WO2001070813A2 - REGULATION OF HUMAN GluR5-LIKE RECEPTOR - Google Patents

REGULATION OF HUMAN GluR5-LIKE RECEPTOR Download PDF

Info

Publication number
WO2001070813A2
WO2001070813A2 PCT/EP2001/003335 EP0103335W WO0170813A2 WO 2001070813 A2 WO2001070813 A2 WO 2001070813A2 EP 0103335 W EP0103335 W EP 0103335W WO 0170813 A2 WO0170813 A2 WO 0170813A2
Authority
WO
WIPO (PCT)
Prior art keywords
gr5lr
polypeptide
polynucleotide
activity
test compound
Prior art date
Application number
PCT/EP2001/003335
Other languages
French (fr)
Other versions
WO2001070813A3 (en
Inventor
Shyam Ramakrishnan
Original Assignee
Bayer Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Aktiengesellschaft filed Critical Bayer Aktiengesellschaft
Priority to AU2001252232A priority Critical patent/AU2001252232A1/en
Priority to EP01925504A priority patent/EP1290025A2/en
Publication of WO2001070813A2 publication Critical patent/WO2001070813A2/en
Publication of WO2001070813A3 publication Critical patent/WO2001070813A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the invention relates to the area of regulation of glutamate-gated ion channel receptors. More particularly, the invention relates to the regulation of human GluR5- like receptors to increase or decrease excitatory neurotransmission at synapses.
  • Another embodiment of the invention is a method of screening for agents which decrease the activity of GR5LR.
  • a test compound is contacted with a polynucleotide encoding a GR5LR polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 ;
  • Another embodiment of the invention is a method of screening for agents which regulate the activity of GR5LR.
  • a test compound is contacted with a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and
  • a GR5LR activity of the polypeptide is detected.
  • a test compound which increases GR5LR activity of the polypeptide relative to GR5LR activity in the absence of the test compound is thereby identified as a potential agent for increasing the activity of GR5LR.
  • a test compound which decreases GR5LR activity of the polypeptide relative to GR5LR activity in the absence of the test compound is thereby identified as a potential agent for decreasing the activity of GR5LR.
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3;
  • nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
  • GR5LR activity in the cell is thereby decreased.
  • the invention thus provides reagents and methods for regulating the high affinity binding of GluR5-like receptor (GR5LR) to kainate.
  • GR5LR GluR5-like receptor
  • Such reagents and methods can be used inter alia, to treat or prevent epilepsy, schizophrenia and other mood disorders, neurodegenerative diseases such as Huntington's disease and Alzheimer's disease, ischemia, and pain.
  • Fig. 1 shows the DNA-sequence encoding a GR5LR polypeptide.
  • the invention relates to an isolated polynucleotide encoding a GR5LR polypeptide and being selected from the group consisting of: - , . a) a polynucleotide encoding a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
  • Human GR5LR polypeptides according to the invention comprise an amino acid sequence as shown in SEQ ID NO:2, a portion of that amino acid sequence, or a biologically active variant.
  • SEQ ID NO:l or 3 is a nucleotide sequence which encodes SEQ ID NO:2.
  • a GR5LR polypeptide can be a portion of a receptor molecule, a full-length GR5LR molecule, or a fusion protein comprising all or a portion of a GR5LR molecule.
  • a GR5LR polypeptide has a kainate receptor binding activity. Kainate receptor binding activity can be measured, ter alia, as described in Example 2.
  • Amino acid insertions or deletions are changes to or within an amino acid sequence.
  • GR5LR polypeptides typically fall in the range of about 1 to 5 amino acids.
  • Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a GR5LR polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active GR5LR polypeptide can readily be determined by assaying for GR5LR binding activity, as described, for example, in Example 2.
  • the second protein segment can be a full-length protein or a protein fragment or polypeptide.
  • Proteins commonly used in fusion protein construction include ⁇ - galactosidase, ⁇ -glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT).
  • a fusion protein also can be engineered to contain a cleavage site located between the GR5LR polypeptide-encoding sequence and the heterologous protein sequence, so that the GR5LR polypeptide can be cleaved and purified away from the heterologous moiety.
  • Species homologs of human GR5LR can be obtained using GR5LR polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of GR5LR, and expressing the cDNAs as is known in the art.
  • GR5LR Polynucleotides described below to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of GR5LR, and expressing the cDNAs as is known in the art.
  • Variants of' human GR5LR polynucleotides or GR5LR polynucleotides of other species can therefore be identified by hybridizing a putative homologous GR5LR polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or 3 or the complement thereof to form a test hybrid.
  • the melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising GR5LR polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated. ⁇
  • Nucleotide sequences which hybridize to GR5LR polynucleotides or their complements following stringent hybridization and/or wash conditions also are provided.
  • Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
  • a naturally occurring GR5LR polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids.
  • Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated GR5LR polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise GR5LR nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
  • filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters.
  • the filters are hybridized with the labeled probe using hybridization conditions described by Davis et al., 1986.
  • the partial sequences, cloned into lambda or pBluescript can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification.
  • the resulting autoradiograms are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque.
  • the colonies or plaques are selected and expanded, and the DNA is isolated from the colonies for further analysis and sequencing.
  • GR5LR polypeptides can be purified, for example, from human neuronal cells or cell lines or from cells which have been transfected with a GR5LR polynucleotide.
  • a purified GR5LR polypeptide is separated from other compounds which normally associate with the GR5LR polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis.
  • Purification of recombinant GluR5, a similar receptor is taught in Bettler et al, Neuron. 5, 583-595 (1990).
  • a preparation of purified GR5LR polypeptides is at least 80% pure; preferably, the preparations are
  • a GR5LR polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence.
  • Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding GR5LR polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y, 1989.
  • a variety of expression vector/host systems can be utilized to contain and express sequences encoding a GR5LR polypeptide.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
  • microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors
  • yeast transformed with yeast expression vectors insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus,
  • control elements or regulatory sequences are those non-translated regions of the vector ⁇ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity.
  • any number of suitable transcription and translation elements including constitutive and inducible promoters, can be used.
  • inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used.
  • the baculovirus polyhedrin promoter can be used in insect cells.
  • Promoters or enhancers derived from the genomes of plant cells e.g., heat shock, RUBISCO, and storage protein genes
  • plant viruses e.g., viral promoters or leader sequences
  • promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a GR5LR polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.
  • pIN vectors Van Heeke & Schuster, J Biol. Chem. 264, 5503- 5509, 1989 or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • Proteins made in such systems can be designed to include 'heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
  • yeast Saccharomyces cerevisiae a number of vectors containing constitutive or inducible promoters, such as alpha factor, alcohol oxidase, and PGH, can be used.
  • constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH
  • sequences encoding GR5LR polypeptides can be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987).
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671- 1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Prohl. Cell Differ. 17, 85-105, 1991).
  • constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection.
  • pathogen-mediated transfection Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murry, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
  • An insect system also can be used to express a GR5LR polypeptide.
  • Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • Sequences encoding GR5LR polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter.
  • Successful insertion of GR5LR polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • the recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which GR5LR polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
  • a number of viral-based expression systems can be used to express GR5LR polypeptides in mammalian host cells.
  • sequences encoding GR5LR polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a GR5LR polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655- 3659, 1984).
  • transcription enhancers such as the Rous sarcoma virus
  • RSV mammalian host cells
  • HACs Human artificial chromosomes
  • RACs Human artificial chromosomes
  • HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
  • a host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed GR5LR polypeptide in the desired fashion.
  • modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.
  • Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding, and/or function.
  • any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tic or aprtr cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci.
  • Visible markers such as anthocyanins, ⁇ -glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
  • a marker gene can be placed in tandem with a sequence encoding a GR5LR polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of a GR5LR polynucleotide.
  • host cells which contain a GR5LR polynucleotide and which express a GR5LR polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein.
  • the presence of a polynucleotide sequence encoding a GR5LR polypeptide can be detected by DNA- DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding the GR5LR polypeptide.
  • Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding the GR5LR polypeptide to detect transformants which contain a GR5LR polynucleotide.
  • Host cells transformed with nucleotide sequences encoding a GR5LR polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used.
  • expression vectors containing polynucleotides which encode GR5LR polypeptides can be designed to contain signal sequences which direct secretion of GR5LR polypeptides through a prokaryotic or eukaryotic cell membrane.
  • purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan. modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.).
  • cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the GR5LR polypeptide also can be used to facilitate purification.
  • One such expression vector provides for expression of a fusion protein containing a GR5LR polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif.
  • enterokinase cleavage site provides a means for purifying the GR5LR polypeptide from the fusion protein.
  • Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
  • Sequences encoding a GR5LR polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Niicl. Acids Res.
  • GR5LR polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid- phase techniques (Merrif ⁇ eld, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge eta , Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer).
  • fragments of GR5LR polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
  • the newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983).
  • the composition of a synthetic GR5LR polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the GR5LR polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
  • codons preferred by a particular 1 prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
  • Antibody as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab') 2 , and Fv, which are capable of binding an epitope of a GR5LR polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope.
  • An antibody which specifically binds to an epitope of a GR5LR polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots,
  • ELISAs ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art.
  • Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
  • BCG Bacilli Calmette-Gueriri
  • Corynebacterium parvum are especially useful.
  • Monoclonal and other antibodies also can be "humanized” to prevent a patient from mounting an immune response against the antibody when it is used therapeutically.
  • Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions.
  • humanized antibodies can be produced using recombinant methods,, as described in
  • single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to GR5LR polypeptides.
  • Antibodies with related specificity, but of distinct idiotypic composition can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
  • Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11).
  • Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
  • a nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below.
  • single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol. Meth. 165, 81- 91).
  • Antibodies which specifically bind to GR5LR polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Oriandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991).
  • Other types of antibodies can be constructed and used therapeutically in methods of the invention.
  • chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of GR5LR gene products in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
  • Modifications of GR5LR gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of a GR5LR gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a GR5LR polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent GR5LR nucleotides, can provide sufficient targeting specificity for GR5LR mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or "a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the . ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a GR5LR polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the GR5LR polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
  • the nucleotide sequence shown in SEQ ID NO:l and 3 and the complement provide sources of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
  • the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease GR5LR expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. l
  • the invention provides assays for screening test compounds which bind to or modulate the binding activity of a GR5LR polypeptide or a GR5LR polynucleotide.
  • a test compound preferably binds to a GR5LR polypeptide or polynucleotide. More preferably, a test compound decreases a GR5LR kainate binding activity of a GR5LR polypeptide or expression of a GR5LR polynucleotide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
  • Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity.
  • the compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound” library method, and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
  • Test compounds can be screened for the ability to bind to GR5LR polypeptides or polynucleotides or to affect GR5LR kainate binding activity or GR5LR gene expression using high throughput screening.
  • high throughput screening many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened.
  • the most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ⁇ l.
  • many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
  • free format assays or assays that have no physical barrier between samples, can be used.
  • an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994).
  • the cells are placed under agarose in peiri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose.
  • the combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
  • Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
  • test samples are placed in a porous matrix.
  • One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.
  • the test compound is preferably a small molecule which binds to and occupies the active site of a GR5LR polypeptide, thereby making the active site inaccessible to substrate such that normal biological binding activity is prevented.
  • test compound or the GR5LR polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the
  • GR5LR polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
  • binding of a test compound to a GR5LR polypeptide can be determined without labeling either of the interactants.
  • a microphysiometer can be used to detect binding of a test compound with a GR5LR polypeptide.
  • a microphysiometer e.g., CytosensorTM
  • a microphysiometer is an analytical instrument that measures the rate at which a cell acidifies its environment using a light- addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a GR5LR polypeptide.
  • LAPS light- addressable potentiometric sensor
  • a GR5LR polypeptide in yet another aspect of the invention, can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046- 12054, 1993; Barrel et al, Biotechniques 14, 920-924, 1993; Iwabuchi et al,
  • the two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains.
  • the assay utilizes two different DNA ' constructs. For example, in one construct a polynucleotide encoding a GR5LR polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein (“prey" or "sample”) can be fused to a polynucleotide that codes for the activation domain of the known transcription factor.
  • a DNA sequence that encodes an unidentified protein "prey" or "sample”
  • Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the GR5LR polypeptide.
  • a GR5LR polypeptide or polynucleotide
  • the test compound can be bound to a solid support.
  • Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads).
  • any method known in the art can be used to attach the GR5LR polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide or test compound and the solid support.
  • Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a GR5LR polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
  • a GR5LR polypeptide is a fusion protein comprising a domain that allows the GR5LR polypeptide to be bound to a solid support.
  • glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non- adsorbed GR5LR polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
  • antibodies which specifically bind to a GR5LR polypeptide, polynucleotides, or a test compound, but which do not interfere with a desired binding site, such as the active site of the GR5LR polypeptide can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
  • GST-immobilized complexes include immunodetection of complexes using antibodies which specifically bind to a GR5LR polypeptide or test compound, enzyme-linked assays which rely on detecting a GR5LR activity of the GR5LR polypeptide, and SDS gel electrophoresis under non-reducing conditions.
  • Any cell which comprises a GR5LR polynucleotide or polypeptide can be used in a cell-based assay system.
  • a GR5LR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • An intact cell is contacted with a test compound. Binding of the test compound to a GR5LR polypeptide or polynucleotide is determined as described above, after lysing the cell to release the GR5LR polypeptide-or polynucleotide-test compound complex.
  • Test compounds can be tested for the ability to increase or decrease GR5LR binding activity of a GR5LR polypeptide.
  • GR5LR binding can be measured, for example, by contacting either a purified GR5LR polypeptide, a cell extract, or an intact cell with a test compound.
  • a test compound which decreases GR5LR binding to kainate by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential antagonist of the receptor.
  • a test compound which increases GR5LR binding to kainate by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agonist of the receptor.
  • test compounds which increase or decrease GR5LR gene expression are identified.
  • a GR5LR polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the GR5LR polynucleotide is determined.
  • the level of expression of GR5LR mRNA or polypeptide in the presence of the test compound is compared to the level of expression of GR5LR mRNA or polypeptide in the absence of the test compound.
  • the test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of GR5LR mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of GR5LR mRNA or polypeptide expression.
  • the level of GR5LR mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptides. Either qualitative or quantitative methods can be used.
  • the presence of polypeptide products of a GR5LR polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry.
  • polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a GR5LR polypeptide. Such screening can be carried out either in a cell-free assay system or in an intact cell.
  • Any cell which expresses a GR5LR polynucleotide can be used in a cell-based assay system.
  • the GR5LR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above.
  • Either a primary culture or an established cell line, including cell lines such as the HCN-1A, HCN-2, CATH.a, Neuro-2a, and PC 12 (Clontech), can be used.
  • compositions of the invention can comprise, for example, a GR5LR polypeptide, GR5LR polynucleotide, antibodies which specifically bind to GR5LR activity, or mimetics, agonists, antagonists, or inhibitors of GR5LR activity.
  • the compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water.
  • the compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
  • compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means.
  • Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
  • compositions for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen.
  • disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
  • Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • suitable coatings such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
  • Push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol.
  • Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers.
  • the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
  • compositions suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline.
  • Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • suspensions of the active compounds can be prepared as appropriate oily injection suspensions.
  • Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.
  • Non-lipid polycationic amino polymers also can be used for delivery.
  • the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
  • the pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms.
  • compositions After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.
  • Parkinsonism linked to chromosome 17, frontotemporal dementias including Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld- Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis also can be treated.
  • cognitive-related disorders such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities, by regulating the activity of Glutamate receptors.
  • glutamatergic transmission in the spinal cord is essential for bladder and urethral sphincter reflexes and for the spinal processing of afferent input from the urinary bladder.
  • Both NMD A and non-NMDA glutamatergic receptors have been implicated in transmission between the brain micturition center and the spinal preganglionic neurons. These receptors also mediate excitatory transmission between interneurons and preganglionic neurons.
  • Glutamate has also been identified as a mediator of a spinal micturition reflex pathway triggered by perineal afferents in neonatal rats and by bladder distension in adult paraplegic rats. Non-NMDA receptors are involved in these pathways.
  • glutamate is likely to be involved at various sites in the micturition reflex pathway and antagonizing glutamate receptor may have the clinical relevance to the therapy of urinary incontinence.
  • Glutamate is involved in epileptogenesis. Overstimulation of glutamate receptors can lead to seizures and excitotoxin injury throughout the CNS and in particular the hippocampus. Antagonists of GR5LR can act to prevent or treat epilepsy.
  • the reagent is delivered using a liposome.
  • the liposome is stable in the animal into which it has been administered for at least about
  • a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
  • Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol.
  • a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.
  • antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery.
  • Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci.
  • a polynucleotide encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun,” and DEAE- or calcium phosphate-mediated transfection.
  • Effective in vivo dosages of an antibody are in the range of about 5 ⁇ g to about 50 ⁇ g/kg, about 50 ⁇ g to about 5 mg/kg, about 100 ⁇ g to about 500 ⁇ g kg of patient body weight, and about 200 to about 250 ⁇ g/kg of patient body weight.
  • effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ⁇ g to about 2 mg, about 5 ⁇ g to about 500 ⁇ g, and about 20 ⁇ g to about 100 ⁇ g of DNA.
  • the reagent is preferably an antisense oligonucleotide or a ribozyme.
  • Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
  • a reagent reduces expression of a GR5LR gene or the binding activity of a GR5LR polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent.
  • the effectiveness of the mechanism chosen to decrease the level of expression of a GR5LR gene or the binding activity of a GR5LR polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to GR5LR-specific mRNA, quantitative RT-PCR, immunologic detection of a GR5LR polypeptide, or measurement of GR5LR binding activity.
  • any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents.
  • Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles.
  • the combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
  • a therapeutically effective dose refers to that amount of active ingredient which increases or decreases GR5LR binding activity relative to GR5LR binding activity which occurs in the absence of the therapeutically effective dose.
  • the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs.
  • the animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
  • Therapeutic efficacy and toxicity e.g., ED 50 (the dose therapeutically effective in
  • compositions which exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use.
  • the dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
  • the exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
  • Normal dosage amounts of any particular reagent can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration.
  • Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for polypeptides or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
  • any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.
  • the above disclosure generally describes the present invention, and all patents and patent applications cited in this disclosure are expressly incorporated herein. A more complete understanding can be obtained by reference to the following specific
  • the polynucleotide of SEQ ID NO: 1 or 3 is inserted into the expression vector pCEV4 and the expression vector ⁇ CEV4-GR5LR polypeptide obtained is transfected into human embryonic kidney 293 cells.
  • the cells are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C.
  • the pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 ⁇ g/ml aprotinin, 0.5 mg/ml leupeptin, and 10 ⁇ g/ml phosphoramidon.
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of an added radioligand, i.e. 125 I-labeled kainate, are added to 96-well polypropylene microtiter plates containing ligand, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125 I ligand.
  • Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration through GF B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program. Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. The GR5LR activity of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is demonstrated. EXAMPLE 2
  • Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human GR5LR protein are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO 4 , 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 %
  • Optimal membrane suspension dilutions defined as the protein concentration required to bind less than 10 % of the added radioligand, i.e. 125 I-labeled kainate, are added to 96-well polypropylene microtiter plates containing ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 ⁇ l.
  • Binding reaction mixtures are incubated for one hour at 30 °C.
  • the reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
  • GR5LR polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution.
  • GR5LR polypeptides comprise an amino acid sequence shown in SEQ ID NO:2.
  • the test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
  • Cellular membrane extracts from a human embryonic 293 kidney cells transfected with a GR5LR polynucleotide are contacted with test compounds from a small molecule library and assayed for GR5LR kainate binding activity. (Sommer et al. EMBO J. 11, 1651-1656, 1992). Control extracts in the absence of a test compound also are assayed.
  • test compound is administered to a culture of neuronal cells and incubated at 37 oC for 10 to 45 minutes.
  • a culture of the same type of cells incubated for the same time without the test compound provides a negative control.
  • RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979).
  • Northern blots are prepared using 20 to 30 ⁇ g total RNA and hybridized with a 32 P-labeled GR5LR-specific probe at 65°C in Express-hyb
  • the probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:l or 3.
  • a test compound which decreases the GR5LR-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of GR5LR gene expression.
  • a human embryonic 293 kidney cell line is transfected with a GR5LR polynucleotide.
  • Test compounds comprising potential GR5LR antagonists or agonists are prepared. Forty-eight hours after transfection, agonist-activated and antagonist-deactivated currents in the presence of kainate are measured using standard patch clamp techniques in the whole-cell configuration. See Sommers et al. EMBO J. 11, 1651-1656, 1992; Keinanen et al, Science. 249, 556-560 (1990);
  • test compounds that evoke currents in the presence of kainate are identified as agonists of GR5LR and compounds that depress currents in the presence of kainate are identified as antagonists of GR5LR.
  • oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate- buffered saline (PBS) at the desired concentration. Purity of these oligonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte
  • the antisense oligonucleotides are administered to a patient with epilepsy. The severity of the patient's epilepsy is decreased.
  • PCR polymerase chain reaction
  • mRNA messenger RNA
  • PCR on the cDNA a method called quantitative reverse transcription-polymerase chain reaction (quantitative RT-PCR).
  • RNA from different human tissues was performed to investigate the tissue distribution of GR6LR mRNA. 25 .mu.g of total RNA from various tissues (Human Total RNA Panel I-V, Clontech Laboratories, Palo Alto, CA,
  • First-strand cDNA synthesis was carried out according to the manufacturer's protocol using oligo (dT) to hybridize to the 3' poly A tails of mRNA and prime the synthesis reaction. 10 ng of the first-strand cDNA was then used as template in a polymerase chain reaction. The polymerase chain reaction was performed in a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN, USA), in the presence of the DNA-binding fluorescent dye SYBR Green I which binds to the minor groove of the DNA double helix, produced only when double-stranded DNA is successfully synthesized in the reaction (Morrison et al., 1998).
  • SYBR Green I Upon binding to double-stranded DNA, SYBR Green I emits light that can be quantitatively measured by the LightCycler machine.
  • the polymerase chain reaction was carried out using oligonucleotide primers LBRI019-L9 (TGAAGTGTCCGTATGCCTTGATAATCC) and LBRI019-R6
  • the level of housekeeping gene expression is considered to be relatively constant for all tissues (Adams et al., 1993, Adams et al., 1995, Liew et al., 1994) and therefore can be used as a gauge to approximate relative numbers of cells per .mu.g of total RNA used in the cDNA synthesis step. Except for the use of a slightly different set of housekeeping genes and the use of the LightCycler system to measure expression levels, the normalization procedure was essentially the same as that described in the RNA Master Blot User Manual, Apendix C (1997, Clontech Laboratories, Palo Alto, CA, USA).
  • Results are given below, showing the experimentally obtained copy numbers of mRNA per 10 ng of first-strand cDNA on the left and the normalized values on the right.
  • GR6LR shows high expression in the fetal brain and placenta, and a fairly broad, low expression level in most other tissues. Notably, however, expression in the fetal liver is nearly undetectable. This expression pattern is in keeping with the role of the fetal liver as primarily a source of glutamate and the placenta as an organ that captures a large proportion of the fetal plasma glutatmate, and thereby suggests that GR6LR may play an important role in prenatal uptake and metabolism of glutamate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Neurosurgery (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Neurology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Reagents and methods for regulating the high affinity binding of GluR5-like receptor (GR5LR) to kainate are provided. Such reagents and methods can be used inter alia, to treat or prevent urinary incontinence, epilepsy, schizophrenia and other mood disorders, neurodegenerative diseases such as Huntington's disease and Alzheimer's disease, ischemia, and pain.

Description

REGULATION OF HUMAN GluR5-LIKE RECEPTOR
TECHNICAL FIELD OF THE INVENTION The invention relates to the area of regulation of glutamate-gated ion channel receptors. More particularly, the invention relates to the regulation of human GluR5- like receptors to increase or decrease excitatory neurotransmission at synapses.
BACKGROUND OF THE INVENTION L-glutamate is the major excitatory neurotransmitter in the vertebrate central nervous system (CNS). L-glutamate opens cation channels that mediate fast excitatory synaptic responses and establish and maintain synaptic plasticity underlying learning and memory. These cation channels also mediate cell death resulting from excessive glutamate release in the CNS due to acute injury or environmental excitotoxins. Thus, glutamate receptors are involved in the developmental plasticity processes and long term potentiation. Further, the continuous activation of glutamate receptors can contribute to the pathogenesis of diseases such as ischemia, pain, epilepsy, schizophrenia, Huntington's disease, Parkinson's disease and Alzheimer's disease.
There are distinct ionotropic glutamate receptor subtypes: NMDA, AMPA-low affinity kainate, and high affinity kainate receptors. The AMPA-low affinity kainate and high affinity kainate receptors are referred to as non-NMDA receptors. GluR5 is a high affinity kainate glutamate receptor. GluR5 has a high affinity for domoate and kainate and is capable of forming homomeric channels that can be gated by domoate, kainate, L-glutamate, and AMPA. See Sommer et al, EMBO J. 11, 1651-1656,
1992; Bettler et al, Neuron. 5, 583-595, 1990.
Because of the role of glutamate in various pathologic disorders, there is a need in the art to identify members of the glutamate receptor family which can be regulated to provide a therapeutic effect. Ionotropic glutamate receptors are of critical importance to both central and peripheral nervous system and novel ionotropic glutamate receptors are therefore promising new targets for the treatment of nervous system disease, for example in primary and secondary disorders after brain injury, disorders of mood, anxiety disorders, disorders of thought and volition, disorders of sleep and wakefulness, diseases of the motor unit like neurogenic and myopathic disorders, neurodegenerative disorders like Alzheimer's and Parkinson's disease, disorders leading to peripheral and chronic pain.
SUMMARY OF THE INVENTION
It is an object of the invention to provide reagents and methods of regulating high affinity kainate receptors (GR5LR). These and other objects of the invention are provided by one or more of the embodiments described below.
One embodiment of the invention is a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
Yet another embodiment of the invention is a method of screening for agents which decrease the activity of GR5LR. A test compound is contacted with a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of:
amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2.
Binding between the test compound and the GR5LR polypeptide is detected. A test compound which binds to the GR5LR polypeptide is thereby identified as a potential agent for decreasing the activity of GR5LR.
Another embodiment of the invention is a method of screening for agents which decrease the activity of GR5LR. A test compound is contacted with a polynucleotide encoding a GR5LR polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1 ;
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3; and
the nucleotide sequence shown in SEQ ID NO: 3.
Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing the activity of GR5LR. The agent can work by decreasing the amount of the GR5LR through interacting with the GR5LR mRNA.
Another embodiment of the invention is a method of screening for agents which regulate the activity of GR5LR. A test compound is contacted with a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and
the amino acid sequence shown in SEQ ID NO: 2.
A GR5LR activity of the polypeptide is detected. A test compound which increases GR5LR activity of the polypeptide relative to GR5LR activity in the absence of the test compound is thereby identified as a potential agent for increasing the activity of GR5LR. A test compound which decreases GR5LR activity of the polypeptide relative to GR5LR activity in the absence of the test compound is thereby identified as a potential agent for decreasing the activity of GR5LR.
Even another embodiment of the invention is a method of screening for agents which decrease the activity of GR5LR. A test compound is contacted with a GR5LR product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1;
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3; and
the nucleotide sequence shown in SEQ ID NO: 3.
Binding of the test compound to the GR5LR product is detected. A test compound which binds to the GR5LR product is thereby identified as a potential agent for decreasing the activity of GR5LR. Still another embodiment of the invention is a method of reducing the activity of GR5LR. A cell is contacted with a reagent which specifically binds to a polynucleotide encoding a GR5LR polypeptide or the product encoded by the polynucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of:
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 1; and
the nucleotide sequence shown in SEQ ID NO: 1;
nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO: 3; and
the nucleotide sequence shown in SEQ ID NO: 3
GR5LR activity in the cell is thereby decreased.
The invention thus provides reagents and methods for regulating the high affinity binding of GluR5-like receptor (GR5LR) to kainate. Such reagents and methods can be used inter alia, to treat or prevent epilepsy, schizophrenia and other mood disorders, neurodegenerative diseases such as Huntington's disease and Alzheimer's disease, ischemia, and pain.
BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 shows the DNA-sequence encoding a GR5LR polypeptide.
Fig. 2 shows the amino acid sequence deduced from the DNA-sequence of
Fig.l. DETAILED DESCRIPTION OF THE INVENTION
The invention relates to an isolated polynucleotide encoding a GR5LR polypeptide and being selected from the group consisting of: - , . a) a polynucleotide encoding a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2. b) a polynucleotide comprising the sequence of SEQ ID NO: 1 or 3; c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b); d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code; and e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d).
Furthermore, it has been discovered by the present applicant that the binding of a
GluR5-like receptor (GR5LR) can be modified to increase or decrease binding of GR5LR to kainate. Human GR5LR is a high affinity kainate subtype of glutamate- gated channels.
Human GR5LR can be used to develop treatments for various diseases, to develop diagnostic assays for these diseases, and to provide new tools for basic research especially in the fields of medicine and biology. Specifically, the present invention can be used to develop new drugs to treat or prevent disease of the peripheral and central nervous system, in particular epilepsy, schizophrenia and other mood disorders, neurodegenerative diseases such as Huntington's disease and Alzheimer's disease, ischemia, pain and urinary incontince. GR5LR Polypeptides
Human GR5LR polypeptides according to the invention comprise an amino acid sequence as shown in SEQ ID NO:2, a portion of that amino acid sequence, or a biologically active variant. SEQ ID NO:l or 3 is a nucleotide sequence which encodes SEQ ID NO:2. Thus, a GR5LR polypeptide can be a portion of a receptor molecule, a full-length GR5LR molecule, or a fusion protein comprising all or a portion of a GR5LR molecule. Most preferably, a GR5LR polypeptide has a kainate receptor binding activity. Kainate receptor binding activity can be measured, ter alia, as described in Example 2.
Biologically Active Variants
GR5LR variants which are biologically active, i.e., retain a kainate receptor binding activity, also are GR5LR polypeptides. Preferably, naturally or non-naturally occurring GR5LR variants have amino acid sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to an amino acid sequence shown in SEQ ID NO:2. Percent identity between a putative GR5LR variant and an amino acid sequence of SEQ ID NO:2 is determined using the Blast2 alignment program.
Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.
Amino acid insertions or deletions are changes to or within an amino acid sequence.
They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of a GR5LR polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active GR5LR polypeptide can readily be determined by assaying for GR5LR binding activity, as described, for example, in Example 2.
Fusion Proteins
Fusion proteins can comprise at least 5, 6, 8, 10, 25, or 50 or more contiguous amino acids of an amino acid sequence shown in SEQ ID NO:2. Fusion proteins are useful for generating antibodies against GR5LR amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of a GR5LR polypeptide. Protein affinity chromatography or library-based assays for protein-protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.
A GR5LR fusion protein comprises two protein segments fused together by means of a peptide bond. The first protein segment comprises at least 5, 6, 8, 10, 25, or 50 or more contiguous amino acids of a GR5LR polypeptide. Contiguous amino acids for use in a fusion protein can be selected from the amino acid sequence shown in SEQ
ID NO:2 or from a biologically active variant of those sequences, such as those described above. The first protein segment also can comprise full-length GR5LR.
The second protein segment can be a full-length protein or a protein fragment or polypeptide. Proteins commonly used in fusion protein construction include β- galactosidase, β-glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horseradish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Additionally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV- G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP 16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the GR5LR polypeptide-encoding sequence and the heterologous protein sequence, so that the GR5LR polypeptide can be cleaved and purified away from the heterologous moiety.
A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two protein segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which comprises a coding sequence from SEQ ID NO:l or 3 in proper reading frame with nucleotides encoding the second protein segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).
Identification of Species Homologs
Species homologs of human GR5LR can be obtained using GR5LR polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of GR5LR, and expressing the cDNAs as is known in the art. GR5LR Polynucleotides
A GR5LR polynucleotide can be single- or double-stranded and comprises a coding sequence or the complement of a coding sequence for a GR5LR polypeptide. A partial coding sequence for a GR5LR polypeptide is shown in SEQ ID NO: 1 and 3.
Degenerate nucleotide sequences encoding human GR5LR polypeptides, as well as homologous nucleotide sequences which are at least about 50, preferably about 75, 90, 96, or 98% identical to the nucleotide sequence shown in SEQ ID NO:l or 3 also are GR5LR polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of -12 and a gap extension penalty of -2. Complementary DNA (cDNA) molecules, species homologs, and variants of GR5LR polynucleotides which encode biologically active GR5LR polypeptides also are GR5LR polynucleotides.
Identification of Variants and Homologs ofGR5LR Polynucleotides
Variants and homologs of the GR5LR polynucleotides described above also are GR5LR polynucleotides. Typically, homologous GR5LR polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known GR5LR polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions~2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each-homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15- 25% basepair mismatches, even more preferably 5-15% basepair mismatches.
Species homologs of the GR5LR polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of GR5LR polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the Tm of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81, 123 (1973). Variants of' human GR5LR polynucleotides or GR5LR polynucleotides of other species can therefore be identified by hybridizing a putative homologous GR5LR polynucleotide with a polynucleotide having a nucleotide sequence of SEQ ID NO:l or 3 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising GR5LR polynucleotides having perfectly complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated. ~
Nucleotide sequences which hybridize to GR5LR polynucleotides or their complements following stringent hybridization and/or wash conditions also are
GR5LR polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.
Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20 °C below the calculated Tm of the hybrid under study. The Tm of a hybrid between a GR5LR polynucleotide having a nucleotide sequence shown in SEQ ID NO:l or 3 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75, 90, 96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc. Natl. Acad. Sci. U.S.A. 48, 1390 (1962):
Tm = 81.5°C - 16.6(log10[Na+]) + 0.41(%G + C) - 0.63(%formamide) - 600/1), where / = the length of the hybrid in basepairs. Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0.5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.
Preparation ofGR5LR Polynucleotides
A naturally occurring GR5LR polynucleotide can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated GR5LR polynucleotides. For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise GR5LR nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70, 80, or 90% free of other molecules.
GR5LR cDNA molecules can be made with standard molecular biology techniques, using GR5LR mRNA as a template. GR5LR cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of GR5LR polynucleotides using either human genomic DNA or cDNA as a template.
Alternatively, synthetic chemistry techniques can be used to synthesize GR5LR polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode a GR5LR polypeptide having, for example, an amino acid sequence shown in SEQ ID NO:2 or a biologically active variant. Obtaining Full-Length GR5LR Polynucleotides
The partial sequence of SEQ ID NO:l or 3 or the complement can be used to identify the corresponding full length gene from which it was derived. The partial sequences can be nick-translated or end-labeled with 32P using polynucleotide kinase using labeling methods known to those with skill in the art (BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, eds., Elsevier Press, N.Y., 1986). For example, a lambda library prepared from human tissue can be screened directly with the labeled sequences of interest or the library can be converted en masse to pBluescript (Stratagene Cloning Systems, La Jolla, Calif. 92037) to facilitate bacterial colony screening (see Sambrook et al, 1989, pg. 1.20).
Both methods are well known in the art. Briefly, filters with bacterial colonies containing the library in pBluescript or bacterial lawns containing lambda plaques are denatured, and the DNA is fixed to the filters. The filters are hybridized with the labeled probe using hybridization conditions described by Davis et al., 1986. The partial sequences, cloned into lambda or pBluescript, can be used as positive controls to assess background binding and to adjust the hybridization and washing stringencies necessary for accurate clone identification. The resulting autoradiograms are compared to duplicate plates of colonies or plaques; each exposed spot corresponds to a positive colony or plaque. The colonies or plaques are selected and expanded, and the DNA is isolated from the colonies for further analysis and sequencing.
Positive cDNA clones are analyzed to determine the amount of additional sequence they contain using PCR with one primer from the partial sequence and the other primer from the vector. Clones with a larger vector-insert PCR product than the original partial sequence are analyzed by restriction digestion and DNA sequencing to determine whether they contain an insert of the same size or similar as the mRNA size determined from Northern blot Analysis. Once one or more overlapping cDNA clones are identified, the complete sequence of the clones can be determined, for example after exonuclease III digestion (McCombie et ah, Methods 3, 33-40, 1991). A series of deletion clones are generated, each of which is sequenced. The resulting overlapping sequences are assembled into a single contiguous sequence of high redundancy (usually three to five overlapping sequences at each nucleotide position), resulting in a highly accurate final sequence.
Various PCR-based methods can be used to extend the nucleic acid sequences encoding the disclosed portions of human GR5LR to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2, 318-322, 1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.
Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al, Nucleic Acids Res. 16, 8186, 1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68°-72° C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.
Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al, PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.
Another method which can be used to retrieve unknown sequences is that of Parker et al, Nucleic Acids Res. 19, 3055-3060, 1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA. This process avoids the need to screen libraries and is useful in finding intron/exon junctions.
When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5' regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d(T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5' non-transcribed regulatory regions.
Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e.g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample. Obtaining GR5LR Polypeptides
GR5LR polypeptides can be obtained, for example, by purification from human neuronal cells, by expression of GR5LR polynucleotides, or by direct chemical synthesis.
Protein Purification
GR5LR polypeptides can be purified, for example, from human neuronal cells or cell lines or from cells which have been transfected with a GR5LR polynucleotide. A purified GR5LR polypeptide is separated from other compounds which normally associate with the GR5LR polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electrophoresis. Purification of recombinant GluR5, a similar receptor, is taught in Bettler et al, Neuron. 5, 583-595 (1990). A preparation of purified GR5LR polypeptides is at least 80% pure; preferably, the preparations are
90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis. Receptor binding activity of the purified preparations can be assayed, for example, as described in
Example 2.
Expression ofGR5LR Polynucleotides
To express a GR5LR polypeptide, a GR5LR polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding GR5LR polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N.Y, 1989.
A variety of expression vector/host systems can be utilized to contain and express sequences encoding a GR5LR polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e.g., baculovirus), plant cell systems transformed with virus expression vectors (e.g. , cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g., Ti or pBR322 plasmids), or animal cell systems.
The control elements or regulatory sequences are those non-translated regions of the vector ~ enhancers, promoters, 5' and 3' untranslated regions — which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e.g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e.g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding a GR5LR polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker. Bacterial and Yeast Expression Systems
In bacterial systems, a number of expression vectors can be selected depending upon the use intended for a GR5LR polypeptide. For example, when a large quantity of a GR5LR polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used. Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding a GR5LR polypeptide can be ligated in frame with sequences for the amino-terminal Met and the subsequent 7 residues of β-galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J Biol. Chem. 264, 5503- 5509, 1989 or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include 'heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.
In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters, such as alpha factor, alcohol oxidase, and PGH, can be used. For reviews, see Ausubel et al (1989) and Grant et al, Methods Enzymol. 153, 516- 544, 1987.
Plant and Insect Expression Systems
If plant expression vectors are used, the expression of sequences encoding GR5LR polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6, 307-311, 1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al, EMBO J. 3, 1671- 1680, 1984; Broglie et al, Science 224, 838-843, 1984; Winter et al, Results Prohl. Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e.g., Hobbs or Murry, in MCGRAW HILL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N.Y., pp. 191-196, 1992).
An insect system also can be used to express a GR5LR polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding GR5LR polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of GR5LR polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which GR5LR polypeptides can be expressed (Engelhard et al, Proc. Nat. Acad. Sci. 91, 3224-3227, 1994).
Mammalian Expression Systems
A number of viral-based expression systems can be used to express GR5LR polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding GR5LR polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential El or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing a GR5LR polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655- 3659, 1984). If desired, transcription enhancers such as the Rous sarcoma virus
(RSV) enhancer can be used to increase expression in mammalian host cells. Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 10M are constructed and delivered to cells via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles).
Specific initiation signals also can be used to achieve more efficient translation of sequences encoding GR5LR polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding a GR5LR polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Schaifet l, Results Probl. Cell Differ. 20, 125-162, 1994).
Host Cells
A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed GR5LR polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the polypeptide also can be used to facilitate correct insertion, folding, and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post- translational activities (e.g., CHO, HeLa, MDCK, HEK293, and WI38), are available from the American Type Culture Collection (ATCC; 10801 University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.
Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express GR5LR polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced GR5LR sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R.I. Freshney, ed., 1986.
Any number of selection systems can be used to recover transformed cell lines. These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al, Cell 11, 223-32, 1977) and adenine phosphoribosyltransferase (Lowy et al, Cell 22, 817-23, 1980) genes which can be employed in tic or aprtr cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al, Proc. Natl. Acad. Sci. 77, 3567-70, 1980) npt confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin et al, J. Mol. Biol. 150, 1- 14, 1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, 1992, supra). Additional selectable genes have been described. For example, trpB, allows cells to utilize indole in place of tryptophan; hisD, allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51, 1988). Visible markers such as anthocyanins, β-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount of transient or stable protein expression attributable to a specific vector system (Rhodes et al, Methods Mol. Biol. 55, 121-131, 1995).
Detecting Expression qfGR5LR Polypeptides
Although the presence of marker gene expression suggests that a GR5LR polynucleotide is also present, its presence and expression may need to be confirmed. For example, if a sequence encoding a GR5LR polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode the GR5LR polypeptide can be identified by the absence of marker gene function.
Alternatively, a marker gene can be placed in tandem with a sequence encoding a GR5LR polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of a GR5LR polynucleotide.
Alternatively, host cells which contain a GR5LR polynucleotide and which express a GR5LR polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding a GR5LR polypeptide can be detected by DNA- DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding the GR5LR polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding the GR5LR polypeptide to detect transformants which contain a GR5LR polynucleotide.
A variety of protocols for detecting and measuring the expression of a GR5LR polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on a GR5LR polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al, SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St.
Paul, Minn., 1990) and Maddox et α/., J. Exp. Med. 158, 1211-1216, 1983).
A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding GR5LR polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, sequences encoding a GR5LR polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical). Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.
Expression and Purification ofGRSLR Polypeptides
Host cells transformed with nucleotide sequences encoding a GR5LR polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode GR5LR polypeptides can be designed to contain signal sequences which direct secretion of GR5LR polypeptides through a prokaryotic or eukaryotic cell membrane.
As discussed above, other constructions can be used to join a sequence encoding a GR5LR polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan. modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the GR5LR polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing a GR5LR polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography, as described in Porath et al, Prot. Exp. Purif. 3, 263-281, 1992), while the enterokinase cleavage site provides a means for purifying the GR5LR polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al, DNA Cell Biol. 12, 441-453, 1993.
Chemical Synthesis ( ;
Sequences encoding a GR5LR polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al, Niicl. Acids Res.
Symp. Ser. 215-223, 1980; Horn et al. Nucl Acids Res. Symp. Ser. 225-232, 1980). Alternatively, a GR5LR polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid- phase techniques (Merrifϊeld, J Am. Chem. Soc. 85, 2149-2154, 1963; Roberge eta , Science 269, 202-204, 1995). Protein synthesis can be performed using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer). Optionally, fragments of GR5LR polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.
The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N.Y., 1983). The composition of a synthetic GR5LR polypeptide can be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the GR5LR polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.
Production of Altered GR5LR Polypeptides
As will be understood by those of skill in the art, it may be advantageous to produce GR5LR polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular1 prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.
The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter GR5LR polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.
Antibodies — _
Any type of antibody known in the art can be generated to bind specifically to an epitope of a GR5LR polypeptide. "Antibody" as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F(ab')2, and Fv, which are capable of binding an epitope of a GR5LR polypeptide. Typically, at least 6, 8, 10, or 12 contiguous amino acids are required to form an epitope.
However, epitopes which involve non-contiguous amino acids may require more, e.g., at least 15, 25, or 50 amino acids.
An antibody which specifically binds to an epitope of a GR5LR polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots,
ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.
Typically, an antibody which specifically binds to a GR5LR polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to GR5LR polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate a GR5LR polypeptide from solution.
GR5LR polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired, a GR5LR polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e.g., aluminum hydroxide), and surface active substances (e.g. lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Gueriri) and Corynebacterium parvum are especially useful.
Monoclonal antibodies which specifically bind to a GR5LR polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al, Nature 256, 495-497, 1985; Kozbor et al, J. Immunol. Methods 81, 31-42, 1985; Cote et al, Proc. Natl. Acad. Sci. 80, 2026-
2030, 1983; Cole et al, Mol. Cell Biol. 62, 109-120, 1984).
In addition, techniques developed for the production of "chimeric antibodies," the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al,
Proc. Natl. Acad. Sci. 81, 6851-6855, 1984; Neuberger et al, Nature 312, 604-608, 1984; Takeda et al, Nature 314, 452-454, 1985). Monoclonal and other antibodies also can be "humanized" to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods,, as described in
GB2188638B. Antibodies which specifically bind to a GR5LR polypeptide can contain antigen binding sites which are either partially or fully humanized, as disclosed in U.S. 5,565,332.
Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to GR5LR polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).
Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al, 1996, Eur. J. Cancer Prev. 5, 507-11). Single-chain antibodies can be mono- or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15,
159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, J. Biol. Chem. 269, 199-206.
A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al, 1995, Int. J. Cancer 61, 497-501; Nicholls et al, 1993, J. Immunol. Meth. 165, 81- 91).
Antibodies which specifically bind to GR5LR polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Oriandi et al, Proc. Natl. Acad. Sci. 86, 3833-3837, 1989; Winter et al, Nature 349, 293-299, 1991). Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the "diabodies" described in WO
94/13804, also can be prepared.
Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which a GR5LR polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.
Antisense Oligonucleotides
Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of GR5LR gene products in the cell.
Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol. Biol. 20, 1-8, 1994; Sonveaux, Meth. Mol. Biol. 26, 1-72, 1994; Uhlmann et al, Chem. Rev. 90, 543-583, 1990.
Modifications of GR5LR gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of a GR5LR gene. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
Therapeutic advances using triplex DNA have been described in the literature (e.g., Gee et al, in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N.Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of a GR5LR polynucleotide. Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a GR5LR polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent GR5LR nucleotides, can provide sufficient targeting specificity for GR5LR mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length. Non- complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular GR5LR polynucleotide sequence. Antisense oligonucleotides can be modified without affecting their ability to hybridize to a GR5LR polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or "a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al, Trends Biotechnol. 10, 152-158, 1992; Uhlmann et al, Chem.
Rev. 90, 543-584, 1990; Uhlmann et al, Tetrahedron. Lett. 215„ 3539-3542, 1987.
Ribozymes
Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, Science 236,
1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568; 1990, Cech, Curr. Opin. Struct. Biol 2, 605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al, U.S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the . ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
The coding sequence of a GR5LR polynucleotide can be used to generate ribozymes which will specifically bind to mRNA transcribed from the GR5LR polynucleotide. Methods of designing and constructing ribozymes which can cleave RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591, 1988). For example, the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme. The hybridization region . contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al, EP 321,201).
Specific ribozyme cleavage sites within a GR5LR RNA target can be identified by scanning the GR5LR target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate GR5LR RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. The nucleotide sequence shown in SEQ ID NO:l and 3 and the complement provide sources of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease GR5LR expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells. As taught in Haseloff et al, U.S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells. l
Screening Methods
The invention provides methods for identifying modulators, i.e., candidate or test compounds which bind to GR5LR polypeptides or polynucleotides and/or have a stimulatory or inhibitory effect on, for example, expression or binding activity of the GR5LR polypeptide or polynucleotide, so as to regulate binding of the receptor to kainate. Decreased or increased binding to kainate is useful, for example, for preventing or treating epilepsy, schizophrenia and other mood disorders, neurodegenerative diseases such as Huntington's disease and Alzheimer's disease, ischemia, pain and urinary incontinence.
The invention provides assays for screening test compounds which bind to or modulate the binding activity of a GR5LR polypeptide or a GR5LR polynucleotide. A test compound preferably binds to a GR5LR polypeptide or polynucleotide. More preferably, a test compound decreases a GR5LR kainate binding activity of a GR5LR polypeptide or expression of a GR5LR polynucleotide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the test compound.
Test Compounds
Test compounds can be pharmacologic agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the "one-bead one-compound" library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145, 1997.
Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al, Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al, J. Med. Chem. 37, 2678, 1994; Cho et al, Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl 33, 2059, 1994; Carell et al, Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al, J.
Med. Chem. 37, 1233, 1994). Libraries of compounds can be presented in'solution (see, e.g., Houghten, Biotechniques 13, 412-421, 1992), or on beads (Lam, Nature 354, 82-84, 1991), chips (Fodor, Nature 364, 555-556, 1993), bacteria or spores (Ladner, U.S. Patent 5,223,409), plasmids (Cull et al, Proc. Natl. Acad. Sci, U.S.A. 89, 1865-1869, 1992), or phage (Scott & Smith, Science 249, 386-390, 199.0; Devlin,
Science 249, 404-406, 1990); Cwirla et al, Proc. Natl Acad. Sci. 97, 6378-6382, 1990; Felici, J. Mol. Biol. 222, 301-310, 1991; and Ladner, U.S. Patent 5,223,409).
High Throughput Screening
Test compounds can be screened for the ability to bind to GR5LR polypeptides or polynucleotides or to affect GR5LR kainate binding activity or GR5LR gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 μl. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96-well format.
Alternatively, "free format assays," or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al, Proc. Natl. Acad. Sci. U.S.A. 19, 1614-18 (1994). The cells are placed under agarose in peiri dishes, then beads that carry combinatorial compounds are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.
Another example of a free format assay is described by Chelsky, "Strategies for
Screening Combinatorial Libraries: Novel and Traditional Approaches," reported at the First Annual Conference of The Society for Biomolecular Screening in Philadephia, Pa. (Nov. 7-10, 1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.
Yet another example is described by Salmon et al, Molecular Diversity 2, 57-63
(1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.
Another high throughput screening method is described in Beutel et al, U.S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support. When samples are introduced to the porous matrix they diffuse sufficiently slowly such that the assays can be performed without the test samples running together. '
Binding Assays
For binding assays, the test compound is preferably a small molecule which binds to and occupies the active site of a GR5LR polypeptide, thereby making the active site inaccessible to substrate such that normal biological binding activity is prevented.
Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules. In binding assays, either the test compound or the GR5LR polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the
GR5LR polypeptide can then be accomplished, for example, by direct counting of radioemmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.
Alternatively, binding of a test compound to a GR5LR polypeptide can be determined without labeling either of the interactants. For example, a microphysiometer can be used to detect binding of a test compound with a GR5LR polypeptide. A microphysiometer (e.g., Cytosensor™) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light- addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and a GR5LR polypeptide. (McConnell et al, Science 257, 1906-1912, 1992).
Determining the ability of a test compound to bind to a GR5LR polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction
Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345, 1991, and Szabo et al, Curr. Opin. Struct. Biol. 5, 699-705, 1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore™). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules. '< ''
In yet another aspect of the invention, a GR5LR polypeptide can be used as a "bait protein" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent 5,283,317; Zervos et al, Cell 72, 223-232, 1993; Madura et al, J. Biol. Chem. 268, 12046- 12054, 1993; Barrel et al, Biotechniques 14, 920-924, 1993; Iwabuchi et al,
Oncogene 8, 1693-1696, 1993; and Brent W094/10300) to identify other proteins which bind to or interact with the GR5LR polypeptide and modulate its activity.
The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA ' constructs. For example, in one construct a polynucleotide encoding a GR5LR polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey" or "sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor.
Expression of the reporter gene can be detected, and cell colonies containing the functional transcription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the GR5LR polypeptide.
It may be desirable to immobilize either a GR5LR polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the GR5LR polypeptide (or polynucleotide) or the test compound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the GR5LR polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide or test compound and the solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to a GR5LR polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.
In one embodiment, a GR5LR polypeptide is a fusion protein comprising a domain that allows the GR5LR polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non- adsorbed GR5LR polypeptide; the mixture is then incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.
Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either a GR5LR polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated GR5LR polypeptides, polynucleotides, or test compounds can be prepared from biotin-NHS(N- hydroxysuccinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to a GR5LR polypeptide, polynucleotides, or a test compound, but which do not interfere with a desired binding site, such as the active site of the GR5LR polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.
Methods for detecting such complexes, in addition to those described above for the
GST-immobilized complexes, include immunodetection of complexes using antibodies which specifically bind to a GR5LR polypeptide or test compound, enzyme-linked assays which rely on detecting a GR5LR activity of the GR5LR polypeptide, and SDS gel electrophoresis under non-reducing conditions.
Screening for test compounds which bind to a GR5LR polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises a GR5LR polynucleotide or polypeptide can be used in a cell-based assay system. A GR5LR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including cell lines such as the HCN-1 A, HCN-2, CATH.a, Neuro-2a, and PC 12 (Clontech), can be used, can be used. An intact cell is contacted with a test compound. Binding of the test compound to a GR5LR polypeptide or polynucleotide is determined as described above, after lysing the cell to release the GR5LR polypeptide-or polynucleotide-test compound complex.
GR5LR Assays
Test compounds can be tested for the ability to increase or decrease GR5LR binding activity of a GR5LR polypeptide. GR5LR binding can be measured, for example, by contacting either a purified GR5LR polypeptide, a cell extract, or an intact cell with a test compound. A test compound which decreases GR5LR binding to kainate by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential antagonist of the receptor. A test compound which increases GR5LR binding to kainate by at least about 10, preferably about 50, more preferably about 75, 90, or 100% is identified as a potential agonist of the receptor.
GR5LR Gene Expression
In another embodiment, test compounds which increase or decrease GR5LR gene expression are identified. A GR5LR polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the GR5LR polynucleotide is determined. The level of expression of GR5LR mRNA or polypeptide in the presence of the test compound is compared to the level of expression of GR5LR mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of GR5LR mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of GR5LR mRNA or polypeptide expression.
Alternatively, when expression of GR5LR mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of GR5LR mRNA or polypeptide expression.
The level of GR5LR mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptides. Either qualitative or quantitative methods can be used. The presence of polypeptide products of a GR5LR polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into a GR5LR polypeptide. Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses a GR5LR polynucleotide can be used in a cell-based assay system. The GR5LR polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, including cell lines such as the HCN-1A, HCN-2, CATH.a, Neuro-2a, and PC 12 (Clontech), can be used.
Pharmaceutical Compositions
The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, a GR5LR polypeptide, GR5LR polynucleotide, antibodies which specifically bind to GR5LR activity, or mimetics, agonists, antagonists, or inhibitors of GR5LR activity. The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.
In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.
Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.
Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i.e., dosage.
Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.
Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.
Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration. Therapeutic Indications and Methods
Glutamate receptors are of critical importance to both central and peripheral nervous system. Glutamate receptors can be regulated to treat disorders of the nervous system. Disorders of the nervous system which may be treated include brain injuries, cerebro vascular diseases and their consequences, Parkinson's disease, corticobasal degeneration, motor neuron disease, dementia, including ALS, multiple sclerosis, traumatic brain injury, stroke, post-stroke, post-traumatic brain injury, and small-vessel cerebrovascular disease. Dementias, such as Alzheimer's disease, vascular dementia, dementia with Lewy bodies, frontotemporal dementia and
Parkinsonism linked to chromosome 17, frontotemporal dementias, including Pick's disease, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeld- Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis also can be treated. Similarly, it may be possible to treat cognitive-related disorders, such as mild cognitive impairment, age-associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders, attention deficit hyperactivity disorders, and memory disturbances in children with learning disabilities, by regulating the activity of Glutamate receptors.
Pain that is associated with nervous system disorders also can be treated by regulating the activity of Glutamate receptors. Pain which can be treated includes that associated with central nervous system disorders, such as multiple sclerosis, spinal cord injury, sciatica, failed back surgery syndrome, traumatic brain injury, epilepsy, Parkinson's disease, post-stroke, and vascular lesions in the brain and spinal cord (e.g., infarct, hemorrhage, vascular malformation). Non-central neuropathic pain includes that associated with post mastectomy pain, reflex sympathetic dystrophy (RSD), trigeminal neuralgia, radioculopathy, post-surgical pain, HIV/AIDS related pain, cancer pain, metabolic neuropathies (e.g., diabetic neuropathy) vasculitic neuropathy (e.g. secondary to connective tissue disease), paraneoplastic polyneuropathy associated, for example, with carcinoma of lung, or leukemia, or lymphoma, or carcinoma of prostate, colon or stomach, and post-herpetic neuralgia. Pain associated with cancer and cancer treatment also can be treated, as can headache pain (for example, migraine with aura, migraine without aura, and other migraine disorders), episodic and chronic tension-type headache, tension-type like headache, cluster headache, and chronic paroxysmal hemicrania. By regulation of the Glutamate receptors one can also treat visceral pain as pancreatits, intestinal cystitis, dysmenorrhea, irritable Bowel syndrome, Crohn's disease, biliary colic, ureteral colic, myocardial infarction and pain syndromes of the pelvic cavity, e.g. vulvodynia, orchialgia, urethral syndrome and protatodynia. Glutamate can also be used to treat acute pain for example postoperative pain and pain after trauma..
Experiments in rats indicate that glutamatergic transmission in the spinal cord is essential for bladder and urethral sphincter reflexes and for the spinal processing of afferent input from the urinary bladder. Both NMD A and non-NMDA glutamatergic receptors have been implicated in transmission between the brain micturition center and the spinal preganglionic neurons. These receptors also mediate excitatory transmission between interneurons and preganglionic neurons. Glutamate has also been identified as a mediator of a spinal micturition reflex pathway triggered by perineal afferents in neonatal rats and by bladder distension in adult paraplegic rats. Non-NMDA receptors are involved in these pathways. Thus glutamate is likely to be involved at various sites in the micturition reflex pathway and antagonizing glutamate receptor may have the clinical relevance to the therapy of urinary incontinence.
Glutamate is involved in epileptogenesis. Overstimulation of glutamate receptors can lead to seizures and excitotoxin injury throughout the CNS and in particular the hippocampus. Antagonists of GR5LR can act to prevent or treat epilepsy.
Glutamate plays a role in ischemic brain damage and compounds that decrease the accumulation of glutamate or block its postsynaptic effects can ameliorate ischemic injury and other forms of acute neuronal degenerative diseases like hypoxia/hypoglycemia, traumatic brain injury, and stroke. Antagonists of GR5LR can act to prevent or treat brain damage.
This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or a polypeptide- binding partner) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.
A reagent which affects GR5LR binding activity can be administered to a human cell, either in vitro or in vivo, to reduce GR5LR binding activity. The reagent preferably binds to an expression product of a GR5LR gene. If the expression product is a polypeptide, for example, the reagent can be an antibody or a small chemical compound. For treatment of human cells ex vivo, a reagent can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.
In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about
30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung or liver. A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 μg of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably
< about 1.0 μg of DNA per 16 nmol of liposome delivered to about 106 cells, and even more preferably about 2.0 μg of DNA per 16 nmol of liposome delivered to about 10° cells. Preferably, a liposome is between about 100 and 500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.
Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.
Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U.S. Patent 5,705,151). Preferably, from about 0.1 μg to about 10 μg of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 μg to about 5 μg of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1.0 μg of polynucleotides is combined with about 8 nmol liposomes.
In another embodiment, antibodies can be delivered to specific tissues in vivo using receptor-mediated targeted delivery. Receptor-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-05 (1993); Chiou et al, GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J.A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988); Wu et al, J. Biol. Chem. 269, 542-46 (1994); Zenke et al, Proc. Natl. Acad. Sci.
USA. 87, 3655-59 (1990); Wu et al, J. Biol. Chem. 266, 338-42 (1991). 1 If the reagent is a single-chain antibody, a polynucleotide encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation, "gene gun," and DEAE- or calcium phosphate-mediated transfection.
Effective in vivo dosages of an antibody are in the range of about 5 μg to about 50 μg/kg, about 50 μg to about 5 mg/kg, about 100 μg to about 500 μg kg of patient body weight, and about 200 to about 250 μg/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg of DNA.
If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides which express antisense oligonucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.
Preferably, a reagent reduces expression of a GR5LR gene or the binding activity of a GR5LR polypeptide by at least about 10, preferably about 50, more preferably about 75, 90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of a GR5LR gene or the binding activity of a GR5LR polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to GR5LR-specific mRNA, quantitative RT-PCR, immunologic detection of a GR5LR polypeptide, or measurement of GR5LR binding activity.
In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergistically to effect the treatment or prevention of the various disorders described above. Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.
Determination of a Therapeutically Effective Dose
Determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases GR5LR binding activity relative to GR5LR binding activity which occurs in the absence of the therapeutically effective dose.
For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.
Therapeutic efficacy and toxicity, e.g., ED50 (the dose therapeutically effective in
50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LD50/ED50.
Pharmaceutical compositions which exhibit large therapeutic indices are preferred. The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.
The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect. Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination(s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.
Normal dosage amounts of any particular reagent can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for polypeptides or their inhibitors. Similarly, delivery of polynucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.
Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans. The above disclosure generally describes the present invention, and all patents and patent applications cited in this disclosure are expressly incorporated herein. A more complete understanding can be obtained by reference to the following specific
< examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.
EXAMPLE 1
Detection ofGR5LR activity
The polynucleotide of SEQ ID NO: 1 or 3 is inserted into the expression vector pCEV4 and the expression vector ρCEV4-GR5LR polypeptide obtained is transfected into human embryonic kidney 293 cells. The cells are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 % BSA, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10 % of an added radioligand, i.e. 125I-labeled kainate, are added to 96-well polypropylene microtiter plates containing ligand, non-labeled peptides, and binding buffer to a final volume of 250 μl.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I ligand.
Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration through GF B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program. Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. The GR5LR activity of the polypeptide comprising the amino acid sequence of SEQ ID NO: 2 is demonstrated. EXAMPLE 2
Radioligand binding assays
Human embryonic kidney 293 cells transfected with a polynucleotide which expresses human GR5LR protein are scraped from a culture flask into 5 ml of Tris HCl, 5 mM EDTA, pH 7.5, and lysed by sonication. Cell lysates are centrifuged at 1000 rpm for 5 minutes at 4 °C. The supernatant is centrifuged at 30,000 x g for 20 minutes at 4 °C. The pellet is suspended in binding buffer containing 50 mM Tris HCl, 5 mM MgSO4, 1 mM EDTA, 100 mM NaCl, pH 7.5, supplemented with 0.1 %
BSA, 2 μg/ml aprotinin, 0.5 mg/ml leupeptin, and 10 μg/ml phosphoramidon. Optimal membrane suspension dilutions, defined as the protein concentration required to bind less than 10 % of the added radioligand, i.e. 125I-labeled kainate, are added to 96-well polypropylene microtiter plates containing ligand or test compound, non-labeled peptides, and binding buffer to a final volume of 250 μl.
In equilibrium saturation binding assays, membrane preparations are incubated in the presence of increasing concentrations (0.1 nM to 4 nM) of 125I ligand or test compound (specific activity 2200 Ci/mmol). The binding affinities of different test compounds are determined in equilibrium competition binding assays, using 0.1 nM
125I -peptide in the presence of twelve different concentrations of each test compound.
Binding reaction mixtures are incubated for one hour at 30 °C. The reaction is stopped by filtration through GF/B filters treated with 0.5% polyethyleneimine, using a cell harvester. Radioactivity is measured by scintillation counting, and data are analyzed by a computerized non-linear regression program.
Non-specific binding is defined as the amount of radioactivity remaining after incubation of membrane protein in the presence of 100 nM of unlabeled peptide. Protein concentration is measured by the Bradford method using Bio-Rad Reagent, with bovine serum albumin as a standard. A test compound which increases the radioactivity of membrane protein by at least 15% relative to radioactivity of membrane protein which was not incubated with a test compound is identified as a compound which binds to a human GR5LR polypeptide.
EXAMPLE 3
Identification of a test compound which binds to a GR5LR polypeptide
Purified GR5LR polypeptides comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. GR5LR polypeptides comprise an amino acid sequence shown in SEQ ID NO:2. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.
The buffer solution containing the test compounds is washed from the wells. Binding of a test compound to a GR5LR polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound was not incubated is identified as a compound which binds to a GR5LR polypeptide.
EXAMPLE 4
Identification of a test compound which decreases GR5LR activity
Cellular membrane extracts from a human embryonic 293 kidney cells transfected with a GR5LR polynucleotide are contacted with test compounds from a small molecule library and assayed for GR5LR kainate binding activity. (Sommer et al. EMBO J. 11, 1651-1656, 1992). Control extracts in the absence of a test compound also are assayed.
Cells are harvested 48 hours after transfection by washing twice with phosphate
K buffered saline (PBS). Call pellets are resuspended in binding buffer (50 mM Tris- citrate, pH 7.0) and homogenized. Membranes are centrifuged at 15,000 x g for 10 min. Homogenization and pelleting is repeated three times. Membrane pellets are resuspended in binding buffer to obtain the membrane equivalent of 2 x 106 cells per 0.4 ml. Binding with [3H]kainate (58 Ci/mmol, NEN) and the test compound is performed in a total volume of 0.5 ml for 60 min. at 0°C with nonspecific binding defined in the presence of 1 mM L-glutamate. After incubation, the reactions are quenched by addition of 5 ml ice-cold binding buffer and filtered through glass fiber filters. Filters are washed twice with ice-cold binding buffer and filter-bound radioactivity determined by liquid scintillation counting.
EXAMPLE 5
Identification of a test compound which decreases GR5LR gene expression
A test compound is administered to a culture of neuronal cells and incubated at 37 oC for 10 to 45 minutes. A culture of the same type of cells incubated for the same time without the test compound provides a negative control.
RNA is isolated from the two cultures as described in Chirgwin et al, Biochem. 18, 5294-99, 1979). Northern blots are prepared using 20 to 30 μg total RNA and hybridized with a 32P-labeled GR5LR-specific probe at 65°C in Express-hyb
(CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO:l or 3. A test compound which decreases the GR5LR-specific signal relative to the signal obtained in the absence of the test compound is identified as an inhibitor of GR5LR gene expression. EXAMPLE 6
Identification ofGR5LR agonists and antagonists
A human embryonic 293 kidney cell line is transfected with a GR5LR polynucleotide. Test compounds comprising potential GR5LR antagonists or agonists are prepared. Forty-eight hours after transfection, agonist-activated and antagonist-deactivated currents in the presence of kainate are measured using standard patch clamp techniques in the whole-cell configuration. See Sommers et al. EMBO J. 11, 1651-1656, 1992; Keinanen et al, Science. 249, 556-560 (1990);
Sommer et al, Science. 249, 1580-1585; Verdoorn et al, Science. 252, 1715-1718, 1991. Currents in the presence of a test agonist or antagonist and in the absence of a test compound are collected, recorded and analyzed. Test compounds that evoke currents in the presence of kainate are identified as agonists of GR5LR and compounds that depress currents in the presence of kainate are identified as antagonists of GR5LR.
EXAMPLE 7
Treatment of epilepsy with a reagent which specifically binds to a GR5LR gene product
Synthesis of antisense GR5LR oligonucleotides comprising at least 11 contiguous nucleotides selected from SEQ ID NO:l or 3 is performed on a Pharmacia Gene Assembler series synthesizer using the phosphoramidite procedure (Uhlmann et al,
Chem. Rev. 90, 534-83, 1990). Following assembly and deproiection, oligonucleotides are ethanol-precipitated twice, dried, and suspended in phosphate- buffered saline (PBS) at the desired concentration. Purity of these oligonucleotides is tested by capillary gel electrophoreses and ion exchange HPLC. Endotoxin levels in the oligonucleotide preparation are determined using the Limulus Amebocyte
Assay (Bang, Biol. Bull. (Woods Hole, Mass.) 105, 361-362, 1953). The antisense oligonucleotides are administered to a patient with epilepsy. The severity of the patient's epilepsy is decreased.
EXAMPLE 8
i Tissue-specific expression of GR6LR
Expression profiling is based on a quantitative polymerase chain reaction (PCR) analysis, also called kinetic analysis, first described in Higuchi et al., 1992 and
Higuchi et al., 1993. The principle is that at any given cycle within the exponential phase of PCR, the amount of product is proportional to the initial number of template copies. Using this technique, the expression levels of particular genes, which are transcribed from the chromosomes as messenger RNA (mRNA), are measured by first making a DNA copy (cDNA) of the mRNA, and then performing quantitative
PCR on the cDNA, a method called quantitative reverse transcription-polymerase chain reaction (quantitative RT-PCR).
Quantitative RT-PCR analysis of RNA from different human tissues was performed to investigate the tissue distribution of GR6LR mRNA. 25 .mu.g of total RNA from various tissues (Human Total RNA Panel I-V, Clontech Laboratories, Palo Alto, CA,
USA) was used as a template to synthsize first-strand cDNA using the
SUPERSCRIPT™ First-Strand Synthesis System for RT-PCR (Life Technologies,
Rockville , MD, USA). First-strand cDNA synthesis was carried out according to the manufacturer's protocol using oligo (dT) to hybridize to the 3' poly A tails of mRNA and prime the synthesis reaction. 10 ng of the first-strand cDNA was then used as template in a polymerase chain reaction. The polymerase chain reaction was performed in a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN, USA), in the presence of the DNA-binding fluorescent dye SYBR Green I which binds to the minor groove of the DNA double helix, produced only when double-stranded DNA is successfully synthesized in the reaction (Morrison et al., 1998). Upon binding to double-stranded DNA, SYBR Green I emits light that can be quantitatively measured by the LightCycler machine. The polymerase chain reaction was carried out using oligonucleotide primers LBRI019-L9 (TGAAGTGTCCGTATGCCTTGATAATCC) and LBRI019-R6
(ATCGGGGAAACTGAGATGGCAAG) and measurements of the intensity of emitted light were taken following each cycle of the reaction when the reaction had reached a temperature of 80 degrees C. Intensities of emitted light were converted into copy numbers of the gene transcript per nanogram of template cDNA by comparison with simultaneously reacted standards of known concentration.
To correct for differences in mRNA transcription levels per cell in the various tissue types, a normalization procedure was performed using similarly calculated expression levels in the various tissues of five different housekeeping genes: glyceraldehyde-3-phosphatase (G3PDH), hypoxanthine guanine phophoribosyl transferase (HPRT), beta-actin, porphobilinogen deaminase (PBGD), and beta-2- microglobulin. The level of housekeeping gene expression is considered to be relatively constant for all tissues (Adams et al., 1993, Adams et al., 1995, Liew et al., 1994) and therefore can be used as a gauge to approximate relative numbers of cells per .mu.g of total RNA used in the cDNA synthesis step. Except for the use of a slightly different set of housekeeping genes and the use of the LightCycler system to measure expression levels, the normalization procedure was essentially the same as that described in the RNA Master Blot User Manual, Apendix C (1997, Clontech Laboratories, Palo Alto, CA, USA). In brief, expression levels of the five housekeeping genes in all tissue samples were measured in three independent reactions per gene using the LightCycler and a constant amount (25 .mu.g) of starting RNA. The calculated copy numbers for each gene, derived from comparison with simultaneously reacted standards of known concentrations, were recorded and converted into a percentage of the sum of the copy numbers of the gene in all tissue samples. Then for each tissue sample, the sum of the percentage values for each gene was calculated, and a normalization factor was calculated by dividing the sum percentage value for each tissue by the sum percentage value of one of the tissues arbitrarily selected as a standard. To normalize an experimentally obtained value for the expression of a particular gene in a tissue sample, the obtained value was multiplied by the normalization factor for the tissue tested.
Results are given below, showing the experimentally obtained copy numbers of mRNA per 10 ng of first-strand cDNA on the left and the normalized values on the right.
Figure imgf000061_0001
GR6LR shows high expression in the fetal brain and placenta, and a fairly broad, low expression level in most other tissues. Notably, however, expression in the fetal liver is nearly undetectable. This expression pattern is in keeping with the role of the fetal liver as primarily a source of glutamate and the placenta as an organ that captures a large proportion of the fetal plasma glutatmate, and thereby suggests that GR6LR may play an important role in prenatal uptake and metabolism of glutamate.

Claims

1. An isolated polynucleotide encoding a GR5LR polypeptide and being selected from the group consisting of:
a) a polynucleotide encoding a GR5LR polypeptide comprising an amino acid sequence selected from the group consisting of: amino acid sequences which are at least about 50% identical to the amino acid sequence shown in SEQ ID NO: 2; and the amino acid sequence shown in SEQ ID NO: 2. b) a polynucleotide comprising the sequence of SEQ ID NO: 1 or 3; c) a polynucleotide which hybridizes under stringent conditions to a polynucleotide specified in (a) and (b); d) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) to (c) due to the degeneration of the genetic code; and e) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (d).
2. An expression vector containing any polynucleotide of claim 1.
3. A host cell containing the expression vector of claim 2.
4. A substantially purified GR5LR polypeptide encoded by a polynucleotide of claim 1.
5. A method for producing a GR5LR polypeptide, wherein the method comprises the following steps: a) culturing the host cell of claim 3 under conditions suitable for the expression of the GR5LR polypeptide; and b) recovering the GR5LR polypeptide from the host cell culture. A method for detection of a polynucleotide encoding a GR5LR polypetide in a biological sample comprising the following steps:
a) hybridizing any polynucleotide of claim 1 to a nucleic acid material of a biological sample, thereby forming a hybridization complex; and b) detecting said hybridization complex.
7. The method of claim 6, wherein before hybridization, the nucleic acid material of the biological sample is amplified.
8. A method for the detection of a polynucleotide of claim 1 or a GR5LR polypeptide of claim 5 comprising the steps ofcontacting a biological sample with a reagent which specifically interacts with the polynucleotide or the GR5LR polypeptide.
9. A diagnostic kit for conducting the method of any one of claims 6 to 8.
10. A method of screening for agents which decrease the activity of a GR5LR, comprising the steps of: contacting a test compound with any GR5LR polypeptide encoded by any polynucleotide of claim 1; , j detecting binding of the test compound of the GR5LR polypeptide, wherein a test compound which binds to the polypeptide is identified as a potential therapeutic agent for decreasing the activity of a GR5LR.
11. A method of screening for agents which regulate the activity of a GR5LR, comprising the steps of: contacting a test compound with a GR5LR polypeptide encoded by any polynucleotide of claim 1 ; and detecting a GR5LR activity of the polypeptide, wherein a test compound which increases the GR5LR activity is identified as a potential therapeutic agent for increasing the activity of the GR5LR, and wherein a test compound which decreases the GR5LR activity of the polypeptide is identified as a potential therapeutic agent for decreasing the activity of the GR5LR.
12. A method of screening for agents which decrease the activity of a GR5LR, comprising the steps of: contacting a test compound with any polynucleotide of claim 1 and detecting binding of the test compound to the polynucleotide, wherein a test compound which binds to the polynucleotide is identified as a potential therapeutic agent for decreasing the activity of GR5LR.
13. A method of reducing the activity of GR5LR, comprising the steps of: contacting a cell with a reagent which specifically binds to any polynucleotide of claim 1 or any GR5LR polypeptide of claim 4, whereby the activity of GR5LR is reduced.
14. A reagent that modulates the activity of a GR5LR polypeptide or a polynucleotide wherein said reagent is identified by the method of any of the claims 10 to 12.
15. A pharmaceutical composition, comprising: the expression vector of claim 2 or the reagent of claim 14 and a pharmaceutically acceptable carrier.
16. Use of the pharmaceutical composition of claim 15 for modulating the activity of a GR5LR in a disease.
17. Use of claim 16 wherein the disease is a disease of the peripheral or central nervous system.
PCT/EP2001/003335 2000-03-24 2001-03-23 REGULATION OF HUMAN GluR5-LIKE RECEPTOR WO2001070813A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
AU2001252232A AU2001252232A1 (en) 2000-03-24 2001-03-23 Regulation of human glur5-like receptor
EP01925504A EP1290025A2 (en) 2000-03-24 2001-03-23 REGULATION OF HUMAN GluR5-LIKE RECEPTOR

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US19175900P 2000-03-24 2000-03-24
US60/191,759 2000-03-24

Publications (2)

Publication Number Publication Date
WO2001070813A2 true WO2001070813A2 (en) 2001-09-27
WO2001070813A3 WO2001070813A3 (en) 2002-01-10

Family

ID=22706824

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2001/003335 WO2001070813A2 (en) 2000-03-24 2001-03-23 REGULATION OF HUMAN GluR5-LIKE RECEPTOR

Country Status (3)

Country Link
EP (1) EP1290025A2 (en)
AU (1) AU2001252232A1 (en)
WO (1) WO2001070813A2 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0529994A1 (en) * 1991-08-26 1993-03-03 Allelix Biopharmaceuticals Inc. Human KA-1 receptor, a kainate high affinity receptor of the EAA1 (Excitatory Amino Acid) family
US5547855A (en) * 1992-12-11 1996-08-20 Allelix Biopharmaceuticals Inc. Kainate-binding human CNS glutamate receptors EAA3C and EAA3D, DNA encoding them, and expression of the DNA in transformed cells

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0529994A1 (en) * 1991-08-26 1993-03-03 Allelix Biopharmaceuticals Inc. Human KA-1 receptor, a kainate high affinity receptor of the EAA1 (Excitatory Amino Acid) family
US5547855A (en) * 1992-12-11 1996-08-20 Allelix Biopharmaceuticals Inc. Kainate-binding human CNS glutamate receptors EAA3C and EAA3D, DNA encoding them, and expression of the DNA in transformed cells

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BETTLER ET AL., : "Cloning of a new glutamate receptor subunit, GluR5: expression in the nervous system during development" NEURON, vol. 5, 1990, pages 583-595, XP001036529 cited in the application *
DATABASE EMBL [Online] 16 March 1999 (1999-03-16) Database accession no. AI435076 XP002181555 *
DATABASE EMBL [Online] 4 December 1997 (1997-12-04) Database accession no. AA678689 XP002181554 *
DATABASE EMBL [Online] 4 May 1995 (1995-05-04) Database accession no. R32841 XP002181553 *
HERB ANNE ET AL: "Q/R site editing in kainate receptor GluR5 and GluR6 pre-mRNAs requires distant intronic sequences." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 93, no. 5, 1996, pages 1875-1880, XP002181552 1996 ISSN: 0027-8424 *
SOMMER B ET AL: "A GLUTAMATE RECEPTOR CHANNEL WITH HIGH AFFINITY FOR DOMOATE AND KAINATE" EMBO (EUROPEAN MOLECULAR BIOLOGY ORGANIZATION) JOURNAL, vol. 11, no. 4, 1992, pages 1651-1656, XP001030827 ISSN: 0261-4189 cited in the application *
SOMMER ET AL: "RNA editing in brain controls a determinant of ion flow in glutamate-gated channels" CELL, CELL PRESS, CAMBRIDGE, NA, US, vol. 67, 4 October 1991 (1991-10-04), pages 11-19, XP002108292 ISSN: 0092-8674 *

Also Published As

Publication number Publication date
WO2001070813A3 (en) 2002-01-10
AU2001252232A1 (en) 2001-10-03
EP1290025A2 (en) 2003-03-12

Similar Documents

Publication Publication Date Title
US20020160394A1 (en) Regulation of transthyretin to treat obesity
US20030099982A1 (en) Regulation of human glur5 -like receptor
US20040030099A1 (en) Regulation of human patched-like protein
WO2002022631A2 (en) Regulation of human pyroglutamyl peptidase-like enzyme
US20030186919A1 (en) Regulation of human sodium-dependent monoamine transporter
US20030175941A1 (en) Regulation of human serine racemase enzyme
WO2001070813A2 (en) REGULATION OF HUMAN GluR5-LIKE RECEPTOR
EP1280897B1 (en) Regulation of nf-at interacting protein nip 45 variant
WO2001072833A2 (en) Human ephrin-like receptor
WO2002033080A2 (en) Regulation of human netrin binding membrane receptor unc5h-1
US20050130138A1 (en) Immune-related proteins and the regulation of the same
EP1307545A2 (en) REGULATION OF HUMAN p78-LIKE SERINE/THREONINE KINASE
WO2002048397A2 (en) Regulation of human adenylate cyclase, type vii
US20040029247A1 (en) Regulation of human adenylate cyclase, type iv
WO2001090318A2 (en) Regulation of human polyamine oxidase-like enzyme
EP1272521A2 (en) Regulation of human oatp2-related protein
WO2001073017A2 (en) Regulation of human adp-ribosylation factor-related protein
WO2002038761A2 (en) Regulation of human oat-like protein
WO2002006313A2 (en) Regulation of human glutamate receptor delta-1 subunit
WO2002029049A2 (en) Regulation of human sodium-dependent monoamine transporter
WO2001072955A2 (en) Regulation of human nedd1-related protein
WO2001073077A2 (en) Regulation of human serine racemase enzyme
WO2001068879A2 (en) Human 1-aminocyclopropane-carboxylate synthase
WO2001068841A2 (en) Human dcc-like proteins
US20030049670A1 (en) Regulation of human leucine aminopeptidase-like enzyme

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

WWE Wipo information: entry into national phase

Ref document number: 2001925504

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 10221936

Country of ref document: US

WWP Wipo information: published in national office

Ref document number: 2001925504

Country of ref document: EP

NENP Non-entry into the national phase in:

Ref country code: JP

WWW Wipo information: withdrawn in national office

Ref document number: 2001925504

Country of ref document: EP