WO2001060854A1 - Nouveaux membres de la famille multigenique des transporteurs h+/oligopeptide - Google Patents

Nouveaux membres de la famille multigenique des transporteurs h+/oligopeptide Download PDF

Info

Publication number
WO2001060854A1
WO2001060854A1 PCT/US2001/004799 US0104799W WO0160854A1 WO 2001060854 A1 WO2001060854 A1 WO 2001060854A1 US 0104799 W US0104799 W US 0104799W WO 0160854 A1 WO0160854 A1 WO 0160854A1
Authority
WO
WIPO (PCT)
Prior art keywords
hphtl
nucleic acid
hpht2
protein
cell
Prior art date
Application number
PCT/US2001/004799
Other languages
English (en)
Other versions
WO2001060854A8 (fr
Inventor
Wolfgang Sadee
Christopher W. Botka
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Priority to AU2001238290A priority Critical patent/AU2001238290A1/en
Publication of WO2001060854A1 publication Critical patent/WO2001060854A1/fr
Publication of WO2001060854A8 publication Critical patent/WO2001060854A8/fr

Links

Classifications

    • G—PHYSICS
    • G11—INFORMATION STORAGE
    • G11C—STATIC STORES
    • G11C13/00—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00
    • G11C13/0002—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00 using resistive RAM [RRAM] elements
    • G11C13/0009—RRAM elements whose operation depends upon chemical change
    • G11C13/0014—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material
    • G11C13/0019—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material comprising bio-molecules
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y10/00—Nanotechnology for information processing, storage or transmission, e.g. quantum computing or single electron logic
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • G—PHYSICS
    • G11—INFORMATION STORAGE
    • G11C—STATIC STORES
    • G11C13/00—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00
    • G11C13/0002—Digital stores characterised by the use of storage elements not covered by groups G11C11/00, G11C23/00, or G11C25/00 using resistive RAM [RRAM] elements
    • G11C13/0009—RRAM elements whose operation depends upon chemical change
    • G11C13/0014—RRAM elements whose operation depends upon chemical change comprising cells based on organic memory material

Definitions

  • This invention relates to the field of oligopeptide transporters and drug transport.
  • this invention relates to the discovery of new H+/oligopeptide transporters and their use in drug delivery applications.
  • peptides are transported in and out of cells by several different transport carriers. Functionally, there are transporters responsible for the influx of peptides into the cell and transporters responsible for the efflux of peptides out of the cells. Influx transporters transport small peptides and related compounds into the cytoplasm, and are indirectly linked to an energy source through ion gradients. Efflux transporters consist of several different transporters that function to remove peptides from the cytoplasm. These include the P-glycoprotein that removes a number of oncolytics as well as hydrophobic peptides (Endicott and Ling (1989) Annu. Rev. Biochem. 58:137-171; Sharma et al. (1992) J. Biol. Chem. 267: 5731-5734).
  • the present invention relates to peptide transporters responsible for influx of peptides into cells or organelles.
  • Peptide transporters are often located in the gastrointestinal tract, kidney, placenta, and liver lysosomes (Ganapathy et al. (1991) Indian J. Biochem. Biophys. 28: 317-323; Skopicki et al. (1991) Am. J. Physiol. 261: F670-F678; Ganapathy et al. (1981) J. Biol. Chem. 256: 118-124; Bird and Lloyd (1990) Biochim. Biophys. Acta 1024:267-270).
  • the main intestinal H+/dipeptide transpoter protein, PepTl is thought to play a critical role in oral bioavailablity of peptide-like drugs (Dantzig and Bergin (1990) Biochim. Biophy. Acta, 1027: 211-217; Matsumoto et al. (1994) J. Pharmacol. Exp. Ther., 270: 498-504; Wenzel et al. (1996) J. Pharmacol. Exp. Ther., 211 ⁇ 831-839; Kramer et al. (1990) Biochim. Biophys. Acta, 1027: 25-30; Fei et al. (1994) Nature, 68: 563-566; Thwaites et al. (1993) J. Biol.
  • hPepTl is a member of a well defined small gene family, the proton-dependent oligopeptide transporters (POT, also referred to as PTR), with ancestral roots that can be traced to bacterial, fungal, and plant peptide transporters (Graul and Sadee (1997) Pharm. Res., 14: 388-400; Fei and Leibach (1998) Prog. Nucleic Acid Res. Mol. Biol, 58: 239-261; Steiner et al. (1995) Mol. Microbiol, 16: 825-834).
  • POT proton-dependent oligopeptide transporters
  • This class of secondary active transporters has broad selectivity for di- and tripeptides, whereas ability to transport longer peptides decreases with increasing length.
  • Substrates include important drug classes such as ⁇ - lactam and cephalosporin antibiotics, rennin inhibitors, ACE inhibitors, and 5' nucleoside esters of amino acids, such as valcyclovir (Han et al. (1998) Pharm. Res., 15: 1154-1159). Despite these advances, it is desirable to identify other peptide transporters to improve uptake of various drugs or prodrugs, to improve tissue specificity for particular drugs, and the like.
  • This invention provides new human proton/oligopeptide transporter (POT) genes and uses thereof. Nucleic acid sequences, amino acid sequences, and primers sufficient to amplify transporter nucleic acid and/or probes specific to these nucleic acids and/or splice variants thereof are provided herein. The new transporters are identified as hPHTl and hPHT2. . Thus, in one embodiment, this invention provides an isolated nucleic acid encoding a proton -coupled peptide transporter.
  • the nucleic acid comprises a nucleic acid or the complement of a nucleic acid selected from the group consisting of: a nucleic acid that specifically hybridizes to hPHTl (e.g.
  • SEQ ID NO: 24 or hPHT2 under stringent conditions and that encodes a proton-coupled peptide transporter; a nucleic acid that has 90% or greater sequence identity with hPHTl or hPHT2 and that encodes a proton-coupled peptide transporter; a nucleic acid that encodes an hPHTl peptide transporter protein or an hPHT2 peptide transporter protein; an hPHTl or hPHT2 splice variant; a nucleic acid that is amplified using primers of SEQ ID NO:l and SEQ ID NO:2, and human intestinal DNA as a template; a nucleic acid that is amplified using primers of SEQ ID NO:3 and SEQ ID NO:4, and human intestinal DNA as a template; a nucleic acid that hybridizes under stringent conditions to a nucleic acid amplified using primers of SEQ ID NO: 1 and SEQ ID NO:2, and human intestinal DNA as a template, where the
  • polypeptides encoded by any of these nucleic acids include, but are not limited to, polypeptides comprising a proton-coupled peptide transporter. Also provided are fragments of such polypeptides that comprise one or more epitopes specifically recognized by an antibody that specifically binds to the hPHTl and/or hPHT2 transporters. Also provided are antibodies (complete, fragments, or single chain) that specifically bind the hPHTl and/or hPHT2 transporters.
  • This invention also provides cells that are transfected with one or more of the nucleic acids described herein.
  • Particularly preferred cells express a heterologous peptide transporter (e.g. an hPHTl and/or hPHT2 transporter).
  • the cells preferably include any vertebrate cell and include somatic cells or oocytes.
  • the cells may be transfected with either a DNA or an RNA and, in this context, transfection includes essentially any method of introducing a nucleic acid into a cell (e.g. electroporation, microinjection, lipid complex, etc.).
  • this invention provides a computer readable medium having recorded thereon one or more of the nucleotide sequences described herein.
  • Particularly preferred media also include an identification of the sequences as transporters or as encoding transporters, or as components of transporters or as components of nucleic acids encoding transporters, or an association to a reference or medium identifying the sequences as encoding transporters.
  • Virtually any computer-readable medium is suitable including, but not limited to a floppy disc, a hard disc, a CD disc, a DVD disc, a random access memory (RAM), a read-only memory (ROM), and a flash memory.
  • the medium can be a component of a nucleic acid and/or peptide synthesizer or compatible with (e.g. able to provide sequence information to) a nucleic acid and/or a peptide synthesizer.
  • This invention also provides assays for identifying a compound whose cellular uptake is mediated by an hPHTl or hPHT2 peptide transporter.
  • the assays preferably involve i)contacting a cell expressing a peptide transporter selected from the group consisting of an hPHTl transporter, and an hPHT2 transporter with a test compound; and ii) detecting uptake of the test compound by the cell where elevated uptake of the compound by the cell as compared to a cell expressing the peptide transporter at a lower level indicates that said peptide transporter mediates transport of said test compound.
  • the cell can be a cell expressing an endogenous hPHTl and/or hPHT2 and/or a cell transfected with a vector that encodes the hPHTl or hPHT2 peptide transporter.
  • the cell is preferably a vertebrate somatic cell or a vertebrate oocyte.
  • amphibian oocytes e.g., Xenopus oocytes
  • mammalian somatic cells e.g. heart cells, intestinal cells, etc.
  • the compounds screened may include virtually any compound, however, in preferred embodiments, the compound is a small organic molecule, more preferably a drug or a prodrug.
  • the peptide transporter is hPHTl and/or hPHT2 and the tissue is heart.
  • This invention additionally provides methods of identifying agent(s) that modulate expression or activity of an hPHTl and/or hPHT2 peptide transporter.
  • the methods involve contacting a cell comprising a gene encoding an hPHTl and/or an hPHT2 peptide transporter with a test agent; and detecting the expression level or activity of hPHTl or hPHT2 peptide transporter(s) where a difference in expression level or activity of hPHTl or hPHT2 as compared to the expression level, or activity, of hPHTl or hPHT2 in a cell contacted with a different amount of said agent indicates that said agent modulates expression, or activity, of the hPHTl peptide transporter or the hPHT2 peptide transporter.
  • the detecting comprises detecting an hPHTl or hPHT2 nucleic acid (e.g. DNA, mRNA, cDNA, etc.), and/or an hPHTl or hPHT2 protein, and/or transport activity of an hPHTl or hPHT2 protein.
  • detecting comprises detecting an hPHTl mRNA or an hPHT2 mRNA (e.g. by hybridizing said mRNA to a probe that specifically hybridizes to an hPHT2 or to an hPHTl nucleic acid).
  • hybridization detection methods include, but are not limited to a Northern blot, a Southern blot using DNA derived from the hPHTl or hPHT2 RNA, an array hybridization, an affinity chromatography, and an in situ hybridization.
  • the hybridization probe can be a single probe or a plurality of probes, e.g. a member of a plurality of probes that forms an array of probes.
  • the level of hPHTl mRNA or hPHT2 RNA is measured using a nucleic acid amplification reaction.
  • detecting comprises detecting an hPHTl protein or an hPHT2 protein (e.g.
  • the cell contacted with the different amount of said agent is a negative control that is not contacted with said agent or the cell contacted with said different amount of the agent is a positive control that is contacted with a greater amount of the agent.
  • the cell is preferably a human somatic cell (e.g. a human heart cell, a human intestinal cell, etc.).
  • this invention provides a method of prescreening for an agent that agent that modulates expression or activity of an hPHTl peptide transporter or an hPHT2 peptide transporter.
  • the method involves contacting an hPHTl or hPHT2 nucleic acid (or fragment thereof) or an hPHTl or hPHT2 protein (or fragment thereof) with a test agent; and detecting specific binding of said test agent to said hPHTl or hPHT2 protein or nucleic acid.
  • the method can further involve recording test agents that specifically bind to said hPHTl or hPHT2 nucleic acid or protein in a database of candidate agents that alter peptide transporter activity.
  • the test agent is not an antibody and/or not a protein, and/or not a nucleic acid.
  • Preferred test agents are small organic smolecules.
  • kits comprising a container containing one or more of the nucleic acids and/or proteins and/or cells, and/or antibodies described herein.
  • the kits optionally further comprise instructional materials providing protocols for the assays described herein.
  • isolated refers to material which is substantially or essentially free from components which normally accompany it as found in its native state.
  • an isolated nucleic acid is typically free of the nucleic acid sequences by which it is flanked in nature.
  • An isolated nucleic acid can be reintroduced into a cell and such "heterologous” nucleic acids are regarded herein as isolated.
  • nucleic acids synthesized de novo or produced by cloning are also regarded as “isolated”.
  • polypeptide polypeptide
  • peptide protein
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • the term also includes variants on the traditional peptide linkage joining the amino acids making up the polypeptide.
  • nucleic acid or “oligonucleotide” or grammatical equivalents herein refer to at least two nucleotides covalently linked together.
  • a nucleic acid of the present invention is preferably single-stranded or double stranded and will generally contain phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are included that may have alternate backbones, comprising, for example, phosphoramide (Beaucage et al. (1993) Tetrahedron 49(10): 1925) and references therein; Letsinger (1970) J. Org. Chem. 35:3800; Sblul et al. (1977) Eur. J. Biochem.
  • Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al. (1995), Chem. Soc. Rev. ppl69-176).
  • nucleic acid analogs are described in Rawls, C & E News June 2, 1997 page 35. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to increase the stability and half-life of such molecules in physiological environments.
  • heterologous as it relates to nucleic acid sequences such as coding sequences and control sequences, denotes sequences that are not normally associated with a region of a recombinant construct, and/or are not normally associated with a particular cell.
  • a heterologous region of a nucleic acid construct is an identifiable segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature.
  • a heterologous region of a construct could include a coding sequence flanked by sequences not found in association with the coding sequence in nature.
  • heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g., synthetic sequences having codons different from the native gene).
  • a host cell transformed with a construct which is not normally present in the host cell would be considered heterologous for purposes of this invention.
  • non-naturally occurring in reference to a cell, refers to a cell that has a non-naturally occurring nucleic acid or a non-naturally occurring peptide or is fused to a cell to which it is not fused with in nature.
  • non-naturally occurring nucleic acid refers to a portion of genomic nucleic acid, cDNA, semi-synthetic nucleic acid, or a synthetic origin nucleic acid which, by virtue of its origin or manipulation is not associated with all the nucleic acid with which it is associated in nature, or is linked to a nucleic acid or other chemical agent other than that to which it is linked in nature, or is not present in nature.
  • a non-naturally occurring peptide refers to a portion of a large naturally occurring peptide or protein, or semi-synthetic or synthetic peptide, which by virtue of its origin or manipulation is not associated with all of a peptide with which it is associated in nature, or is linked to peptides, functional groups or chemical agents other than that to which it is linked in nature, or is present in a purity that is not present in nature, or does not occur in nature.
  • proton refers to a hydrogen ion
  • transporter refers to a composition that participates in the movement of a substrate across a cellular membrane.
  • a "proton-coupled peptide transporter” transports peptides across cellular membranes, which transport is linked or coupled to the transport of a proton or hydrogen ion across the same membrane.
  • the transporter is a protein encoded by a nucleic acid comprising one or more of the nucleic acids described herein, more preferably a PHT1 or PHT2 nucleic acid.
  • nucleic acids and peptides refers to amino acids of a peptide in an order derived from the sequence of a nucleic acid or the complement of the nucleic acid.
  • an "antibody” refers to a protein consisting of one or more polypeptides substantially encoded by imrnunoglobulin genes or fragments of immunoglobulin genes.
  • the recognized imrnunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes.
  • Light chains are classified as either kappa or lambda.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively.
  • a typical immunoglobulin (antibody) structural unit is known to comprise a tetramer.
  • Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light” (about 25 kD) and one "heavy” chain (about 50-70 kD).
  • the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
  • the terms variable light chain (V L ) and variable heavy chain (V H ) refer to these light and heavy chains respectively.
  • Antibodies exist as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases.
  • pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)' 2 , a dimer of Fab which itself is a light chain joined to V H -C H 1 by a disulfide bond.
  • the F(ab)' 2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the (Fab') dimer into a Fab' monomer.
  • the Fab' monomer is essentially a Fab with part of the hinge region (see, Fundamental Immunology, W.E. Paul, ed., Raven Press, N.Y. (1993), for a more detailed description of other antibody fragments).
  • antibody as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo using recombinant DNA methodologies.
  • Preferred antibodies include single chain antibodies (antibodies that exist as a single polypeptide chain), more preferably single chain Fv antibodies (sFv or scFv) in which a variable heavy and a variable light chain are joined together (directly or through a peptide linker) to form a continuous polypeptide.
  • the single chain Fv antibody is a covalently linked V H -V L heterodimer which may be expressed from a nucleic acid including V H - and V - encoding sequences either joined directly or joined by a peptide-encoding linker.
  • the first functional antibody molecules to be expressed on the surface of filamentous phage were single-chain Fv's (scFv), however, alternative expression strategies have also been successful.
  • Fab molecules can be displayed on phage if one of the chains (heavy or light) is fused to g3 capsid protein and the complementary chain exported to the periplasm as a soluble molecule.
  • the two chains can be encoded on the same or on different replicons; the important point is that the two antibody chains in each Fab molecule assemble post-translationally and the dimer is incorporated into the phage particle via linkage of one of the chains to, e.g., g3p (see, e.g., U.S. Patent No: 5733743).
  • scFv antibodies and a number of other structures converting the naturally aggregated, but chemically separated light and heavy polypeptide chains from an antibody V region into a molecule that folds into a three dimensional structure substantially similar to the structure of an antigen-binding site are known to those of skill in the art (see e.g., U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778).
  • Particularly preferred antibodies should include all that have been displayed on phage (e.g., scFv, Fv, Fab and disulfide linked Fv (Reiter et al. (1995) Protein Eng. 8: 1323- 1331).
  • binding preference e.g., affinity for the target molecule/sequence is at least 2 fold, more preferably at least 5 fold, and most preferably at least 10 or 20 fold over a nonspecific (e.g. randomly generated molecule lacking the specifically recognized amino acid or amino acid sequence) target molecule.
  • hybridizing specifically to or “specific hybridization” or “selectively hybridize to” refer to the binding, duplexing, or hybridizing of a nucleic acid molecule preferentially to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
  • stringent conditions refers to conditions under which a probe will hybridize preferentially to its target subsequence, and to a lesser extent to, or not at all to, other sequences.
  • Stringent hybridization and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and northern hybridizations are sequence dependent, and are different under different environmental parameters. An extensive guide to the hybridization of nucleic acids is found in Tijssen
  • An example of stringent hybridization conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or northern blot is 50% formamide with 1 mg of heparin at 42DC, with the hybridization being carried out overnight.
  • An example of highly stringent wash conditions is 0.15 M NaCI at 72°C for about 15 minutes.
  • An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see, Sambrook et al. (1989) Molecular Cloning - A Laboratory Manual (2nd ed.) Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor Press, NY, (Sambrook et al.) supra for a description of SSC buffer).
  • a high stringency wash is preceded by a low stringency wash to remove background probe signal.
  • An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx SSC at 45 ⁇ C for 15 minutes.
  • An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6x SSC at 40 DC for 15 minutes.
  • a signal to noise ratio of 2x (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids which do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
  • stringent conditions are characterized by hybridization in 1 M NaCI, 10 mM Tris-HCl, pH 8.0, 0.01% Triton X-100, 0.1 mg/ml fragmented herring sperm DNA with hybridization at 45°C with rotation at 50 RPM followed by washing first in 0.9 M NaCI, 0.06 M NaH 2 PO 4 , 0.006 M EDTA, 0.01% Tween-20 at 45°C for 1 hr, followed by 0.075 M NaCI, 0.005 M NaH 2 PO 4 , 0.5 mM EDTA at 45°C for 15 minutes.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • substantially identical in the context of two nucleic acids or polypeptides, refers to two or more sequences or subsequences that have at least 60%, preferably 80%, most preferably 90-95% nucleotide or amino acid residue identity, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection.
  • the substantial identity exists over a region of the sequences that is at least about 50 residues in length, more preferably over a region of at least about 100 residues, and most preferably the sequences are substantially identical over at least about 150 residues.
  • the sequences are substantially identical over the entire length of the coding regions.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman (1988) Proc.
  • PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle (1987) J. Mol. Evol. 35:351-360.
  • the method used is similar to the method described by Higgins & Sharp (1989) CABIOS 5: 151-153.
  • the program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids.
  • the multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences.
  • Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences.
  • the final alignment is achieved by a series of progressive, pairwise alignments.
  • the program is run by designating specific sequences and their amino acid or nucleotide coordinates for regions of sequence comparison and by designating the program parameters. For example, a reference sequence can be compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
  • HSPs high scoring sequence pairs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
  • the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993) Proc. Natl. Acad. Sci. USA ,90: 5873-5787).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
  • small organic molecule refers to a molecule of a size comparable to those organic molecules generally used in pharmaceuticals.
  • Preferred small organic molecules range in size up to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
  • Figure IA show the . hPHTl EST map.
  • Figure IB shows the alignments of the ESTs with the main contig.
  • Figure IC shows a schematic of hPHTl splice variants. The sequence missing in splice variant B is identified. Identical sequence between splice Variant A & A' is identified. Unique sequence in splice variant A' and in splice variant A is indicated.
  • Figure ID shows splice variant(hPHTl).
  • Figure IE shows splice variant A(hPHTlvA) with alignment to hPHTl.
  • Figure IF shows splice variant A'(hPHTlvA') with alignment to hPHTl.
  • Figure 1G shows splice variant B(hPHTlvB) with alignment to hPHTl.
  • Figure 2 illustrates the structure of the hPHT2 g. Sequences of exons are provided in sequence listing (SEQ ID NOS: 9-16). Sequences of introns are provided in sequence listing (SEQ ID NOS: 17-23).
  • Figure 3A provides multiple sequence alignments for PHT branch. (Click alignment to see PDF).
  • Figure 3B provides multiple sequence alignments for human PHT+PepT branch. Black: 50% or higher identity; Gray: conservative and similar substitutions.
  • Figure 4A provides hydropathy plots (Kyte Doolittle method) for hPHTl
  • FIG. 4B shows topo diagrams for hPHTl and hPHT2.
  • Figure 5A shows RT-PCR analysis of hPHTl extracted from human small intestine tissue sample.
  • Figure 5B shows Northern blot analysis of hPHTl, hPHT2, and actin expression in human tissues.
  • Figure 6 shows the structure and splicing of the hPEPTl gene.
  • hPEPTl and hPEPTl-RF completely share exons 4-6 and partially share exons 3 and 7, where the alternative splice sites are located (indicated by the vertical lines).
  • Exon T represents a repetitive element. Arrows indicate the translation start and stop sites.
  • the Exonic sequences are shown in the sequence listings as SEQ ID Nos: 11 through 16 (hpeptl-rf exon 3 through hpeptl-rf exon 7').
  • Figure 7 illustrates the membrane topology prediction for hPEPTl. The prediction was carried out using the TOPPRED program. The exon boundaries are indicated by alternating shading.
  • Figure 8 illustrates the membrane topology prediction for hPEPTl- RF. The prediction was carried out using the TOPPRED program. The exon boundaries are indicated by alternating shading.
  • Figure 9 shows the putative promoter region of the human PEPT1 gene. Sequence of nucleotides upstream of the translations (f)(ATG)is shown. The numbering starts (+1) from the transcription start site (f ) to the negative values in the promoter region. The sites for the transcription factors in the promoter region are underlined and the corresponding indicated.
  • This invention provides new members of the h+/oligopeptide transporter gene family.
  • the new genes designated herein as hHPTl and hHPT2.
  • the new genes appear to be members of the POT family of peptide transporters.
  • the human POT family appears to contain at least four genes encoding peptide transporters and, without being bound to a particular theory, it is believed that each is likely to display a distinct pattern of tissue expression.
  • Tissue distribution of POT gene expression is of particular interest for achieving oral bioavailability or for targeting drugs to tumor tissues.
  • each member of the peptide transporter family is believed to exhibit some selectivity for peptides, peptoid drugs, and other agents.
  • hPepTl is highly expressed in pancreatic and colon adenocarcinomas, including liver metastases considerably above the level seen in surrounding normal tissues.
  • substrates for hPepTl can be "specifically" delivered to these tissues.
  • drugs e.g. drugs, prodrugs, etc.
  • hPHTl or hPHT2 e.g. drugs, prodrugs, etc.
  • drugs or prodrugs can be engineered with domains/sites, preferentially transported by hPHTl or hPHT2 and thereby enhance availability of these agents to various tissues.
  • agents that modulate e.g. up-regulate or downregulate expression or activity of hPHTl or hPHTl.
  • agents that modulate can be administered along with drugs transported by hPHTl or hPHT2 transporters to either enhance availability of the drug (e.g. upregulate hPHTl or hPHT2 expression) or diminish availability of the drug (e.g. down-regulate hPHTl or hPHT2) to tissues harboring hPHTl or hPHT2 genes.
  • gene therapy methods can be used to specifically deliver and express hPHTl or hPHT2 to preselected target tissues and thereby increase the availability of an hPHTl or hPHT2 transported agent to that tissue.
  • Nucleic acids encoding H + /oligopeptide transporters proteases The nucleic acid and amino acid sequences of hPHTl and hPHT2 and primers sufficient to amplify the nucleic acid sequences are provided herein (see. e.g. SEQ ID NO: 17 for the full hPHTl sequence). It is noted that there are two splice variants of hPHTl. The sequence listing aligns the splice variants with each other. (A vs B). Another splice variant is actually a sequence obtained from a PCR amplification product using cDNAs from skeletal muscle.
  • PCR run gave a band with the expected sequence (509 bps of hPHTl), and a faster moving band (PCR-2) with 169 bps missing (probable frameshift mutation). Its alignment with hPHTl is given in the sequence listing as well.
  • nucleic acids encoding the full length peptide transporters or fragments of such nucleic acids are prepared using standard methods well known to those of skill in the art.
  • the nucleic acid(s) may be cloned, or amplified by in vitro methods, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (SSR), etc.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • TAS transcription-based amplification system
  • SSR self-sustained sequence replication system
  • the transporter DNA, or their subsequences are to be used as nucleic acid probes, it is often desirable to label the nucleic acids with detectable labels.
  • the labels may be incorporated by any of a number of means well known to those of skill in the art.
  • the label is simultaneously incorporated during the amplification step in the preparation of the sample nucleic acids.
  • PCR polymerase chain reaction
  • transcription amplification using a labeled nucleotide incorporates a label into the transcribed nucleic acids.
  • a label may be added directly to an original nucleic acid sample (e.g., mRNA, polyA mRNA, cDNA, etc.) or to the amplification product after the amplification is completed.
  • Means of attaching labels to nucleic acids are well known to those of skill in the art and include, for example nick translation or end-labeling (e.g. with a labeled RNA) by kinasing of the nucleic acid and subsequent attachment (ligation) of a nucleic acid linker joining the sample nucleic acid to a label (e.g., a fluorophore). Suitable labels are described below.
  • proton/oligopeptide transporters Cloning and expression of proton/oligopeptide transporters. It is desirable express the proton/oligopeptide transporters of this invention in heterologous cells for use in the assays described herein. In addition, it is also useful to express the transporter proteins, or fragments thereof, to generate antibodies for a variety of applications (e.g. determining transporter expression level, etc.).
  • hPHTl and or hPHT2 polypeptides and various fragments thereof can be conveniently produced using synthetic chemical processes or recombinant expression methodologies.
  • the transporter polypeptides of this invention or fragments thereof may be synthesized using standard chemical peptide synthesis techniques. Where the desired subsequences are relatively short (e.g., when a particular antigenic determinant is desired) the molecule may be synthesized as a single contiguous polypeptide. Where larger molecules are desired, subsequences can be synthesized separately (in one or more units) and then fused by condensation of the amino terminus of one molecule with the carboxyl terminus of the other molecule thereby forming a peptide bond.
  • Solid phase synthesis in which the C-terminal amino acid of the sequence is attached to an insoluble support followed by sequential addition of the remaining amino acids in the sequence is the preferred method for the chemical synthesis of the polypeptides of this invention.
  • Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis; pp. 3-284 in The Peptides: Analysis, Synthesis, Biology. Vol. 2: Special Methods in Peptide Synthesis, Part A., Merrifield, et al. (1963) J. Am. Chem. Soc, 85: 2149-2156, and Stewart et al. (1984) Solid Phase Peptide Synthesis, 2nd ed. Pierce Chem. Co., Rockford, 111.
  • the transporter proteins of this invention are synthesized using recombinant expression systems. Generally this involves creating a DNA sequence that encodes the desired protein, placing the DNA in an expression cassette under the control of a particular promoter, and expressing the protein in a host cell. The host cell can then be used in the assays described herein. Alternatively, were isolated transporter proteins are desired, the expressed transporter can be recovered from the cell.
  • DNA encoding the transporter proteins described herein can be prepared by any suitable method as described above, including, for example, cloning and restriction of appropriate sequences or direct chemical synthesis by methods such as the phosphotriester method of Narang et al. (1979) Meth. Enzymol. 68: 90-99; the phosphodiester method of Brown et ⁇ /.(1979) Meth. Enzymol. 68: 109-151; the diethylphosphoramidite method of Beaucage et al. (1981) Tetra. Lett, 22: 1859-1862; and the solid support method of U.S. Patent No. 4,458,066.
  • Chemical synthesis produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template.
  • a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template.
  • One of skill would recognize that while chemical synthesis of DNA is limited to sequences of about 100 bases, longer sequences may be obtained by the ligation of shorter sequences. Alternatively, subsequences may be cloned and the appropriate subsequences cleaved using appropriate restriction enzymes. The fragments may then be ligated to produce the desired DNA sequence.
  • the nucleic acids of this invention can be cloned using DNA amplification methods such as polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the nucleic acid sequence or subsequence is PCR amplified, using a sense primer containing one restriction site (e.g., Ndel) and an antisense primer containing another restriction site (e.g., HindlTJ).
  • a sense primer containing one restriction site e.g., Ndel
  • an antisense primer containing another restriction site e.g., HindlTJ
  • This nucleic acid can then be easily ligated into a vector that can be transfected into an appropriate host cell (e.g. an oocyte, a mammalian somatic cell, etc.)
  • Suitable PCR primers can be determined by one of skill in the art using the sequence information provided herein and representative primers are illustrated herein as well.
  • Appropriate restriction sites can also be added to the nucleic acid encoding the transporter protein or protein subsequence by site-directed mutagenesis.
  • the nucleic acid sequences encoding human transporter proteins or protein subsequences may be expressed in a variety of host cells, including E. coli, other bacterial hosts, yeast, and various higher eukaryotic cells such as the COS, CHO and HeLa cells lines and myeloma cell lines, and various vertebrate oocytes (e.g. Xenopus oocytes).
  • the recombinant protein gene will be operably linked to appropriate expression control sequences for each host cell.
  • this includes a promoter such as the T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription termination signal.
  • control sequences will include a promoter and often an enhancer (e.g., an enhancer derived from immunoglobulin genes, SV40, cytomegalo virus, etc.), and a polyadenylation sequence, and may include splice donor and acceptor sequences.
  • an enhancer e.g., an enhancer derived from immunoglobulin genes, SV40, cytomegalo virus, etc.
  • a polyadenylation sequence may include splice donor and acceptor sequences.
  • the vectors of the invention can be transferred into the chosen host cell by well-known methods such as calcium chloride transformation for E. coli and calcium phosphate treatment, microinjection, or electroporation for vertebrate cells.
  • Cells transformed by the plasmids can be selected by resistance to antibiotics conferred by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.
  • the recombinant hPHTl and/or hPHT2 protein(s) can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see, generally, R. Scopes, (1982) Protein Purification, Springer- Verlag, N.Y.; Deutscher (1990) Methods in Enzymology Vol. 182: Guide to Protein Purification., Academic Press, Inc. N.Y.). Substantially pure compositions of at least about 90 to 95% homogeneity are preferred, and 98 to 99% or more homogeneity are most preferred. Once purified, partially or to homogeneity as desired, the polypeptides may then be used (e.g., as immunogens for antibody production).
  • modifications can be made to the transporter proteins without diminishing their biological activity. Some modifications may be made to facilitate the cloning, expression, or incorporation of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site, or additional amino acids (e.g., poly His) placed on either terminus to create conveniently located restriction sites or termination codons or purification sequences.
  • compositions transported by hPHTl or hPHT2 transporters are transported by hPHTl or hPHT2 transporters. Having discovered new human peptide transporters, it is possible to screen for compounds specifically transported by these transporters. Other transporters have been shown to transport a wide variety of compositions in addition to peptides and/or amino acids. Such compounds include, but are not limited to, antibiotics (including several oral .beta.- lactams), oral angiotensin converting enzyme (ACE) inhibitors, oral renin inhibitors and the like. Thus, the transporters of this invention can readily be utilized in a screening system to identify molecules that they transport.
  • antibiotics including several oral .beta.- lactams
  • ACE angiotensin converting enzyme
  • oral renin inhibitors include, but are not limited to, antibiotics (including several oral .beta.- lactams), oral angiotensin converting enzyme (ACE) inhibitors, oral renin inhibitors and the like.
  • such assays involve expressing the transporters of this invention in a cell contacting the cell with the agent(s) it is desired to screen for the ability to be transported by the transporters of this invention and detecting and/or quantifying the amount of the agent(s) that are transported into the cell.
  • the amount of transported agent can be compared to the amount of that agent transported by cells lacking the transporter and/or to the amount of an agent known not to be transported by the transporters of this invention (negative controls). Preferred embodiments, can also include a comparison to the amount of an agent transported by the cells where it is known that that agent is transported by the transporters of this invention (positive controls).
  • the assay is typically scored as positive where there is a difference between the amount of test agent(s) transported and the negative control(s), preferably where the difference is statistically significant (e.g. at greater than 80%, preferably greater than about 90%, more preferably greater than about 98%, and most preferably greater than about 99% confidence level).
  • Cells suitable for such screening systems preferably include vertebrate cells (e.g., amphibian cells, mammalian cells, etc.) and, in certain embodiments, more preferably include mammalian cells of the tissue to which it is ultimately desired to deliver the test agent(s).
  • the cells may be cells of heart tissue.
  • the assays can be convenientlyl run using oocytes. It is possible to simply inject mRNAs encoding the transporters of these cells into oocytes where they are expressed thereby providing a convenient system for the cellular assay. While the present invention contemplates the use of oocytes isolated from any non-human vertebrate organism, preferred embodiments of the assay feature amphibian oocytes, particularly oocytes which are approximately the same size, or larger, than oocytes which can be isolated from frog species of the genus Xenopus, e.g. Xenopus laevis. In general, the larger oocytes are preferred for ease of manipulation. Furthermore, expression of recombinant proteins and cell culturing techniques are each better characterized for amphibian oocytes, and a greater diversity of expression vectors are available for these systems.
  • Xenopus oocytes can be harvested from female Xenopus laevis and processed using published techniques (Coleman et al, eds., Transcription and Translation: A Practical Approach. IRL Press, pp. 271-302; and Williams et al. (1988) Proc. Natl. Acad. Sci., USA, 85: 4939-4943).
  • preparation of the assay includes obtaining oocytes from the excised ovaries of female frogs anesthetized by hypothermia and from which follicle cells have been removed by treatment with collagenase.
  • Oocytes at a particular stage e.g. Dumont stage V, can be selected and microinjected with the mRNA to be tested, e.g. for in vitro transcribed RNA ("cRNA").
  • cRNA in vitro transcribed RNA
  • Isolation of other suitable oocytes can be, as a matter of course, carried out by one of ordinary skill in the art.
  • techniques routinely used in generation of transgenic animals such as protocols for inducing superovulation and isolating fertilized eggs from various mammals (e.g. mice, rabbits, rats, sheep, goats or pigs) can be slightly modified (i.e. no fertilization step) in order to allow for isolation of mammalian oocytes for use in the subject method (see, e.g., U.S. Pat. No. 4,994,384).
  • protocols exist for in vitro maturation of mammalian oocytes such as mature metaphase II oocytes.
  • telomeres Several methods for expressing recombinant proteins in oocytes (and other cells) are generally known in the art.
  • expression of the recombinant protein(s) to be tested in the subject assay can be carried out by microinjection of cRNA encoding the protein, or by microinjection (or by other form of transfection) of an expression vector encoding the protein of interest. Either method can be carried out by employing the basics of expression cloning strategies known in the art.
  • cDNA libraries are cloned into vectors that can be used for in vitro RNA synthesis.
  • the pCS2+/- vector contains SP6, T7 and T3 promoters that have been introduced upstream and downstream of a cloning site in order to permit in vitro RNA synthesis upon linearization of the plasmid.
  • a plasmid containing the cDNA to be tested can be linearized by cutting downstream from the cDNA insert with a restriction enzyme. The post-restriction digest is digested with Proteinase K and then extracted with two phenol: chloroform (1:1) extractions. The resulting DNA fragments are then ethanol precipitated.
  • the precipitated fragments are mixed with either T3 RNA polymerase (to make sense strand), or T7 RNA polymerase (to make anti-sense strand), plus rATP, rCTP, rGTP, rUTP, and RNase inhibitor. Simultaneously, capped RNA can be produced in vitro (Krieg and Melton, (1987) Meth Enzymol 155: 397-415; and Richardson et al. (1988) Bio/Technology 6: 565-570).
  • Other exemplary vectors useful in the subject assay include: the pSP64T vector (Kreig et al.
  • a marker gene in the oocyte may be desirable to co-express a marker gene in the oocyte in order to standardize the comparison of effects based on level of expression occurring in the oocytes.
  • an ⁇ -amylase gene construct can be provided in the oocyte, and the amylase activity measured in the oocyte (Urnes et al. (1990) Gene 95: 267-274.
  • the level of expression for other proteins can therefore be standardized based on the amount of recombinant amylase produced.
  • Dose response curves can be constructed based on the level of expression of the amylase reporter in the oocyte.
  • the cell expressing the peptide transporter(s) of this invention can be contacted with the agent(s) to be screened and the amount of agent that is internalized is detected.
  • The is routinely accomplished by either measuring depletion of the agent in the media contacting the cell or measuring the amount of the agent internalized by the cell.
  • the test agent(s) are labeled with a detectable label to facilitate their detection in the subject cell and/or media.
  • Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., Dynabeads ), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, and the like, see, e.g., Molecular Probes, Eugene, Oregon, USA), radiolabels (e.g., 3 H, 125 1, 35 S, 14 C, or 32 P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold (e.g., gold particles in the 40 -80 nm diameter size range scatter green light with high efficiency) or colored glass or plastic (e.g., polystyrene, poly
  • Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149; and 4,366,241. Fluorescent labels, colorimetric labels, and radiolabels are particularly preferred.
  • assays are intended to be illustrative and not limiting. Using the teachings provided herein, other variations of such assays will be apparent to one of skill in the art. Such variations include, but are not limited to,, the use of a tissues and/or cells that express endogenous transporters of this invention in the assays described above. It is also noted that assays for screening of uptake of test agents by various peptide transporters is described in U.S. Patents 6,020,479 , 5,919,699, and 5,919,628.
  • this invention is premised, in part, on the discovery of new h+/oligopeptide transporter (e.g. hPHTl and/or hPHT2).
  • hPHTl and/or hPHT2 agents that downregulate expression of decrease the bioavailability of compounds internalized by these receptors, while agents that upregulate hPHTl or hPHT2 increase the bioavailability of compounds internalized by these transporters.
  • this invention provides methods of screening for agents that modulate expression and/or activity.
  • the methods involve detecting the expression level and/or activity level of hPHTl or hPHT2 genes or gene products (e.g. hPHTl or hPHT2 mRNA or proteins) in the presence of the agent(s) in question.
  • a reduced hPHTl or hPHT2 expression level or activity level in the presence of the agent as compared to a negative control where the test agent is absent or at reduced concentration indicates that the agent downregulates hPHTl or hPHT2 activity or expression.
  • hPHTl or hPHT2 expression level or activity level in the presence of the agent as compared to a negative control where the test agent is absent or at reduced concentration indicates that the agent up-regulates hPHTl or hPHT2 activity or expression
  • Expression levels of a gene can be altered by changes in the transcription of the gene product (i.e. transcription of mRNA), and/or by changes in translation of the gene product (i.e. translation of the protein), and/or by post-translational modification(s) (e.g. protein folding, glycosylation, etc.).
  • preferred assays of this invention include assaying for level of transcribed mRNA (or other nucleic acids derived from the hPHTl or hPHT2 genes), level of translated protein, activity of translated protein, etc. Examples of such approaches are described below.
  • Changes in expression level can be detected by measuring changes in hPHTl and/or hPHT2 genomic DNA or a nucleic acid derived from the genomic DNA (e.g., hPHTl or hPHT2 mRNA, reverse-transcribed cDNA, etc.).
  • a nucleic acid sample for such analysis.
  • the nucleic acid is found in or derived from a biological sample.
  • biological sample refers to a sample obtained from an organism or from components (e.g., cells) of an organism. The sample may be of any biological tissue or fluid. Biological samples may also include organs or sections of tissues such as frozen sections taken for histological purposes.
  • the nucleic acid (e.g., mRNA or a nucleic acid derived from an mRNA) is, in certain preferred embodiments, isolated from the sample according to any of a number of methods well known to those of skill in the art. Methods of isolating mRNA are well known to those of skill in the art. For example, methods of isolation and purification of nucleic acids are described in detail in by Tijssen ed., (1993) Chapter 3 of Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Elsevier, N.Y. and Tijssen ed.
  • the "total" nucleic acid is isolated from a given sample using, for example, an acid guanidinium-phenol-chloroform extraction method and polyA+ mRNA is isolated by oligo dT column chromatography or by using (dT)n magnetic beads (see, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989), or Current Protocols in Molecular Biology, F. Ausubel et al., ed. (1987) Greene Publishing and Wiley-Interscience, New York).
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • the nucleic acid sample is one in which the concentration of the hPHTl and/or hPHT2 mRNA transcript(s), or the concentration of the nucleic acids derived from the hPHTl and/or hPHT2 mRNA transcript(s), is proportional to the transcription level (and therefore expression level) of that gene.
  • the hybridization signal intensity be proportional to the amount of hybridized nucleic acid.
  • the proportionality be relatively strict (e.g., a doubling in transcription rate results in a doubling in mRNA transcript in the sample nucleic acid pool and a doubling in hybridization signal), one of skill will appreciate that the proportionality can be more relaxed and even non-linear. Thus, for example, an assay where a 5 fold difference in concentration of the target mRNA results in a 3 to 6 fold difference in hybridization intensity is sufficient for most purposes.
  • the hPHTl and/or bPHT2-containing nucleic acid sample is the total mRNA or a total cDNA isolated and/or otherwise derived from a biological sample.
  • the nucleic acid may be isolated from the sample according to any of a number of methods well known to those of skill in the art as indicated above.
  • hPHTl and/or hPHT2 Using the known sequence of hPHTl and/or hPHT2 (see sequence listing) detecting and/or quantifying the hPHTl and/or hPHT2 transcript(s) can be routinely accomplished using nucleic acid hybridization techniques (see, e.g., Sambrook et al. supra). For example, one method for evaluating the presence, absence, or quantity of hPHTl and/or hPHT2 genomic DNA or reverse-transcribed cDNA involves a "Southern Blot". In a Southern Blot, the DNA typically fragmented and separated on an electrophoretic gel, is hybridized to a probe specific for hPHTl and/or hPHT2.
  • Comparison of the intensity of the hybridization signal from the hPHTl and/or hPHT2 probe with a "control" probe provides an estimate of the relative expression level of the target nucleic acid.
  • the hPHTl and/or hPHT2 mRNA can be directly quantified in a Northern blot.
  • the mRNA is isolated from a given cell sample using, for example, an acid guanidinium-phenol-chloroform extraction method. The mRNA is then electrophoresed to separate the mRNA species and the mRNA is transferred from the gel to a nitrocellulose membrane.
  • labeled probes are used to identify and/or quantify the target hPHTl and/or hPHT2 mRNA.
  • Appropriate controls e.g. probes to housekeeping genes provide a reference for evaluating relative expression level.
  • in situ hybridization An alternative means for determining the hPHTl and/or hPHT2 expression level is in situ hybridization.
  • In situ hybridization assays are well known (e.g., Angerer (1987) Meth. Enzymol 152: 649).
  • in situ hybridization comprises the following major steps: (1) fixation of tissue or biological structure to be analyzed; (2) prehybridization treatment of the biological structure to increase accessibility of target DNA, and to reduce nonspecific binding; (3) hybridization of the mixture of nucleic acids to the nucleic acid in the biological structure or tissue; (4) post-hybridization washes to remove nucleic acid fragments not bound in the hybridization and (5) detection of the hybridized nucleic acid fragments.
  • the reagent used in each of these steps and the conditions for use vary depending on the particular application.
  • tRNA, human genomic DNA, or Cot-1 DNA is used to block non-specific hybridization.
  • amplification-based assays can be used to measure hPHTl and/or hPHT2 expression (transcription) level.
  • the target nucleic acid sequences i.e., hPHTl and/or hPHT2
  • act as template(s) in amplification reaction(s) e.g. Polymerase Chain Reaction (PCR) or reverse-transcription PCR (RT-PCR)
  • PCR Polymerase Chain Reaction
  • RT-PCR reverse-transcription PCR
  • the amount of amplification product will be proportional to the amount of template (e.g., hPHTl and/or hPHT2 mRNA) in the original sample.
  • PCR Polymerase Chain Reaction
  • RT-PCR reverse-transcription PCR
  • Quantitative amplification involves simultaneously co-amplifying a known quantity of a control sequence using the same primers. This provides an internal standard that may be used to calibrate the PCR reaction.
  • Detailed protocols for quantitative PCR are provided in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.).
  • One approach for example, involves simultaneously co-amplifying a known quantity of a control sequence using the same primers as those used to amplify the target. This provides an internal standard that may be used to calibrate the PCR reaction.
  • One preferred internal standard is a synthetic AW106 cRNA.
  • the AW106 cRNA is combined with RNA isolated from the sample according to standard techniques known to those of skill in the art.
  • the RNA is then reverse transcribed using a reverse transcriptase to provide copy DNA.
  • the cDNA sequences are then amplified (e.g., by PCR) using labeled primers.
  • the amplification products are separated, typically by electrophoresis, and the amount of labeled nucleic acid (proportional to the amount of amplified product) is determined.
  • the amount of mRNA in the sample is then calculated by comparison with the signal produced by the known AW106 RNA (or other) standard.
  • PCR Protocols A Guide to Methods and Applications, Innis et al. (1990) Academic Press, Inc. N.Y..
  • the nucleic acid sequence(s) for hPHTl and hPHT2 provided herein are sufficient to enable one of skill to routinely select primers to amplify any portion of the gene.
  • the methods of this invention can be utilized in array- based hybridization formats.
  • Arrays are a multiplicity of different "probe” or “target” nucleic acids (or other compounds) attached to one or more surfaces (e.g., solid, membrane, or gel).
  • the multiplicity of nucleic acids (or other moieties) is attached to a single contiguous surface or to a multiplicity of surfaces juxtaposed to each other.
  • "low density" arrays can simply be produced by spotting (e.g. by hand using a pipette) different nucleic acids at different locations on a solid support (e.g. a glass surface, a membrane, etc.).
  • a solid support e.g. a glass surface, a membrane, etc.
  • Arrays can also be produced using oligonucleotide synthesis technology.
  • U.S. Patent No. 5,143,854 and PCT Patent Publication Nos. WO 90/15070 and 92/10092 teach the use of light-directed combinatorial synthesis of high density oligonucleotide arrays. Synthesis of high density arrays is also described in U.S. Patents 5,744,305, 5,800,992 and 5,445,934.
  • nucleic acid hybridization formats are known to those skilled in the art.
  • common formats include sandwich assays and competition or displacement assays.
  • assay formats are generally described in Hames and Higgins (1985) Nucleic Acid Hybridization, A Practical Approach, IRL Press; Gall and Pardue (1969) Proc. Natl. Acad. Sci. USA 63: 378-383; and John et al. (1969) Nature 223: 582-587.
  • Sandwich assays are commercially useful hybridization assays for detecting or isolating nucleic acid sequences. Such assays utilize a "capture" nucleic acid covalently immobilized to a solid support and a labeled "signal" nucleic acid in solution. The sample will provide the target nucleic acid. The "capture” nucleic acid and “signal” nucleic acid probe hybridize with the target nucleic acid to form a "sandwich” hybridization complex. To be most effective, the signal nucleic acid should not hybridize with the capture nucleic acid. Typically, labeled signal nucleic acids are used to detect hybridization.
  • Complementary nucleic acids or signal nucleic acids may be labeled by any one of several methods typically used to detect the presence of hybridized polynucleotides. The most common method of detection is the use of autoradiography with 3 H, 125 1, 35 S, 14 C, or 32 P- labelled probes or the like. Other labels include ligands that bind to labeled antibodies, fluorophores, chemi-luminescent agents, enzymes, and antibodies which can serve as specific binding pair members for a labeled ligand. Detection of a hybridization complex may require the binding of a signal generating complex to a duplex of target and probe polynucleotides or nucleic acids.
  • such binding occurs through ligand and anti-ligand interactions as between a ligand-conjugated probe and an anti-ligand conjugated with a signal.
  • the sensitivity of the hybridization assays may be enhanced through use of a nucleic acid amplification system that multiplies the target nucleic acid being detected. Examples of such systems include the polymerase chain reaction (PCR) system and the ligase chain reaction (LCR) system.
  • PCR polymerase chain reaction
  • LCR ligase chain reaction
  • Other methods recently described in the art are the nucleic acid sequence based amplification (NASBAO, Cangene, Mississauga, Ontario) and Q Beta Replicase systems.
  • Nucleic acid hybridization simply involves providing a denatured probe and target nucleic acid under conditions where the probe and its complementary target can form stable hybrid duplexes through complementary base pairing. The nucleic acids that do not form hybrid duplexes are then washed away leaving the hybridized nucleic acids to be detected, typically through detection of an attached detectable label. It is generally recognized that nucleic acids are denatured by increasing the temperature or decreasing the salt concentration of the buffer containing the nucleic acids, or in the addition of chemical agents, or the raising of the pH. Under low stringency conditions (e.g., low temperature and/or high salt and/or high target concentration) hybrid duplexes (e.g., DNA:DNA,
  • hybridization conditions may be selected to provide any degree of stringency. In a preferred embodiment, hybridization is performed at low stringency to ensure hybridization and then subsequent washes are performed at higher stringency to eliminate mismatched hybrid duplexes. Successive washes may be performed at increasingly higher stringency (e.g., down to as low as 0.25 X SSPE at 37°C to 70°C) until a desired level of hybridization specificity is obtained. Stringency can also be increased by addition of agents such as formamide. Hybridization specificity may be evaluated by comparison of hybridization to the test probes with hybridization to the various controls that can be present.
  • the wash is performed at the highest stringency that produces consistent results and that provides a signal intensity greater than approximately 10% of the background intensity.
  • the hybridized array may be washed at successively higher stringency solutions and read between each wash. Analysis of the data sets thus produced will reveal a wash stringency above which the hybridization pattern is not appreciably altered and which provides adequate signal for the particular probes of interest.
  • background signal is reduced by the use of a blocking reagent (e.g., tRNA, sperm DNA, cot-1 DNA, etc.) during the hybridization to reduce non-specific binding.
  • a blocking reagent e.g., tRNA, sperm DNA, cot-1 DNA, etc.
  • the use of blocking agents in hybridization is well known to those of skill in the art (see, e.g., Chapter 8 in P. Tijssen, supra.) Methods of optimizing hybridization conditions are well known to those of skill in the art (see, e.g., Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 24: Hybridization With Nucleic Acid Probes, Elsevier, N.Y.).
  • Optimal conditions are also a function of the sensitivity of label (e.g., fluorescence) detection for different combinations of substrate type, fluorochrome, excitation and emission bands, spot size and the like.
  • label e.g., fluorescence
  • Low fluorescence background surfaces can be used (see, e.g., Chu (1992) Electrophoresis 13:105-114).
  • the sensitivity for detection of spots ("target elements") of various diameters on the candidate surfaces can be readily determined by, e.g., spotting a dilution series of fluorescently end labeled DNA fragments. These spots are then imaged using conventional fluorescence microscopy.
  • the sensitivity, linearity, and dynamic range achievable from the various combinations of fluorochrome and solid surfaces can thus be determined.
  • Serial dilutions of pairs of fluorochrome in known relative proportions can also be analyzed. This determines the accuracy with which fluorescence ratio measurements reflect actual fluorochrome ratios over the dynamic range permitted by the detectors and fluorescence of the substrate upon which the probe has been fixed. d) Labeling and detection of nucleic acids.
  • the probes used herein for detection of hPHTl and/or hPHT2 expression levels can be full length or less than the full length of the hPHTl and/or hPHT2 mRNA. Shorter probes are empirically tested for specificity. Preferred probes are sufficiently long so as to specifically hybridize with the hPHTl and/or hPHT2 target nucleic acid(s) under stringent conditions.
  • the preferred size range is from about 20 bases to the length of the hPHTl and/or hPHT2 mRNA, more preferably from about 30 bases to the length of the hPHTl and/or hPHT2 mRNA, and most preferably from about 40 bases to the length of the hPHTl and/or hPHT2 mRNA.
  • the probes are typically labeled, with a detectable label. Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means.
  • Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein, texas red, rhodamine, green fluorescent protein, and the like, see, e.g., Molecular Probes, Eugene, Oregon, USA), radiolabels (e.g., 3 H, 125 1, 35 S, 14 C, or 32 P), enzymes (e.g., horse radish peroxidase, alkaline phosphatase and others commonly used in an ELISA), and colorimetric labels such as colloidal gold (e.g., gold particles in the 40 -80 nm diameter size range scatter green light with high efficiency) or colored glass or plastic (e.g., polystyrene, polypropylene, latex, etc.) beads.
  • Patents teaching the use of such labels include U.S. Patent Nos. 3,817,837; 3,850
  • a fluorescent label is preferred because it provides a very strong signal with low background. It is also optically detectable at high resolution and sensitivity through a quick scanning procedure.
  • the nucleic acid samples can all be labeled with a single label, e.g., a single fluorescent label.
  • different nucleic acid samples can be simultaneously hybridized where each nucleic acid sample has a different label. For instance, one target could have a green fluorescent label and a second target could have a red fluorescent label. The scanning step will distinguish sites of binding of the red label from those binding the green fluorescent label.
  • Each nucleic acid sample (target nucleic acid) can be analyzed independently from one another.
  • Suitable chromogens which can be employed include those molecules and compounds which absorb light in a distinctive range of wavelengths so that a color can be observed or, alternatively, which emit light when irradiated with radiation of a particular wave length or wave length range, e.g., fluorescent molecules.
  • fluorescent labels should absorb light above about 300 nm, preferably about 350 nm, and more preferably above about 400 nm, usually emitting at wavelengths greater than about 10 nm higher than the wavelength of the light absorbed. It should be noted that the absorption and emission characteristics of the bound dye can differ from the unbound dye. Therefore, when referring to the various wavelength ranges and characteristics of the dyes, it is intended to indicate the dyes as employed and not the dye which is unconjugated and characterized in an arbitrary solvent. Fluorescent labels are generally preferred because by irradiating a fluorescent molecule with light, one can obtain a plurality of emissions. Thus, a single label can provide for a plurality of measurable events.
  • Detectable signal can also be provided by chemi luminescent and bioluminescent sources.
  • Chemiluminescent sources include a compound which becomes electronically excited by a chemical reaction and can then emit light which serves as the detectable signal or donates energy to a fluorescent acceptor.
  • luciferins can be used in conjunction with luciferase or lucigenins to provide bioluminescence.
  • Spin labels are provided by reporter molecules with an unpaired electron spin which can be detected by electron spin resonance (ESR) spectroscopy.
  • exemplary spin labels include organic free radicals, transitional metal complexes, particularly vanadium, copper, iron, and manganese, and the like.
  • exemplary spin labels include nitroxide free radicals.
  • the label may be added to the target (sample) nucleic acid(s) prior to, or after the hybridization.
  • direct labels are detectable labels that are directly attached to or incorporated into the target (sample) nucleic acid prior to hybridization.
  • indirect labels are joined to the hybrid duplex after hybridization.
  • the indirect label is attached to a binding moiety that has been attached to the target nucleic acid prior to the hybridization.
  • the target nucleic acid may be biotinylated before the hybridization. After hybridization, an avidin-conjugated fluorophore will bind the biotin bearing hybrid duplexes providing a label that is easily detected.
  • Fluorescent labels are easily added during an in vitro transcription reaction.
  • fluorescein labeled UTP and CTP can be incorporated into the RNA produced in an in vitro transcription.
  • the labels can be attached directly or through a linker moiety.
  • the site of label or linker-label attachment is not limited to any specific position.
  • a label may be attached to a nucleoside, nucleotide, or analogue thereof at any position that does not interfere with detection or hybridization as desired.
  • certain Label-On Reagents from Clontech provide for labeling interspersed throughout the phosphate backbone of an oligonucleotide and for terminal labeling at the 3' and 5' ends.
  • labels can be attached at positions on the ribose ring or the ribose can be modified and even eliminated as desired.
  • the base moieties of useful labeling reagents can include those that are naturally occurring or modified in a manner that does not interfere with the purpose to which they are put.
  • Modified bases include but are not limited to 7-deaza A and G, 7-deaza-8-aza A and G, and other heterocyclic moieties.
  • fluorescent labels are not to be limited to single species organic molecules, but include inorganic molecules, multi -molecular mixtures of organic and/or inorganic molecules, crystals, heteropolymers, and the like.
  • CdSe-CdS core-shell nanocrystals enclosed in a silica shell can be easily derivatized for coupling to a biological molecule (Bruchez et al.
  • alterations in expression of hPHTl and/or hPHT2 transporters can be detected and/or quantified by detecting and/or quantifying the amount and/or activity of translated hPHTl and or hPHT2 polypeptide or fragments thereof.
  • the polypeptide(s) encoded by the hPHTl and/or hPHT2 gene(s) can be detected and quantified by any of a number of methods well known to those of skill in the art. These may include analytic biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like, or various immunological methods such as fluid or gel precipitin reactions, immunodiffusion (single or double), immunoelectrophoresis, radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISAs), immunofluorescent assays, western blotting, and the like.
  • analytic biochemical methods such as electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, and the like
  • various immunological methods such as fluid or gel precipitin reactions, immuno
  • the hPHTl and/or hPHT2 polypeptide(s) are detected quantified in an electrophoretic protein separation (e.g. a 1- or 2-dimensional electrophoresis).
  • electrophoretic protein separation e.g. a 1- or 2-dimensional electrophoresis.
  • Means of detecting proteins using electrophoretic techniques are well known to those of skill in the art (see generally, R. Scopes (1982) Protein Purification, Springer- Verlag, N.Y.; Deutscher, (1990) Methods in Enzymology Vol. 182: Guide to Protein Purification, Academic Press, Inc., N.Y.).
  • Western blot (immunoblot) analysis is used to detect and quantify the presence of polypeptide(s) of this invention in the sample.
  • This technique generally comprises separating sample proteins by gel electrophoresis on the basis of molecular weight, transferring the separated proteins to a suitable solid support, (such as a nitrocellulose filter, a nylon filter, or derivatized nylon filter), and incubating the sample with the antibodies that specifically bind the target polypeptide(s).
  • the antibodies specifically bind to the target polypeptide(s) and may be directly labeled or alternatively may be subsequently detected using labeled antibodies (e.g., labeled sheep anti-mouse antibodies) that specifically bind to the a domain of the antibody.
  • labeled antibodies e.g., labeled sheep anti-mouse antibodies
  • an immunoassay is an assay that utilizes an antibody to specifically bind to the analyte (e.g., the target polypeptide(s)).
  • the immunoassay is thus characterized by detection of specific binding of a polypeptide of this invention to an antibody as opposed to the use of other physical or chemical properties to isolate, target, and quantify the analyte.
  • Immunological binding assays typically utilize a "capture agent" to specifically bind to and often immobilize the analyte (hPHTl and/or hPHT2 polypeptide).
  • the capture agent is an antibody.
  • Immunoassays also often utilize a labeling agent to specifically bind to and label the binding complex formed by the capture agent and the analyte.
  • the labeling agent may itself be one of the moieties comprising the antibody/analyte complex.
  • the labeling agent may be a labeled polypeptide or a labeled antibody that specifically recognizes the already bound target polypeptide.
  • the labeling agent may be a third moiety, such as another antibody, that specifically binds to the capture agent /polypeptide complex.
  • proteins capable of specifically binding immunoglobulin constant regions such as protein A or protein G may also be used as the label agent. These proteins are normal constituents of the cell walls of streptococcal bacteria. They exhibit a strong non- immunogenic reactivity with immunoglobulin constant regions from a variety of species (see, generally Kronval, et al. (1973) J. Immunol, 111: 1401-1406, and Akerstrom (1985) J. Immunol, 135: 2589-2542).
  • Preferred immunoassays for detecting the target polypeptide(s) are either competitive or noncompetitive.
  • Noncompetitive immunoassays are assays in which the amount of captured analyte is directly measured.
  • the capture agents can be bound directly to a solid substrate where they are immobilized. These immobilized antibodies then capture the target polypeptide present in the test sample. The target polypeptide thus immobilized is then bound by a labeling agent, such as a second antibody bearing a label.
  • the amount of analyte (hPHTl and/or hPHT2 polypeptide) present in the sample is measured indirectly by measuring the amount of an added (exogenous) analyte displaced (or competed away) from a capture agent (antibody) by the analyte present in the sample.
  • a known amount of, in this case, labeled hPHTl and/or hPHT2 polypeptide is added to the sample and the sample is then contacted with a capture agent.
  • the amount of labeled polypeptide bound to the antibody is inversely proportional to the concentration of target hPHTl and/or hPHT2 polypeptide present in the sample.
  • the antibody is immobilized on a solid substrate.
  • the amount of target polypeptide bound to the antibody may be determined either by measuring the amount of target polypeptide present in a polypeptide/antibody complex, or alternatively by measuring the amount of remaining uncomplexed polypeptide.
  • the immunoassay methods of the present invention include an enzyme immunoassay (EIA) which utilizes, depending on the particular protocol employed, unlabeled or labeled (e.g., enzyme-labeled) derivatives of polyclonal or monoclonal antibodies or antibody fragments or single-chain antibodies that bind hPHTl and/or hPHT2 polypeptide(s), either alone or in combination.
  • EIA enzyme immunoassay
  • unlabeled or labeled e.g., enzyme-labeled derivatives of polyclonal or monoclonal antibodies or antibody fragments or single-chain antibodies that bind hPHTl and/or hPHT2 polypeptide(s)
  • a different detectable marker for example, an enzyme-labeled antibody capable of binding to the monoclonal antibody which binds the hPHTl and/or hPHT2 polypeptide, may be employed.
  • EIA enzyme-linked immunoabsorbent assay
  • ELISA enzyme-linked immunoabsorbent assay
  • immunoblotting immunoassay techniques such as western blotting employing an enzymatic detection system.
  • the immunoassay methods of the present invention may also be other known immunoassay methods, for example, fluorescent immunoassays using antibody conjugates or antigen conjugates of fluorescent substances such as fluorescein or rhodamine, latex agglutination with antibody-coated or antigen-coated latex particles, haemagglutination with antibody-coated or antigen-coated red blood corpuscles, and immunoassays employing an avidin-biotin or strepavidin-biotin detection systems, and the like.
  • the particular parameters employed in the immunoassays of the present invention can vary widely depending on various factors such as the concentration of antigen in the sample, the nature of the sample, the type of immunoassay employed and the like.
  • the amount of antibody that binds hPHTl and/or hPHT2 polypeptide is typically selected to give 50% binding of detectable marker in the absence of sample. If purified antibody is used as the antibody source, the amount of antibody used per assay will generally range from about 1 ng to about 100 ng.
  • Typical assay conditions include a temperature range of about 4°C. to about 45°C, preferably about 25°C to about 37°C, and most preferably about 25°C, a pH value range of about 5 to 9, preferably about 7, and an ionic strength varying from that of distilled water to that of about 0.2M sodium chloride, preferably about that of 0.15M sodium chloride.
  • Times will vary widely depending upon the nature of the assay, and generally range from about 0.1 minute to about 24 hours.
  • buffers for example PBS
  • other reagents such as salt to enhance ionic strength, proteins such as serum albumins, stabilizers, biocides and non-ionic detergents may also be included.
  • the assays of this invention are scored (as positive or negative or quantity of target polypeptide) according to standard methods well known to those of skill in the art.
  • the particular method of scoring will depend on the assay format and choice of label.
  • a Western Blot assay can be scored by visualizing the colored product produced by the enzymatic label. A clearly visible colored band or spot at the correct molecular weight is scored as a positive result, while the absence of a clearly visible spot or band is scored as a negative.
  • the intensity of the band or spot can provide a quantitative measure of target polypeptide concentration.
  • Antibodies for use in the various immunoassays described herein are commercially available or can be produced as described below.
  • Either polyclonal or monoclonal antibodies may be used in the immunoassays of the invention described herein.
  • Polyclonal antibodies are preferably raised by multiple injections (e.g. subcutaneous or intramuscular injections) of substantially pure polypeptides (hPHTl and/or hPHT2 or fragments thereof) or antigenic polypeptides into a suitable non-human mammal.
  • the antigenicity of the target peptides can be determined by conventional techniques to determine the magnitude of the antibody response of an animal that has been immunized with the peptide.
  • the peptides that are used to raise antibodies for use in the methods of this invention should generally be those which induce production of high titers of antibody with relatively high affinity for target polypeptides encoded by hPHTl and/or hPHT2.
  • the immunizing peptide may be coupled to a carrier protein by conjugation using techniques that are well-known in the art.
  • a carrier protein such commonly used carriers which are chemically coupled to the peptide include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA), and tetanus toxoid.
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • tetanus toxoid tetanus toxoid.
  • the coupled peptide is then used to immunize the animal (e.g. a mouse or a rabbit).
  • the antibodies are then obtained from blood samples taken from the mammal.
  • the techniques used to develop polyclonal antibodies are known in the art (see, e.g.,
  • Polyclonal antibodies produced by the animals can be further purified, for example, by binding to and elution from a matrix to which the peptide to which the antibodies were raised is bound.
  • Those of skill in the art will know of various techniques common in the immunology arts for purification and/or concentration of polyclonal antibodies, as well as monoclonal antibodies see, for example, Coligan, et al. (1991) Unit 9, Current Protocols in Immunology, Wiley Interscience).
  • the antibodies produced will be monoclonal antibodies ("mAb's").
  • mAb's monoclonal antibodies
  • immunization of a mouse or rat is preferred.
  • antibody as used in this invention includes intact molecules as well as fragments thereof, such as, Fab and F(ab') 2 , and/or single-chain antibodies (e.g. scFv) which are capable of binding an epitopic determinant.
  • hybridomas secreting mAbs The general method used for production of hybridomas secreting mAbs is well known (Kohler and Milstein (1975) Nature, 256:495). Briefly, as described by Kohler and Milstein the technique comprises fusing an antibody-secreting cell (e.g. a splenocyte) with an immortalized cell (e.g. a myeloma cell). Hybridomas are then screened for production of antibodies that bind to hPHTl and/or hPHT2 or a fragment thereof.
  • an antibody-secreting cell e.g. a splenocyte
  • an immortalized cell e.g. a myeloma cell
  • Confirmation of specificity among mAb's can be accomplished using relatively routine screening techniques (such as the enzyme-linked immunosorbent assay, or "ELISA", BiaCore, etc.) to determine the binding specificity and/or avidity of the mAb of interest.
  • Antibodies fragments e.g. single chain antibodies (scFv or others), can also be produced/selected using phage display technology.
  • the ability to express antibody fragments on the surface of viruses that infect bacteria (bacteriophage or phage) makes it possible to isolate a single binding antibody fragment, e.g., from a library of greater than 10 10 nonbinding clones.
  • an antibody fragment gene is inserted into the gene encoding a phage surface protein (e.g., plU) and the antibody fragment-pHI fusion protein is displayed on the phage surface (McCafferty et al. (1990) Nature, 348: 552-554; Hoogenboom et al. (1991) Nucleic Acids Res. 19: 4133-4137).
  • a phage surface protein e.g., plU
  • phage bearing antigen binding antibody fragments can be separated from non-binding phage by antigen affinity chromatography (McCafferty et al. (1990) Nature, 348: 552-554).
  • affinity chromatography McCafferty et al. (1990) Nature, 348: 552-554
  • enrichment factors of 20 fold - 1,000,000 fold are obtained for a single round of affinity selection.
  • more phage can be grown and subjected to another round of selection. In this way, an enrichment of 1000 fold in one round can become 1,000,000 fold in two rounds of selection (McCafferty et al. (1990) Nature, 348: 552-554).
  • Human antibodies can be produced without prior immunization by displaying very large and diverse V-gene repertoires on phage (Marks et al. (1991) J. Mol. Biol. 222: 581-597).
  • natural VH and VL repertoires present in human peripheral blood lymphocytes are were isolated from unimmunized donors by PCR.
  • the V-gene repertoires were spliced together at random using PCR to create a scFv gene repertoire which is was cloned into a phage vector to create a library of 30 million phage antibodies (Id.).
  • binding antibody fragments have been isolated against more than 17 different antigens, including haptens, polysaccharides and proteins (Marks et al. (1991) J. Mol. Biol. 222: 581-597; Marks et al. (1993). Bio/Technology. 10: 779-783; Griffiths et al. (1993) EMBO J. 12: 725-734; Clackson et al. (1991) Nature. 352: 624-628). Antibodies have been produced against self proteins, including human thyroglobulin, immunoglobulin, tumor necrosis factor and CEA (Griffiths et al. (1993) EMBO J. 12: 725-734).
  • antibodies can be prepared by any of a number of commercial services (e.g., Berkeley antibody laboratories, Bethyl Laboratories, Anawa, Eurogenetec, etc.).
  • hPHTl and/or hPHT2 are transporters.
  • endogenous hPHTl and/or hPHT2 activity in a cell can be readily measured by providing a suitable substrate (e.g. one identified according to the methods described herein) and detecting the uptake of that substrate by hPHTl or hPHT2.
  • test agents for the ability to interact with (e.g. specifically bind to) an hPHTl or hPHT2 nucleic acid or polypeptide. Specifically, binding test agents are more likely to interact with and thereby modulate hPHTl or hPHT2 expression and/or activity.
  • the test agent(s) are pre-screened for binding to hPHTl and/or hPHT2 nucleic acids or to hPHTl and/or hPHT2 proteins before performing the more complex assays described above.
  • such pre-screening is accomplished with simple binding assays.
  • Means of assaying for specific binding or the binding affinity of a particular ligand for a nucleic acid or for a protein are well known to those of skill in the art.
  • the hPHTl and/or hPHT2 protein or protein fragment, or nucleic acid is immobilized and exposed to a test agent (which can be labeled), or alternatively, the test agent(s) are immobilized and exposed to an hPHTl and/or hPHT2 protein (or fragment) or to an hPHTl or hPHT2 nucleic acid or fragment thereof (which can be labeled).
  • the immobilized moiety is then washed to remove any unbound material and the bound test agent or bound hPHTl or hPHT2 nucleic acid or protein is detected (e.g. by detection of a label attached to the bound molecule).
  • the amount of immobilized label is proportional to the degree of binding between the hPHTl and/or hPHT2 protein or nucleic acid and the test agent.
  • the assays for modulators of peptide transporter expression and/or activity or for agents transported by the transporters of this invention are also amenable to "high- throughput" modalities.
  • new chemical entities with useful properties e.g., modulation of transporter activity or expression, or ability to be transported by the transporters of this invention
  • a chemical compound called a "lead compound”
  • HTS high throughput screening
  • high throughput screening methods involve providing a library containing a large number of compounds (candidate compounds) potentially having the desired activity. Such “combinatorial chemical libraries” are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The compounds thus identified can serve as conventional "lead compounds" or can themselves be used as potential or actual therapeutics.
  • a combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical "building blocks" such as reagents.
  • a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks. For example, one commentator has observed that the systematic, combinatorial mixing of 100 interchangeable chemical building blocks results in the theoretical synthesis of 100 million tetrameric compounds or 10 billion pentameric compounds (Gallop et al. (1994) 37(9): 1233-1250).
  • combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Patent 5,010,175, Furka (1991) Int. J. Pept. Prot. Res., 37: 487-493, Houghton et al. (1991) Nature, 354: 84-88).
  • Peptide synthesis is by no means the only approach envisioned and intended for use with the present invention.
  • Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptoids (PCT Publication No WO 91/19735, 26 Dec.
  • nucleic acid libraries see, e.g., Strategene, Corp.
  • peptide nucleic acid libraries see, e.g., U.S. Patent 5,539,083
  • antibody libraries see, e.g., Vaughn et al. (1996) Nature Biotechnology, 14(3): 309-314
  • PCT/US96/10287 carbohydrate libraries
  • carbohydrate libraries see, e.g., Liang et al. (1996) Science, 274: 1520-1522, and U.S. Patent 5,593,853
  • small organic molecule libraries see, e.g., benzodiazepines, Baum (1993) C&EN, Jan 18, page 33, isoprenoids U.S.
  • Patent 5,569,588, thiazolidinones and metathiazanones U.S. Patent 5,549,974, pyrrolidines
  • U.S. Patents 5,525,735 and 5,519,134, morpholino compounds U.S. Patent 5,506,337, benzodiazepines 5,288,514, and the like.
  • Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville KY, Symphony, Rainin, Woburn, MA, 433A Applied Biosystems, Foster City, CA, 9050 Plus, Millipore, Bedford, MA).
  • a number of well known robotic systems have also been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate ⁇ , Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett-Packard, Palo Alto, Calif.) which mimic the manual synthetic operations performed by a chemist. Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art.
  • Preferred assays thus detect inhibition of transcription (i.e., inhibition of mRNA production) by the test compound(s), inhibition of protein expression by the test compound(s), binding to the gene (e.g., gDNA, or cDNA) or gene product (e.g., mRNA or expressed protein) by the test compound(s) in the case of expression assays, while transport assays preferably measure internalization of the test agent.
  • High throughput assays for the presence, absence, or quantification of particular nucleic acids or protein products are well known to those of skill in the art.
  • binding assays are similarly well known.
  • U.S. Patent 5,559,410 discloses high throughput screening methods for proteins
  • U.S. Patent 5,585,639 discloses high throughput screening methods for nucleic acid binding (i.e., in arrays)
  • U.S. Patents 5,576,220 and 5,541,061 disclose high throughput methods of screening for ligand/antibody binding.
  • high throughput screening systems are commercially available (see, e.g., Zymark Corp., Hopkinton, MA; Air Technical Industries, Mentor, OH; Beckman Instruments, Inc. Fullerton, CA; Precision Systems, Inc., Natick, MA, etc.). These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay.
  • These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols the various high throughput.
  • Zymark Corp. provides technical bulletins describing screening systems for detecting the modulation of gene transcription, ligand binding, and the like. VI. Kits.
  • kits for isolation and/or detection and/or cloning of the transporter genes of this invention are provided for the practice of any of the assay methods described herein.
  • the kits comprise one or more containers containing nucleic acids encoding one or more of the H+/oligopeptide transporters or fragments thereof, or (optionally labeled) probes that specifically bind to one or more of the H+/oligopeptide transporters of this invention.
  • kits comprise one or more containers containing a vector encoding one or more of the transporters of this invention and/or cells or cell lines optionally transfected with one or more of these vectors.
  • the kit contain mRNA(s) encoding one or more of the transporters of this invention and/or cells suitable for transfection with such mRNAs.
  • the kits may optionally contain DNA template(s) suitable for preparation of such mRNAs.
  • the kits may optionally include one or more reagents for use in the methods of this invention. Such “reagents” may include, but are not limited to, cells and/or cell lines, transfection reagents (e.g.
  • kits may include instructional materials containing directions
  • kits for creating or modifying cells encoding one or more of the transporters of this invention, and or utilizing the kit contents for measuring expression of one or more of the transporters of this invention, or for screening for agents that are transported by one or more of the transporters of this invention.
  • the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials.
  • the proton-dependent oligopeptide transporters (POT) gene family currently consists of -70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepTI and PepT2 have been cloned in several species including humans, in addition to a rat histidine/peptide transporter (rPHTI). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent human orthologue of rPHTI (expression largely confined to rat brain and retina) was represented by numerous ESTs originating from many tissues.
  • EST human expressed sequence tags
  • HVdipeptide transporter protein PepTI
  • PepTI HVdipeptide transporter protein
  • hPepTl is a member of a well defined small gene family, the proton-dependent oligopeptide transporters (POT, also referred to as PTR), with ancestral roots that can be traced to bacterial, fungal, and plant peptide transporters (Graul and Sadee (1997) Pharm. Res., 14: 388-400; Fei et al. (1998) Prog. Nucleic Acid Res. Mol. Biol, 58: 239-261; Paulsen and Skurray (1994) Trends Biochem. Sci., 19: 404; Steiner et al. (1995) Mol. Microbiol, 16: 825-834).
  • POT proton-dependent oligopeptide transporters
  • This class of secondary active transporters has broad selectivity for di- and tripeptides, whereas ability to transport longer peptides decreases drastically with increasing length.
  • Most of the POT members share a common structural architecture with -12 predicted transmembrane domains (TMDs), but among the dipeptide transporters in distant phyla, variations on this theme do occur.
  • TMDs transmembrane domains
  • PepTI and PepT2 the main renal peptide transporters
  • Substrates include important drug classes, such as ⁇ -lactam and cephalosporin antibiotics, renin inhibitors, ACE inhibitors, and 5'-nucleoside esters of amino acids, such as valcyclovir (Han et al. (1998) Pharm. Res., 15: 1154-1159).
  • *POT indicates proton-dependent oligopeptide transporters; TMD indicates transmembrane domain. fPossible alternative splicing product of hPepTl.
  • a greater repertoire of the dipeptide transporter gene family in humans must be considered in the interpretation of pharmacological studies with peptoid drugs and could also serve for targeting drugs to specific tissues. Moreover, sequence variations in these transporters could account for interindividual genetic differences in the disposition of peptoid drugs.
  • TMHMM http://www.cbs.dtu.dk/services/TMHMM-1.0/
  • TMPRED http://www.ch.embnet.org/software/TMPRED_form.html
  • HMMTOP http://www.enzim.hu/hmmtop/
  • MEMSTAT http://globin.bio. warwick.ac.uk/psipred/
  • the transmembrane topology schematic was rendered using TOPO (S.J. Johns and R.C. Speth, Transmembrane protein display software, http://www.sacs.ucsf.edu/TOPO/topo.html).
  • Sequence identities were calculated using the Smith Waterman algorithm (Smith and Waterman (1981) J. Mol. Biol, 147: 195-197) by the program ssearch3, a component of the FASTA programs (Pearson (1991) Genomics, 11: 635-650).
  • RNA samples extracted from human intestinal biopsy specimen were analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR).
  • RT-PCR reverse transcriptase-polymerase chain reaction
  • RT-PCR was performed with the GeneAmp RNA PCR Kit Part No. N808-0017 from Perkin Elmer (Wellesley, MA) using 0.5ul AmpliTaq® DNA Polymerase.
  • cDNA samples from skeletal muscle and pancreas purchased from CLONTECH Laboratories, Palo Alto, CA
  • the thermocycle included heating at 95°C, annealing at 60°C, reaction temperature at 70°C, for 35 cycles.
  • 3'MHPHT1 (GAGGATGAGCACAGCATCAA, SEQ ED NO: , right primer, at position
  • the amplified product was electrophoresed on a 1% Agarose gel, extracted, and sequenced by the University of California San Francisco Human Genetics Sequencing Service, San Francisco, CA.
  • Membrane blots containing size-fractionated poly(A)+ mRNA from 12 tissues of human origin were purchased from CLONTECH Laboratories.
  • the accession codes of the ESTs used as probes are W53019 and AA242853 for hPHTl and hPHT2, respectively.
  • These cDNA's were labeled with ⁇ 32 P-dATP (3000 Ci/mmol; Amersham, Piscataway, NJ) according to the random priming method, using a kStrip-EZ DNA kit (Ambion, Austin, TX). Hybridization was performed at 42°C overnight after purifying 32 -P- cDNA on a Sephadex G-50 spin column (mini Quick Spin Columns; Boehringer Mannheim, Indianapolis, IN).
  • the blots were washed twice at 42°C for 5 min with low stringency solution (Ambion) and for 15 min with high stringency solution (Ambion).
  • the membranes were exposed against x-ray film at -80°C for 3 to 7 days with intensifying screens.
  • the hybridized probe was removed from the membranes by using a Strip-EZ DNA kit (Ambion) before rehybridization.
  • each of the 68 members of the core cluster was run against the human EST database, and the results tabulated such that the identified ESTs were listed with the core sequence providing the highest score.
  • a bacterial drug-resistance transporter in the protein core cluster (bold-face); this sequence would have identified more members of the core cluster in a third iteration (not done here).
  • These include bacterial drug resistance transporters which are currently listed outside the core cluster. Putative POT members from C elegans are shown in bold-face with italics.
  • the human ESTs mainly cluster with sequences 11 (hPepT2), 50 (rPHT), and 51 (mouse cAMP-inducible 1 protein).
  • RCH2 protein [Brassica napus] 123 6e-27
  • Table 2 contains only two iterations. A number of these drug-resistance transporters of the major facilitator type transporter family appear in the list of neighbor sequences outside the core cluster (Table 2).
  • the core cluster contains 5 putative POT genes from the completely sequenced genome of C elegans (Table 2, bold-face and italics). Each of these deduced proteins has high similarity to hPepTl. This finding suggests that the human genome may also contain more POT members than are currently cloned.
  • Table 2 includes a number of deposited sequences encoding the main intestinal and renal transporters, hPepTl (sequences 1-3) and hPepT2 (sequence 12), and their orthologues in other mammalian species .
  • the pH sensing regulatory factor of peptide transporter (sequence 20) (Saito et al.
  • rPHTI rat peptide/histidine transporter
  • rPHTI and mouse cAMP-inducible 1 protein have apparent human orthologues, which we term hPHTl and hPHT2, respectively.
  • rPHTI and mouse cAMP-inducible 1 protein represent two distinct but closely related genes belonging to the POT family.
  • the core cluster of POT sequences contains one additional human sequence, namely, erythroid differentiation-related factor 2 (sequence 42.41, Table 2).
  • the E value (4 x 10 " ) suggests probable homology to a putative POT transporter of Bacillus subtilis (sequence 42; 13 predicted TMDs). However, this sequence is rather short (107 residues), showing good sequence similarity with TMD11 and adjacent loop of the B subtilis transporter.
  • Second Pass INCA Scanning the Human EST Database
  • PepT2 vs human EST gi
  • a schematics of the hPHTl contig assembly Figure IA contains the minimum number of EST's spanning the length of the deduced hPHTl sequence. To view the EST coverage of each segment, click on the EST/region of interest. This will reveal segments with numerous overlapping ESTs. Because multiple ESTs cover the same regions of hPHTl, one can deduce possible sequence variations in the human population where EST sequences are not identical. Clearly, many of these variations may be due to sequencing errors, but in a few cases a variation occurs more than once at the same location.
  • the contig sequence is closely related to that of rPHTI; however, the first -50 5'-terminal base pairs are missing. (It appears that there is a rare N ⁇ tl site at the 5'-end, which could have caused truncation during preparation for EST sequence analysis.) Thus, the EST contig is likely to represent >95% of the coding region of hPHTl.
  • the deduced hPHTl amino acid sequence is shown in SEQ D NO: 5).
  • the faster migrating band contained a gap of 169 bps in the middle of hPHTl Figure IC, Variant B; for RT-PCR results see Figure 5 A).
  • Some of the putative hPHTl splice variants may introduce a frame shift and would not be expected to result in a functionally active transporter. These variants need to be cloned individually and tested experimentally. The information presented here is therefore important for guiding cloning efforts to produce functional hPHTl protein. Genomic hPHT2 Sequence.
  • the human EST contig sequence corresponding to rat cAMP-inducible 1 protein served to scan the human nr nucleotide databases. This revealed a PAC clone (Pl- derived artificial chromosome) containing human genomic sequences closely related to the mouse cDNA-encoding cAMP-inducible 1 protein.
  • PAC clone Pl- derived artificial chromosome
  • cDNA sequence of cAMP- inducible 1 protein we were able to identify the likely introns and exons representing the presumed hPHT2 gene Figure 2; (SEQ ED Nos: 7-23). Each of the intron-exon boundaries are flanked by GT. . . AG in the intron sequence.
  • the intron structure follows the GT- AG rule, where GT is called the splice donor and AT is called the splice acceptor.
  • the deduced cDNA coding sequence and protein sequence are shown in
  • Table 4 lists the identities and similarities among the protein sequences of the main mammalian members of the POT family. While hPepTl and hPEPT2 represent one branch of this family, hPHTl, hPHT2, rPHT, and mouse cAMP-inducible 1 protein are closely related and form a second branch. hPHTl has 89% identity to rPHTI, while hPHT2 is 81% identical to mouse cAMP-inducible 1 protein. Multiple sequence alignments are provided in Figure 3, including either the PHT branch only (Figure 3A), or both branches ( Figure 3B).
  • the deduced putative cDNA coding sequence is the identical length of the coding sequence suggested by our genomic hPHT2 sequence, and it is identical to hPHT2 over a large portion of the presumed coding region.
  • a fragment of 50 bps in the hPHT2 coding region from position 61-110 is replaced in the cloned cDNA by a 50-bp fragment of low complexity (cg-rich), which is excluded from BLAST analysis by a low complexity filter.
  • This 50-bp cDNA fragment did not recognize any sequence in the PAC clone containing the hPHT2 genomic sequence, but it did recognize fragments in a number of unrelated genes, therefore, possibly representing a low complexity repeat fragment.
  • cDNA sequence was identical to that of hPHT2, except for an insertion of three nucleotides each in three different locations of hPHT2 (at positions 837, 1271, and 1428 of hPHT2). These sequence variations would indicate the presence of three additional amino acids at these respective positions, without disturbing the overall reading frame. It remains to be seen how these changes from our deduced coding sequence came about and whether they are of functional significance. In any case, comparing the cDNA and genomic sequences reveals many details of the possible protein structure not available otherwise.
  • hPHTl was mainly expressed in skeletal muscle, followed by kidney, heart, and liver, with relatively little expression in colon and brain. mRNA bands were detected at apparent molecular weight 2.8 kb and 5.1 kb, indicating the presence of possible mRNA variants.
  • the mRNA tissue distribution of hPHT2 differed significantly from that of hPHTl Figure 5B. A single major band appeared at 2.4 kb, with highest expression in spleen, placenta, lung, and leukocytes, followed by heart, kidney, and liver.
  • hPHTl a contig sequence termed hPHTl
  • EST sequencing is not rigorously quality controlled and single nucleotide variants occur only sporadically, multiple overlapping ESTs could nevertheless assist in finding single nucleotide polymorphisms (SNPs).
  • hPHTl The strong representation of hPHTl in the EST database suggests that the presumed hPHTl is widely expressed in human tissues, largely in the CNS, in contrast to its restricted expression in rats.
  • One of these ESTs stems from a human colon carcinoma, an indication that hPHTl may also be expressed in human intestines.
  • RT-PCR Northern blot analysis has revealed that hPHTl and KPHT2 are not highly expressed in intestines relative to other tissues. Protein expression and functional studies are required to determine whether these transporters, in addition to hPepTl, could play a role in intestinal peptoid drug absorption.
  • hPHTl or 2 could play a role in oral antibiotic bioavailability remains to be seen.
  • Our Northern blot analysis revealed strong expression for hPHTl in skeletal muscle and kidney while hPHT2 was highly expressed in leukocytes, lung placenta, and spleen. Detectable expression of both genes in organs, such as the heart, may be of interest in understanding the efficacy of antibiotic treatment of localized infections -; particularly if the infectious agent resides intracellularly.
  • the tissue distribution of gene expression differs from that of hPepTl (mainly intestinal) and hPepT2 (mainly renal) which underscores the relevance of our findings to targeting therapy to specific organs.
  • hPepTl hPepTl
  • affinity of these nucleoside prodrugs for other peptide transporters remains to be determined.
  • PEPTI Proton-coupled oligopeptide transporter PEPTI facilitates the transport of dipeptides and peptoid drugs (including antibiotics) across the cell membranes of endothelial and epithelial cells.
  • Substrate transport by the proton symport is driven by pH gradients, while the profile of pH sensitivity is regulated by a closely related protein, hPEPTl-RF.
  • hPEPTl-RF a closely related protein
  • hPEPTl is encoded by 23 exons and hPEPTl-RF by 6 exons. Coding sequences of hPEPTl- RF share 3 exons completely and 2 exons partially with hPEPTl.
  • the genomic organization of hPEPTl shows high similarity with its mouse orthologue. Exon-intron boundaries occur mostly in the loops connecting transmembrane segments (TMSs), suggesting a modular gene structure reflecting the TMS-loop repeat units in hPEPTl.
  • TMSs transmembrane segments
  • the putative promoter region of hPEPTl contains TATA boxes and GC-rich regions and a potential insulin responsive element.
  • POTs Proton-coupled oligopeptide transporters
  • A.17 for transporter classification see http://www.biology.ucsd.edu/ ⁇ msaier/transport/titlep age.html.
  • Oligopeptide transporters are symporters driven by the flux of protons; they have a molecular architecture consisting of -12 predicted TMSs (Sadee et al. (1995) Pharm Res. 12: 1823-1837).
  • Members of the POT family include peptide transporter 1 (PEPTI) (Fei et al. (1994) Nature, 368: 563-566; Liang et al. (1995) J. Biol. Chem. 270: 6456-6463), peptide transporter 2 (PEPT2) (Liu et al.
  • Human PEPTI cDNA contains 3105 base pairs (bp), and the predicted protein consists of 708 amino acids.
  • the transporter protein has 12 predicted TMSs and 2 putative protein kinase C phosphorylation sites.
  • the membrane topology of the human dipeptide transporter, hPEPTl was determined by epitope insertions by Covitz et al (Covitz et al. (1998) Biochem. 37: 15214-15221).
  • PEPTI is expressed in the intestine (brush border), early proximal kidney tubuli, liver, placenta, and pancreas (Liang et al. (1995) 7. Biol. Chem. 270: 6456-6463; Shen et al. (1999) Am J Physiol. 276: F658- F665). In the intestines, PEPTI facilitates absorption of digested dipeptides so that most of the dietary nitrogen is absorbed as dipeptides rather than as amino acids (Ganapathy and Leibach (1999) pages 456-467 In: Yamada T, ed. Textbook of Gastroenterology. Philadelphia, PA: Lippincott Williams and Wilkins).
  • Human PEPTI has broad substrate specificity.
  • the substrates include di- and tripeptides and peptoid drugs.
  • PEPTI mediates the high bioavailability of many hydrophilic beta-lactam antibiotics (Terada et al. (1999) Am J Physiol. 276: G1435-G1441).
  • PEPTI is suggested to play a role in intracellular peptide transport, including lysosomal transport (Gonzales et al. (1998) Cancer Res. 519-525). Saito et al. (1997) Biochem Biophys Res Commun. 237: 577-582, have described a highly related transcript, termed hPEPTl-RF, which modulates the activity of human PEPTI.
  • the cDNA for the regulatory factor encodes an open reading frame of 208 amino acids. Residues 18-195 are identical to residues 8-185 in hPEPTl, while sequences 1- 17 and 196-208 are unique. Both hPEPTl and hPEPTl-RF are expressed in Caco-2 cells. Expression studies in Xenopus oocytes and Caco-2 cells showed that the regulatory factor shifted the pH-sensitivity profile of hPEPTl -mediated peptide transport (Saito et al. (1997) Biochem Biophys Res Commun. 237: 577-582). Although somatic cell hybrid analysis and in situ hybridization studies of Liang et al. (1995) J. Biol. Chem.
  • BLAST National Center for Biotechnology Information
  • NCBI National Center for Biotechnology Information
  • BLOSUM62 matrix was used with default parameters. The analysis was done with and without filtering of the low-complexity sequences and without masking of repetitive elements. Queries used the cDNA sequences of human PEPTI (accession number: NM_005073) and hPEPTl-RF (AB001328) and the high-throughput genomic sequence (HTGS) database.
  • sequences 2 kb upstream from the transcription start sites of hPEPTl and hPEPTl -RF were investigated using programs FindPatterns and FitConsensus (Genetics Computer Group, Madison, WI)to locate possible promoters and enhancer sites.
  • Codon phase refers to the codon in the 5' end of the exon.
  • ⁇ xon T is repetitive element UTR.
  • the hPEPTl gene structure shows several interesting features.
  • the start sites of the transcripts for hPEPTl and pH-regulatory factor are located in different exons ( Figure 6).
  • exon 1 located >20 kb upstream of exon 2 contains only the first 4 nucleotides of the hPEPTl coding region.
  • Alternative splicing occurs in exon 3, and 118 bases in the 5' end of exon 3 are spliced out of the mRNA of hPEPTl.
  • Another site for differential splicing is exon 7 of hPEPTl -RF. In this case, 41 bases in the 3' end of the exon are spliced out of hPEPTl hmRNA ( Figure 6).
  • Membrane topology predictions of hPEPTl and hPEPTl -RF proteins are shown in Figures 2 and 3.
  • the transmembrane topology schematics were rendered using TOPO (S.J. Johns and R.C. Speth, Transmembrane protein display software, http://www.sacs.ucsf.edu/TOPO/topo.html, unpublished data).
  • the figures show the peptide sequences that are encoded by each exon.
  • hPEPTl is predicted to have 12 transmembrane segments (TMSs).
  • TMSs transmembrane segments
  • the upstream region (2 kb) from the transcription start sites of hPEPTl is shown in Figure 4. TATA boxes were found about 520 bp upstream from the transcription start site in hPEPTl.
  • the putative regulatory region also contains GC boxes, so several GC boxes are located within 300 bp from the transcription site in hPEPTl. Binding sites for transcription factors did not include any amino acid responsive element. Some other transcription factor binding sites of the regulatory regions are illustrated in Figure 9.
  • the genomic structure of hPEPTl and hPEPTl-RF presented here is based on a sequence in the HTGS database.
  • the HTGS contains yet unordered pieces of genomic sequences.
  • Three introns of hPEPTl include such gaps (indicated by > signs in Table 5), while hPEPTl -RF exons are all located in one contig. Within the contigs the sequences are likely to be unaffected, and intron sizes are reliable
  • PEPT1-RF and PEPTI share 5 identical TMSs, while the extramembraneous terminals differ ( Figure 6, Figure 7, and Figure 8).
  • PEPT1-RF is not capable of transporting substrates across the membrane, but it is thought to sense pH changes and modulate the response of PEPTI to these changes (Saito et al. (1997) Biochem Biophys Res Commun. 237: 577-582).
  • Fei et al. (1998) Biochem Biophys Res Commun. 246: 39-44, have shown by using chimeric PEPT1- PEPT2 proteins that the TMSs 7-9 are important for substrate recognition by hPEPTl.
  • PEPT1-RF does not have these TMSs and does not transport substrates.
  • Insulin regulation was mediated by transporter translocation to the basolateral side of the cells upon release of hPEPTl from the translated intracellular pool to the plasma membrane. Changes in hPEPTl mRNA were not seen in that study. However, the putative insulin responsive element is located upstream from the transcription start site ( Figure 9), suggesting that insulin might be involved in the regulation of hPEPTl transcriptional activity.
  • the genomic organization of hPEPTl and hPEPTl- RF indicates that they are splice variants of the same gene ( Figure 6). Expression of hPEPTl -RF has not been studied in detail. Nevertheless, the splice variants may be expressed in different proportions depending on, for example, the stage of differentiation, hormonal regulation signals, and cell type.
  • Human PEPTI is expressed in several tissues (intestine, kidney, brain, liver) where the pH environment is quite different. Also, an intracellular pool of hPEPTl may be associated with peptide trafficking in lysosomes and endosomes that have different pH depending on the maturity of the vesicle (Gonzales et al. (1998) Cancer Res. 519-525).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Mathematical Physics (AREA)
  • Theoretical Computer Science (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention concerne le domaine des transporteurs oligopeptide et le transport de médicaments. La présente invention concerne en particulier la découverte de nouveaux transporteurs H+/oligopeptide et leur utilisation dans diverses applications d'administration de médicaments. L'invention concerne également des analyses permettant d'identifier des agents transportés par ces transporteurs découverts récemment et/ou d'identifier des modulateurs de l'expression de ces transporteurs.
PCT/US2001/004799 2000-02-14 2001-02-14 Nouveaux membres de la famille multigenique des transporteurs h+/oligopeptide WO2001060854A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2001238290A AU2001238290A1 (en) 2000-02-14 2001-02-14 Novel members of the h+/oligopeptide transporter gene family

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US18232800P 2000-02-14 2000-02-14
US60/182,328 2000-02-14
US78295901A 2001-02-13 2001-02-13
US09/782,959 2001-02-13

Publications (2)

Publication Number Publication Date
WO2001060854A1 true WO2001060854A1 (fr) 2001-08-23
WO2001060854A8 WO2001060854A8 (fr) 2001-11-29

Family

ID=26877992

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2001/004799 WO2001060854A1 (fr) 2000-02-14 2001-02-14 Nouveaux membres de la famille multigenique des transporteurs h+/oligopeptide

Country Status (1)

Country Link
WO (1) WO2001060854A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024913A2 (fr) * 2000-09-25 2002-03-28 Millennium Pharmaceuticals, Inc. 32612, un nouveau transporteur de peptides humain et utilisations de celui-ci

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066041A1 (fr) * 1998-06-16 1999-12-23 Human Genome Sciences, Inc. 94 proteines humaines secretees

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999066041A1 (fr) * 1998-06-16 1999-12-23 Human Genome Sciences, Inc. 94 proteines humaines secretees

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002024913A2 (fr) * 2000-09-25 2002-03-28 Millennium Pharmaceuticals, Inc. 32612, un nouveau transporteur de peptides humain et utilisations de celui-ci
WO2002024913A3 (fr) * 2000-09-25 2003-05-15 Millennium Pharm Inc 32612, un nouveau transporteur de peptides humain et utilisations de celui-ci

Also Published As

Publication number Publication date
WO2001060854A8 (fr) 2001-11-29

Similar Documents

Publication Publication Date Title
Chou et al. Tic40, a membrane‐anchored co‐chaperone homolog in the chloroplast protein translocon
Ham et al. A polypyrimidine tract binding protein, pumpkin RBP50, forms the basis of a phloem-mobile ribonucleoprotein complex
Gottschalk et al. Identification by mass spectrometry and functional analysis of novel proteins of the yeast [U4/U6· U5] tri‐snRNP
Colón-Carmona et al. Aux/IAA proteins are phosphorylated by phytochrome in vitro
Jaulin-Bastard et al. Interaction between Erbin and a Catenin-related protein in epithelial cells
Back et al. ER stress signaling by regulated splicing: IRE1/HAC1/XBP1
US7736853B2 (en) Methods of diagnosis of androgen-dependent prostate cancer, prostate cancer undergoing androgen withdrawal, and androgen-independent prostate cancer
Echard et al. Alternative splicing of the human Rab6A gene generates two close but functionally different isoforms
AU2010202722B2 (en) Juvenile hemochromatosis gene (HFE2A), expression products and uses thereof
US6096515A (en) NF-AT polynucleotides
Hendrickson et al. IC138 is a WD-repeat dynein intermediate chain required for light chain assembly and regulation of flagellar bending
Mingot et al. Ambient pH signaling regulates nuclear localization of the Aspergillus nidulans PacC transcription factor
Chambraud et al. FAP48, a new protein that forms specific complexes with both immunophilins FKBP59 and FKBP12: prevention by the immunosuppressant drugs FK506 and rapamycin
CA2459219A1 (fr) Procedes de diagnostic du cancer, compositions et procedes de criblage de modulateurs du cancer
US5523227A (en) DNA encoding calcium-signal modulating cyclophilin ligand
AU2008229749A1 (en) Novel compositions and methods for cancer
KR20080042162A (ko) 신장암 진단, 신장암 환자 예후 예측을 위한 조성물 및 방법
US5837514A (en) IκB kinases
Goehring et al. MyRIP anchors protein kinase A to the exocyst complex
Pu et al. The balance of RanBP1 and RCC1 is critical for nuclear assembly and nuclear transport
AU2009202600A1 (en) Novel compositions and methods for cancer
Geng et al. Saccharomyces cerevisiae Rab-GDI displacement factor ortholog Yip3p forms distinct complexes with the Ypt1 Rab GTPase and the reticulon Rtn1p
JP2003159059A (ja) 痛みに関連する分子の同定及び使用
Chirivi et al. Characterization of multiple transcripts and isoforms derived from the mouse protein tyrosine phosphatase gene Ptprr
Bonnet‐Corven et al. An analysis of the sequence requirements of EDEN‐BP for specific RNA binding

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
AK Designated states

Kind code of ref document: C1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

CFP Corrected version of a pamphlet front page
CR1 Correction of entry in section i

Free format text: PAT. BUL. 34/2001 UNDER (30) REPLACE "60/271758" BY "09/782959"

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP