WO2001068829A2

WO2001068829A2 - Genetically stable cholera vaccines

Info

Publication number: WO2001068829A2
Application number: PCT/US2001/008305
Authority: WO
Inventors: Claudia Hase; John J. Mekalanos
Original assignee: St. Jude Children's Research Hospital; President And Fellows Of Harvard College
Priority date: 2000-03-16
Filing date: 2001-03-16
Publication date: 2001-09-20
Also published as: AU2001247453A1; WO2001068829A3

Abstract

The invention relates to nontoxigenic genetically stable mutant strains of Vibrio cholerae which lack functional flagellum and are useful as a vaccine for inducing immunological protection against cholera and a method for making the same. The strains of the present invention comprise a genetically engineered deletion mutation resulting in loss of at least part of a gene encoding a protein required for the energization or assembly of flagellum. In particular, mutant strains lacking one or more functional genes selected from the group of motX, motY, pomA and pomA/pomB are provided. In addition mutant strains lacking a functional hap gene and/or ctxA gene and/or rtx gene, in combination with one or more of the motX, motY, pomA and pomA/pomB and fliG genes are provided. Mutant strains further comprising alterations wherein expression of the ctxB gene can be induced are also provided. The invention further relates to methods of making genetically engineered mutant V. cholerae strains and to immunogenic compositions thereof. Methods for inducing an immune response by administration of the mutant strains and live or killed cholera vaccines comprising the mutant strains of the invention are also provided.

Description

GENETICALLY STABLE CHOLERA VACCINES

GOVERNMENTAL SUPPORT

The research leading to the present invention was supported, at least in part, by a grant from The National Institute of Health Grant No. AI-18045 and the Government may have certain rights in the invention.

FIELD OF THE INVENTION

The present invention relates generally to genetically stable mutant strains of Vibrio cholerae which lack functional flagellum and are useful as a vaccine for inducing immunological protection against cholera and a method for making the same. In a particular aspect, the strains ofthe present invention comprise a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. In particular, mutant strains lacking one or more functional genes selected from the group oϊmotX, motY, pomA, pomA/pomB and fliG are provided. In addition, mutant strains further lacking a functional hap gene and/or ctxA gene and/or rtx gene are provided. Mutant strains further comprising alterations wherein expression ofthe dxB gene can be induced are also provided. The invention further relates to methods of making genetically engineered mutant V. cholerae strains. Methods for inducing an immune response by administration ofthe mutant strains and live or killed cholera vaccines comprising the mutant strains ofthe invention are also provided.

BACKGROUND OF THE INVENTION

Cholera is a disease that has affected mankind for centuries. It is a severe and potentially lethal diarrheal disease caused by the Gram-negative bacterium Vibrio cholerae. Upon ingestion, the bacteria colonize the small intestine, where they produce a toxin, cholera toxin (CT), that causes the secretion of large amounts of water into the intestine, resulting in the profuse watery diarrhea characteristic of cholera.

V. cholerae is a waterborne bacterium that commonly causes epidemics in areas ofthe world where there is overcrowding and poor sanitation. The cholera bacterium may also live in the environment in brackish rivers and coastal waters. Shellfish eaten raw may have been a source of cholera, and a few persons in the United States have contracted cholera after eating raw or undercooked shellfish from the Gulf of Mexico. Cholera infected countries, as listed by the Centers for Disease Control, include many regions of Africa, South America, Central America, South East Asia and East Asia, the Middle East and the Indian Subcontinent. The cholera epidemic in Africa has lasted more than twenty years.

Cholera is the most severe of many diarrheal diseases that affect humans. It is unusual in the speed with which dehydration and death can occur. In severe cases, patients may develop hypovolemic shock and acidosis, and can die in as short a period as 24 hours. Mortality rates in untreated patients can reach 70%.

Infection with V. cholerae results in long-lasting immunity. Adults in endemic areas, such as Bangladesh, have been shown to be ten times less likely to die from a cholera infection than children between 1 and 5 years old. This is presumably due in part to protective immunity that is established from surviving a childhood infection. This strong and long-lasting immunity indicates that the development of an effective vaccine is feasible. Research toward the development of a vaccine for cholera began more than a century ago.

Vaccine research has included work towards whole-cell killed approaches as well as live-attenuated approaches. Several vaccines have been developed and tested, but problems with efficacy, for the whole-cell killed vaccines, and reactogenicity

(unwanted symptoms), for the live-attenuated strains, has hindered the development and acceptance of a safe and effective vaccine for cholera. While a vaccine for cholera is available, it confers only brief immunity and is not recommended by the CDC for travelers.

Historically only the 01 serogroup of V. cholerae has been associated with epidemic cholera. However, in early 1993 in India and Bangladesh, a major cholera epidemic was caused by a novel non-Ol serogroup of V. cholerae named V. cholerae 0139. Strains belonging to this newly emerged V. cholerae serogroup replaced the endemic El Tor 01 strains of V. cholerae to become the principal clinical and environmental isolate of V. cholerae on the Indian subcontinent (Cholera Working Group, 1993, . Lancet 342:387-390, 1993). The initial microbiologic characterization of V. cholerae 0139 revealed that this serogroup was closely related to the El Tor biotype of V. cholerae Ol. The shared properties of V. cholerae 0139 and El Tor 01 strains, include identical sized restriction fragments for genes which have known polymorphisms (Calia et al., Infect. Immun. 62:1504-1506, 1994; Waldor et al., supra), identical electrophoretic types by multilocus enzyme electrophoresis analysis (Popovic et al., J. Infect. Dis. 171:122-127, 1995), tandem duplications ofthe CTX genetic element (Waldor et al., J. Infect. Dis. 170:278-283, 1994); and identical chromosomal location ofthe CTX genetic element (Waldor et al., 1994, supra). These findings support the hypothesis that V. cholerae 0139 is a derivative of an El Tor Ol strain of V. cholerae. Recent analyses ofthe sequences ofthe genes encoding aspartate- semialdehyde dehydrogenase and tcpA in various strains of V. cholerae also support a closer genetic relationship between 0139 strains with El Tor Ol strains rather than with classical Ol strains. As only the Ol and more recently the 0139 (synonym Bengal) serotypes of V. cholerae cause large scale epidemics, the development of a safe and effective vaccine against cholera seems feasible. An ideal cholera vaccine should produce long-lasting protective immunity against Ol and 0139 strains of V. cholerae and be safe, inexpensive to produce and easy to administer.

The development of V. cholerae vaccines has focused on reproducing the naturally occurring immunity generated in clinical infection, but the currently available parenteral, killed whole-cell vaccine preparation provides less than 50% protection from disease, for a duration of only 3 to 6 months (Saroso et al, Bull. W.H.O. 56:619- 627, 1978; Levine et al., Microbiol. Rev. 47:510-550, 1983). Parental vaccines for cholera have been largely abandoned, as they do not generate an adequate local immune response at the site of infection, i.e., at the mucosal surface. A genetically- engineered, live oral vaccine for V. cholerae adheres selectively to the M cells ofthe gastrointestinal tract (Owen et al., J. Infect. Dis. 153:1108-1118, 1986) and is a strong stimulus to the common mucosal immune system (Svennerholm et al, Lancet i:305- 308, 1982); and oral cholera vaccination in humans produces a strong salivary gland IgA response to cholera toxin B subunit (Czerkinsky et al., Infect. Immun. 59:996- 1001, 1991). Oral vaccines take advantage ofthe fact that oral administration of antigens appears to be the most efficient stimulus for the development of secretory IgA (Svennerholm, supra), and that secretory IgA by itself is sufficient to protect against intestinal disease from V. cholerae (Winner III, et al., Infect. Immun. 59:977-982, 1991).

Oral, killed whole cell vaccines with or without the B subunit of cholera toxin have undergone extensive testing in volunteer and field trials over the past decade, and have been found to be more immunogenic and confer longer protection than the parenteral killed whole-cell vaccine (Svennerholm et al., J. Infect. Dis. 149:884-893, 1984; Black et al., Infect. Immun. 55:1116-1120, 1987; Clemens et al., Lancet i:: 1375-1378, 1988; Clemens et al., J. Infect. Dis. 158:60-69, 1988; Jertborn et al., J. Infect Dis. 157:374- 377, 1988; Sack et al., 164:407-11, 1991). Such killed whole-cell vaccines were traditionally favored over live whole-cell vaccines because the latter, which can multiply in the gut ofthe vaccinated animal, were considered unsafe. However, unlike killed-cell vaccines, live-cell vaccines would not require multiple doses, and in a rabbit model, live bacteria are more effective immunogens for secretory IgA than dead organisms (Keren et al., J. Immunol. 128:475-479, 1982). Live vaccines have the further advantage of potentially being transmitted from recipients to others in the community, leading to herd immunity. The feasibility for live attenuated cholera vaccines was initially shown with a V. cholerae strain called Texas Star-SR that produced the immunogenic B subunit but not the enzymatically active A subunit of CT.

More recently, recombinant DNA technology has been used to generate genetically stable live attenuated V. cholerae vaccine strains, An important virulence factor for V. cholerae in causing clinical disease is cholera toxin, a protein complex consisting of one A subunit and five B subunits. Live, oral vaccine strains currently being tested bear mutations in either the A subunit or in both subunits of cholera toxin (Mekalanos et al. (1983) Nature 306:551-557; Herrington et al. (1988) J. Exp. Med. 168:1487- 1492; Levine et al. (1988) Lancet ii:467-470). The first recombinant live oral vaccines tested in human volunteers expressed neither the A nor the B subunit of CT (JBK70) or only expressed the non-toxic B subunit (CVDIOI) (Kapet et al (1984) Nature 308:655). An internal deletion ofthe gene encoding the A subunit of cholera toxin (ctxA) in the classical strain 0395 produces a strain (0395-N1) which is highly immunogenic in humans, but produces non-specific symptoms in about half of the recipients (Mekalanos et al. (1983) Nature 306:551-557; Herrington et al. (1988) J. Exp. Med. 168:1487-1492; Mekalanos, U.S. Pat. No. 4,882,278, herein incorporated •by reference), an indication that the strain is still virulent. Although these strains were effective i munogens, they were also very reactogenic, causing symptoms such as mild to severe diarrhea, cramps, nausea, and anorexia. The reasons for this reactogenicity are currently not understood but it is possible that V. cholerae may secrete additional toxin. Alternatively, the mere colonization ofthe intestinal tract by the bacteria may somehow disturb intestinal function and lead to the observed side effects.

Strains of V. cholerae have been generated with alterations in key virulence factors. Cholera toxin is comprised of two polypeptide subunits CT-A and CT-B, encoded by the ctxA and ctxB genes. The CT-B is non-toxic when expressed on its own. The CVD 103-HgR strain carries a mutated CT-A gene, an Hg++-resistance gene to differentiate it from wild-type vibrios' and an active CT-B gene (Levine et al (1988) Lancet ii:467). Strain CVD 103-HgR, the first licensed, live attenuated cholera vaccine (licensed in Switzerland and a few other countries) failed completely in an extensive field trial in Indonesia. These results prompted a FDA advisory panel to recommend against licensure of CVD 103-HgR in the United States. CVD 103-HgR is derived from a classical strain 569B of V. cholerae and is known to be only mildly effective (less than 62% protection) in preventing diarrhea after challenge of North Americans with an El Tor Ol strain of V. cholerae.

Since most ofthe cases of cholera in the current pandemic are caused by the El Tor biotype Ol and 0139 serotype V. cholerae recent efforts have focused on generating vaccine constructs in these strain backgrounds. V. cholerae is capable of gene transfer by transduction, conjugation and transformation. Thus, deleted or mutated genetic elements could potentially be reacquired from toxigenic strains in nature by homologous recombination. Therefore, strategies have been utilized to minimize - possible reversion to enterotoxicity and provide a significant level of safety to live vaccines. Deletion ofthe entire region carrying the cholera toxin encoding CTX genetic element will result in the loss ofthe ctxAB genes as well as the RS and attRS sequences required for recombination, and should prevent the strains from reintegrating the CTXΦ phage into the chromosome (Pearson et al (1993) PNAS 90:3750). To confer another level of safety, the recA gene is also deleted from these strains (Taylor et al (1994) J Infect Dis 170: 1518). Genetically engineered mutant cholera strains having deletions of ctxA and attRS 1 sequences are described in U.S. Patent No. 5,631,070, which is hereby incorporated by reference in its entirety. As overexpression ofthe B subunit of CT may have an adjuvant effect as well as elicit an antitoxin immune response, the ctxB gene has been introduced under the control ofthe powerful heat shock promoter (Taylor et al (1994) J Infect Dis 170: 1518).

To be an optimum candidate for a live cholera vaccine, a mutant should: 1) be well- characterized and genetically stable (i.e., it should not revert to the toxin-producing wild-type); 2) colonize well in the intestine; and 3) provide long-lasting, broad-based immunity. Despite the development of V. cholerae strains which are effective immunogens, they remain reactogenic, causing symptoms such as mild to severe diarrhea, cramps, nausea, and anorexia. The advantages of oral live vaccines include the stimulation of mucosal immunity and the feasibility of a single dose vaccine. It is essential, however, that V. cholerae strains be derived which are suitable for live oral vaccines and which lack significant reactogenicity and any relevant virulence which is not required for protection. Therefore, in view ofthe aforementioned deficiencies, particularly in elicited protection and reactogenicity, attendant with prior art cholera vaccines, it should be apparent that there still exists a need in the art for a cholera vaccine which is safe and effective. In particular, a cholera vaccine wherein reactogenicity is reduced, but colonization and immunogenicity are not significantly limited is particularly desirable.

The citation of references herein shall not be construed as an admission that such is prior art to the present invention.

SUMMARY OF THE INVENTION

The present invention encompasses a nontoxigenic genetically stable mutant strain of Vibrio cholerae, said strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum.

The present invention provides a Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum. In particular, genetically engineered V. cholerae mutant strains are provided wherein said gene is selected from the group consisting oϊmotX, motY, pomA and pomA/pomB '. The present invention further provides a Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation in two or more genes encoding a protein required for the energization of flagellum, particularly selected from the group consisting of motX, motY, pomA and pomA/pomB. The present invention further provides a Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum. In particular, genetically engineered V. cholerae mutant strains are provided wherein said gene is selected from the group consisting of fiiG and flaA.

Vibrio cholerae mutants comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum, in combination with a deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum are also included in the present invention. In particular, Vibrio cholerae strains comprising a genetically engineered deletion mutation in the fiiG gene, in combination with a genetically engineered deletion mutation in one or more energization genes selected from the group consisting of motX, motY, pomA, pomB and pomA/pomB are provided by the present invention.

The Vibrio cholerae strain ofthe present invention includes a genetically engineered deletion mutation in any of motX, motY, omA and fiiG, further comprising a genetically engineered deletion mutation in the pomB gene.

The Vibrio cholerae strain ofthe present invention may further comprise a genetically engineered deletion mutation in the hap gene.

The Vibrio cholerae strain ofthe present invention may further comprise a genetically engineered deletion mutation in the rtx gene, including in combination with a mutation in the hap gene.

The Vibrio cholerae strain ofthe present invention may still further comprise a genetically engineered deletion of DNA encoding ctxA subunit. The Vibrio cholerae strain ofthe present invention may also comprise a genetically engineered deletion of attRS 1 sequences, including in combination with a genetically engineered deletion of DNA encoding ctxA subunit.

The present invention also includes Vibrio cholerae strains which further comprise a genetically engineered deletion or alteration of the recA gene such that the recA gene is inactivated. In particular, strains comprising genetically engineered deletions or alterations ofthe recA gene wherein the ctxB gene under the control of an inducible promoter is inserted into the recA gene are provided by the present invention. In particular, strains wherein the inducible promoter is a heat shock promoter, more particularly the promoter derived from the htpG gene, are contemplated.

The Vibrio cholerae strains ofthe present invention are derived from parental strains capable of inducing long-lasting, comprehensive protection and of colonizing the human intestine. In particular, the strains ofthe present invention are derived from a parental strain belonging to the El Tor biotype. Particularly provided are strains derived from a parental strain of the Ol or 0139 serotype. More particularly provided are strains derived from a parental strain belonging to the Inaba or Ogawa serotype. The strains ofthe present invention particularly include strains derived from parental strains selected from the group consisting of Bah (for instance, E7946), Bengal (for instance, M010), Peru (for instance, C6709) and Bang (for instance, P27459).

Particularly contemplated are mutant strains derived from the cholera toxin A mutant parental strains Bah-2, Bengal-2, Peru-2 and Bang-2.

The invention provides a method of making a genetically stable mutant strain of Vibrio cholerae comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum, said method comprising introducing into a Vibrio cholerae strain a plasmid comprising a fragment of Vibrio cholerae DNA which is mutated in a first gene encoding a protein required for energization or assembly of flagellum, said DNA capable of recombining with wild type Vibrio cholerae DNA inside said Vibrio cholerae strain, resulting in the generation of said genetically stable mutant strain. The invention particularly provides such a method wherein the first gene mutated encodes a protein required for the energization or assembly of flagellum, preferably selected from the group consisting of motX, motY, pomA, pomA/pomB and fiiG.

The method ofthe present invention further comprises introducing into the genetically stable mutant strain mutated in a first gene a further fragment of Vibrio cholerae DNA which is mutated in a second gene encoding a protein required for energization or assembly of flagellum, said DNA capable of recombining with wild type Vibrio cholerae DNA inside said genetically stable mutant Vibrio cholerae strain, resulting in the generation of a genetically stable mutant strain carrying a loss of at least part of two or more genes encoding a protein required for the energization or assembly of flagellum. The invention particularly provides such a method wherein the second gene mutated encodes a protein required for the energization or assembly of flagellum, preferably selected from the group consisting of motX, motY, pomA, pomB and fiiG and wherein the second gene is different from the first gene.

The invention also provides an immunogenic composition comprising at least one Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. In particular, immunogenic compositions comprising genetically engineered V. cholerae mutants in one or more genes selected from the group consisting oϊmotX, motY, pomA, pomA/pomB and fiiG are provided herein. Particulary preferred are immunogenic compositions comprising at least one Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss in two or more genes selected from the group of motX, motY, pomA, pomA/pomB and fiiG.

The invention provides immunogenic compositions of genetically engineered flagellar mutants derived from a single parental strains or mixtures derived from more than one parental strain. Preferred immunogenic compositions are mixtures of genetically engineered flagellar mutants derived from a parental strain of the O139 serotype, mixed with genetically engineered flagellar mutants derived from one or more parental strains ofthe Ol serotype. Particularly preferred are immunogenic compositions which are mixtures of genetically engineered flagellar mutants derived from a Bengal parental strain, mixed with genetically engineered flagellar mutants derived from one or more parental strains selected from the group of Bah, Peru and Bang.

The invention provides a vaccine comprising a nontoxigenic genetically stable mutant strain of Vibrio cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. In particular, vaccines comprising genetically engineered V. cholerae mutants in one or more genes selected from the group consisting of motX, motY, pomA, pomA/pomB and fiiG are provided herein. Particulary preferred are vaccines comprising at least one Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss in two or more genes selected from the group of motX, motY, pomA, pomA/pomB and fiiG.

Vaccines comprising mixtures of V. cholerae mutant strains derived from different parental strains, including particularly strains ofthe Ol serotype combined with strains of the 0139 serotype, are further provided. The present invention includes a vaccine comprising a mutant strain derived from a first parental strain administered as a first dose and a mutant strain derived from a second or further parental strain administered as a second or further dose, or as a booster.

The invention further includes a method for preventing infection with a Vibrio bacterium comprising administering an immunogenically effective dose ofthe vaccine ofthe present invention.

The invention also provides a method of inducing an immune response in a subject which may be or has been exposed to or infected with a Vibrio bacterium comprising administering to the subject an amount of a Vibrio cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum, thereby inducing an immune response.

The invention further provides a mutant Vibrio bacteria carrying a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. Particularly, such mutant is altered in one or more ofthe genes selected from the group consisting of motX, motY, pomA, pomA/pomB, oτfliG. More particularly, such motX, motY, pomA, pomA/pomB or fiiG mutant is Vibrio cholerae. Most particularly, such motX, motY, pomA, pomA/pomB or fiiG mutant is a Vibrio cholerae strain derived from a parental strain ofthe Ol or 0139 serotype. Still more particularly, the Vibrio cholerae strain ofthe present invention is derived from a parental strain selected from the group consisting of Bah, Bengal, Peru and Bang. Particularly contemplated are mutant strains derived from the cholera toxin A mutant parental strains Bah-2, Bengal- 2, Peru-2 and Bang-2.

Other objects and advantages will become apparent to those skilled in the art from a review ofthe following description which proceeds with reference to the following illustrative drawings.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE 1. Chromosomal region ofthe V cholerae nqr gene cluster. The positions of different transposon insertions are indicated. The amino acid sequence homologies ofthe various Nqr proteins from V. cholerae and V. alginolyticus are shown below.

FIGURE 2. Effects of growth conditions on b-galactosidase activities in wild-type and nqr mutant V. cholerae strains carrying a toxT::lacZ reporter construct. Cells were grown in LB with a starting pH of 6.5 or 8.5, or in LB (pH 6.5) with low (0 mM), normal (85mM) or high (500 mM) concentrations of NaCl, or in LB (pH 6.5) with 2.5 mM HQNO. FIGURE 3. Comparison of b-galactosidase activities in DtoxR OtcpP toxT::lacZ V cholerae strains with or without the nqr: :TnMar mutation carrying a plasmid expressing the tcpPH genes from an arabinose-inducible promoter (pBAD-PH). 0.02 % arabinose and 2.5 mM HQNO (A) were added as indicated. Effects of different media pH or various concentrations of NaCl are shown (B).

FIGURE 4. Effects of modulation of flagella rotation and specific mutations affecting motility on toxT::lacZ expression. Cell were grown in LB or in LB containing 20 mM phenamil, 20 mM monensin, 5% PVP, or 10% PVP as indicated.

FIGURE 5. Model ofthe interactions of some ofthe molecules affected by changes in membrane Na+ flux.

FIGURE 6. Analyses of mutants for motility and flagella production. Swarms in soft agar plates (A) and electron micrographs (B) ofthe V. cholerae strain O395N1 (WT) and the wotX(VcDX), motY (VcDY), pomAB (VcDAB), and fiiG (VcDG) mutant derivatives as well as the motX motY pomAB (VcDXYAB) quadruple mutant strain are shown.

FIGURE 7. Complementation of fiiG mutants by plasmids carrying various fiiG genes. (A) Amino acid sequence alignment ofthe E. coli and V. cholerae FiiG proteins and diagrams ofthe chimaeric FiiG fusion proteins. The arrow indicates the position ofthe junction between the two domains in the fusion proteins. (B) Diagram ofthe chimaeric FiiG proteins. Hatched boxes indicate V. cholerae and open boxes indicate E. coli sequences. Numbers correspond to amino acid residues. (C) Swarming abilities in the presence or absence of arabinose of the E. coli (EcDG) or V. cholerae (VcDG) fiiG deletion strains complemented by plasmids carrying the E. coli (pB AD-EcG), V. cholerae (pBAD-VcG), or chimaeric (pBAD-FPl, pBAD-FP2)/7tG genes.

FIGURE 8. Complementation ofthe V cholerae VcDXYABG strain by plasmids carrying the E. coli motAB and different./7/G genes. (A) Swarm circles ofthe quintuple deletion strain carrying the pMotAB or pACYC184 control plasmid as well as either pBAD-24, pBAD-EcG, pBAD-VcG or pBAD-FPl. (B) Swarming behavior ofthe parental (P) and of spontaneous hypermotile derivatives (HM-1, HM-2, HM-3) ofthe VcDXYABG strain carrying pMotAB and pBAD-VcG. Both soft agar plates contain arabinose.

FIGURE 9. Linking ofthe hypermotile phenotype to the pMotAB plasmid. Swarm circles in an arabinose containing soft agar plate ofthe V cholerae VcDXYABG strain carrying the pMotAB and pBAD-VcG plasmids from different origins. Shown are the parental strain (P) and a spontanous hypermotile derivative (HM). Both plasmids, pMotAB and pBAD-VcG, from the HM strain were introduced back into the host strain either together or with the original plasmids. Stars indicate that the plasmid was derived from the hypermotile strain.

FIGURE 10. Effects of different media pH on swarm circles. Motility ofthe V cholerae (VcDG, pBAD-VcG) and E. coli (EcDG, pBAD-EcG) control strains as well as several spontaneous hypermotile derivatives ofthe V. cholerae hybrid motor strain (HM-1, HM-2, and HM-3) were assayed in arabinose containing soft agar plates with a pH of 6.5 or 8.5.

FIGURE 11 depicts the predicted amino acid sequence ofthe V. cholerae MotX protein.

FIGURE 12 depicts the predicted amino acid sequence ofthe V. cholerae MotY protein.

FIGURE 13 depicts the predicted amino acid sequence ofthe V. cholerae PomA protein.

FIGURE 14 depicts the predicted amino acid sequence ofthe V. cholerae PomB protein. FIGURE 15 depicts the predicted amino acid sequence ofthe V cholerae FiiG protein.

FIGURE 16 depicts the nucleic acid coding sequence of V. cholerae motX.

FIGURE 17 depicts the nucleic acid coding sequence of V. cholerae motY.

FIGURE 18 depicts the nucleic acid coding sequence of V. cholerae pomA.

FIGURE 19 depicts the nucleic acid coding sequence of V. cholerae pomB.

FIGURE 20 depicts the nucleic acid coding sequence of V. cholerae fiiG.

DETAILED DESCRIPTION

The present invention encompasses a nontoxige ic genetically stable mutant strain of Vibrio cholerae, said strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum.

The present invention provides a Vibrio cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum. In particular, genetically engineered V. cholerae mutant strains are provided wherein said gene is selected from the group consisting of motX, motY, pomA and pomA/pomB. The present invention further provides a Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation in two or more genes encoding a protein required for the energization of flagellum, particularly selected from the group consisting of motX, motY, pomA and pomA/pomB '. The present invention further provides a Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum. In particular, genetically engineered V. cholerae mutant strains are provided wherein said gene is selected from the group consisting of fiiG and flaA.

Bacterial proteins involved in the assembly or energization of bacterial flagellum have been described and detailed by Macnab (Macnab, R.M. (1996) Flagella and Motility in "E.Coli and Salmonella: Cellular and Molecular Biology" (Neidhardt et al eds., ASM Press, Wash D.C.) pp. 123-45);

Vibrio cholerae strains comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum, in combination with a deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum are also included in the present invention. In particular, Vibrio cholerae strains comprising a genetically engineered deletion mutation in the fiiG gene, in combination with a genetically engineered deletion mutation in one or more energization genes selected from the group consisting oϊmotX, motY, pomA and pomA/pomB are provided by the present invention. Genetically engineered mutant V. cholerae strains comprising mutations at more than one of any such proteins, including but not limited to double or triple mutants, are included in the present invention. Thus, motXmotY, motXpomA, motXpomB, motYpomA, motYpomB, pomApomB, motXmotYpomA, motXmotYpomB and motXmotYpomApomB mutants are provided. These mutations may also be combined with fiiG mutations.

The genetically engineered mutations in one or more V. cholerae genes required for energization or assembly of flagellum may be combined with mutations in key virulence factors. Thus, the Vibrio cholerae strain ofthe present invention will preferably further comprise a genetically engineered deletion of DNA encoding ctxA subunit. The Vibrio cholerae strain ofthe present invention may also comprise a genetically engineered deletion of attRSl sequences, including in combination with a genetically engineered deletion of DNA encoding ctxA subunit.

The present invention also includes Vibrio cholerae strains which further comprise a genetically engineered deletion or alteration of the recA gene such that the recA gene is inactivated. In particular, strains comprising genetically engineered deletions or alterations ofthe recA gene wherein the ctxB gene under the control of an inducible promoter is inserted into the recA gene are provided by the present invention. In particular, strains wherein the inducible promoter is a heat shock promoter, more particularly a heat shock promoter derived from the htpG gene, are contemplated.

The Vibrio cholerae strain ofthe present invention may further comprise a genetically engineered deletion mutation in the hap gene. Thus, mutants in one or more ofthe genes selected from. motX, motY, pomA, pomA/pomB and fiiG may be further engineered to contain a hop gene mutation.

V cholerae mutants in one or more ofthe genes selected from motX, motY, pomA, and fiiG may be further engineered to contain a pomB gene mutation.

The Vibrio cholerae strain of the present invention may further comprise a genetically engineered deletion mutation in the rtx gene, including in combination with a mutation in the hap gene.

The Vibrio cholerae strains ofthe present invention are derived from parental strains capable of inducing long-lasting, comprehensive protection and colonizing the human intestine. In particular, the strains ofthe present invention are derived from a parental strain belonging to the El Tor biotype. Particularly provided are strains derived from a parental strain of the Ol or 0139 serotype. More particularly provided are strains derived from a parental strain belonging to the Inaba or Ogawa serotype. The strains ofthe present invention particularly include strains derived from parental strains selected from the group consisting ofthe Bah, Bengal, Peru or Bang series. Particular parental strains include, for instance, E7946 (Bah), MO 10 (Bengal), C6709 (Peru) and P27459 (Bang).

Attenuated derivatives of a V. cholerae strain C6709-Sm isolated from a cholera patient in Peru in 1991 have been constructed. The derivatives Peru-1 and Peru-2, carry small Type-1 (core) and large Type-2 deletions, respectively, which remove the DNA encoding the cholera toxin in addition to DNA encoding zot, an intestinal colonization factor (ICF) that is unrelated to cholera toxin. The larger Type-2 deletion present in Peru-2 also removes an insertion-like sequence called RSI which is present in two or more copies as part of a larger DNA segment called the CTX genetic element. The RSI sequence encodes a site-specific recombination system that can duplicate at a high-frequence and cause insertion ofthe CTX element into the V. cholerae chromosome at a 17 base pair target site called attRSl. Sequences nearly identical to attRS 1 (and apparently just as recombinationally active) exist at the ends ofthe RSI sequences. Genetically engineered live attenuated cholera vaccines are theoretically safe only if they cannot revert or otherwise regain the capacity to produce cholera toxin. Strains which carry a single copy ofthe attRSl sequence can efficiently acquire a new copy ofthe CTX element through DNA transfer by either P factor conjugation or bacteriophage transduction. Thus, deletions which render V. cholerae devoid of RS 1 and attRS 1 sequences can prevent a vaccine strain from reacquiring the CTX genetic element in nature through its own site specific recombination system. Such a deletion is present in strain Peru-2 and its derivatives. Four strains that carry the same two types of deletions (Type-1 and Type-2) as strains Peru-1 and Peru-2 have been constructed in V. cholerae strains isolated from patients in Bangladesh (P27459-Sm)and Bahrain (E7946-Sm). These four derivatives, Bang-1, Bang-2, Bah- 1 and Bah-2 vary in colonization and/or other properties (e.g., serotype). These Type- 1 and Type-2 deletion strains are described and provided -in U.S. Patent No 5,631,010, which is incorporated herein by reference.

The method ofthe present invention further comprising introducing into the genetically stable mutant strain mutated in a first gene a further fragment of Vibrio cholerae DNA which is mutated in a second gene encoding a protein required for energization or assembly of flagellum, said DNA capable of recombining with wild type Vibrio cholerae DNA inside said genetically stable mutant Vibrio cholerae strain, resulting in the generation of a genetically stable mutant strain carrying a loss of at least part of two or more genes encoding a protein required for the energization or assembly of flagellum. The invention particularly provides such a method wherein the second gene mutated encodes a protein required for the energization or assembly of flagellum, preferably selected from the group consisting of motX, motY, pomA, pomA/pomB, pomB and fiiG and wherein the second gene is different from the first gene.

Methods for generating genetically engineered deletion mutants of V. cholerae are provided by the instant invention. Additional particular deletion mutations, in addition to those particularly exemplified herein, are also contemplated. These mutations can be generated by the skilled artisan utilizing the methods provided herein and in the art including but not limited to (Donneberg and Kaper (1991) Infect Immunol 59:4310). Alternative deletion mutants of motX, motY, pomA, pomA/pomB, pomB and fiiG can be generated utilizing the nucleic acid sequences provided herein, including (SEQ ID NOS: 6-10) and exemplary methods provided and known to the skilled artisan. The invention further provides a mutant Vibrio bacteria carrying a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. Particularly, such mutant is altered in one or more ofthe genes selected from the group consisting of motX, motY, pomA, pomA/pomB and fiiG. More particularly, such motX, motY, pomA, pomA/pomB ox fiiG mutant, including any single, double or triple, etc. mutant, is Vibrio cholerae. Most particularly, such motX, motY, pomA, pomA/pomB or fiiG mutant, including any single, double or triple, etc. mutant is a Vibrio cholerae strain derived from a parental strain of the Ol or 0139 serotype. Still more particularly, the Vibrio cholerae strain ofthe present invention is derived from a parental strain selected from the group consisting ofthe Bah, Bengal, Peru or Bang series, including but not limited to Bah-2, Bengal-2, Peru-2 and Bang-2.

V. cholerae vaccine strains which are motility deficient and have a soft agar penetration phenotype, particularly Bengal-15, Peru-14, Peru-15, VRI-16 and Bah-15, are described in PCT Application WO 95/18633, which is hereby incorporated by reference in its entirety. This PCT Application further describes a method for generating mutants by transposon insertion mutagenesis, wherein random gene insertions to generate a particular phenotype, specifically a soft agar perietration- defective phenotype, are utilized to isolate mutant V. cholerae strains. The insertion points of one soft agar penetration-defective transposon insertion were sequenced and the gene determined to be the V. cholerae homolog of E. coli motB. Gardel and Mekalanos report the utilization ofthe V. cholerae motB homolog sequence obtained from the transposon insertion in targeting insertion of a suicide vector in the V. cholerae motB homolog (Gardel C. and Mekalanos J.J. (1996) Infect Immun

64(6):2246-55). This V. cholerae motB insertion mutant produced a normal sheathed flagellum but was unable to penetrate soft agar. .

Human clinical trial results on mutant strains derived from Bah, Bengal, Peru and Bang have been reported, including those by Taylor et al, Coster et al, and Benitez et al (Taylor DN et al (1994) J Infect Dis 170-1518-23; Coster TS et al (1995) Lancet 345:949-52; Benitez et al (1999) Infect Immunity 67(2): 539-45). Taylor et al reports the study of mutant strains Bah-3, Bang-3, Peru-3 (recA negative), Peru-5 (recA positive) and Peru-14. Coster et al reports the study of MO10 wild type, Bengal-3, Bengal-15 and VRI-16. Peru-14, Bengal-15 and VRI-16 are all non-motile by virtue of spontaneous, undefined mutations. While both the Bengal-15 and VRI-16 strains produced few symptoms, only Bengal-15 was immunogenic in humans. Peru-14, a spontaneous filamentous motility-deficient mutant of Peru-3, produced a few symptoms and was immunogenic. To be an optimum candidate for a live anticholera vaccine, a mutant should: 1) be well-characterized and genetically stable (i.e., it should not revert to the toxin-producing wild-type); 2) colonize well in the intestine; and 3) provide long-lived, broad-based immunity. Spontaneous or uncharacterized mutations may therefore pose problems. In addition, the immunogenicity and reactogenicity of spontaneous mutants characterized only by phenotype may not readily be predicted.

Methods for testing and assaying the strains and vaccines ofthe present invention are known to the skilled artisan. Mammals other than humans, including rodents, dogs, cats and monkeys are not naturally susceptible to cholera infection, hindering the application of traditional animal model studies. Previous studies have shown a correlation of intestinal colonization in experimental animals (suckling mice, rabbits, etc.) with immunogenicity of live cholera vaccines (Pierce, N. F. et al., (1988) Infect Immun 56:142-8). Adherence, multiplication and detachment of Vibrio cholerae can be tested in vitro on monolayers ofthe human mucin-secreting cell line HT29-18N2 (Benitez, JA et al (1997) Infect Immun 65(8):3474-7). Burgos et al have developed a functional ex vivo test for determining the diarrheagenic potential of attenuated V. cholera strains (Burgos, JM (1999) Vaccine 17(7-8):949-56). Net water movement, electrical potential difference and short-circuit current are simultaneously recorded across the human intestine ex vivo. Ultimately, testing is performed in adult human volunteers in order to assay strains fully for reactogenicity and assess their safety and immunogenicity. The strains ofthe present invention may further include a genetically engineered V. cholerae chromosome containing a DNA sequence encoding a heterologous antigen, particularly wherein the DNA sequence is functionally linked to a naturally-occurring V. cholerae promoter. Such strains carrying heterologous antigens are capable of further inducing an antigenic response to said heterologous antigen. The heterologous antigen DNA sequence may be functionally linked to a V. cholerae promoter for a virulence factor, particularly wherein expression ofthe virulence factor is thereby prevented. Methods for generating V. cholerae encoding heterologous antigens are provided in U.S. Patent No. 5,747,028 and 5,874,088, which are herein incorporated by reference.

The present invention particularly contemplates mutant strains wherein one or more V. cholerae genes encoding a protein required for energization or assembly of flagellum, particularly including motX, motY, pomA, pomA/pomB, and JUG, is deleted and/or inactivated by insertion of a DNA sequence encoding a heterologous antigen.

The therapeutic possibilities that are raised by Vibrio cholerae strains comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum derive from the fact that motility of V. cholerae influences (reduces) reactogenicity but does not significantly limit colonization or immunogenicity.

Immunogenic Compositions and Vaccines

The invention also provides an immunogenic composition comprising a mutant Vibrio cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. An immunogenic composition comprising a V. cholerae mutant in one or more genes selected from the group consisting of motX, motY, pomA, pomA/pomB and fiiG is particularly contemplated. The immunogenic composition may comprise a V. cholerae mutant having a deletion mutation in one or more genes selected from the group consisting of motX, motY, pomA and fiiG, further comprising a deletion mutation inpomB. Also provided are immunogenic compositions comprising V. cholerae mutants further altered in additional virulence genes, including but not limited to one or more ofthe group of ctxA, recA, hap, attRSl and rtx. Immunogenic compositions comprising V. cholerae mutants further altered wherein expression ofthe ctxB gene can be induced are also provided.

The invention provides a vaccine comprising a nontoxigenic genetically stable mutant strain of Vibrio cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum.

The vaccine is comprised of a genetically engineered mutant V. cholerae strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. Such mutation may result from the genetically engineered loss of at least part of one or more genes encoding a protein required for the energization of flagellum, particularly wherein said gene is selected from the group consisting of motX, motY, pomA and pomA/pomB. Such mutation may also result from the genetically engineered loss of at least part of one or more genes encoding a protein required for the assembly of flagellum, particularly wherein said gene is selected from the group consisting of fiiG, flaA. Vaccines utilizing genetically engineered mutant V. cholerae strains comprising mutations at more than one of any such proteins, including double, triple etc. mutants are included in the present invention.

The vaccines ofthe present invention may be based on V. cholerae strains comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum, in combination with a deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum are also included in the present invention. In particular, Vibrio cholerae strains comprising a genetically engineered deletion mutation in the fiiG gene, in combination with a genetically engineered deletion mutation in one or more energization genes selected from the group consisting of motX, motY, pomA and pomA/pomB are useful in the vaccines of the present invention.

Vaccines comprising strains containing genetically engineered mutations in one or more V. cholerae genes required for energization or assembly of flagellum, combined with mutations in key virulence factors are provided. Thus, Vibrio cholerae strains for the vaccine ofthe present invention may further comprise a genetically engineered deletion of DNA encoding ctxA subunit. The Vibrio cholerae strain may also comprise a genetically engineered deletion of attRSl sequences, including in combination with a genetically engineered deletion of DNA encoding ctxA subunit.

Because V. cholerae is capable of gene transfer by transduction, conjugation and transformation, the deleted or mutated genetic elements could potentially be reacquired from toxigenic strains in nature by homologous recombination. Therefore, a strategy can be utilized to introduce a deletion into the recA gene to provide a significant level of safety from possible reversion to enterotoxicity. The recA mutation also results in sensitivity ofthe mutant strain to UV light. Vaccines ofthe present invention thus further utilize strains carrying the V. cholerae flagellum mutations ofthe present invention in combination with a genetically engineered deletion or alteration of the recA gene such that the recA gene is inactivated. In particular, strains comprising genetically engineered deletions or alterations ofthe recA gene wherein the ctxB gene under the control of an inducible promoter is inserted into the recA gene are provided by the present invention. In particular, strains wherein the inducible promoter is a heat shock promoter, more particularly a heat shock promoter derived from the htpG gene, are contemplated. Vaccines based on Vibrio cholerae strains ofthe present invention further comprising a genetically engineered deletion mutation in the hap gene, alone or in combination with a genetically engineered deletion mutation in the rtx gene are also provided.

The vaccine ofthe present invention can be a live or killed vaccine. Because the mutant strains ofthe present invention lack flagella or produce non-functional flagllum, they are thereby attenuated and may, therefore, not induce a significant toxic reaction in the vaccine. The mutant strains ofthe present invention can therefore be used as live-cell vaccines, permitting effective immunity to result from administration of a single dose of the vaccine.

Historically only the Ol serogroup of V. cholerae has been associated with epidemic cholera. However, in early 1993 in India and Bangladesh, a major cholera epidemic was caused by a novel non-Ol serogroup of V. cholerae named V. cholerae 0139. Strains belonging to this newly emerged V. cholerae serogroup replaced the endemic El Tor Ol strains of V. cholerae to become the principal clinical and environmental isolate of V. cholerae on the Indian subcontinent (Cholera Working Group, 1993, Lancet 342:387-390, 1993). An ideal cholera vaccine should produce long-lasting protective immunity against Ol and 0139 strains of V. cholerae and be safe, inexpensive to produce and easy to administer. In addition, any vaccine approach should be able to address any emerging new strains of distinct or related serogroup. The genetically engineered mutant strains ofthe present invention can be recombinantly generated in any parental background and the methods ofthe present invention can, therefore, be used to construct mutant strains in the background of emerging virulent V. cholerae serogroups or serotypes suitable as immunogenic compositions or vaccines.

In preferred embodiments, the invention includes a live vaccine, preferably an oral vaccine, comprising at least two different genetically stable mutant strains of Vibrio cholerae comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum. The said different genetically stable mutant strains are particularly distinct in being derived from different parental strains of distinct serotype or serogroup. Depending upon the relevant local epidemiology, the vaccine strains may be administered together in a single dose, or more preferably, separately 7-28 days apart. Where only one ofthe serotypes presents a threat of disease, it may be preferable to administer a vaccine regime comprising only one strain.

The immunogenic composition or vaccine ofthe present invention will comprise mutant strains in a parental Ol and 0139 strain background. The Ol and 0139 derived mutant strains may be provided in a single vaccine dose, or in a first dose comprising an initial parental background and a second or further booster dose comprising a second or further parental background, including additional emerging parental serogroups or serotypes. This will ensure broad immunity, particularly in the case of travelers to distant and distinct endemic areas.

As used herein, "immunogenic composition" refers to therapeutically effective amounts ofthe mutant V. cholerae strain or strains ofthe invention together with suitable diluents, preservatives, solubilizers, emulsifiers, and/or carriers useful in therapy against bacterial infection or in inducing an immune response.

A "therapeutically effective amount" as used herein refers to that amount which provides a therapeutic effect for a given condition and administration regimen. In particular, when considering an immunogenic composition, a therapeutically effective amount refers to an amount which is sufficient to generate or elicit an immune response, particularly by measure of antibodies, to V. cholerae antigen(s). In particular, when considering a vaccine, a therapeutically effective amount refers to an amount which is sufficient to elicit or otherwise provide protection against V. cholerae challenge.

The vaccines and immunogenic compositions ofthe present invention may be prepared and administered under the dosages and conditions described in Holme et al Acute Enteric Infections in Children, New Prospects for Treatment and Prevention (1981) Elsevier North Holland Biomedical Press, Ch. 26, pp.443 (Levine et al). In addition, previously reported clinical trials, particularly of live oral vaccines, include those reported by Taylor et al, Coster et al, and Benitez et al (Taylor DN et al (1994) J Infect Dis 170-1518-23; Coster TS et al (1995) Lancet 345:949-52; Benitez et al (1999) Infect Immunity 67(2): 539-45).

An effective oral dose ofthe vaccine would contain approximately IO⁴ to 10¹⁰ bacteria, preferably IO⁶ to 10⁸ bacteria. The dose volume will vary, but must be an amount that can be readily and conveniently ingested by the vaccinee. Particularly preferred volumes are in the range of 50-250 ml, with a particularly preferred volume of approximately 100-150 ml liquid. The diluent used would typically be water or an aqueous solution or other biologically or pharmaceutically acceptable diluent solution, such as 2 grams of sodium bicarbonate dissolved in 150 ml distilled water, which may be ingested by the vaccine at one sitting, either all at once or over any convenient period of time.

Other Aspects of the Invention

In as much as the MotX, MotY, PomA, PomB and FiiG polypeptides are provided in the present invention, this invention further contemplates a vaccine which comprises a polypeptide MotX, MotY, PomA, PomB and FiiG and a pharmaceutically acceptable adjuvant or carrier. Such a vaccine may comprise a combination of at least any two such polypeptides and a pharmaceutically acceptable adjuvant or carrier. The polypeptide may comprise an amino acid sequence of a flagellar polypeptide as set forth in FIGURES 11-15 and SEQ ID NOS: 1-5. The invention further contemplates nucleic acid based vaccines comprising an isolated nucleic acid encoding a flagellar polypeptide selected from the group of MotX, MotY, PomA, PomB and FiiG and a pharmaceutically acceptable adjuvant or carrier. This invention further provides a vaccine comprising isolated nucleic acid encoding a combination of at least two such polypeptides.

Active immunity against V. cholerae may be induced by immunization (vaccination) with an immunogenic amount ofthe flagellar polypeptide, or peptide derivative or fragment thereof, and an adjuvant, wherein the polypeptide, or antigenic derivative or fragment thereof, is the antigenic component ofthe vaccine. The polypeptide, or antigenic derivative or fragment thereof, may be one antigenic component, in the presence of other antigenic components in a vaccine. For instance, the polypeptide of the present invention may be combined with other known Vibrio polypeptides, or immunogenic fragments thereof, as for instance other key virulence factors, including but not limited to ctxB, in a multi-component vaccine. Such multi-component vaccine may be utilized to enhance immune response, even in cases where the polypeptide of the present invention elicits a response on its own. The polypeptide ofthe present invention may also be combined with existing vaccines to enhance such existing vaccines.

Passive immunity can be conferred to an animal subject suspected of suffering an infection with a Vibrio bacterium, preferably V. cholerae, by administering antiserum, polyclonal antibodies, or a neutralizing monoclonal antibody against a flagellar polypeptide MotX, MotY, PomA, PomB, or FiiG ofthe invention, or a fragment thereof, to the patient. A combination of antibodies directed- against at least two such polypeptides is also contemplated.

The present invention provides flagellar polypeptides MotX, MotY, PomA, PomB and FiiG. In a particular embodiment the polypeptides have the amino acid sequence as set forth in any of FIGURES 11-15 and SEQ ID NOS: 1-5 including fragments, mutants, variants, analogs, or derivatives, thereof. The identity or location of one or more amino acid residues may be changed or modified to include variants such as, for example, deletions containing less than all ofthe residues specified for the protein, substitutions wherein one or more residues specified are replaced by other residues and additions wherein one or more amino acid residues are added to a terminal or medial portion ofthe polypeptide. These molecules include: the incorporation of codons "preferred" for expression by selected non-mammalian hosts; the provision of sites for cleavage by restriction endonuclease enzymes; and the provision of additional initial, terminal or intermediate DNA sequences that facilitate construction of readily expressed vectors.

The invention includes peptide fragments ofthe flagellar polypeptides which result from proteolytic digestion products ofthe polypeptide. In another embodiment, the derivative ofthe polypeptide has one or more chemical moieties attached thereto. In another embodiment the chemical moiety is a water soluble polymer. In another embodiment the chemical moiety is polyethylene glycol. In another embodiment the chemical moiety is mon-, di-, tri- or tetrapegylated. In another embodiment the chemical moiety is N-terminal monopegylated.

Synthetic polypeptide, prepared using the well known techniques of solid phase, liquid phase, or peptide condensation techniques, or any combination thereof, can include natural and unnatural amino acids. Thus, polypeptide ofthe invention may comprise D-amino acids, a combination of D- and L-amino acids, synthetic amino acids and various "designer" amino acids (e.g., β-methyl amino acids, Cα-methyl amino acids, and Nα-methyl amino acids, etc.) to convey special properties. A constrained, cyclic or rigidized peptide may be prepared synthetically.

This invention provides a pharmaceutical composition comprising an amount ofthe flagellar polypeptide as described and a pharmaceutically acceptable carrier or diluent. This invention provides a pharmaceutical composition comprising an amount of a flagellar polypeptide selected from the group of MotX, MotY, PomA, PomB and FiiG and a pharmaceutically acceptable carrier or diluent. Compositions of two or more flagellar polypeptides are also included.

Mutations can be made in a nucleic acid encoding the flagellar polypeptide such that a particular codon is changed to a codon which codes for a different amino acid. A substitution mutation of this sort can be made to change an amino acid in the resulting protein in a non-conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to another grouping) or in a conservative manner (i.e., by changing the codon from an amino acid belonging to a grouping of amino acids having a particular size or characteristic to an amino acid belonging to the same grouping). The present invention should be considered to include sequences containing conservative changes which do not significantly alter the activity or characteristics of the resulting protein. Substitutes for an amino acid within the sequence may be selected from other members ofthe class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids containing aromatic ring structures are phenylalanine, tryptophan, and tyrosine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Such alterations will not be expected to affect apparent molecular weight as determined by polyacrylamide gel electrophoresis, or isoelectric point. Synthetic DNA sequences allow convenient construction of genes which will express analogs or "muteins". A general method for site-specific incorporation of unnatural amino acids into proteins is described inNoren, et al. Science, 244: 182-188 (April 1989). This method may be used to create analogs with unnatural amino acids.

In accordance with the present invention there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al, "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-III [Ausubel, R M., ed. (1994)]; "Cell Biology: A Laboratory Handbook" Volumes I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M.J. Gait ed. 1984); "Nucleic Acid Hybridization" [B.D. Hames & S.J. Higgins eds. (1985)]; "Transcription And Translation" [B.D. Hames & S.J. Higgins, eds. (1984)]; "Animal Cell Culture" [RI. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

This invention provides an isolated nucleic acid encoding a V. cholerae flagellar polypeptide selected from the group of motX, motY, pomA, pomB and fiiG. In one embodiment the nucleic acid is set forth in any of FIGURES 16-20 and SEQ ID NOS: 6-10, including fragments, mutants, variants, analogs, or derivatives, thereof. The nucleic acid is DNA, cDNA, genomic DNA, RNA. Further, the isolated nucleic acid may be operatively linked to a promoter of RNA transcription.

A "vector" is a replicon, such as plasmid, phage or cosmid, to which another DNA segment may be attached so as to bring about the replication ofthe attached segment.

A "DNA" refers to the polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or a double-stranded helix. This term refers only to the primary and secondary structure ofthe molecule, and does, not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter αliα, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the nontranscribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A DNA sequence is "operatively linked" to an expression control sequence when the expression control sequence controls and regulates the transcription and translation of that DNA sequence. The term "operatively linked" includes having an appropriate start signal (e.g., ATG) in front ofthe DNA sequence to be expressed and maintaining the correct reading frame to permit expression ofthe DNA sequence under the control ofthe expression control sequence and production ofthe desired product encoded by the DNA sequence. If a gene that one desires to insert into a recombinant DNA molecule does not contain an appropriate start signal, such a start signal can be inserted in front ofthe gene.

This invention also provides a vector which comprises the above-described nucleic acid molecule. The promoter may be, or is identical to, a bacterial, yeast, insect or mammalian promoter. Further, the vector may be a plasmid, cosmid, yeast artificial chromosome (YAC), bacteriophage or eukaryotic viral DNA. Numerous vector backbones known in the art as useful for expressing protein may be employed.

This invention also provides a host vector system for the production of a polypeptide which comprises the vector of a suitable host cell. Suitable host cells include, but are not limited to, prokaryotic or eukaryotic cells, e.g. bacterial cells (E. coli and Vibrio), yeast cells, fungal cells, insect cells, and animals cells. Numerous mammalian cells may be used as hosts, including, but not limited to, mouse, rabbit, monkey and human cells.

It will be understood that not all vectors, expression control sequences and hosts will function equally well to express the DNA sequences of this invention. Neither will all hosts function equally well with the same expression system. However, one skilled in the art will be able to select the proper vectors, expression control sequences, and hosts without undue experimentation to accomplish the desired expression without departing from the scope of this invention. For example, in selecting a vector, the host must be considered because the vector must function in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, will also be considered. In selecting an expression control sequence, for example, the relative strength ofthe system, its controllability, and its compatibility with the particular DNA sequence or gene to be expressed will be considered. This invention further provides a method of producing a polypeptide which comprises growing the above-described host vector system under suitable conditions permitting the production ofthe polypeptide and recovering the polypeptide so produced.

This invention further provides an antibody capable of specifically recognizing or binding to the isolated polypeptide. The antibody may be a monoclonal or polyclonal antibody. Further, the antibody may be labeled with a detectable marker that is either a radioactive, calorimetric, fluorescent, or a luminescent marker. The labeled antibody may be a polyclonal or monoclonal antibody. In one embodiment, the labeled antibody is a purified labeled antibody. Methods of labeling antibodies are well known in the art.

The term "antibody" includes, by way of example, both naturally occurring and non- naturally occurring antibodies. Specifically, the term "antibody" includes polyclonal and monoclonal antibodies, and fragments thereof. Furthermore, the term "antibody" includes chimeric antibodies and wholly synthetic antibodies, and fragments thereof. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library.

Various procedures known in the art may be used for the production of polyclonal antibodies to polypeptide or derivatives or analogs thereof (-fee, e.g., Antibodies — A Laboratory Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory Press: Cold Spring Harbor, Ne York, 1988). For the production of antibody, various host animals can be immunized by injection with the flagellar polypeptide(s) ofthe present invention, or a derivative (e.g., fragment or fusion protein) thereof, including but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, the polypeptide can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvant may be used to increase the immunological response, depending on the host species. For preparation of monoclonal antibodies, or fragment, analog, or derivative thereof, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used (see, e.g., Antibodies — A Laboratory Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory Press: Cold Spring Harbor, Ne York, 1988). These include but are not limited to the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495-497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In an additional embodiment ofthe invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology (PCT/US90/02545). According to the invention, human antibodies may be used and can be obtained by using human hybridomas (Cote et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96). In fact, according to the invention, techniques developed for the production of "chimeric antibodies" (Morrison et al, 1984, J. Bacteriol. 159-870; Neuberger et α/., 1984, Nature 312:604-608; Takeda et al, 1985, Nature 314:452-454) by splicing the genes from a mouse antibody molecule specific for a polypeptide together with genes from a human antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. An additional embodiment ofthe invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al, 1989, Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for the polypeptide, or its derivatives, or analogs.

Antibody fragments which contain the idiotype ofthe antibody molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragment which can be produced by pepsin digestion ofthe antibody molecule; the Fab¹ fragments which can be generated by reducing the disulfide bridges ofthe F(ab')₂ fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent. Antibodies can be labeled for detection in vitro, e.g., with labels such as enzymes, fluorophores, chromophores, radioisotopes, dyes, colloidal gold, latex particles, and chemiluminescent agents. Alternatively, the antibodies can be labeled for detection in vivo, e.g., with radioisotopes (preferably technetium or iodine); magnetic resonance shift reagents (such as gadolinium and manganese); or radio-opaque reagents.

The present invention contemplates screens for a modulator of flagellar polypeptides. In one such embodiment, an expression vector containing the polypeptide ofthe present invention, or a derivative or analog thereof, is placed into a cell in the presence of at least one agent suspected of exhibiting flagellar polypeptide modulator activity. The cell is preferably a bacterial cell and most preferably an E. coli or Vibrio cell. The flagellar or motility activity is determined and any such agent is identified as a modulator when the amount of flagellar or motility activity in the presence of such agent is different than in its absence. The vectors may be introduced by any ofthe methods described above.

Further, as used herein "pharmaceutically acceptable carrier" are well known to those skilled in the art and include, but are not limited to, 0.01-0.1M and preferably 0.05M phosphate buffer or 0.8% saline. Additionally, such pharmaceutically acceptable carriers may be aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, collating agents, inert gases and the like.

The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response (Hood et al., Immunology, Second Ed., 1984, Beηjamin/Cummings: Menlo Park, California, p. 384). Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvant include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvant such as BCG (bacille Calmette-Gueriή) and Corynebacterium parvum. Preferably, the adjuvant is pharmaceutically acceptable.

According to the invention, the component or components of a immunogenic composition or pharmaceutical composition ofthe invention may be introduced parenterally, transmucosally, e.g., orally, nasally, pulmonarailly, or rectally, or transdermally. Oral or pulmonary delivery is preferred to activate mucosal immunity; which may be a particularly effective preventive treatment. Parental administration may be via intravenous injection, intra-arteriole, intramuscular, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial administration.

Administration with other compounds. For treatment of a bacterial infection, one may administer the compositions ofthe present invention with one or more pharmaceutical compositions used for treating bacterial infection, including but not limited to (1) antibiotics; (2) soluble carbohydrate inhibitors of bacterial adhesin; (3) other small molecule inhibitors of bacterial adhesin; (4) inhibitors of bacterial metabolism, transport, or transformation; (5) stimulators of bacterial lysis, or (6) anti-bacterial antibodies or vaccines directed at other bacterial antigens. Other potential active components include anti-inflammatory agents, such as steroids and non-steroidal anti- inflammatory drugs. Administration may be simultaneous (for example, administration of a mixture ofthe present active component and an antibiotic), or may be in seriatim.

The invention may be better understood by reference to the following non-limiting Examples, which are provided as exemplary ofthe invention. The following examples are presented in order to more fully illustrate the preferred embodiments ofthe invention and should in no way be construed, however, as limiting the broad scope of the invention.

EXAMPLE 1

Effects Of Changes In Membrane Sodium Flux On Virulence Gene Expression

In Vibrio Cholerae

The studies and results detailed in this Example demonstrate that the regulation of several virulence factors in V. cholerae is modulated by endogenous and exogenous sodium levels. The flagellar motor of V. cholerae is also shown to be driven by sodium motive force (smf). The expression of several virulence factors of V. cholerae is coordinately regulated by the ToxT molecule and the membrane proteins TcpP/H and ToxR/S which are required for toxT transcription. To identify proteins that negatively affect toxT transcription, we screened transposon mutants of V. cholerae carrying a chromosomally integrated toxTrfacZ reporter construct for darker blue colonies on media containing X-gal. Two mutants had transposon insertions in a region homologous to the nqr gene cluster of V. alginolyticus, encoding a sodium-translocating NADH-ubiquinone oxidoreductase (NQR). The flagellar motor of V cholerae appears to be driven by smf arid modulation of flagella rotation by inhibitory drugs, high media viscosity, or specific mutations resulted in increases of toxTrfacZ expression. Thus, the regulation ofthe main virulence factors of V. cholerae appears to be modulated by endogenous and exogenous sodium levels in a complex way, including via flagellar smf.

INTRODUCTION

V. cholerae is a gram-negative bacterium that causes the diarrheal disease cholera. In order to establish infection and cause disease, V. cholerae must express a variety of virulence factors, including cholera toxin (CT), and colonization factors such as the toxin co-regulated pilus (TCP). Expression of CT and TCP is coordinately regulated and strongly influenced by environmental stimuli (1). Transcription ofthe genes encoding these virulence factors is controlled by a regulatory^" cascade in which ToxR and TcpP control expression of ToxT, a transcriptional activator that directly controls expression of several virulence genes (2-4). ToxR and TcpP are inner membrane proteins that contain cytoplasmic DNA-binding domains. The periplasmic domains of . ToxR and TcpP are thought to interact with other transmembrane regulatory proteins, ToxS and TcpH, respectively, that stimulate their activities (4-7). ToxT is an AraC-like transcriptional activator that activates transcription of several genes, including the ctx and tcp operons, encoding CT and TCP, respectively (3).

In the present study, we isolated several V. cholerae transposon mutants that showed increased expression of a chromosomal toxTrfacZ reporter construct. Two ofthe isolated mutants had transposon insertions in a region with high homology to the V. alginolyticus nqr gene cluster, which encodes a sodium-translocating NADH-ubiquinone oxidoreductase (8, 9). We had previously isolated a mutant strain of V. cholerae with a transposon insertion in a nqr gene homolog by selecting for V. cholerae cells that produce TCP even when grown under non-inducing growth conditions (4). Since overexpression of toxT can result in cells constitutively expressing TCP (10), this prompted further investigation ofthe role ofthe nqr gene homologs in the expression of virulence genes in V. cholerae.

MATERIALS AND METHODS

Strains, plasmids. and culture conditions. V. cholerae strain O395N1 toxTrlacZ (4) was host for the tansposon mutagenesis. The transposon TnMar was introduced into V. cholerae on a suicide plasmid by conjugation with the E. coli strain b2155 carrying pFDl (11). Transposon-mutagenized V. cholerae cells were selected by plating dilutions ofthe conjugation mixture on Sm (100 ug/ml) and Kan (50 ug/ml) containing media with 5-Bromo-4-chloro-3-indolyl-b-D-galactosidase (X-gal) at 20 ug/ml. Darker blue colonies were obtained by visually scoring and tested for increased b-galactosidase activity compared to the parent strain following overnight growth in LB at 30°C. For non-inducing culture conditions, the bacteria were either grown at 30°C in LB where the pH was increased to 8.5 by adding NaOH or in LB with various amounts of NaCl added. To increase media viscosity, a 10% polyvinylpyrrolidone (PVP-360) or 15% Ficoll solution was prepared in LB and dialyzed against LB. X-gal, monensin, carbonyl cyanide m-chlorophenylhydrazone (CCCP), and 2-n-heptyl-4-hydroxyquinoline N-oxide (HQNO) were purchased from Sigma. Phenamil was purchased from Research Biochemical International.

Genetic manipulations. Chromosomal DNA was extracted from V. cholerae cells using the Easy-DNA kit (Invitrogen). The genomic regions surrounding the transposon insertions were cloned into the suicide vector pCVD442 carrying the kanR gene (pCVD442p) as described previously (12). Briefly, the plasmid pCVD442p was introduced into the transposon carrying V. cholerae strain by conjugation, selecting for AmpR and KanR cells. This should result in the integration ofthe plasmid into the transposon insertion site via homologous recombination between the kanR genes present on the plasmid and the transposon. Chromosomal DNA from these strains was prepared and digested with the restriction enzyme Bglll, which does not cut in pCVD442p or in the transposon. The chromosomal digest was then diluted, ligated, and transformed into DH5alpir E. coli cells. Plasmid DNA was prepared by using the Quiagen miniprep extraction kit and sequenced with primers specific to the transposon ends (11). The non-motile mutants were generated by homologus recombination. The plasmid pKEK93 (kindly provided by Karl Klose) (13) was used to generate the flaArcat mutation. The motY and fiiG genes were amplified in PCR reactions using specific primers and cloned into the plasmid vector pCR2.1 (Invitrogen). Internal deletions were generated using convenient restriction sites present in the genes and the DNA was then subcloned into pCVD442. The mutated alleles of these genes were introduced into the chromosome ofthe O395N1 toxTrlacZ strain following sucrose selection as described previously (14).

Motility assays. Motility phenotypes were assessed for swarm diameter following inoculation into 0.3% soft agar. Bacterial cells were also assayed for swimming speed under a dark-field microscope following the addition of various drugs.

Biochemical assays, b-galactosidase activities were assayed as described previously (4, 15).

RESULTS Identification of a gene cluster in V. cholerae with high homology to genes encoding a sodium-translocating NADH-ubiquinone oxidoreductase from V. alginolyticus. We recently reported the construction of a V. cholerae strain carrying a chromosomal toxTrlacZ reporter construct (4). To identify genes involved in the negative regulation of toxT transcription, transposon mutagenesis of this strain was performed followed by screening for darker blue colonies on medium containing X-gal. Several mutants were isolated that exhibited increased b-galactosidase activity when compared to the parent strain. Sequencing ofthe DNA adjacent to the transposon insertion in these strains revealed regions with homology to both genes of known function and genes of unknown function (data not shown). Two mutant strains had transposon insertions in a chromosomal region with high homology to the nqr gene cluster from V. alginolyticus (Figure 1). We had previously isolated a V. cholerae mutant with a Tnbla insertion in an nqr homolog, and this mutant displayed constitutive TCP expression (4). In V. alginolyticus, the nqr genes are part of a cluster of six genes encoding various subunits of a sodium-translocating NADH-ubiquinone oxidoreductase (NQR) (8, 9), a respiration-driven Na+-pump that establishes an electrochemical gradient of sodium ions across the membrane (16). Using the partial genome sequences deposited by TIGR and various primers, we confirmed that the nqr gene homologs are also linked in the V. cholerae chromosome (Figure 1). The nqr gene regions from V. cholerae and V. alginolyticus showed high sequence homology; for example, the deduced amino acid sequences ofthe two NqrA proteins are 86.5% identical (Figure 1).

Effects of loss of NOR activity on toxTrlacZ expression in V. cholerae. The nqr mutant strains were isolated as colonies that appeared darker blue on X-gal containing medium compared to the parental V. cholerae strain, and the mutant strains produced approximately 2 fold more b-galactosidase activity than the parent strain when assayed in liquid media (Figure 2). The NQR enzyme is thought to be involved in pH and ion homeostasis in V. alginolyticus (16). In V. cholerae, high pH and low or high NaCl are known to negatively affect CT and TCP production, which is believed to occur via modulation of toxT transcription (1, 10). We assayed the toxTrfacZ expression in both the parental and nqr mutant strains following growth in LB with a starting pH of 6.f> or 8.5 (Figure 2). Consistent with previous findings that the transcription of tetEis strongly affected by the external pH (10), b-galactosidase activity in the parental strain is much reduced when the cells are grown in media with a high starting pH. In the nqr mutant strains, b-galactosidase activity was also strongly reduced following growth at elevated pH (Figure 2). In contrast, very low or high concentrations of NaCl in the growth medium resulted in reduced toxTrlacZ expression in the parental but not the nqr mutant strain (Figure 2). It is interesting to note that the nqr mutant strain showed a slight growth defect compared to the parental strain and showed poorest growth at the low and high NaCl concentrations, suggesting an important role of this enzyme in ion homeostasis in V. cholerae. HQNO was reported to be a specific inhibitor ofthe NQR enzyme complex from V. alginolyticus and blocks its activity at micromolar concentrations (17). Addition of 2.5 mM HQNO to the growth medium resulted in markedly increased b-galactosidase activities only in the parental V. cholerae strain (Figure 2). These results suggest that it is the activity ofthe NQR enzyme rather than the absence ofthe protein complex that is responsible for the observed effect on toxT transcription.

Enhanced toxTrlacZ activity in a nqr mutant strain occurs even when only TcpP/H are expressed. To investigate whether the effects of this sodium pump on the toxT promoter are mediated via the ToxR/S or TcpP/H proteins, we introduced the «#r::TnMar transposon insertion into a OtoxR DtcpP toxTrlacZ V. cholerae strain (4). As reported previously (4), the OtoxR DtcpP toxTrlacZ parent strain showed very low b-galactosidase activity and the derivative strain containing the nqr mutation showed similarly low b-galactosidase activity (Figure 3 A). Overexpression ofthe tcpP and tcpH genes from an arabinose-dependent promoter can partially complement the toxR deletion for activation ofthe toxTrlacZ reporter construct (4) (Figure 3 A). If tcpPH are induced with the same arabinose concentrations in the strain carrying the nqr mutation, significantly higher b-galactosidase activities were observed compared to the parental strain (Figure 3 A). Furthermore, the addition of 2.5 mM HQNO to the growth media results in increased b-galactosidase activities in the parental but not the nqr mutant strain (Figure 3 A). Together these results indicate that the TcpP H molecules are required for the increased toxT transcription in a nqr mutant background. The activity ofthe TcpP/H proteins is sensitive to NaCl but not pH. Carroll et al. recently reported that the transcription of tcpPH is strongly reduced at high pH and temperature (7). Consistent with this, expression of tcpPH from an independent promoter resulted in toxTrfacZ expression even under alkaline conditions (Figure 3B) that result in strong repression of toxT transcription in a wild-type strain (Figure 2) (10). In contrast, the b-galactosidase activity levels from the toxTrlacZ reporter achieved by overexpression ofthe tcpPH genes are dramatically reduced if the cultures are grown in the presence of elevated concentrations of NaCl (Figure 3B). Together, these results indicate that the activities ofthe TcpP/H proteins are sensitive to high salt concentrations but not elevated pH. Interestingly, the negative effects of high NaCl concentrations on toxT transcription appear to be more pronounced when TcpP/H are expressed in the absence of ToxR/S than in a wild-type background. Induction of TcpP/H also leads to elevated b-galactosidase activities in anE. coli strain carrying a chromosomally integrated copy ofthe toxTrlacZ reporter construct (data not shown). Interestingly, these expression levels are not negatively affected by the addition of NaCl to the growth medium (data not shown), suggesting that the TcpP/H molecules are sensitive to elevated salt concentrations only in a V. cholerae background.

The flagellum of V. cholerae is energized by sodium ions. In several marine and halophilic bacterial species, the respiration-driven Na+ pump, NQR, produces an electrochemical gradient of sodium ions across the membrane, which can be utilized for solute import, ATP-synthesis, and flagella rotation (16). The single polar flagella of V. alginolyticus and V. parahaemolyticus are energized by the translocation of sodium ions (18, 19). It was previously observed that, like in other Vibrio species, motility of V. cholerae increases with increased NaCl concentrations, indicating that Na+ plays an important role in the motility in this organism (20). Furthermore, the partial genomic sequences of V. cholerae recently released by TIGR contain several homologs of genes encoding subunits specific for a Na+-driven flagellar motor (21), including motX, motY, and pomB (data not shown), that when mutagenized result in non-motile phenotypes (see below) (22). To determine whether the flagellum of V. cholerae is driven by sodium ions, we analyzed motility behavior ofthe V. cholerae wild-type strain 0395 following the addition of various inhibitors. Swimming speed of V. cholerae was dramatically reduced following the addition ofthe protonophore CCCP at pH 6.5 but not at pH 8.5 (data not shown), analogous to the results obtained for V. parahaemolyticus (19). Furthermore, the addition of micromolar concentrations of phenamil, an amiloride compound believed to specifically block the sodium ion-conducting portion of flagellar motors (23, 24), resulted in dramatically reduced motility (data not shown). Together, these results indicating that the V. cholerae flagellum is energized by the translocation of sodium ions.

Effects of modulation of flagella rotation on toxTrlacZ expression. It was previously found that motility and virulence factor expression are inversely correlated in V. cholerae (22). As loss of NQR activity, an enzyme complex involved in generating a sodium motive force that can be utilized by flagella rotation, resulted in increased toxTrfacZ expression, we wished to analyze whether changes in Na+ flux through the flagellum also result in altered toxT transcription. The addition of phenamil, an inhibitor of sodium-driven flagella, as well as addition of monensin, an ionophore that dissipates smf (25), resulted in a moderate increases in b-galactosidase activity in the O395N1 toxTrlacZ reporter strain (Figure 4). Similarly, introduction of various specific mutations that produced non-motile phenotypes resulted in slightly increased b-galactosidase activities compared to the parental strain (Figure 4). Furthermore, increasing the media viscosity by adding 5% or 10% PVP (Figure 4) or 15% Ficoll (data not shown) more dramatically induced toxTrlacZ expression, reminiscent ofthe laf gene induction observed by increased media viscosity in V. parahaemolyticus (26).

DISCUSSION

The main virulence factors of V. cholerae, CT and TCP, are coordinately regulated by a cascade of regulatory proteins in response to environmental conditions (1). The ToxT protein directly activates the ctx and tcpA promoters, and transcription ofthe tσxEgene is dependent on the ToxR/S and TcpP/H proteins. Thus far, only the Cya and Crp proteins are known to negatively affect toxT transcription (27). To identify additional negative regulators of toxT transcription, we performed transposon mutagenesis of a V. cholerae toxTrlacZ reporter strain followed by a screen for darker blue colonies. Several mutants were isolated that showed increased b-galactosidase activities compared to the parental strain. Analysis ofthe DNA sequences adjacent to the transposon insertions revealed homologies to several genomic regions of known as well as unknown functions. Interestingly, two mutant strains had transposon insertions in genes homologous to the nqr gene cluster from V. alginolyticus (8, 9). We had previously isolated an nqr.LYnbla mutant of V. cholerae that showed increased TCP expression at elevated media pH (4). Thus, we have isolated three independent mutants in the nqr gene cluster that resulted in elevated toxT transcription and/or TCP production in V. cholerae.

The NQR enzyme has been extensively studied in V. alginolyticus and is a respiration linked Na+ pump (a Na+-dependent NADH-ubiquinone reductase) (16) establishing an electrochemical gradient of sodium ions across the membrane, resulting in a sodium motive force (smf). Several bacterial species can use a smf for solute transport, ATP synthesis, and flagella rotation. This alternative energy coupling of sodium ions rather than protons enables the bacteria to maintain a cytoplasmic pH near neutrality in an alkaline environment. At alkaline pH, a strong reduction in toxT transcription is observed in both the wild-type and to a somewhat lesser extent in the nqr mutant strain, suggesting that the NQR enzyme is not the primary factor involved in the transcriptional repression of toxT and ToxT-regulated virulence genes in V. cholerae in response to alkaline conditions. In contrast, very low or high NaCl concentrations resulted in decreased toxTrlacZ expression in the parental but not nqr mutant strain, suggesting that the NQR enzyme may play a role in the response of virulence factor expression to changes in NaCl concentration.

The ability of TcpP/H to activate the toxTrlacZ fusion is dramatically reduced at high NaCl levels in V. cholerae. This suggests that TcpP H may directly sense elevated extra-cytoplasmic Na+ ions or some other signal associated with high osmostress (e.g., turgor pressure or perhaps the conformation of other membrane proteins that undergo osmotically triggered structural changes). If so, it would not be surprising that loss of the NQR activity (by mutation or HQNO intoxication) causes elevated toxTrlacZ activity since the effect ofthe NQR complex is to pump out Na+ ions. However, TcpP/H mediated activation of toxTrlacZ does not respond to elevated Na+ ion concentrations in the E. coli heterologous background. Thus, the negative signal that TcpP/H sense as a result of high Na+ concentrations may depend on another V. cholerae-specific product or physiological state. For example, another protein that negatively modulates TcpP/H activity may be induced by growth under elevated levels of NaCl. Because TcpP/H are putative membrane proteins, they may sense the activation state ofthe NQR complex directly through protein-protein interactions in the membrane. Alternatively, TcpP H may sense the level of sodium gradient rather than high Na+ concentrations per se.

Motility is an important virulence factor in a variety of pathogenic bacteria and, in some cases, is inversely regulated with other virulence factors (28). Motility in V. cholerae is known to be negatively regulated by the ToxR regulon. At least two ToxR-regulated genes on the TCP-ACF island, tcpl and acfB, encode proteins with high homology to methyl-accepting chemotaxis proteins, suggesting they are chemoreceptors, and mutations in these two genes negatively affect motility of V. cholerae as assayed by swarm plate assays (29, 30). Furthermore, toxR mutant strains display a hypermotile phenotype (22). Conversely, some nonmotile mutants showed constitutive expression of CT and TCP at alkaline conditions, whereas some hypermotile mutants expressed no CT and TCP under normally inducing conditions (22). It may be that the effects ofthe nqr mutation on toxT transcription are mediated indirectly via motility. Unlike E. coli, the single polar flagella of several Vibrio species are energized by sodium ions rather than protons. Inhibition of motility by phenamil or monensin as shown here strongly suggests that the flagellar motor of V. cholerae is also energized by the smf via translocation of sodium ions. As the activity ofthe NQR enzyme complex is believed to generate a smf that can energize flagella rotation, perhaps a lack ofthe NQR activity reduces smf which in turn slows flagella. TcpP/H or another regulatory factor might sense flagellar rotation rates directly via a mechanosensing mechanism or by sensing sodium flux through the flagellar motor. Consistent with this idea, we found that inhibiton of flagellar rotation by the addition of phenamil (a known inhibitor of sodium-driven flagellar motors), monensin (an ionophore that dissipates smf), or introduction of mutations resulting in nonmotile phenotypes lead to moderate increases in toxTrlacZ expression and CT production under in vitro expression conditions. Furthermore, increasing the media viscosity resulted in an even more dramatic induction of virulence factor expression. Viscosity iS thought to increase laf gene expression in V. parahaemoltyticus by a signaling process that involves the sensing of flagellar rotation speed (26) and perhaps a similar mechanism explains the relationship between virulence gene expression and flagellar function in V. cholerae. During infection, V. cholerae encounters a high viscosity environment in the mucus lining ofthe gut. Sensing of he changes in viscosity may be one ofthe signals which converts this organism from its environmental to its pathogenic phase.

Further experiments will be necessary to elucidate how changes in membrane sodium flux and motility affect virulence gene expression in V. cholerae. It is tempting to speculate that many signals affecting the ToxR regulon may do so by altering motility, smf, or Na-f flux (Figure 5). In agreement with this model are the observations that ^' some ofthe conditions that negatively affect the ToxR regulon, such as high pH and bile, result in hyper otility (20, 31). Alternatively, it is possible that the effects ofthe nqr mutation on toxT transcription are mediated indirectly by affecting the ATP levels and hence cAMP levels in the cell. This could lead to altered states ofthe CRP protein which is known to negatively affect toxT transcription (27). However, although we obtained three independent nqr mutants and mutations in several other genes, including hns,fumA, and glmS, that resulted in significantly raised toxT transcription, none of these were in either crp or cya, suggesting that the effects of these mutations may be more prominent than the later two.

The data presented here strongly suggest that the expression ofthe main virulence factors of V. cholerae appears to be intimately connected to the sodium energetics in this halophilic organism. Sodium regulation probably plays a role in both ofthe major environments of V. cholerae, in the intestine and in water sources. It has been argued that one of cholera toxin's functions is to generate a high Na+ environment for V. cholerae in the lumen ofthe intestine (32). It is clear that the toxin causes electrolyte levels in the intestinal lumen to increase and perhaps this milieu is a more favorable environment for the intraintestinal growth of V. cholerae (Figure 5). This might lead to a negative feedback mechanism as elevated extracellular NaCl concentrations result in reduced cholera toxin production. Furthermore, it has been hypothesized that the sodium cycle of energy plays a role in the persistence of V. cholerae in the environment, as induction of this type of energy coupling may increase the resistance of bacteria to various environmental factors (33). It is conceivable that changes in the sodium cycle of energy are the primary signals that this bacterial species uses to sense whether it is in the extra-host environment or the human gut.

REFERENCES

1. Skorupski, K & Taylor, R. K. (1997) Molecular Microbiology 25, 1003-1009.

2. Higgins, D. E. & DiRita, V. J. (1994) Molecular Microbiology 14, 17-29.

3. DiRita, V. J. (1995) in Two-Component Signal Transduction, eds. Hoch, J. A. & Silhavy, T. J. (American Society for Microbiology, Washington, DC), pp.

351-365.

4. Hase, C. C. & Mekalanos, J. J. (1998) Proceedings ofthe National Academy of Sciences USA 95, 730-734.

5. Miller, V. L., DiRita, V. J. & Mekalanos, J. J. (1989) J. Bacteriology 171, 1288-1293.

6. DiRita, V. J. & Mekalanos, J. J. (1991) Cell 64, 29-37.

7. Carroll, P. A., Tashima, K. T., Rogers, M. B., DiRita, V. J. & Calderwood, S. B. (1997) Molecular Microbiology 25, 1099-1111.

8. Hayashi, M., Hirai, K. & Unemoto, T. (1995) FEBS Letters 363, 75-77.

9. Beattie, P., Tan, K, Bourne, R. M., Leach, D., Rich, P. R. & Ward, F. B. (1994) FEBS Letters 356, 333-338.

10. DiRita, V J., Parsot, C, Jander, G. & Mekalanos, J. J. (1991) Proceedings of the National Academy of Sciences ofthe United States of America 88, 5403-5407. 11. Rubin, E. J., Akerley, B. I, Husson, R.N., Mekalanos, J.J. (1999) .

12. Skorupski, K. & Taylor, R. K. (1996) Gene 169, 47-52.

13. Klose, K. E. & Mekalanos, J. J. (1998) Journal of Bacteriology 180, 303-316.

14. Donnenberg, M. S. & Kaper, J. B. (1991) Infect Immun 59, 4310-7.

15. Miller, J. H. (1972) Experiments in molecular genetics. (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).

16. Unemoto, T. & Hayashi, M. (1993) J Bioenerg Biomembr 25, 385-91.

17. Tokuda, H. & Unemoto, T. (1982) J Biol Chem 257, 10007-14. 18. Dibrov, P. A., Kostryko, V. A., Lazarova, R. L., Skulachev, V. P. & Smirnova, I. A. (1986) Biochim Biophys Acta 850, 449-57.

19. Atsumi, T., McCarter, L. & Imae, Y. (1992) Nature 355, 182-4.

20. Kiiyukia, C, Kawakami, H. & Hashimoto, H. (1993) Microbios 73, 249-55. 21. Asai, Y., Kojima, S., Kato, H., Nishioka, N., Kawagishi, I. & Homma, M.

(1997) J Bacteriol 179, 5104-10.

22. Gardel, C. & Mekalanos, J. J. (1996) Journal of Bacteriology 64, 2246-2255.

23. Atsumi, T., Sugiyama, S., Cragoe, E. J., Jr. & Imae, Y. (1990) J Bacteriol 172, 1634-9. 24. Kojima, S., Atsumi, T., Muramoto, K., Kudo, S., Kawagishi, I. & Homma, M. (1997) J Mol Biol 265, 310-8.

25. Nachliel, E., Finkelstein, Y. & Gutman, M. (1996) Biochim Biophys Acta 1285, 131-45.

26. Belas, R., Simon, M. & Silverman, M. (1986) J Bacteriol 167, 210-8. 27. Skorupski, K. & Taylor, R. K. (1997) PNAS 94, 265-270.

28. Ottemann, K. M. & Miller, J. F. (1997) Mol Microbiol 24, 1109- 17.

29. Everiss, K. D., Hughes, K. J., Kovach, M. E. & Peterson, K. M. (1994) Infect Immun 62, 3289-98.

30. Harkey, C. W., Everiss, K. D. & Peterson, K. M. (1994) Infection and Immunity 62, 2669-2678.

31. Gupta, S. & Chowdhury, R. (1997) Infection and Immunity 65, 1131-1134.

32. Bakeeva, L. E., Chumakov, K. M., Drachev, A. L., Metlina, A. L. & Skulachev, V P. (1986) Biochimica et Biophysica Acta 850, 466-472.

33. Brown, 1. 1. & Sirenko, L. A. (1997) Biochemistry (Mosc) 62, 225-30.

EXAMPLE 2

Requirements for the Conversion ofthe Na+-Driven Flagellar Motor of Vibrio cholerae to the H+-Driven Motor of Escherichia coli

The studies and results provided in this Example relate to the generation and analysis of genetically-engineered V cholerae deletion mutants wherein genes encoding the flagellar proteins MotX, MotY, PomA/PomB and FiiG are deleted. Any of these single gene deletion mutants and a mutant deleted in all these genes demonstrate motility defects. A fiiG mutant lacks flagella. The studies described also assess the ability of homologous E. coli genes to complement the V. cholera gene deletions. The E. coli flagellar system uses H⁺ flux while the V. cholerae flagellar system uses Na⁺ flux (see also Example 1).

Bacterial flagella are powered by a motor that converts a transmembrane electrochemical potential of either H+ or Na+ into mechanical work. InE. coli, the MotA and MotB proteins form the proton translocating channel and the stator, whereas the FliG protein is located on the rotor and is involved in torque generation. In sodium-driven polar flagella of Vibrio species, PomAB and MotXY are involved in Na+-translocation and FliG is important for flagella assembly. Deletions in these genes in V. cholerae are now shown to result in non-motile phenotypes. The E. coli and V. cholerae homologous but not heterologousytVG genes complemented the respective Zt^'G-deletion strains. In chimaeric FliG proteins, the C-terminal domains could functionally interact with the ion-translocating components ofthe heterologous flagella. Complementation of a V. cholerae pomA, pomB, motX, and motY deletion strain with the E. coli motA and motB genes resulted in some motility. Spontaneous hypermotile mutants were isolated from this strain; however, in most strains the mutations did not map to the fiiG, motA or motB genes. Like E. coli, but unlike wild-type V. cholerae, motility ofthe V. cholerae strain containing the hybrid motor was inhibited by the protonophore CCCP under neutral as well as alkaline conditions but not by the sodium motor-specific inhibitor phenamil. We conclude that the E. coli proton motor components MotA and MotB can functionally substitute the sodium-translocating proteins of V. cholerae and the electrochemical energy from this proton flux can be transduced to the V. cholerae flagellar motor presumably via FliG.

INTRODUCTION

Many bacteria swim by rotating their flagella, the filamentous organelles that function as a propeller. Flagellar rotation is carried out by a rotary motor in the cell membrane at the base ofthe flagellar filament. The motor complex generating torque converts ion flux to motor rotation. The source of energy for motor rotation is the electrochemical gradient of protons or, in some species, sodium ions across the cytoplasmic membrane. Extensive studies on the proton-driven motors of Escherichia coli and Salmonella typhimurium showed that the rotor part ofthe motor is composed ofthe FliG, FliM, and FliN proteins, whereas the stator complex consists ofthe MotA and MotB proteins (for reviews see (1) (2) (3) (4)). MotA and MotB interact via their transmembrane regions and function as the proton-conducting channel (5) (6) (7). Although the mechanism ofthe conversion of electrochemical energy into mechanical work is not completely understood at the molecular level, torque generation is believed to occur at a interface between cytoplasmic domains ofthe MotA-MotB complexes and the C-terminal domain of FliG (8) (9) (10).

The architecture ofthe sodium-type motor is much less well defined. In the sodium-driven polar flagella of Vibrio alginolyticus and Vibrio parahaemolyticus, four proteins, PomA, PomB, MotX, and MotY have been shown to be essential for rotation and may comprise the stator (11) (12).(13) (14). PomA and PomB have sequence similarities to MotA and MotB, respectively. The rotation of sodium-driven flagella is specifically inhibited by phenamil, an amiloride analog, and mutations conferring resistance to phenamil mapped to the pomA and pomB genes, implicating both proteins in sodium transfer (15) (16). More indirectly, MotX was also implicated in Na+ channel function (13). Recently, the V. parahaemolyticus FliG, FliM and FliN proteins were demonstrated to be important in flagella assembly (17).

Vibrio cholerae, the causative agent ofthe severe diarrheal disease cholera, is motile via a single polar sheathed flagellum. The life cycle of V. cholerae consists of a free-swimming phase outside the host and a virulent phase when colonizing the human small intestine. While motility is thought to contribute to the pathogenicity of V. cholerae, the relationship between motility and virulence is not yet understood (18).

Interestingly, alterations in motility phenotypes were found to correlate with changes in expression ofthe major virulence genes (19). Induced changes in the membrane sodium flux were shown to affect virulence gene regulation, perhaps by affecting motility, suggesting an intriguing interplay of sodium energetics, motility, and virulence in this organism (as provided in Example 1 above; 20). The polar flagellum of V. cholerae was recently demonstrated to be sodium-driven (Example 1; 20) (21). V. cholerae gene homologs of pomA, pomB, motX, motY and fliG are present in the genome. In the present study, we analyzed the involvement of the four putative stator proteins, PomA, PomB, MotX, and MotY and the torque generating FliG protein in flagella function and assembly in V. cholerae and tested specific mutants in these genes for functional complementation by their E. coli counterparts.

MATERIALS AND METHODS

Strains. Plasmids. and Culture Conditions.

V. cholerae strain O395N1 was used for mutagenesis of thepomAB, motX, motY, and fliG genes. E. coli strain DH5alpir was used to maintain the suicide plasmids during cloning steps, whereas E. coli strain b2155 (supplemented with 0.002% DAP) was used as the host ofthe suicide plasmids for conjugation with V. cholerae cells. The E. coli fliG deletion strain DFB225 (named EcDG in this study) was kindly provided by D. Blair (22). The plasmid vector pBAD-24 was used for the cloning and expression ofthe various./7/G genes with 0.02% L-arabinose used for induction. Plasmid pJZ19 (6) (named pMotAB in this study) carrying the E. coli motAB genes in pACYC184 was generously provided by D. Blair. Plasmid pLS25 (from D. Blair) was used as the template in a PCR reaction to clone the E. coli fliG gene into pBAD-24 (pBAD-EcG). All strains were grown in LB containing the appropriate antibiotics at the following concentrations: streptomycin lOOug/ml, ampicillin 50ug/ml; chloramphenicol lOug/ml. Carbonyl cyanide m-chlorophenylhydrazone (CCCP) and phenamil were purchased from Sigma.

Genetic Manipulations.

Mutants of V. cholerae were generated by homologous recombination. Preliminary sequence data for V. cholerae were obtained by analysis ofthe unannotated V. cholerae sequences located at The Institute for Genomic Research website at http://www.tigr.org. The genes and surrounding sequences were amplified in PCR reactions (by using the specific primers for motX, motY,pomA/B and fliG provided in Example 3) and cloned into the plasmid vectors pCR2.1 (Invitrogen) or pUC19. Internal deletions were generated by using convenient restriction sites present in the genes, and the DNA was then subcloned into pWM91 (23) (generously provided by B. Wanner). The mutated alleles were introduced into the chromosome ofthe O395N1 strain following sucrose selection as described (24). Plasmid DNA was prepared by using the Qiagen (Chatsworth, CA) Miniprep extraction kit and introduced into bacteria by electroporation as described. The FP1 chimaeric construct was generated by replacement of a Sall-EcoRI fragment of pBAD-VcG containing the C-terminal 272 bp ofthe V. cholerae fliG gene with a Sall-EcoRI fragment containing the 228 bp C-terminal fragment of E. coli fliG. pBAD-FP2 was constructed by replacement ofthe Sall-Hindlll fragment of pB AD-EcG containing the C-terminal 258 bp of the E. coli fliG gene with a Sall-Hindlll fragment containing the 276 bp ofthe V. cholerae fliG.

Motility Assays. Motility phenotypes were assessed for swarm diameter following inoculation into 0.3% soft agar. Bacterial cells were also assayed for swimming ability under a dark-field microscope after the addition of various compounds. CCCP was added at 30 mM and phenamil at 50-100 mM. Three pluses indicate greater than 70% ofthe bacteria were swimming. Swimming ofthe V. cholerae parental strain was scored with four pluses to indicate the increased speed compared to E. coli or the hybrid Vibrio strain. A minus indicates that less than 10% ofthe bacteria were swimming.

RESULTS

Involvement ofthe V. cholerae PomAB. MotX. MotY. and FliG proteins in flagellar function and assembly. The V. cholerae pomA, pomB, motX, motY and fliG genes were identified by analysis ofthe unannotated V. cholerae sequences found at the Institute for Genomic Research website at http://www.tigr.org. The protein sequences for the PomA, PomB, MotX, MotY and FliG sequences are shown in FIGURES 11- 15, and SEQ ID NOS: 1-5, respectively. The nucleic acid coding sequence ofthe pomA, pomB, motX, motY and flig genes are shown in FIGURES 16-20, and SEQ ID NOS: 6-10, respectively. To study the roles ofthe V. cholerae pomAB, motX, motY, and fliG homologous genes in flagellar function and assembly, we created strains with specific deletion mutations in these genes, a strain deleted in the four putative stator genes, as well as a strain lacking all of these genes. Analyses ofthe resulting strains in soft agar plates and under light microscopy showed that all mutant strains displayed non-motile phenotypes (FIGURE 6 A). EM studies of these strains revealed that all strains deleted in the putative stator genes, including the quadruple mutant (FIGURE 6B), produced apparently normal flagella. In contrast, strains with a deletion in the fliG gene did not produce any flagella as analyzed by EM (FIGURE 6B).

Complementation of V. cholerae and E. coli DfliG strains with plasmids carrying fliG. The V. cholerae predicted FliG protein has 39.5% amino acid sequence identity with the E. coli FliG protein' (FIGURE 7A). To address whether the V. cholerae and E. coli FliG proteins can functionally complement each other, we introduced plasmids with different fliG genes under an arabinose inducible promoter into V. cholerae and E. coli yj/^'G-deletion strains. No restoration ofthe motility phenotypes as assayed in soft agar plates was observed with either the V. cholerae DfliG strain harboring the E. coli fliG gene on a plasmid or the E. coli DfliG strain carrying the V. cholerae fliG gene on a plasmid (FIGURE 7C). However, the respective fliG genes did complement their parental mutations (FIGURE 7C). A fusion protein, consisting ofthe N-terminal portion ofthe V. cholerae FliG fused to the C-terminal domain ofthe E. coli FliG (FP-1, FIGURE 7B) was capable of complementing the V. cholerae, but not the E. coli,fliG-deleted strain (FIGURE 7C). Similarly, the inverse E. coli-V. cholerae fusion protein (FP-2, FIGURE 7B) only complemented the E. coli but not V. cholerae DfliG strain (FIGURE 7C). In contrast, the V. cholerae FliG protein truncated at the fusion position, thus missing the C-terminal domain, did not restore motility in either fliG deletion background strain (data not shown). EM studies ofthe V. cholerae DfliG strain carrying different plasmids showed that none or only very few bacteria produced flagella when the E. coli wild-type FliG, the FP-2, or the truncated fliG construct. In contrast, normal flagella were observed when the V. cholerae wild-type or the chimaric FP-1 proteins were expressed (data not shown).

Complementation ofthe V. cholerae pomAB. motX. and motY genes by the E. coli motAB genes. The N-terminal domain ofthe E. coli FliG protein is believed to interact with the flagellar basal body whereas the C-terminal domain interacts with the MotA-MotB complex (9). Thus, for functional complementation ofthe ion-translocating subunits ofthe flagella we anticipated the need for a chimaeric FliG protein. A fusion protein was constructed, consisting ofthe N-terminal portion ofthe V. cholerae FliG fused to the C-terminal domain ofthe E. coli FliG (FIGURE 7B). The V. cholerae strain carrying chromosomal deletions in the pomAB, motX, motY, and fliG genes (VcDABXYG) was transformed with the plasmids encoding either the wild-type V. cholerae or E. coli fliG genes or the V. cholerae-E. coli fliG chimaeric construct from an arabinose-inducible promoter. A second plasmid containing the E. coli motAB genes was then introduced. Some, although very small, swarm circles were observed in soft agar plates only in the strain carrying the V. cholerae wild-type or chimaeric fliG genes only in the presence of arabinose (FIGURE 8 A). This motility was dependent on the presence ofthe E. coli motAB genes, as the control strain harboring pACYC184 produced no appreciable motility (FIGURE 8 A). Interestingly, spontaneous hypermotile mutants were readily observed that when isolated produced larger motility circles in soft agar plates than the parental strain (FIGURE 8B).

Moreover, these hypermotile strains also produced further hypermotile variants and several such hypermotile strains when isolated demonstrated increasingly larger motility circles (FIGURE 8B). Similar increasingly motile variants were also isolated from the strain with the chimaeric fliG gene (data not shown). Normal flagella production by the motile strains was demonstrated by EM (data not shown).

To test whether the mutations are linked to the E. coli motAB or V. cholerae fliG genes, plasmid DNA isolated from some hypermotile strains was transformed into the VcDABXYG strain selecting for both plasmid markers. The majority ofthe resulting strains did not display increased motility compared to the original strain (data not shown). However, we were able to isolate four independent pMotAB plasmids that, when transformed with the original pB AD-FliG construct, resulted in increased swarming circles (FIGURE 9).

Analysis ofthe coupling ion used for motility ofthe V. cholerae VcDABXYG strain carrying the V. cholerae fliG and E. coli motAB genes on plasmids. The £. coli flagellar motor is known to use the translocation of protons as the energy source for rotation whereas the polar flagella of V. cholerae were found to be sodium-driven. By replacing the V. cholerae pomAB, motX, and motY genes by theE. coli motAB genes we generated a functional hybrid flagellar motor and wished to investigate which coupling ion, H+ or Na+, was used for the observed motility. We investigated the energy requirement of several isolated hypermotile variants, as the original hybrid motor strain so readily produced these mutants that a pure population of cells could not be analyzed in this strain. The protonophore CCCP, a compound known to collapse proton motive force, inhibited motility ofthe E. coli control strain and the V. cholerae hybrid motor strains at neutral as well as alkaline conditions (TABLE 1). In contrast, the V cholerae control strain was inhibited at neutral pH but was insensitive to CCCP at an alkaline pH (TABLE 1). Interestingly, the addition of even very small amounts of CCCP (2-5.mM) at either pH completely inhibited motility ofthe V. cholerae hybrid motor strain, whereas much larger concentrations of CCCP (25-50 mM) were required to block motility ofthe E. coli strain (data not shown).

The sodium channel blocker phenamil, an amiloride analog known to specifically block the sodium-translocating portion of flagella (25), inhibited motility ofthe V cholerae parental strain but not ofthe V. cholerae hybrid motor strains or the E. coli control strain (TABLE 1). The addition of increasing concentrations of NaCl to LB increased the swimming speed ofthe V. cholerae parental strain, but not ofthe E. coli or V. cholerae hybrid motor strain (data not shown). Similarly, increased pH resulted in increased swarm circles by the V. cholerae parental strain, but not by the E. coli or V. cholerae hybrid motor strains (FIGURE 5). Together, these results strongly suggest that this hybrid flagellar motor, like the E. coli but unlike the V. cholerae flagellar motor, uses protons as the coupling ion for rotation.

TABLE I CCCP _: PHENAMIL pH 6.5 pH 8.5 φ 30μM φ 30μM φ 50μM

ECΔG +++ - +++ - +++ +++

EG

VCΔG ++++ - ++++ +++ ++++ +/- VCG

HMR1 +++ - +++ - +++ +-H-

HMR2 +++ - +++ - +++ +++

HMR3 +++ - +++ - +++ +++

Table 1. Effects of inhibitors on motility. Motility ofthe V. cholerae (VcDG, pB AD-VcG) and E. coli (EcDG, pBAD-EcG) control strains as well as several hypermotile derivatives ofthe V. cholerae hybrid motor strains (HM-1, HM-2, and HM-3) were assayed under the microscope. CCCP was added at a pH of 6.5 or 8.5, whereas phenamil was only added at pH 6.5. Motility was scored as described in Materials and Methods.

DISCUSSION

The single polar flagellum of V. cholerae is energized by the translocation of sodium ions (Example 1; 20) (21). The structure and function of many proteins in the proton-driven flagella of E. coli and S. typhimurium have been extensively studied (2) (4), whereas less is known about the architecture of sodium-driven flagella. The now completed sequence ofthe V. cholerae genome presents the first opportunity for an extensive sequence comparisons of various proteins constituting the two types of flagellar motors. The single polar flagella of V. alginolyticus and V. parahaemolyticus, like V. cholerae, utilize an electrochemical gradient of sodium ions (sodium motive force, smf) as energy stock for flagellar rotation (26) (27). In these two species, four proteins, PomA, PomB, MotX, and MotY, are believed to form the sodium ion conducting channel and the stator ofthe motor (11) (12) (13) (14). The PomA and PomB proteins have some sequence homology to the E. coli MotA and MotB proteins that form the proton conducting complex and stator ofthe E. coli flagella. In this study, we identified the V. cholerae gene homologs for pomA, pomB, motX, and motY from the genomic database and created V. cholerae strains with specific deletions in these genes as well as a strain deleted in all four genes. These strains showed non-motile phenotypes but produced apparently normal flagella, indicating that these proteins, like the E. coli and V. parahaemolyticus stator proteins, are required for flagellar function but not assembly. In E. coli, only three proteins, MotA, MotB, and FliG participate closely in torque generation. Torque generation is believed to occur at the interface between cytoplasmic domains ofthe MotA-MotB complexes and the C-terminal domain of FliG (8) (9). Recently, the structure ofthe C-terminal domain ofthe Thermatoga maritima FliG protein was determined (28). A fliG deletion strain of V. cholerae did not produce flagella, suggesting that like in E. coli and V. parahaemolyticus, the V. cholerae FliG protein is required for flagella assembly. Whereas the E. coli and V. cholerae fliG mutant strains were readily complemented by their homologous genes, expression ofthe heterologousyZ G genes did not restore motility. Motility required chimaeric FliG proteins where the N-termini determined species specificity, showing that the C-terminal regions ofthe two FliG proteins are functionally interchangable. Although the C-terminal domains ofthe two FliG proteins have high amino acid sequence homology, it is still remarkable that the E. coli FliG C-terminal domain can functionally interact with the sodium-translocating components (presumably PomA) of the Vibrio flagella and vice versa. This suggests very similar mechanisms of torque generation in the two types of motors. In contrast, the N-terminal domains ofthe FliG proteins apparently cannot interact properly with other flagella proteins ofthe heterologous species and seem to not even suffice for efficient assembly ofthe flagellar structure. Similarly, the E. coli and V parahaemolyticus FliG proteins did not functionally complement each other (17). Furthermore, a chimaeric E. coli-

T. maritima FliG protein, but not the full length, T. maritima FliG restored flagella production and motility of anE. coli fliG mutant strain (28).

To investigate whether the sodium-translocating components ofthe V. cholerae flagella can functionally be complemented by the E. coli proton-translocating proteins, a V. cholerae strain deleted in the pomAB, motX, and motY genes was transformed with the E. coli motAB genes. Some, although very small, swarm circles in soft agar plates were observed in this strain with spontaneous hypermotile variants appearing readily (data not shown). As the C-terminal domain ofthe FliG protein is involved in torque generation by interacting with the ion channel components, we expected that the V. cholerae-E. coli chimaeric FliG fusion protein may better interact with the MotAB proteins. A V. cholerae strain deleted in the four putative stator genes and the fliG gene carrying the E. coli motAB genes and expressing either the full-length V. cholerae or chimaeric FliG proteins displayed equally small motility zones. This indicates that the C-terminus ofthe V. cholerae FliG protein can interact efficiently with the E. coli MotAB proteins. Both strains produced spontaneous hypermotile variants and in most strains the hypermotile phenotype was not linked to the plasmids, i.e., the motAB ox fliG genes. It is possible that these mutations result in better recognition and installation ofthe foreign MotAB protein by chaperone-like proteins. Alternatively, the mutations might be in systems involved in the generation of electrochemical gradients of protons or sodium ions across the membrane, thus increasing the available energy source for flagellar rotation. However, the increased swarm circles might be a result of improved chemotaxis behavior. As the FliG proteins is part ofthe switch complex that regulates direction of flagella rotation in response to interaction with CheY (4), perhaps the hybrid motor cannot properly interact with the chemotaxis machinery. In summary, we have created a V. cholerae strain that is motile by using a hybrid flagellar motor composed ofthe V. cholerae flagellar machinery interacting with the E. coli MotAB proteins. This hybrid motor strain may provide a useful tool to help us better understand the processes involved in flagellar assembly and protein interactions required for flagellar function.

To investigate which coupling ion, H+ or Na+, was used for flagellar rotation by the hybrid motor, we used inhibitors such as CCCP and phenamil, an amiloride homolog known to specifically block the sodium-translocating portion ofthe flagella (25). Together with data from using different H+ or Na+ concentrations, we concluded that the hybrid motor strain, like E. coli but unlike V. cholerae, uses proton motive force (pmf) as the driving energy source. Thus, the mechanisms of converting electrochemical energy into rotational energy in proton- or sodium-driven flagella seem to be similar and are functionally interchangable. Furthermore, this suggests that the FliG protein does not directly interact with the ion flux across the membrane. It would be interesting to create a similar but reverse hybrid flagellar motor by introducing the V. cholerae PomAB and MotXY proteins into a motAB deleted E. coli strain to access their ability to function perhaps after induction of an artificial smf. It was recently reported that the V. parahaemolyticus motAB genes alone did not restore motility of an E. coli motAB mutant strain (17). Little is known about the residues involved in the ion selectivity ofthe sodium-translocating flagellar channel molecules. Recently, the Rhodobacter spheroides MotA protein was found to functionally complement a pomA mutant of V. alginolyticus thus creating a hybrid motor (29). However, this motor was still using the coupling of sodium ion flux, indicating that the MotA/PomA proteins alone do not dictate the ion specificity. The ion specificity of our hybrid motor has been switched from sodium ions to protons. Apparently, the E. coli MotAB proteins are specialized to translocate protons but not sodium ions even in a V. cholerae host environment that supposedly provides a strong smf. Even a V. cholerae strain deleted for only the pomAB genes complemented by the E. coli MotAB proteins seemed to use protons rather than sodium ions for flagella rotation (data not shown), indicating that the presence ofthe MotXY proteins does not influence the coupling ion used by the MotAB proteins. By introducing the E. coli motA or motB genes alone into our various stator-deletion V. cholerae strains we should be able to address which proteins are involved in ion selectivity.

The hybrid motor strain might allow us to understand the underlying mechanism for the significantly increased speed of sodium-driven flagella compared to proton-driven flagella. The E. coli flagella is known to rotate at about 15,000 rpm (30), whereas Vibrio flagella have been reported to achieve as high as 100,000 rpm (31). Perhaps the function ofthe MotXY proteins is to further stabilize the motor in the membrane to allow faster rotation. Alternatively, these two proteins might form an ion channel independent of PomAB, adding to the available energy conversion. However, a V. cholerae pomAB-deletion strain complemented with theE. coli motAB genes showed no significant increase in swarm circles or swimming speed compared to the similar strain that has all four stator genes deleted (data not shown). This indicates that the MotXY proteins either do not functionally interact with the E. coli MotAB proteins or are not involved in swimming speed. Further studies on these strains might reveal the underlying mechanism for the difference in speed between the different types of motors.

I E. coli, a strong pmf is generated by respiration at neutral conditions, whereas an alkaline environment results in an opposite DpH and a pmf is harder to maintain. Some bacteria, including several Vibrio species, can switch to a sodium cycle of energy, thus enabling the cells to maintain a neutral cytoplasmic pH at alkaline conditions. At neutral pH, a H+/Na+ antiporter converts the pmf generated by respiration into smf, whereas at alkaline pH an enzyme complex, called NQR, can generate a smf directly linked to respiration (for reviews see (32) (33)). Therefore, motility of V. cholerae is sensitive to the ionophore CCCP, an agent widely used to collapse pmf, only at neutral but not alkaline pH. Interestingly, we noticed that the sensitivity ofthe motility to CCCP was markedly different between the Vibrio hybrid motor strain and the E. coli control strain. Much less CCCP was required to completely prevent motility ofthe V. cholerae hybrid motor strain compared to the E. coli control at neutral as well as alkaline conditions. One possible explanation for this is that V. cholerae cells may be inherently more sensitive to CCCP, perhaps due to their membrane composition or lack of efflux systems. Alternatively, this difference in CCCP sensitivity might reflect differences in the strength of pmf production between these organisms. Perhaps at neutral pH V. cholerae, but not E. coli, converts a substantial portion ofthe pmf into smf. At alkaline pH, E. coli might have a specific mechanism, such as induction of an electrogenic antiporter, for maintaining a pmf that is lacking in V. cholerae, as Vibrio cells usually switch to the sodium cycle of energy under these conditions. Creating hybrid motor strains might provide useful tools to investigate the differences in membrane bioenergetics between organisms.

Motility is an important virulence factor in a variety of pathogenic bacteria and, in some cases, is inversely regulated with other virulence factors (18). Motility in V. cholerae is known to be negatively regulated by the ToxR regulon and conversely, some motility mutants showed altered expression levels ofthe main virulence factors (19). Inhibition ofthe V. cholerae smf-generating NQR enzyme complex, either by mutation or addition of a specific inhibitor, resulted in increased virulence gene expression by affecting expression ofthe regulatory protein ToxT (20). It was proposed that the effect of loss of NQR activity on toxT transcription may be indirectly mediated by affecting motility. The sodium influx through the flagellum may somehow be transduced into altered transcription of toxT, possibly by affecting the regulatory proteins TcpP/H (Example 1; 20). The hybrid motor strain presented in this study will help elucidate how changes in membrane sodium energetics and motility affect virulence gene expression in V. cholerae. We can now investigate whether the sodium influx through the flagella is sensed by an as yet uncharacterized mechanism or if the motion ofthe bacteria or if perhaps flagella rotation speed are signals resulting in changes of gene expression.

REFERENCES

1. Blair, D. F. (1995) Annu. Rev. Microbiol. 49, 489-522.

2. DeRosier, D. J. (1998) Cell 93, 17-20. 3. Berg, H. C. (1995) Biophys. J. 68, 163-167.

4. Macnab, R. (1996) in Escherichia coli and Salmonella: cellular and molecular biology, ed. FC Neidhardt, R. C, III, JL Ingraham, ECC Lin, KB Low, Magasanik, WS Reznikoff, M Riley, M Schaechter, and HE Umbarger (ASM Press, Washington, DC), pp. 123-146. 5. Tang, H., Braun, T. F. & Blair, D. F. (1996) J. Mol. Biol. 261, 209-221.

6. Zhou, J., Lloyd, S. A. & Blair, D. F. (1998) Proc. Natl. Acad. Sci. USA 95, 6436-6441.

7. Braun, T. F., Poulson, S., Gully, J. B., Empey, J. C, Van Way, S., Putnam, A. & Blair, D. F. (1999) J. Bacteriol. 181, 3542-3551. 8. Thomas, D. R., G, M. D. & DeRosier, D. J. (1999) Proc. Natl. Acad. Sci. USA 96, 10134-10139.

9. Lloyd, S. A. & Blair, D. F. (1997) J. Mol. Biol. 266, 733-744.

10. Irikura, V. M., Kihara, M., Yamaguchi, S., Sockett, H. & Macnab, R. M. (1993) J. Bacteriol. 175, 802-810. 11. Asai, Y., Kojima, S., Kato, H., Nishioka, N., Kawagishi, I. & Homma, M. (1997) J Bacteriol. 179, 5104-5110.

12. McCarter, L. L. (1994) J. Bacteriol. 176, 4219-4225.

13. McCarter, L. L. (1994) J. Bacteriol. 176, 5988-5998.

14. Okunishi, I., Kawagishi, I. & Homma, M. (1996) J. Bacteriol. 178, 2409-2415. 15. Kojima, S., Asai, Y., Atsumi, T., Kawagishi, I. & Homma, M. (1999) J. Mol.

Biol. 285, 1537-1547.

16. Jaques, S., Kim, Y.-K. & McCarter, L. L. (1999) Proc. Natl. Acad. Sci. USA

96, 5740-5745. 17. Boles, B. R. & McCarter, L. L. (2000) J. Bacteriol. 182, 1035-1045.

18. Ottemann, K. M. & Miller, J. F. (1997) Mo.l Microbiol. 24, 1109-17.

19. Gardel, C. & Mekalanos, J. J. (1996) J. Bacteriol. 64, 2246-2255.

20. Hase, C. C. & Mekalanos, J. J. (1999) Proc. Natl. Acad. Sci. USA 96, 3183-3187.

21. Kojima, S., K, Y., Kawagishi, I. & Homma, M. (1999) J. Bacteriol. 181, 1927-1930.

22. Lloyd, S. A, Tang, H, Wang, X., Billings, S. & Blair, D. F. (1996) J. Bacteriol. 178, 223-231. 23. Metcalf, W. W., Jiang, W., Daniels, L. L., Kim, S. K, Haldimann, A. & Wanner, B. L. (1996) Plasmid 35, 1-13.

24. Donnenberg, M. S. & Kaper, J. B. (1991) Infect Immun 59, 4310-4317.

25. Atsumi, T., Sugiyama, S., Cragoe, E. J., Jr. & Imae, Y. (1990) J Bacteriol 172, 1634-1639. 26. Atsumi, T., McCarter, L. & Imae, Y. (1992) Nature 355, 182-4.

27. Kawagishi, I., Maekawa, Y., Atsumi, T., Homma, M. & Imae, Y. (1995) J. Bacteriol. 177, 5158-5160.

28. Lloyd, S. A, Whitby, F. G, Blair, D. F. & Hill, C. P. (1999) Nature 400, 472-475. 29. Asai, Y., Kawagishi, I., Sockett, R. E. & Homma, M. (1999) J. Bacteriol. 181, 6332-6338.

30. Lowe, G., Meister, M. & Berg, H. C. (1987) Nature 325, 637-640.

31. Magariyama, Y., Sugiyama, S., Muramoto, K., Maekawa, Y., Kawagishi, I. & Imae, Y. (1994) Nature 371, 752. . 32. Dimroth, P. (1997) Biochim. Biophys. Acta 1318, 11-51.

33. Unemoto, T. & Hayashi, M. (1993) J. Bioenerg. Biomembr. 25, 385-391.

EXAMPLE 3

Genetically Stable Mutant Strains of V. Cholerae Useful as a Vaccine

It is important to determine the basis ofthe adverse reactions observed with most live attenuated cholera vaccine candidates, such as mild diarrhea, abdominal cramps, malaise, vomiting, and low grade fever. Work focusing on the pathogenesis of V. cholerae led to the identification of several key virulence factors, including the cholera toxin; however, the virulence factors responsible for the residual reactogenicity of most vaccine strains remain to be identified. The near completion ofthe V. cholerae genomic sequence provides an unprecedented opportunity to engineer nonreactogenic cholera vaccines. A preliminary analysis ofthe large (>100 residue) open reading frames (ORF's) deduced from this sequence information has revealed several putative toxins that might be responsible for some ofthe reactogenicity. The genetic tools are available to generate isogenic variants deleted in these putative virulence factors in the already tested El Tor background strains.

Mammals other than humans, including rodents, dogs, cats and monkeys are not naturally susceptible to cholera infection, hindering the application of traditional animal model studies. Previous studies have shown a correlation of intestinal colonization in experimental animals (suckling mice, rabbits, etc.) with immunogenicity of live cholera vaccines (Pierce, N. F. et al., (1988) Infect Immun 56:142-8). Adherence, multiplication and detachment of Vibrio cholerae can be tested in vitro on monolayers ofthe human mucin-secreting cell line HT29-18N2 (Benitez,^' JA et al (1997) Infect Immun 65(8):3474-7). Burgos et al have developed a functional ex vivo test for determining the diarrheagenic potential of attenuated V. cholerae strains (Burgos, JM (1999) Vaccine 17(7-8): 949-56). Net water movement, electrical potential difference and short-circuit current are simultaneously recorded across the human intestine ex vivo. Ultimately, testing is performed in adult human volunteers in order to assay strains fully for reactogenicity and assess their safety and immunogenicity.

The candidate genes that encode putative cytotoxic proteins include hap, a gene known to encode a zinc-metalloprotease that has been shown to elicit a secretory response and disrupt the function of intestinal tissue. Culture supematants of hap⁺but not hap^" strains induced fluid accumulation in the ileal loop assay and resulted in increases in short circuit current and tissue conductance in Ussing chambers, indicating that this protease can induce a secretory response. The structural gene hap encodes the extracellular hemagglutinin/protease (HA/protease) of V. cholerae. The mature HA/pro tease shows 61.5% identity with the Pseudomonas aeruginosa elastase (Hase, C. C. and Finnelstein, J. J. (1991) J. Bacteriol 173(11):3311-7). Null mutants in hap are fully virulent in infant rabbits. Assays using cultured human intestinal cells indicate that the HA/protease is responsible for detachment ofthe vibrios from intestinal cells by digestion of putative receptors for V. cholerae adhesives (Finkelstein, R. R. et al., (1992) Infect Immun 60(2):472-8). It has been postulated that inactivation of hap, by increasing the duration of adherence, may decrease excretion of a vaccine strain and thus increase its immunogenicity (Robert, A. et al., (1996) Vaccine 14(16): 1517-22). Preliminary clinical assessment ofthe safety and immunogenicity of a CTX Phi- negative, HA/protease defective strain showed no significant adverse reactions, strong colonization ofthe human small bowel, and elicited significant serum vibriocidal antibody and anti-cholera IgA antibody secreting cell responses (Benitez, J. A. et al., (1999) Infect Immun 67(2):539-45).

It had been observed that non-motile strains are much less reactogenic than their motile variants (Taylor et al (1994) ). Perhaps they are unable to deliver the other putative enterotoxin(s). Alternatively, the close proximity or contact of bacterial cells to the apical surface ofthe intestinal epithelium causes reactogenicity perhaps through the induction of a local inflammatory response. Highly motile, chemotactic strains of V. cholerae are known to penetrate the mucus gel and swim deeply into the intervillus spaces and crypts. Moreover, it was recently found that the diarrheal stool of volunteers colonized with reactogenic vaccine strains contains copious amounts of lactoferrin, a reliable marker for inflammatory diarrhea.

While motility is important for full virulence of V. cholerae in rabbit models, various spontaneous nonmotile mutants show no defect for colonization in the infant mouse competition assay (Richardson, K. (1991) Infect Immun 59:2727-36; Gardel, CL. and Mekalanos, J.J. (1996) Infect Immun 64:2246-55). Spontaneous nonmotile mutants of live attenuated V. cholerae vaccines (Bengal-15 and Peru-15) show reduced reactogenicity in humans while maintaining their ability to colonize the intestine (Coster, T.S. et al. (1995) Lancet 345:949-52; Kenner, J.R. et al. (1995) Infect Dis 172: 1126-9). These nonmotile mutants, however, carry unidentified motility mutations and their ability to spontaneously revert is unknown. It has been previously reported that mutants in flaA are nonflagellated (Klose, K.E. and Mekalanos, J.J. (1998) J Bacteriol 180(2):303-16). Genetic deletion in genes involved in the energization ofthe flagellum, such as motX, motY, pomA and pomB, permit the determination of whether anti-flagellum antibodies might contribute to the protective immunity. As flagellins can cause inflammatory responses, a series of a- flagellate mutant derivatives will also be tested for reactogenicity, including mutants in fliG, which is required for assembly of flagella.

The factors involved in the reactogenicity of previous cholera vaccines may be multi- factorial and might require several mutations to be introduced to result in an effective and safe vaccine. For this reason several double mutant strains have been generated. The double mutant strains were generated by using standard techniques for conjugation ofthe E. coli strain SMIOlamdapir carrying pCVD442-Δhap with the Bah-2 or Bengal-2 V. cholerae strains carrying deletions in the fliG, motX, motY, or pomA/pomB genes.

The Bengal-2 strain was derived from an 0139 clinical isolate (MO 10) through deletion ofthe entire CTX element (including RSI sequences and the attRSl integration site) by recombination with plasmid pAR62 (Waldor, M. K. and Mekalanos, J. J. (1994) J. Infect Dis 170:278-83). Bengal-2 colonizes the small intestines of suckling mice almost as well as the parental MO 10 strain.

Because V. cholerae is capable of gene transfer by transduction, conjugation and transformation, the CTX gene could potentially be reacquired from toxigenic strains in nature by homologous recombination. Therefore, a strategy can be utilized to introduce a deletion into the recA gene and also simultaneously insert a construct encoding ctxB under control ofthe htpG heat shock promoter (Parsot, C. et al., (1990) PNAS USA 87:9898-902). This ctxBv.recA resultant derivative is expected, based on growth of such strains in vitro, to produce levels ofthe B subunit of cholera toxin that exceed 25 fold versus parental strains (Waldor, M. K. and Mekalanos, J. J. (1994) J. Infect Dis 170:278-83). The B subunit of cholera toxin is nontoxic but has been shown to induce some short term cholera immunity (Clemens, J. D. et al., (1988) J. Infect Dis 158:372-7). The combination ofthe recombination element attRSl deletion and the recA disruption provides a significant level of safety from possible reversion to enterotoxicity. The recA mutation also results in sensitivity ofthe mutant strain to UV light.

The following collection of single and double mutant strains are provided and tested in human volunteers:

In the Bah-2 strain background (V cholerae Ol, E7946, El Tor, Ogawa, Δctx); described in Taylor et al., 1994, J. Infect. Dis. 170:1518: Bah-2 ΔmotX

Bah-2 ΔmotY

Bah-2 Δhap

Bah-2 ΔfliG

Bah-2 ΔpomA/B Bah-2 ΔmotX Δhap

Bah-2 ΔmotY Δhap .

Bah-2 ΔfliG Δhap

Bah-2 ΔpomA/B Δhap

In the Bengal-2 strain background (V.cholerae 0139, MOlO, Δctx); described in

Coster et al., 1995, Lancet, 345:949)

Bengal-2 ΔmotX

Bengal-2 ΔmotY

Bengal-2 Δhap Bengal-2 ΔfliG

Bengal-2 ΔpomA/B

Bengal-2 ΔmotX Δhap

Bengal-2 ΔmotY Δhap

Bengal-2 ΔfliG Δhap Bengal-2 ΔpomA/B Δhap

A recently identified cholera toxin gene cluster contains four genes tightly linked to the CTX element in the V. cholerae genome and is required for cytotoxic activity. (Lin, W. et al., (1999) PNAS USA 96(3): 1071-6.). This RTX gene cluster (for "repeats in toxin") is comprised of RtxA, the toxin, RtxC, an activator, and an associated ABC transporter system, RtxB and RtxD. The Rtx toxin, expressed in pandemic El Tor 01 and 0139 strains, but not expressed (by virtue of an RtxC gene deletion) in classical biotype V. cholerae strains, may be associated with the residual reactogenicity of certain live, attenuated cholera vaccines. Therefore, in addition to the flagellar mutants described above (ΔmotX, ΔmotY, ΔfliG, ΔpomA/B), mutant strains further possessing an Rtx gene deletion (particularly as RTX cluster deletion or, RtxA or RtxC gene deletion) are provided and tested as double mutants and in combination with hap deletion (triple mutants), for virulence, reactogenicity and immunogenicity.

MATERIALS AND METHODS

Mutants of V. cholerae were generated by homologous recombination. The genes and surrounding sequences were amplified in PCR reactions by using specific primers (see below) and cloned into the plasmid vectors pCR2.1 (Invitrogen) or pUC19. Internal deletions were generated by using convenient restriction sites present in the genes, and the DNA was then subcloned into ρWM91 (Metcalf et al. 1996, Plasmid 35:1, kindly provided by B. Wanner). The mutated alleles were introduced into the V. cholerae chromosome following sucrose selection as described (Donnenberg and Kaper, 1991, Infect Immun I 59:4310).

Primers: .

PomA5': GGGGTACCCCTCAATCATAGGACACTCATC (SEQ ID NO: 11) PomBS': CCAATGCATGTCGACGCGCAATCACTT (SEQ ID NO: 12)

MotY5': GCGCGTCATTTTTATCAGTCATGCG (SEQ ID NO: 13) MotY3': CCCTGATGGTTACATGATTGAGC (SEQ ID NO: 14)

MotX5'_: GAAGTTTCACCTATGGCTGCTGACGC (SEQ ID NO: 15) MotX3': CATCCTACGCTCTAAACCTTGACG (SEQ ID NO: 16) FliG5': CCGCAGAAGCTTTTCAGCACGC (SEQ ID NO: 17) FliG3': CCGCGCAGGTGGATATCGAACTCG (SEQ ID NO: 18)

The mutated allele of hap, encoding the V. cholerae HA/protease, was introduced by homologous recombination into the chromosome of Bah-2 ΔfliG, Bah-2 ΔmotX, Bengal-2 ΔfliG, and Bengal-2 ΔmotX by conjugation with the E. coli strain SMlOlambdapir carrying the plasmid pCVD442-Δhap followed by sucrose selection as described by Donnenberg and Kaper (Donnenberg and Kaper (1991) Infect. Immun. 59:4310). The ctxB gene under the control ofthe heat-shock promoter derived from the htpG gene is inserted into the recA gene of potential vaccine strains using published methods (Taylor et al., (1994) J. Infect. Dis. 170:1518).

Volunteers are randomized and receive approx. IO⁶ cfu of one ofthe freshly harvested prototype cholera vaccines suspended in 150 ml of distilled water with 2 g of sodium bicarbonate. Ten volunteers are tested per vaccine strain and 10 for the placebo control. Rectal swabs, measuring of stool volume and drawing of blood are performed. The volunteers are monitored for several days and then treated with tetracycline to eliminate shedding ofthe organisms. Those with diarrhea will be given oral rehydration solution (ORS).

This invention may be embodied in other forms or carried out in other ways without departing from the spirit or essential characteristics thereof. The present disclosure is therefore to be considered as in all aspects illustrate and not restrictive, the scope of the invention being indicated by the appended Claims, and all changes which come within the meaning and range of equivalency are intended to be embraced therein.

Various references are cited throughout this Specification, each of which is incorporated herein by reference in its entirety.

Claims

WHAT IS CLAIMED IS:

1. A nontoxigenic genetically stable mutant strain of Vibrio cholerae, said strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum.

2. The Vibrio cholerae strain of claim 1 wherein said strain comprises a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization of flagellum wherein said gene is selected from the group consisting oϊmotX, motY, pomA and pomA/pomB .

3. The Vibrio cholerae strain of claim 1 wherein said strain comprises a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the assembly of flagellum wherein said gene is selected from the group consisting of fliG and flaA.

4. The Vibrio cholerae strain of claim 2, wherein said strain further comprises a genetically engineered deletion mutation in the fliG gene.

5. The Vibrio cholerae strain of claim 1, wherein said strain further comprises a genetically engineered deletion mutation in the hap gene.

6. The Vibrio cholerae strain of claim 1 or claim 5, wherein said strain further comprises a genetically engineered deletion mutation in the rtx gene.

7. The Vibrio cholerae strain of any of claims 1, 5 or 6, herein said strain further comprises a genetically engineered deletion of DNA encoding ctxA subunit.

8. The Vibrio cholerae strain of claim 7 wherein said strain further comprises a genetically engineered deletion of attRSl sequences.

9. The Vibrio cholerae strain of any of claims 1 and 5-8, wherein said strain further comprises a genetically engineered deletion or alteration of the recA gene such that the recA gene is inactivated.

10. The Vibrio cholerae strain of claim 9 wherein the ctxB gene under the control of an inducible promoter is inserted into the recA gene.

11. The Vibrio cholerae strain of claim 10 wherein said inducible promoter is the heat shock promoter derived from the htpG gene.

12. The Vibrio cholerae strain of claim 1 wherein said strain is derived from a parental strain belonging to the Ol or 0139 serotype.

13. The Vibrio cholerae strain of claim 12 wherein said strain is derived from a parental strain belonging to the Inaba or Ogawa serotype.

14. The Vibrio cholerae strain of claim 13 wherein said strain is selected from the group consisting of Bah-2, Bengal-2, Peru-2, and Bang-2.

15. A method of making a genetically stable mutant strain of Vibrio cholerae comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum, said method comprising introducing into a Vibrio cholerae strain a plasmid comprising a fragment of Vibrio cholerae DNA which is mutated in a first gene encoding a protein required for energization or assembly of flagellum, said DNA capable of recombining with wild type Vibrio cholerae DNA inside said Vibrio cholerae strain, resulting in the generation of said genetically stable mutant strain.

16. The method of claim 15 wherein said first gene encoding a protein required for the energization or assembly of flagellum is selected from the group consisting of motX, motY, pomA, pomA/pomB and fliG.

17. The method of claim 15 further comprising introducing into the genetically stable mutant strain of claim 15 a further fragment of Vibrio cholerae DNA which is mutated in a second gene encoding a protein required for energization or assembly of flagellum, said DNA capable of recombining with wild type Vibrio cholerae DNA inside said genetically stable mutant Vibrio cholerae strain, resulting in the generation of a genetically stable mutant strain carrying a loss of at least part of two or more genes encoding a protein required for the energization or assembly of flagellum.

18. An immunogenic composition comprising at least one Vibrio cholerae mutant strain comprising a genetically engineered deletion mutation resulting in loss of at least part of one or more genes encoding a protein required for the energization or assembly of flagellum.

19. The immunogenic composition of claim 18 said genes are selected from the group consisting of motX, motY, pomA, pomAlpomB and fliG.

20. An immunogenic compositions comprising a mixture of genetically engineered flagellar mutants derived from more than one parental strain.

21. The immunogenic composition of claim 20 wherein said mixture is derived from parental strains ofthe Ol and 0139 serotypes.

22. A vaccine comprising the nontoxigenic genetically stable mutant strain of Vibrio cholerae of any of claims 1 or 4-8.

23. A method for preventing infection with a Vibrio bacterium comprising administering an immunogenically effective dose ofthe vaccine of claim 18 to a subject.

24. A method of inducing an immune response in a subject which may be or has been exposed to or infected with a Vibrio bacterium comprising administering to the subject an amount ofthe Vibrio cholerae strain of any of claims 1 or 4-8, thereby inducing an immune response.