WO2001066592A1 - A novel polypeptide, human rna helicase 9 and the polynucleotide encoding thereof - Google Patents

Abstract

The invention discloses a novel polypeptide, human RNA helicase 9, the polynucleotide encoding such polypeptide and the method of production thereof by DNA recombinant techniques. Methods of using the polypeptide for treating various diseases such as malignant tumor, cancer, nervous system diseases and immune system diseases and the like are also disclosed. Furthermore, the invention discloses the antagonists of the polypeptide and the effects thereof. The use of the polynucleotide encoding the novel human RNA helicase 9 is also disclosed.

Description

 A new polypeptide-human RNA helicase 9 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human RNA helicase 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to the preparation method and application of the polynucleotide and polypeptide. Background technique

 In many activities of the cell, the regulation of the RNA structure, such as splicing of precursor RNA, assembly of spliceosome, and protein translation are all necessary. These processes are usually regulated by a variety of different RNA helicases. RNA helicases from different sources constitute a large family of proteins, and their presence can be detected in many biological systems where RNA plays an important role. They are widely distributed in various tissues and organs from prokaryotes (including viruses) to lower and higher organisms. They are involved in cell and mitochondrial division, RNA editing, rRNA processing, transcription initiation, nuclear mRNA transport and tnRNA. Degradation and other processes. RNA helicases are considered important factors in cell development and differentiation, and some of them also play a role in the transcription and replication of viral single-stranded RNA [Arri Eisen, John C. Lucchesi, Bioessays, 1998, 20: 634 -641]. It provides effective means for the diagnosis, prevention and treatment of cancer, nervous system diseases and immune system diseases in vivo.

 RNA helicases are divided into different subfamilies, subfamily I and subfamily II based on their structural characteristics. All helicases contain two Walker-type NTP binding domains, the A domain (or ATPase A domain) and the B domain (or ATPase B domain). Members of subfamily I contain the conserved ATPase A domain: GXXXXGKT. It was later discovered that some ATPase crust domain A of some RNA helicases had mutations in some amino acid sites, and the conserved sequence of the ATPase A domain was: AXXGXGKT, so these proteins were divided into one class, namely, subfamily Π. In subfamily II, some proteins contain a conserved DEAD box in the ATPase domain B. It was discovered that members of this subfamily can be divided into three different subclasses according to their DEAD boxes, namely DEAD boxes Protein, DEAH box protein and DEXH box protein [Angel ika Luking, Ulf Stahl et al., 1998, Crit. Rev. Biochem. Mol. Biol., 33: 259-296].

In 1995, Zhang S. et al. Cloned the NDHI I protein from cattle, which is a member of the RNA helicase family containing DEAD boxes. It contains the DEIH motif in its domain II. This protein also has high homology with human helicase A and Drosophila Mle protein. All three are considered to play important roles in the metabolism of nuclear DNA and RNA [Zhang S., Maacke H. et al., 1995, J. Biol. Chem., 270: 16422-16427] ₀ RNA helicase A has both RNA helicase activity and DNA helicase activity in vivo. Therefore, this enzyme plays an important biological function in the transcriptional regulation of RNA [Lee CG, Eki t et al., 1998, Genomi cs, 47: 365-371]. It can be known from the above that members of the RNA helicase protein family containing DEAD boxes play an important biological function in the transcriptional regulation of RNA. The abnormal expression of this type of protein will cause some metabolic disorders caused by abnormal transcriptional regulation. A variety of immune system diseases and malignant diseases of some related tissues.

 Gene chip analysis revealed that in thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv 304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, arsenic-stimulated for 1 hour In the L02 cell line and prostate tissue, the expression profile of the polypeptide of the present invention is very similar to the expression profile of human RNA helicase 95, so the functions of the two may also be similar. The invention is named human RNA helicase 9.

 As mentioned above, the human RNA helicase 9 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more involved in these processes The human RNA helicase 9 protein, especially the amino acid sequence of this protein was identified. Isolation of the new human RNA helicase 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human RNA helicase 9 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human RNA helicase 9.

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human RNA helicase 9.

 Another object of the present invention is to provide a method for producing human RNA helicase 9.

 Another object of the present invention is to provide an antibody against the polypeptide-human RNA helicase 9 of the present invention. Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of human RNA helicase 9 against the polypeptide of the present invention.

Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormalities of human RNA helicase 9. The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 800-1042 in SEQ ID NO: 1; and (b) a sequence having 1-2229 in SEQ ID NO: 1 Sequence of bits.

 The present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human RNA helicase 9 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for detecting a disease or disease susceptibility related to abnormal expression of human RNA helicase 9 protein in vitro, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, or detecting a biological The amount or biological activity of a polypeptide of the invention in a sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for the treatment of malignant tumors, cancers, neurological diseases and immune system diseases or other diseases caused by abnormal expression of human RNA helicase 9.

Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof Minute. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A "variant" of a protein or polynucleotide refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes, in which the amino acid substituted has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human RNA helicase 9, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human RNA helicase 9.

 An "antagonist" or "inhibitor" refers to a molecule that blocks or regulates the biological or immunological activity of human RNA helicase 9 when combined with human RNA helicase 9. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that binds human RNA helicase 9.

 "Regulation" refers to a change in the function of human RNA helicase 9, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological, functional, or immune properties of human RNA helicase 9.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human RNA helicase 9 using standard protein purification techniques. Basically pure person

RNA helicase 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of human RNA helicase 9 peptide can be analyzed by amino acid sequence.

"Complementary" or "complementary" refers to polynucleotides that naturally bind through base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-ACT". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands The efficiency and strength of hybridization between nucleic acid strands has a significant effect.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern imprinting or Nor thern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of fully homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that conditions with reduced stringency allow non-specific binding, because conditions with reduced stringency require that the two sequences bind to each other as either specific or selective interactions.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Mad Son Wis.). The MEGALIGN program can compare two or more sequences according to different methods Method C lus ter (H i gg ins, DG and PM Sharp (1988) Gene 73: 237-244) 0 C l us ter method by examining all the pairs The distance between them arranges the groups of sequences into clusters. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B

The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun He in (He in J., (1990) Methods in emzumo l ogy 183: 625-645) ₀ ""Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment between amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to a "sense strand."

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and? Which can be specific Sexually binds to the epitope of human RNA helicase 9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .

 As used herein, "isolated human RNA helicase 9" means that human RNA helicase 9 is substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human RNA helicase 9 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human RNA helicase 9 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human RNA helicase 9, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

The invention also includes fragments, derivatives and analogs of human RNA helicase 9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human RNA helicase 9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is replaced by another group to include a substituent; or (ΙΠ) Such a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide and formed from the polypeptide sequence (Like the leading Sequences or secreted sequences or sequences used to purify this polypeptide or protease sequences) As set forth herein, such fragments, 00 derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2229 bases in length and its open reading frame 800-1042 encodes 80 amino acids. According to the comparison of gene chip expression profiles, it was found that this peptide has a similar expression profile to human RNA helicase 95, and it can be deduced that the human RNA helicase 9 has a similar function to human RNA helicase 95.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) only between the two sequences The hybridization occurs only when the identity between the nucleotides is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide is identical to the mature polypeptide shown in SEQ ID NO: 2 Biological function and activity.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used in the present invention, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human RM helicase 9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human RNA helicase 9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DM of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Qiagene). And the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculolar Cloning, A Labora tory Manua, Coll Spring Harbor Labora tory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) measuring the level of human RNA helicase 9 transcripts; (4) ) Detection of protein products expressed by genes through immunological techniques or determination of biological activity. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is usually a DM sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.

DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA) can be used to detect the protein product of human RNA helicase 9 gene expression. A method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DM / RNA fragment can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a human RNA helicase 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology. .

 In the present invention, a polynucleotide sequence encoding human RNA helicase 9 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human RNA helicase 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRM synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of an enhancer sequence into a vector will allow it to be transcribed in higher eukaryotic cells. To enhance. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers from 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human RNA helicase 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl, the steps used are well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 By the conventional recombinant DM technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human RNA helicase 9 (Scence, 1984; 224: 1431). Generally there are the following steps:

(1) using the polynucleotide (or variant) encoding human human RNA helicase 9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted into a cell. Extracellular. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of gene chip expression profiles of human RNA helicase 9 and human RNA helicase 95 of the present invention. The upper graph is a graph of the expression profile of human RNA helicase 9 and the lower sequence is the graph of the expression profile of human RNA helicase 95.

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human RNA helicase 9 isolated. 9kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are generally performed according to conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer Suggested conditions.

 Example 1: Cloning of human RNA helicase 9

Human fetal brain total MA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolation Kit (product of Qiegene). 2ug poly (A) mRNA was reverse transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragment into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle reaction sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0148B09 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragments of the clone in both directions. The results show that the full-length cDNA contained in the 0148B09 clone is 2229bp (as shown in Seq ID NO: 1), and has a 243bp open reading frame (0RF) from 800bp to 1042bp, encoding a new Protein (as shown in Seq ID NO: 2) We named this clone PBS-0148B09 and the encoded protein was named human RM helicase 9. Example 2: Cloning of a gene encoding human RNA helicase 9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Primer 1: 5'- GATTCAAAGTAGGTTAAGCTATCA -3 '(SEQ ID NO: 3)

 Primer2: 5,-GACAGAGCCTCGCTCTGTCACCAG -3, (SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp of the 5th end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 μl of KC1, 10 mmol / L Tris-Cl, (pH8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol in a reaction volume of 50 μ 1 Primer, 1U of Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94 ° C 30sec; 55 ° C 30sec; 72. C 2min. During RT-PCR, set β-act in as a positive control and template blank as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2229bp shown in SEQ ID NO: 1. Example 3: Northern blot analysis of human RNA helicase 9 gene expression:

Total RNA extraction in one step [Anal. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. I.e. with 4M guanidine isothiocyanate - 25mM sodium citrate, 0.2M sodium acetate _(P H4.0) of the tissue was homogenized, 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water. Using 20 g of RNA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (PH7.0)-5 mM sodium acetate-1 mM EDTA-2.2M formaldehyde. It was then transferred to a nitrocellulose membrane. ³² P dATP Preparation ³² P- DNA probe labeled by the random primer Method - with o. The DNA probe used was the PCR amplified human RM helicase 9 coding region sequence (800b _P to 1042bp) shown in FIG. 1. The 32P- labeled probe (approximately 2 X 10 ⁶ cpm / ml) and RNA was transferred to a nitrocellulose membrane overnight at 42 ° C in a hybridization solution, the solution comprising 50% formamide - 25mM KH ₂ P0 ₄ (pH7.4) -5 x SSC-5 x Denhardt's solution and 200 g / ml salmon sperm DNA. After hybridization, the filters were placed in 1 x SSC-0.1% SDS at 55. C Wash for 30min. Then, Phosphor Imager was used for analysis and quantification. Example 4: In vitro expression, isolation and purification of recombinant human RM helicase 9

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

 Primer 3: 5,-CATGCTAGCATGAGGAAATCTTCACAAGAGAGT- 3, (Seq ID No: 5)

 Primer4: 5'-CCCGAATTCTTATGGCTTATTCTTGGTGCTTAT-3 '(Seq ID No: 6) The 5' ends of these two primers contain Nhel and EcoRI digestion sites, respectively, followed by the coding sequences of the 5 'and 3' ends of the target gene, respectively. The Nhel and EcoRI restriction sites correspond to the selective endonuclease sites on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). The pBS-0148B09 plasmid containing the full-length gene of interest was used as a template for the PCR reaction. The PCR reaction conditions were as follows: a total volume of 50 μl containing 10 pg of pBS- 0148B09 plasmid, primers Primer-3 and Primer-4 were lOpmol, Advantage polymerase Mix (Clontech) 1 μ1, respectively. Cycle parameters: 94. C 20s, 60 ° C 30s, 68 ° C 2 min, 25 cycles. Nhel and EcoRI were used to double-digest the amplified product and plasmid ρET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into E. coli DH5a using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive colonies were screened by colony PCR method and sequenced. A positive clone (PET-0148B09) with the correct sequence was selected. The recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host strain BL21 (pET-0148B09) was at 37. C. Cultivate to logarithmic growth phase, add IPTG to a final concentration of 1 mmol / L, and continue to cultivate for 5 hours. The cells were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified human RNA helicase 9 was purified. After SDS-PAGE electrophoresis, a single band was obtained at 9 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were completely identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 5 Production of anti-human RNA helicase 9 antibodies

 The following peptides specific for human RNA helicase 9 were synthesized using a peptide synthesizer (product of PE):

 NH2-Met-Arg-Lys-Ser-Ser-Gln-Glu-Ser-Asn-Cys-Leu-Tyr-Cys-Leu-Leu-0H

(SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avrameas, et al. Immunochemistry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Isolation from antibody-positive rabbit serum with protein A-Sepharose Total IgG. The peptide was bound to a cyanogen bromide-activated Sephar _{0S e} 4B column, and the anti-peptide antibody was separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human RM helicase 9. Example 6: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same basic hybridization method after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

3. There should be no complementary regions inside the probe;

4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements Region for homology comparison, if the homology with non-target molecular region is greater than 85% or more than 15 consecutive bases are exactly the same, the primary probe should not be used in general;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5-TGAGGAAATCTTCACAAGAGAGTAACTGTCTGTATTGTTTG-3 '(SEQ ID NO: 8)

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):

 5'-TGAGGAAATCTTCACAAGAGCGTAACTGTCTGTATTGTTTG-3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not listed in the following specific experimental steps, please refer to the literature: DNA PROBES GH Keller; MM Manak; Stockton Press, 1989 (USA ), And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" U998 Second Edition) [US] Sambruck et al., Science Press.

 Sample Preparation:

1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (add lmU every 0.1 g of the initial tissue sample, and then follow the phenol extraction method below.

2, phenol extraction method for DNA

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1,000 g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or at 37 ° C. C gently shake overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the aqueous phase containing DNA to a new tube. Of course The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 180 vol. 2mol / L sodium acetate and 2 vol. Cold 100% ethanol to the DNA solution and mix. Leave at -20 ° C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Vortex at low speed or suck with a dropper while gradually increasing TE, mix until the DNA is fully dissolved, and add approximately 1 ul for every 1-5 χ ΐθ ⁶ cells.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100u _g / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well at -20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure A ₂₆ . And A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° (:. Preparation of sample film:

 1) Take 4x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, in order to follow the experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), and dry in filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.1 IOD / Ιθμ 1), add 2 μ IKinase buffer, 8-10 uCi γ- ³² P- dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37'C for 2 hours.

3) Add 1/5 volume of bromophenol blue indicator (BPB). 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (moni tor can be used for monitoring).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) were collected after the first peak were combined as ³² P-Probe (second peak to prepare the desired free γ- ³² P- dATP) ₀

 Pre-hybridization

 Place the sample membrane in a plastic bag, add 3-10 mg of prehybridization solution (1 OxDenhardfs; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), Seal the bag, 68. C water bath for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C Wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray autoradiography:

 -70T, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

釆 The hybridization experiments performed under low-intensity membrane washing conditions did not differ significantly in the radioactivity of the above two probe hybrid spots; while the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of hybridization spots of probe 1 was obvious. Stronger in radioactivity than the hybridization spot of another probe. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 7 DNA Microarray Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of rapid, efficient, and high-throughput analysis of biological information. The polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Sc ience 278, 680-686. And the literature Hel le, RA, Schema , M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDMs are used as target DMs, including the polynucleotides of the present invention. They were amplified by PCR respectively. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been variously reported in the literature, and the post-sampling processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking ''

Total mRNA was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and the mRNA was purified with Ol igotex mRNA Midi Kit (purchased from QiaGen). The fluorescent test was also labeled with Cy3dUTP (5-Amino-propargy 1-2 · -deoxyur i dine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech Co.), and fluorescent reagents were used. Cy5dUTP (5- Amino- propargy 2 '-deoxyur idine 5' -tr iphate coupled to Cy5 f luorescent dye, purchased from Amersham Phamac ia Biotech) to label mRNA of specific tissues (or stimulated cell lines) of the body, after purification A probe was prepared. With See the steps and methods for detailed steps:

 Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, R. f (1995) Science. 270. (20): 467-480.

(Three) cross

 Combine the probes from the two tissues with the chips in UniHyb ™ Hybridization

Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with washing solution (1 x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000 scanner (purchased from General Scanning, USA). The scanned image Imagene software (Biodiscovery, USA) was used for data analysis and processing to calculate the Cy3 / Cy5 ratio of each point.

 The above specific tissues (or stimulated cell lines) are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1) . It can be seen from the figure that the expression profiles of human RNA helicase 9 and human RNA helicase 95 according to the present invention are very similar. Industrial applicability

 The polypeptides of the present invention, as well as antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can treat malignant tumors, cancers, neurological diseases, immune system diseases, and the like.

 RNA and DNA helicases are expressed in cancer tissues, brain and nerve tissues, and tissues associated with inflammation and immune responses. Thus, RNA helicases play an important role in cancer, nervous system diseases, and immune system diseases. In particular, the expression of RNA helicase is significantly increased in cancer and immune system diseases; in nervous system-related diseases, its expression is reduced or its activity is weakened.

 In particular, with regard to the novel human RNA helicase of the present invention, the enzyme and its fragments or derivatives can be used to diagnose and treat diseases related to the nervous system, including but not limited to the following, sedation panic disorder, presenile Dementia, memory anterograde amnesia, amyotrophic lateral sclerosis, bipolar neurocytic disorder, tension, brain tumors, dementia, depression, delayed dyskinesia, dystonia, epilepsy, hereditary chronic chorea, multiple Lateral sclerosis, neurofibromas, Parkinson's disease, paranoid neuropathy, schizophrenia, Tourette's disease, etc.

The novel human helicases and fragments or derivatives thereof of the present invention can also be used to diagnose and treat some cancers, including but not limited to the following, adenoma, leukemia, lymphoma, melanoma, myeloma, sarcoma, etc .; In particular, cancers including the following tissues: thyroid, bladder, bone, bone marrow, brain, breast, cervix, tendon sheath cyst, heart, kidney, lung, liver, muscle, ovary, pancreas, nail Parathyroid glands, prostate, uterus, salivary glands, skin, spleen, testes, penis, thymus, gallbladder, gastrointestinal tract, etc.

 The novel human helicases and fragments or derivatives thereof of the present invention can also be used to diagnose and treat diseases related to the immune system, including but not limited to the following, rheumatoid arthritis, chronic active hepatitis, primary Sjogren's syndrome, ankylosing spondylitis, hemochromatosis, immune complex glomerulonephritis, mycocarditis after gonococcal infection, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, polymyositis, mouth Xerophthalmia syndrome, nodular polyarteritis, Wegener's granulomatosis, myasthenia gravis, Guillain-Barre syndrome, autoimmune hemolytic anemia, immune thrombocytopenic purpura, insulin autoimmune syndrome, autoimmune Immune thyroid disease, autoimmune heart disease, Down syndrome, short-limb dwarfism, hereditary transcobalamin deficiency with hypogammaglobulinemia, biotin-dependent carboxylase deficiency, Dun Can syndrome , Thymoma, chronic disease skin mucosal candidiasis, aplastic anemia, Di George syndrome, Wi s co U-Aldrich syndrome, immunodeficiency disease with ataxia telangiectasia, etc.

 The novel human helicases and fragments or derivatives thereof of the present invention can also be used to diagnose and treat diseases related to the immune system, including but not limited to the following, pulmonary eosinophilia, sarcoidosis, rheumatism Arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex glomerulonephritis, acute anterior uveitis, osteoporosis, dermatomyositis, urticaria, Specific dermatitis, hemochromatosis, polymyositis, Addison's disease, Graves' disease, chronic active hepatitis, emergency bowel syndrome, atrophic gastritis, systemic lupus erythematosus, myasthenia gravis, cerebral spinal cord Multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, Wegener's granulomatosis, autoimmune thyroiditis, autoimmune interstitial nephritis, ulcerative colitis, anemia, pancreatitis, segmental ileitis, Myocarditis, atherosclerosis, multiple scleroderma, etc.

 The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human RNA helicase 9. Agonists enhance human RNA helicase 9 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or a membrane preparation expressing human RNA helicase 9 can be cultured with labeled human RNA helicase 9 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human RNA helicase 9 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human RNA helicase 9 can bind to human RM helicase 9 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot perform biological functions.

When screening compounds as antagonists, human RNA helicase 9 can be added to bioanalytical assays In this study, the effect of a compound on the interaction between human RM helicase 9 and its receptor was determined to determine whether the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human RNA helicase 9 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. In screening, human RM helicase 9 molecule should generally be labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies against human RNA helicase 9 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments generated from Fab expression libraries.

Polyclonal antibodies can be produced by injecting human RNA helicase 9 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's adjuvant. Wait. Techniques for preparing monoclonal antibodies to human RM helicase 9 include, but are not limited to, hybridoma technology (Kohler and Milste in. Nature, 1975, 256: 495-497), triple tumor technology, human beta-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851). ₀ Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single-chain antibodies against human RNA helicase 9.

 Anti-human RM helicase 9 antibodies can be used in immunohistochemistry to detect human RNA helicase 9 in biopsy specimens.

 Monoclonal antibodies that bind to human RNA helicase 9 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

 Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human RNA helicase 9 high affinity monoclonal antibodies can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human RNA helicase 9 positive cells .

 The antibodies of the present invention can be used to treat or prevent diseases associated with human RNA helicase 9. Administration of an appropriate amount of antibody can stimulate or block the production or activity of human RNA helicase 9.

The invention also relates to a diagnostic test method for quantitative and localized detection of human RNA helicase 9 levels. These tests are well known in the art and include FISH assays and radioimmunoassays. The level of human RNA helicase 9 detected in the test can be used to explain the importance and use of human RNA helicase 9 in various diseases. For the diagnosis of diseases in which human RNA helicase 9 functions.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 Polynucleotides encoding human RNA helicase 9 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human A helicase 9. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human RNA helicase 9 to inhibit endogenous human RNA helicase 9 activity. For example, a mutated human RNA helicase 9 may be a shortened human RNA helicase 9 that lacks a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human helicase 9. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human RNA helicase 9 into cells. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding human RNA helicase 9 can be found in the existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding human RNA helicase 9 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

 Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human RNA helicase 9 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RM. The mechanism is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA, DNA, and ribozymes can be obtained using any existing RM or DNA synthesis technology, such as solid-phase phosphate amide chemical synthesis to synthesize oligonucleotides. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the vector's RNA polymerase promoter. In order to increase the stability of the nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the phosphorothioate or peptide bond instead of the phosphodiester bond is used for the ribonucleoside linkage.

The polynucleotide encoding human RM helicase 9 can be used for the diagnosis of diseases related to human RNA helicase 9. The polynucleotide encoding human RNA helicase 9 can be used to detect the expression of human RNA helicase 9 or the abnormal expression of human RNA helicase 9 in a disease state. For example, the DNA sequence encoding human RNA helicase 9 can be used to hybridize biopsy specimens to determine the expression of human RNA helicase 9. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. Part or all of a polynucleotide of the invention It can be used as a probe to be fixed on a microarray or a DM chip (also known as a "gene chip") to analyze the differential expression analysis and gene diagnosis of genes in tissues. Human RM helicase 9 specific primers can be used to perform RNA-polymerase chain reaction (RT-PCR) in vitro amplification to detect human RNA helicase 9 transcription products.

 Detection of mutations in the human RM helicase 9 gene can also be used to diagnose human RM helicase 9-related diseases. Human RNA helicase 9 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to normal wild-type human RNA helicase 9 DNA sequences. Mutations can be detected using existing techniques such as Southern imprinting, DNA sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

 PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in a single step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

Next, the differences in cDNA or genomic sequences between the affected and unaffected individuals need to be determined. If a mutation is observed in some or all diseased individuals, and the mutation is not observed in any normal individual, The mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in the chromosome, such as deletions or translocations that are visible at the chromosomal level or detectable using cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human RNA helicase 9 is administered in an amount effective to treat and / or prevent a specific indication. The amount and dose range of human RNA helicase 9 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

Book

I. An isolated polypeptide-human RNA helicase 9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95 »/» identity with the amino acid sequence shown in SEQ ID D0: 2.

 3. The polypeptide according to claim 2, further comprising a polypeptide having an amino acid sequence represented by SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of: (a) encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment thereof, or an analog thereof; Polynucleotides of derivatives;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 800-1 042 in SEQ ID NO: 1 or a sequence of positions 1-2229 in SEQ ID NO: 1. sequence.

 7. A recombination vector containing an exogenous polynucleotide, characterized in that it is a recombination constructed by the polynucleotide according to any one of claims 4-6 and a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

 9. A method for preparing a polypeptide having human RM helicase 9 activity, characterized in that the method includes:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing human RM helicase 9;

(b) Isolating a polypeptide having human RNA helicase 9 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that the antibody is an antibody capable of specifically binding to human RNA helicase 9.

II. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they mimic, promote, Compounds that antagonize or inhibit the activity of human MA helicase 9.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. Use of a compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human RM helicase 9 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human RM helicase 9; or for peptides Fingerprint identification.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human RNA helicase 9 abnormality.

 18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.