 2000; 7:1802-1809.

Efrat S, Tal M, Lodish HF (1994) The pancreatic β-cell glucose sensor. Trends Biochem. Sci. 79:535-538.

Foster DW (1998) Diabetes mellitus. In Harrison's Principles of Internal Medicine (Eds. AS Fauci, et al.) 14^th edition, pp. 2060-2081, McGraw-Hill.

Henquin JC (1994) Cell biology of insulin secretion. In Joslins's Diabetes Mellitus (Eds. Kahn CR and Weir GC) 13^th edition, pp. 56-80, Lea & Febiger.

Kaytor EN, Shih HM and Towle HC (1997) Carbohydrate regulation of hepatic gene expression. J. Biol. Chem. 272:7525-7531.

Malaisse W, Malaisse-Lagae F and Wright PH (1967) A new method for the measurement in vitro of pancreatic insulin secretion. Endocrinology 50:99-108.

Marmur and Doty (1962) J. Mol. Biol. 5: 109. Shih HM, Liu Z and Towle HC (1995) Two CACGTG motifs with proper spacing dictate the carbohydrate regulation of hepatic gene transcription. J. Biol. Chem. 270:21991-21997.

Skelly RH, Schuppin GT, Ishihara H, Oka Y and Rhodes CJ (1996) Glucose-regulated translational control of proinsulin biosynthesis with that of proinsulin endopeptidases PC2 and PC3 in the insulin-producing MIN6 cell line. Diabetes 45:37-43.

Tuch BE et al. (1998) Transplantation of genetically engineered insulin-producing hepatocytes into immunoincompetent mice. Transplant. Proc. 30:473.

Claims

1. A genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

2. A genetic construct according to Claim 1 wherein the nucleotide sequences encode insulin.

3. A genetic construct according to Claim 1 wherein the nucleotide sequence encodes a precursor of insulin.

4. A genetic construct according to Claim 3 wherein the insulin precursor carries the an endoproteolytic site to permit cleavage to insulin.

5. A genetic construct according to Claim 1 or 3 or 4 wherein the insulin precursor is encoded by the nucleotide sequence as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions.

6. A genetic construct according to Claim 4 or 5 wherein the endoproteolytic site is cleavable by furin.

7. A genetic construct according to any one of the preceding claims wherein the cis acting element is a metal and/or carbohydrate response elements.

8. A genetic construct according to Claim 7 wherein the cis acting element is a metal response element.

9. A genetic construct according to Claim 7 wherein the cis acting element is a carbohydrate element.

10. A genetic construct according to Claim 9 wherein the carbohydrate response element is present in multiple copies.

11. A genetic construct according to Claim 10 comprising from about 2 to about 10 copies of the carbohydrate response element.

12. A genetic construct according to Claim 11 comprising from about 2 to about 6 copies of the carbohydrate response element.

13. A genetic construct according to any one of Claims 7 to 12 wherein the carbohydrate response element comprises a nucleotide sequence set forth in SEQ ID NO:7 or a nucleotide sequence having at least 70%) similarity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO:7 or its complementary form under low stringency conditions.

14. A genetic constructing according to Claim 7 wherein the metal response element is a zinc response element.

15. A genetic construct according to Claim 1 for use in non-pancreatic cells.

16. A genetic construct according to Claim 15 wherein the non-pancreatic cells are myoblast, myofibre and/or muscle tissue cells, hepatocytes, liver cells or liver tissue or progenitor or multipotent cells differentiated into cells suitable as recipients of said construct.

17. A genetic construct according to Claim 1 selected from the list consisting of constructs A to N and Z in Figures 1 A to 10 or functional and/or structural equivalents thereof.

18. A genetic construct comprising a nucleotide sequence encoding a precursor of insulin or a functional derivative or homologue thereof which precursor of insulin carries an endoproteolytic site to permit cleavage to insulin, said nucleotide sequence substantially as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

19. A genetic construct according to Claim 18 wherein the nucleotide sequences encode insulin.

20. A genetic construct according to Claim 18 wherein the nucleotide sequence encodes a precursor of insulin.

21. A genetic construct according to Claim 20 wherein the insulin precursor carries the an endoproteolytic site to permit cleavage to insulin.

22. A genetic construct according to Claim 18 or 20 or 21 wherein the insulin precursor is encoded by the nucleotide sequence as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions.

23. A genetic construct according to Claim 21 or 22 wherein the endoproteolytic site is cleavable by furin.

24. A genetic construct according to any one of the preceding claims wherein the cis acting element is a metal and/or carbohydrate response elements.

25. A genetic construct according to Claim 24 wherein the cis acting element is a metal response element.

26. A genetic construct according to Claim 24 wherein the cis acting element is a carbohydrate element.

27. A genetic construct according to Claim 26 wherein the carbohydrate response element is present in multiple copies.

28. A genetic construct according to Claim 27 comprising from about 2 to about 10 copies of the carbohydrate response element.

29. A genetic construct according to Claim 28 comprising from about 2 to about 6 copies of the carbohydrate response element.

30. A genetic construct according to any one of Claims 24 to 29 wherein the carbohydrate response element comprises a nucleotide sequence set forth in SEQ ID NO: 7 or a nucleotide sequence having at least 70% similarity thereto or a nucleotide sequence capable of hybridizing to SEQ ID NO: 7 or its complementary form under low stringency conditions.

31. A genetic constructing according to Claim 24 wherein the metal response element is a zinc response element.

32. A genetic construct according to Claim 18 for use in non-pancreatic cells.

33. A genetic construct according to Claim 32 wherein the non-pancreatic cells are myoblast, myofibre and/or muscle tissue cells, hepatocytes, liver cells or liver tissue or progenitor or multipotent cells differentiated into cells suitable as recipients of said construct.

34. A genetic construct according to Claim 18 selected from the list consisting of constructs A to N and Z in Figures 1 A to 10 or functional and/or structural equivalents thereof.

35. A genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said precursor form canying a proteolytic cleavage site to cleave the molecule to insulin, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form of the promoter which promoter is regulatable by one or more metal and/or carbohydrate response elements to provide regulatable insulin/precursor insulin synthesis and secretion from a target cell, said genetic construct optionally further comprising a nucleotide sequence encoding a proteolytic enzyme capable of cleaving the precursor form of insulin to produce insulin.

36. A method for the treatment or prophylaxis of diabetes in a mammal, said method comprising administering to said mammal an effective amount of a genetic construct comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

37. A method of treatment according to Claim 36 wherein the mammal is a human.

38. A method of treatment according to Claim 37 wherein the insulin precursor carries the an endoproteolytic site to permit cleavage to insulin.

39. A method of treatment according to Claim 37 or 38 wherein the insulin precursor is encoded by the nucleotide sequence as set forth in SEQ ID NO:l or a nucleotide sequence having at least about 60% similarity after optimal alignment or a nucleotide sequence capable of hybridizing to SEQ ID NO:l or to a complementary strand thereof under low stringency conditions.

40. A method of treatment according to Claim 39 wherein the endoproteolytic site is cleavable by furin.

41. A method of freatment according to any one of Claims 38 to 40 wherein the cis acting elements comprise metal and/or carbohydrate response elements.

42. A method of treatment according to Claim 41 wherein the metal response element is a zinc response element.

43. A method of treatment according to Claim 36 for use in non-pancreatic cells.

44. A method of treatment according to Claim 36 selected from the list consisting of constructs A to N and Z in Figures 1A to 1O or functional and/or structural equivalents thereof.

45. A composition comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or with another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the confrolled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor, said composition further comprising one or more pharmaceutically acceptable earners and/or diluents.

46. A genetically modified animal which comprises non-pancreatic cells capable of producing insulin or a precursor thereof or a derivative or homologue of insulin or its precursor.

47. A mammalian cell comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor.

48. Use of genetically modified cells, said cells comprising a nucleotide sequence encoding insulin or a precursor thereof or a functional derivative or homologue of insulin or its precursor, said nucleotide sequence operably linked to a promoter or functional derivative, homologue or hybrid form, the function of which promoter is regulatable by one or more cis and/or trans acting elements associated with the genetic construct or another genetic construct or associated with the genome of a host mammalian cell wherein said genetic construct when introduced into a mammalian cell is capable of the controlled production of insulin or a precursor thereof or a derivative or homologue of said insulin or its precursor in the treatment or the prophylaxis of diabetes mellitus or a related condition.