WO2001055410A2

WO2001055410A2 - Ceramidase compositions and methods based thereon

Info

Publication number: WO2001055410A2
Application number: PCT/US2001/002866
Authority: WO
Inventors: Yusuf A. Hannun; Samer El Bawab
Original assignee: Musc Foundation For Research Development
Priority date: 2000-01-28
Filing date: 2001-01-29
Publication date: 2001-08-02
Also published as: WO2001055410A9; WO2001055410A3; AU2001233086A1

Abstract

The present invention relates to ceramidase genes, in particular to human mitochondrial ceramidase genes and their encoded protein products, as well as derivatives and analogs thereof. Production of ceramidase proteins, derivatives, and antibodies are also provided. The present invention relates to methods for treating and preventing hyperproliferative diseases, cardiovascular diseases and inflammation based on the regulation of the level of ceramide. In particular, the invention relates to the regulation of the level of ceramide by inhibiting ceramidase expression or activity. The invention encompasses ceramidase and related nucleic acids, host cell expression systems, mutant ceramidase proteins, ceramidase fusion proteins, ceramidase antibodies, ceramidase antisense nucleic acids, and other compounds that modulate gene expression or ceramidase activity that can be used for prevention and treatment of proliferative disorders, including but not limited to breast cancer; cardiovascular diseases and inflammation.

Description

CERAMIDASE COMPOSITIONS AND METHODS BASED THEREON

This application claims priority to the provisional application no.

60/178,975, filed January 28, 2000, which is incorporated herein by reference in its entirety.

1. INTRODUCTION

The present invention relates to ceramidase genes, in particular to human mitochondrial ceramidase genes, and their encoded protein products, as well as derivatives and analogs thereof. The invention further relates to compositions and methods of diagnosis and therapy for diseases associated with cell overproliferation and sphingolipid signal transduction. In particular, the invention relates to the regulation of the level of ceramide by inhibiting ceramidase expression or activity.

2. BACKGROUND 2.1 CERAMIDE Sphingolipid metabolites are now recognized as important components in signal transduction. Ceramide is one of these sphingolipid metabolites (Merrill, Jr., Nutr. Rev. 50:78 (1992), Kolesnick and Fuks, J. Exp. Med. 181 :1949 (1995), Chao, Mol. Cell.

Neurosci. 6:91 (1995), Liscovitch, Trends Biochem. Sci. 17:393 (1992). It has been shown to play a role in mediating, at least in part, the actions of these stimuli on cell differentiation, apoptosis, cell cycle arrest, and growth suppression. This is supported by the ability of exogenous analogs of ceramide to induce these biologic responses in the respective cell types (Hannun, 1994, J. Biol. Chem. 269:3125; Okazaki et al, 1990, J. Biol.

Chem. 265:15823; Bielawska et al, 1992, FEBS Lett. 307:211 ; Obeid et al, 1993, Science 259:1769; Laulederkind et al, 1995, J. Exp. Med. 182:599; Goldkorn et al, 1991. J. Biol. Chem. 266:16092; Perry and Hannun, 1998, Biochim. Biophys. Acta 1436:223-243; Mathias et al., 1998, Biochem. J. 335:465-480; and Dickson et al., 1999, Biochim. Biophys Acta. 1426:347-357). Furthermore, the action of a number of extracellular agents as well as stress stimuli, such as lα,25-dihydroxyvitamin D₃, tumor necrosis factor , interleukin- lβ, neurotrophins, the Fas ligand, dexamethasone. serum withdrawal, chemotherapeutic agents, and γ. -irradiation, can cause an elevation in the endogenous levels of ceramide (Hannun, J. Biol. Chem. 269:3125 (1994), Hannun and Obeid, Trends Biochem. Sci. 20:73 (1995), Ballou et al, J. Biol. Chem. 267:20044 (1992), Quintans et al, Biochem. Biophys. Res. Commun. 202:710 (1994), Dobrowsky et al, Science 265:1596 (1994), Yanaga and Watson, FEBS Lett. 314:297 (1992), Dressier and Kolesnick, Science 255:1715 (1992)). Indeed, ceramide occupies a central position in sphingolipid metabolism. Complex sphingolipids can be derived from ceramide through various enzymatic reactions that add various head groups to the 1-hydroxyl position (Hannun, J. Biol. Chem. 269:3125 (1994), Wiegandt in Glycolipids (Weigandt. ed) pp. 199-259, Elsevier, New York (1985), Merrill, Jr. and Jones, Biochim. Biophys. Acta 1044: 1 (1990), Van Echten and Sandhoff J. Biol. Chem. 268:53412 (1993), Hakomori, Annu. Rev. Biochem. 50:733 (1981)). The breakdown of these sphingolipids through sequential metabolic reactions also results in the formation of ceramide. In turn, ceramide can be degraded further through the action of ceramidases resulting in the formation of sphingosine and free fatty acids (Hannun, J. Biol. Chem. 269:3125 (1994), Spence et al, Biochem. Cell Biol. 64:400 (19867), Slife et al, J. Biol. Chem. 264:10371 (1989)). Several mechanisms are involved in the regulation of cellular ceramide levels, which include activation of sphingomyelinases, activation of the de novo synthetic pathway, and inhibition of ceramidases (CDase). Ceramidases hydro lyze ceramide to form sphingosine, which in turn can serve as a substrate for sphingosine kinase, resulting in the formation of sphingosinel -phosphate. Ample evidence suggests distinct functions for these sphingolipids (Hannun et al, 2000, Trends Cell. Biol. 10: 73-80.)

2.2 CERAMIDASE

Ceramidases (CDases) are enzymes that cleave the N-acyl linkage of ceramide into sphingosine (SPH) and free fatty acid, and recent studies suggest that CDase may exert important functions in the regulation of its substrate (Cer) or in the regulation of its immediate product (SPH) or the downstream metabolite sphingosine 1 -phosphate (SPP). Indeed, current understanding indicates that the major pathway for the formation of sphingosine is via the degradation of ceramide and not from the de novo pathway (Merill et al., 1992, Methods Enzymol. 209:427-437; Michel et al, 1997, J. Biol. Chem. 272:22432- 22437.) This suggests that CDases are the key enzymes to regulate levels of SPH. Two reports implicate an alkaline CDase activity in signal transduction. Using cell homogenate of rat glomerular mesangial cells, Coroneos et al. have shown that an alkaline CDase activity was stimulated by the platelet-derived growth factor and not by the inflammatory cytokines (tumor necrosis factor oc and interleukin-1) or the vasoconstrictor peptide endothelin-1 (Coroneos et al, 1995, J. Biol. Chem. 270: 23305-23309.) In another report, Nikolova-Karakashian et al. showed in primary cultures of rat hepatocytes that alkaline CDase activity is stimulated by low concentrations of interleukin-1 (Nikolova-Karakashian et al., 1997, J. Biol. Chem. 272: 18718-18724.) The activation of CDase in these cells resulted in the formation of SPH, and these authors suggested that SPH or SPP may mediate some of the effects of low concentrations of interleukin-1.

Three ceramidases have been described thus far that differ by their pH optima. An acid ceramidase was first described by Gatt in rat brain (Gatt, 1963, J. Biol. Chem. 238: 3131-3133). The enzyme has been purified and cloned from human urine and recently from mouse tissue (Koch et al., 1996, J. Biol. Chem. 271 :33110-33115; Li et al., 1998, Genomics 50: 267-274.) This enzyme is located in the lysosomes, and it plays a role in the catabolic pathway of ceramide, and the inherited deficiency of this enzyme causes Farber disease (Sugita et al., 1972, Science 178: 1100-1102.) A neutral activity has been described in liver plasma membranes and in rat intestinal brush border membranes; little is known about this enzyme (Slife et al, 1989, J. Biol. Chem. 264: 10371-10377; Nilsson et al., 1969, Biochim. Biophys. Acta 176: 339-347.) An alkaline activity was described in human cerebellum, fibroblasts, and in many rat tissues (Sugita et al., 1975, Biochim. Biophys. Acta 398: 125-131; Momoi et al., 1982, Biochem. J. 205: 419-425; Spence et al., 1985, Biochim. Cell Biol. 64: 400-404.) Alkaline CDases were best characterized in Guinea pig skin epidermis, where two enzymes were purified, one to apparent homogeneity and the other only partially (Yada et al., 1995, J. Biol. Chem. 270:12677-12684.) These two enzymes are membrane-bound, and their estimated molecular masses on SDS-PAGE were 60 and 148 ka, respectively. Recent studies are also beginning to suggest a role for ceramidases in regulating the net levels of ceramide in response to stimuli. For example, it has been shown in rat hepatocytes that interleukin 1 β at low concentration activates sphingomyelinases and ceramidases, resulting in the formation of sphingosine, whereas high concentrations of interleukin-1 β, stimulated only sphingomyelinases resulting in the accumulation of ceramide (Nikolova-Karakashian et al., 1997, J. Biol. Chem. 272: 18718-18724.) In rat renal mesangial cells, both tumor necrosis factor and nitric oxide donors have been shown to stimulate sphingomyelinases, but only nitric oxide donors inhibited ceramidases and resulted in an increase in ceramide levels and the consequent biological effects (Huwiler et al., 1999, J. Biol. Chem. 274: 7190-7195.) Also, in smooth muscle cells, oxidized low density lipoprotein has been shown to stimulate sphingomyelinases, ceramidases, and sphingosine kinase, leading to the production of sphingosine- 1 -phosphate, which these authors suggested promotes the proliferation of these cells (Auge et al., 1999, J. Biol. Chem. 274: 21533-21538.) Ceramidases have also been shown to be activated in response to platelet-derived growth factor in rat glomerular mesangial cells (Coroneos et al.,1995, J. Biol. Chem. 270: 23305-23309.) Despite the interest in the role of ceramidases in signal tranduction, to date, there has been a paucity of molecular tools to study the function of ceramide and to understand the significance of nonlysosomal enzymes of ceramide metabolism. The inventors of the present invention recently purified a rat brain membrane- bound ceramidase with a pH optimum in the neutral to alkaline range and used peptides obtained from the purified rat brain enzyme to clone the human isoform.

Citation of references hereinabove shall not be construed as an admission that such references are prior art to the present invention.

3. SUMMARY OF THE INVENTION The present invention is based upon the identification by the present inventors of a novel human mitochondrial ceramidase (Genbank accession no. NM019893). The human mitochondrial ceramidase hydrolyses ceramide to form sphingosine. Inhibition of ceramidase activity by a ceramide inhibitor, Urea-C16-ceramide, decrease survival and viability in a breast cancer cell line. Moreover, preliminary data show that there is a higher expression of the human mitochondrial ceramidase gene in lung cancer tissues as compared to normal tissues. Hence, a decreased level of the ceramidase inhibits cell proliferation, viability and survival. As such, the ceramidase gene product is involved in the mechanisms underlying the onset and development of diseases associated with cell overproliferation such as cancer and inflammation.

The present invention relates to nucleotide sequences of ceramidase genes, including, human ceramidase genes and homologs of other species, and amino acid sequences of their encoded proteins. Nucleic acids hybridizable to or complementary to the foregoing nucleotide sequences are also provided. The nucleotide sequences can be genomic DNA, cDNA or RNA. In the case of genomic DNA, the nucleotide sequence does not consist of the nucleotide sequence of Genbank sequence accesion no. AC 012131. Specifically, an isolated nucleic acid molecule comprising: (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2; (c) a ceramidase gene contained in plasmid Mito- CDase-TOPO/BII as deposited with the ATCC on January 25; or (d) the complement of the nucleotide sequence of (a), (b) or (c).

The invention also provides an isolated nucleic acid molecule comprising a nucleotide sequence that hybridizes to a nucleic acid probe consisting of: (a) the nucleotide sequence of nucleotide position 1 to 1702 or nucleotide position 2289 to 2583 of SEQ ID NO: 1 ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or amino acid position 750-761 of SEQ ID NO: 2;

(c) a ceramidase gene contained in plasmid Mito-CDase-TOPO/BII as deposited with the ATCC on January 25, 2001 ; or (d) the complement of the nucleotide sequence of (a), (b) or (c).

Specifically, the invention provides an isolated nucleic acid comprising a nucleotide sequence that consists of at least 8 consecutive nucleotides of: (a) the nucleotide sequence of nucleotide position 1 to 1702 or nucleotide position 2289 to 2583 of SEQ ID NO: 1; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or amino acid position 750 to 761 of SEQ ID NO: 2; (c) a ceramidase gene contained in plasmid Mito-CDase-TOPO/BII as deposited with the ATCC; or (d) the complement of the nucleotide sequence of (a), (b) or (c).

The invention also provides a nucleic acid probe consisting of at least 8 nucleotides, wherein the nucleic acid probe is hybridizable to at least a portion of: (a) the nucleotide sequence of nucleotide position 1 to 1702 or nucleotide position 2289 to 2583 of SEQ ID NO: 1 ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or 750 to 761 of SEQ ID NO: 2; (c) a ceramidase gene contained in plasmid Mito-CDase-TOPO/BII as deposited with the ATCC; or (d) the complement of the nucleotide sequence of (a), (b) or (c); (under moderately stringent conditions).

The invention also provides a nucleic acid comprising a nucleotide sequence encoding a fragment of a ceramidase protein that has an amino acid sequence as set forth in

SEQ ID NO: 2, wherein said fragment displays one or more functional activities of the ceramidase protein. The invention also provides a nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: 1; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to amino acid position 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b); wherein said fragment displays one or more functional activities of ceramidase protein.

The invention also provides a nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of SEQ ID NO: 1 ;

(b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b); wherein said nucleotide sequence of said deletion mutant comprises more than 791 nucleotides.

In another embodiment, the ceramidase protein is a human protein. The invention also relates to fragments (derivatives and analogs thereof) of ceramidase, which comprise one or more domains of a ceramidase protein.

Also encompassed are fragments (derivatives and analogs thereof) of ceramidase, which are functionally active, i.e., they are capable of displaying one or more known functional activities associated with a full-length (wild-type) ceramidase protein. Such functional activities include but are not limited to ceramidase activity, antigenicity

(i.e., ability to bind, or compete with ceramidase for binding, to an anti-ceramidase antibody), immunogenicity (i.e., ability to generate antibody which binds to ceramidase), and ability to bind, or compete with ceramidase for binding, to ceramidase.

The invention also provides an isolated polypeptide, the amino acid sequence of which comprises at least one region selected from the group consisting of residues 1 to

19, 38-66, 176-196, 313-333, 431-451, 505 to 525, and 543-563 of SEQ ID NO: 2.

The invention also provides an isolated polypeptide which is at least 60% identical to the ceramidase polypeptide having the amino acid sequence of SEQ ID NO:2, and displays one or more functional activities of ceramidase protein. The invention also provides a chimeric protein comprising a fragment of a ceramidase protein consisting of at least 6 amino acids fused via a covalent bond to an amino acid sequence of a second polypeptide. In a specific embodiment, the second polypeptide is a signal peptide which facilitate the secretion of the chimeric protein out of the cell. Such chimeric protein is particularly useful in the mass production of the chimeric protein since the protein can be harvested out of the cell, such as in a culture media. Antibodies, antisense nucleic acid, and ribozyme to ceramidase, and ceramidase derivatives and analogs, are additionally provided. Methods of production of the ceramidase proteins, derivatives and analogs, e.g., by recombinant means, are also provided.

The present invention also encompasses (a) DNA vectors that contain any of the foregoing ceramidase gene, antisense ceramidase gene, and modified ceramidase gene sequences encoding mutant and fusion ceramidase proteins; (b) DNA expression vectors that contain any of the foregoing ceramidase gene, antisense ceramidase gene, and modified ceramidase gene sequences encoding mutant and fusion ceramidase proteins operatively associated with a regulatory element that directs the transcription and/or expression of the foregoing ceramidase gene, antisense ceramidase gene, and modified ceramidase gene sequences encoding mutant and fusion ceramidase proteins; and (c) genetically engineered host cells that contain any of the foregoing DNA vectors or DNA expression vectors. The present invention provides compositions which include but are not limited to ceramidase proteins and analogs and derivatives (including fragments) thereof; antibodies, antisense nucleic acids, and ribozymes thereto; nucleic acids encoding the ceramdiase proteins, analogs, or derivatives. The compositions of the present invention additionally include cloning vectors, including expression vectors, containing the nucleic acid molecules of the invention, and hosts which contain such nucleic acid molecules.

The invention also provides methods for the diagnosis of hyperproliferative diseases, cardiovascular diseases and inflammation, using antibodies, antisense nucleic acids, and ribozymes thereto; nucleic acids encoding the ceramdiase proteins, analogs, or derivatives.

The invention provides methods for the prevention and/or treatment of hyperproliferative diseases, cardiovascular diseases and inflammation, using antibodies, antisense nucleic acids, and ribozymes thereto; nucleic acids encoding the ceramdiase proteins, analogs, or derivatives, to modulate the expression of ceramidase gene and/or the activity of ceramidase gene product.

Specifically, the invention provides for treatment of disorders of overproliferation (e.g., cancer and hyperproliferative disorders) by administering compounds that inhibit ceramidase activity (e.g., antibodies, antisense nucleic acids, and ribozymes thereto; nucleic acids encoding the ceramdiase proteins, analogs or derivatives; antagonist of ceramidase, particularly those that are active in decreasing cell survival and viability (e.g., as demonstrated in in vitro assays or in breast cancer cell line assays, or can be identified using in vitro assays, animal models, or cell culture assays). The invention also provides methods of treatment of disorders involving deficient cell proliferation or growth, or in which cell proliferation is otherwise desired (e.g., degenerative disorders, growth deficiencies, lesions, physical trauma) by administering compounds that promote ceramidase function (e.g., ceramidase, activator of ceramidase, nucleic acids that encode ceramidase). Activating ceramide function can also be done to grow larger animals and plants, e.g., those used as food or material sources.

The invention also provides a method of identifying a molecule that specifically binds to a ligand selected from the group consisting of a ceramidase protein, a fragment of a ceramidase protein comprising a domain of the protein, and a nucleic acid encoding the protein or fragment, comprising: (a) contacting said ligand with a plurality of molecules under conditions conducive to binding between said ligand and the molecules; and (b) identifying a molecule within said plurality that specifically binds to said ligand.

The invention also provides a method for identifying compounds that modulate ceramidase gene expression, comprising: (a) contacting a test compound with a cell or cell lysate containing a reporter gene operatively associated with a ceramidase gene regulatory element; and (b) detecting expression of the reporter gene product.

The invention also provides a method for identifying compounds that modulate ceramidase gene expression comprising: (a) contacting a test compound with a cell or cell lysate containing an expressible ceramidase gene construct; and (b) detecting the transcription and/or translation of the ceramidase gene. The invention also provides a method for identifying compounds that modulate the activity of ceramidase gene product or homolog of ceramidase gene product comprising: (a) contacting a test compound with an organism or a cell containing ceramidase gene product or homolog of ceramdiase; and (b) comparing the phenotype of the organism or cell with the phenotype of organism or cell that did not contact the test compound, wherein a change in phenotype indicates that the test compound is capable of modulating the activity of ceramidase gene product or homolog of ceramdiase gene product. 4. BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Illustration of the pathways in sphingolipid metabolism.

Figure 2. The role of ceramide in cell-cycle arrest and apoptosis induced by tumor necrosis factor (TNF ). Figure 3. cDNA and deduced amino acid sequences of human ceramidase. The first and second columns indicate the nucleotide (i.e., SEQ ID NO.T) and the deduced amino acid sequences (i.e., SEQ ID NO:2), respectively. Nucleotide and amino acid positions are shown on the right. Position amino acid 1 refers to the first nucleotide and amino acid of the ceramidase-predicted coding region. Amino acid sequences determined by Edman sequencing of the purified rat brain enzyme are underlined. The putative signal peptide

(double underline), myristoylation site (boxed), low complexity signal ( ), and transmembrane domain ( ) are also shown.

Figure 4. Sequence comparison of human ceramidase to putative ceramidase from .4. thaliana, M. tuberculosis, and D. discoideum. Identical amino acids in all four proteins are shaded. Boxed areas indicate gaps introduced to optimize the alignment. Alignment was performed using the Mac Vector, Multiple sequence Alignment program. Figure 5. Northern blot analysis of poly(AV^" RNAs from human tissues. The labeled 3' -end of human ceramidase was used to probe a human multiple tissue Northern blot; each lane contained 2μg of poly(A)⁺ RNA. Size markers are indicated on the right. The major ceramidase band corresponds to a size of 3.5kb.

Figure 6. Overexpression and characterization of ceramidase. Figure 6A. HEK293 and MCF7 cells were transfected with vector alone (pcDNA3.1/HisC) or vector containing ceramidase cDNA (pcDNA3.1/HisC-CDase). 48 hours after transfection, ceramidase activity was measured as described in material and methods. Data are the mean of three experiments. Figure 6B. Cells transfected with empty vector (pEGFPC3, control) or vector containing ceramidase (pEGFPC3 -CDase, overexpression) were lysed, and ceramidase activity was measured on cell lysates. A fraction of the overexpressing cell lysate was also immunoprecipitated with anti-GFP antibody or with normal rabbit IgG as a control. Immune complexes were precipitated by the addition of a mixture protein A/protein G agarose. Ceramidase activity was measured on lysates and immunoprecipitant (IP). The inset shows a Western blot using GFP antibody of control and overexpressing cells. Ab, antibody. Figure 6C and D. The activity of ceramidase was measured in cells transfected with pcDNA3.1/HisC-CDase vector. Figure 6C. The pH was adjusted by the addition of the following buffers at a final concentration of lOOmM: acetate (pH 4 and 5), phosphate (pH 6 and 6.5), Hepes (pH 7-8), glycine (pH 9-10.5). Figure 6D. Cations and EDTA were used at lOmM, and dithiothreitol (DTT) was used at 20mM. Figure 7. Activity of ceramidase at different pHs. Figure 8. Localization of ceramidase. Cells were transfected with lμg of pEGFPC3 empty vector (results not shown) or pEGFPC3-CDase vector containing ceramidase. After 48 hours, they were stained with specific mictochondrial probes, washed, and then fixed before microscopy observation. Figure 8A. Cells were stained with Mitotracker Red and visualized by fluorescence microscopy. Figure 8B. Cells were stained with TMRM and visualized by confocal microscopy.

Figure 9A. Effect of Urea-C₁₆-Ceramide on ceramidase activity using rat brain purified enzyme. A graph expressed as ceramidase activity measured in % of control ceramidase activity vs. concentration of Urea-C_I6-ceramide. Ceramidase was purified from rat brain as described in Material and Methods. The effect of Urea-C₁₆-ceramide was tested for inhibition using the purifed enzyme (5-10ng of protein in the assay) and [³H]-C₁₆-ceramide as substrate in a mixed micelles system as described in Material and Methods. Figure 9B. Effect of Urea-C₁₆-Ceramide on MCF7 cell viability (as measured by MTT assay). A graph expressed as cell viability measured in % of control cells vs. concentration of Urea-C_I6- ceramide. Cells were seeded in 100mm dishes. The next day, cells were treated with Urea- C₁₆-ceramide at the indicated concentration for 18 hours. Urea-C₁₆-ceramide was delivered in a solution of ethanol containing 2% dodecane. After 18 hours, cell viability was assayed using the MTT assay.

5. DETAILED DESCRIPTION OF THE INVENTION 5.1. THE CERAMIDASE GENES

The present invention relates to nucleotide sequences of ceramidase genes, and amino acid sequences of their encoded proteins. The invention further relates to fragments and other derivatives, and analogs, of ceramidase proteins. Nucleic acids encoding such fragments or derivatives are also within the scope of the invention. The invention encompasses genes encoding human, and rat ceramidase and related genes

(homologs) in other species. The inventors of the present invention have recently purified a rat brain membrane-bound nonlysosomal ceramidase (El Bawab et al. 1999, J. Biol. Chem. 274, 27948-27955). Using peptide sequences obtained from the purified rat brain enzyme, the inventors successfully cloned the human isoform.

In one embodiment, the invention provides the nucleotide sequences of ceramidase gene which comprise the cDNA sequences of SEQ ID NO: l (Figure 3), or nucleotide sequences encoding a ceramidase protein (e.g., a protein having the amino acid sequence of SEQ ID NO:2) (Figure 3). The human ceramidase protein (or ceramidase gene product) as depicted in Figure 3 comprises 763 amino acids and has a molecular weight of 84 KDa. Northern blot analysis of multiple human tissues showed the presence of a major band corresponding to a size of 3.5 kilobase. Analysis of this major band on the blot indicated that the ceramidase protein is ubiquitously expressed but with higher levels in kidney, skeletal muscle, and heart. The deduced amino acid sequence of the protein did not show any similarity with proteins of known function but was homologous to three putative proteins from Arabidospis thaliana, Mycobacterium tuberculosis, and Dictyostelium discoideum. The ceramidase genes of Arabidospis thaliana (accession no. AAD32770), Mycobacterium tuberculosis (accession No. CAB09388), Dictyostelium discoideum

(accession no. 2367392), and putative slug protein (accession no. 2367392) are not within the scope of the present invention. In specific embodiments, the ceramidase genes and proteins are from vertebrates, or more particularly, mammals. In a preferred embodiment of the invention, the ceramidase gene and protein are of human origin. In another embodiment, the ceramidase gene and protein are of rat origin. Production of the foregoing proteins and derivatives, e.g., by recombinant methods, is provided.

As used herein, "ceramidase gene" refers to (a) a nucleic acid molecule comprising the DNA sequence of SEQ ID No. 1 as shown in Figure 3; (b) any nucleic acid molecule consisting essentially of a DNA sequence that encodes the amino acid sequence of SEQ ID No. 2 as shown in Figure 3, or (c) a nucleic acid molecule that hybridizes to another nucleic acid consisting of the DNA sequences that encode the amino acid sequence of SEQ ID No. 2 as shown in Figure 3 or the complement thereof, under medium stringent conditions and encodes a naturally occurring ceramidase protein. The ceramidase gene can be cDNA, genomic DNA, or RNA. The term "ceramidase gene" also includes naturally occurring variants including allelic variants of ceramidase, and degenerate variants of DNA sequences of (a) through (c) as described above. A ceramidase gene sequence preferably exhibits at least about 60-80% overall similarity at the nucleotide level to the nucleic acid sequence of SEQ ID NO:l, more preferably exhibits at least about 85-90% overall similarity to the nucleic acid sequence of SEQ ID NO: 1 and most preferably exhibits at least about 95% overall similarity to the nucleic acid sequence of SEQ ID NO:l. Ceramidase genes that are less than 60%) overall similar at the nucleotide level to the nucleic acid sequence of SEQ ID NO: 1 are least preferred. The degree of similarity can be determined by analyzing sequence data using a computer algorithm, such as those used by the BLAST computer program. The ceramidase gene may be a segment of the cDNA molecule, or a genomic DNA molecule that comprises one or more intervening sequences or introns. as well as regulating regions located beyond the 5' and 3' ends of the coding region or within an intron. Human EST sequence (accession no. AA913512) and human genomic sequence (accession no. 2367392) are not within the scope of the present invention.

Specific embodiments for the cloning of a ceramidase gene, presented as a particular example but not by way of limitation, follows:

Any eukaryotic cell potentially can serve as the nucleic acid source for the molecular cloning of the ceramidase gene. The nucleic acid sequences encoding ceramidase can be isolated from vertebrate, mammalian, human, porcine, bovine, feline, avian, equine, canine, as well as additional primate sources, insects, plants, etc. The DNA may be obtained by standard procedures known in the art from cloned DNA (e.g., a DNA "library"), by chemical synthesis, by cDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purified from the desired cell. (See, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; Glover. D.M. (ed.), 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford, U.K. Vol. I, II.) Clones derived from genomic DNA may contain regulatory and intron DNA regions in addition to coding regions; clones derived from cDNA will contain only exon sequences. Whatever the source, the gene should be molecularly cloned into a suitable vector for propagation of the gene.

In the molecular cloning of a ceramidase gene from genomic DNA, DNA fragments are generated and cloned to form a genomic library. Since some of the sequences encoding related ceramidases are available and can be purified and labeled, the cloned DNA fragments in the genomic DNA library may be screened by nucleic acid hybridization to the labeled probe (Benton, W. and Davis, R., 1977, Science 196:180; Grunstein, M. And Hogness, D., 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments with substantial homology to the probe will hybridize. It is also possible to identify the appropriate fragment by restriction enzyme digestion(s) and comparison of fragment sizes with those expected according to a known restriction map if such is available.

Alternatives to isolating the ceramidase genomic DNA include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence or making cDNA to the niRNA which encodes the ceramidase. For example, RNA for cDNA cloning of the ceramidase gene can be isolated from cells which express the ceramidase. A cDNA library may be generated by methods known in the art and screened by methods, such as those disclosed for screening a genomic DNA library. If an antibody to the ceramidase is available, the ceramidase may be identified by binding of labeled antibody to the putatively ceramidase synthesizing clones.

In the molecular cloning of the gene from genomic DNA, DNA fragments are generated, some of which will encode the desired gene. The DNA may be cleaved at specific sites using various restriction enzymes. Alternatively, one may use DNAse in the presence of manganese to fragment the DNA, or the DNA can be physically sheared, as for example, by sonication. The linear DNA fragments can then be separated according to size by standard techniques, including but not limited to, agarose and polyacrylamide gel electrophoresis and column chromatography.

Once the DNA fragments are generated, identification of the specific DNA fragment containing the desired gene may be accomplished in a number of ways. For example, if an amount of a portion of a ceramidase (of any species) gene or its specific

RNA, or a fragment thereof (see Section 5.1), is available and can be purified and labeled, the generated DNA fragments may be screened by nucleic acid hybridization to the labeled probe (Benton, W. and Davis, R., 1977, Science 196:180; Grunstein, M. And Hogness, D., 1975, Proc. Natl. Acad. Sci. U.S.A. 72:3961). Those DNA fragments with substantial homology to the probe will hybridize. It is also possible to identify the appropriate fragment by restriction enzyme digestion(s) and comparison of fragment sizes with those expected according to a known restriction map if such is available. Further selection can be carried out on the basis of the properties of the gene. Alternatively, the presence of the gene may be detected by assays based on the physical, chemical, or immunological properties of its expressed product. For example, cDNA clones, or DNA clones which hybrid-select the proper mRNAs, can be selected which produce a protein that, e.g., has similar or identical electrophoretic migration, isolectric focusing behavior, proteolytic digestion maps, kinase activity, inhibition of cell proliferation activity, substrate binding activity, or antigenic properties as known for ceramidase If an antibody to ceramidase is available, the ceramidase protein may be identified by binding of labeled antibody to the putatively ceramidase synthesizing clones, in an ELISA (enzyme-linked immunosorbent assay)-type procedure The ceramidase gene can also be identified by mRNA selection by nucleic acid hybridization followed by in vitro translation In this procedure, fragments are used to isolate complementary mRNAs by hybridization Such DNA fragments may represent available, purified ceramidase DNA of another species (e g human and rat) Immunoprecipitation analysis or functional assays (see Section 6 1) of the in vitro translation products of the isolated products of the isolated mRNAs identifies the mRNA and, therefore, the complementary DNA fragments that contain the desired sequences In addition, specific mRNAs may be selected by adsorption of polysomes isolated from cells to immobilized antibodies specifically directed against ceramidase protein A radiolabelled ceramidase cDNA can be synthesized using the selected mRNA (from the adsorbed polysomes) as a template The radiolabelled mRNA or cDNA may then be used as a probe to identify the ceramidase DNA fragments from among other genomic DNA fragments

Accordingly, the one embodiment of the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that hybπdizes to a nucleic acid probe consisting of (a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO 1 , (b) a nucleotide sequence that encodes a polypeptide having the ammo acid sequence of ammo acid position 1 to 554 or ammo acid position 750 to 761 of SEQ ID NO 2, or (c) the complement of the nucleotide sequence of (a), or (b)

Alternatives to isolating the ceramidase genomic DNA include, but are not limited to, chemically synthesizing the gene sequence itself from a known sequence or making cDNA to the mRNA which encodes the ceramidase protein For example, RNA for cDNA cloning of the ceramidase gene can be isolated from cells which express ceramidase Other methods are possible and within the scope of the invention

For expression cloning (a technique commonly known m the art), an expression library is constructed by methods known in the art For example, mRNA (e g , human) is isolated, cDNA is made and hgated into an expression vector (e g , a bacteπophage deπvative) such that it is capable of being expressed by the host cell into which it is then introduced Vaπous screening assays can then be used to select for the expressed ceramidase product. In one embodiment, anti-ceramidase antibodies can be used for selection.

In another embodiment, polymerase chain reaction (PCR) is used to amplify the desired sequence in a genomic or cDNA library, prior to selection. Oligonucleotide primers representing known ceramidase sequences can be used as primers in PCR. In a preferred aspect, the oligonucleotide primers represent at least part of the ceramidase conserved segments of strong homology between ceramidase of different species (e.g., transmembrane domains, putative transmembrane domains, signal peptide and low compositional complexity region. The synthetic oligonucleotides may be utilized as primers to amplify by PCR sequences from a source (RNA or DNA), preferably a cDNA library, of potential interest. PCR can be carried out, e.g., by use of a Perkin-Elmer Cetus thermal cycler and Taq polymerase (Gene Amp^™). The DNA being amplified can include mRNA or cDNA or genomic DNA from any eukaryotic species. One can choose to synthesize several different degenerate primers, for use in the PCR reactions. It is also possible to vary the stringency of hybridization conditions used in priming the PCR reactions, to allow for greater or lesser degrees of nucleotide sequence similarity between the known ceramidase nucleotide sequence and the nucleic acid homolog being isolated. For cross species hybridization, low stringency conditions are preferred. For same species hybridization, moderately stringent conditions are preferred. After successful amplification of a segment of a ceramidase homolog, that segment may be molecularly cloned and sequenced, and utilized as a probe to isolate a complete cDNA or genomic clone. This, in turn, will permit the determination of the gene's complete nucleotide sequence, the analysis of its expression, and the production of its protein product for functional analysis, as described infra. In this fashion, additional genes encoding ceramidase proteins and ceramidase analogs may be identified.

The above -methods are not meant to limit the following general description of methods by which clones of ceramidase may be obtained.

The identified and isolated gene can then be inserted into an appropriate cloning vector. A large number of vector-host systems known in the art may be used. Possible vectors include, but are not limited to, plasmids or modified viruses, but the vector system must be compatible with the host cell used. Such vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as pBR322 or pUC plasmid derivatives or the Bluescript vector (Stratagene). The insertion into a cloning vector can, for example, be accomplished by ligatmg the DNA fragment into a cloning vector which has complementary cohesive termini However, if the complementary restπction sites used to fragment the DNA are not present in the cloning vector, the ends of the DNA molecules may be enzymatically modified Alternatively, any site desired may be produced by ligatmg nucleotide sequences (linkers) onto the DNA termini, these hgated linkers may compπse specific chemically synthesized oligonucleotides encoding restπction endonuclease recognition sequences In an alternative method, the cleaved vector and ceramidase gene may be modified by homopolymeπc tailing Recombinant molecules can be introduced into host cells via transformation, transfection, infection, electroporation, etc , so that many copies of the gene sequence are generated

In an alternative method, the desired gene may be identified and isolated after insertion into a suitable cloning vector m a "shot gun" approach Enπchment for the desired gene, for example, by size fractionization, can be done before insertion into the cloning vector In specific embodiments, transformation of host cells with recombinant DNA molecules that incorporate the isolated ceramidase gene, cDNA, or synthesized DNA sequence enables generation of multiple copies of the gene Thus, the gene may be obtained in large quantities by growing transformants, isolating the recombinant DNA molecules from the transformants and, when necessary, retπevmg the inserted gene from the isolated recombinant DNA

In another embodiment, the invention provides nucleic acids consisting of at least 8 nucleotides (i e , a hybπdizable portion) of a ceramidase gene sequence, in other embodiments, the nucleic acids consist of at least 25 (consecutive) nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides of a ceramidase gene sequence, or a full-length ceramidase coding sequence In another embodiment, the nucleic acids are smaller than 35, 200 or 500 nucleotides in length Such nucleic acids can be single or double stranded The invention also relates to nucleic acids hybπdizable to or complementary to the foregoing nucleotide sequences In specific aspects, nucleic acids are provided which compπse a nucleotide sequence complementary to at least 8, 10, 25, 50, 100, or 200 nucleotides or the entire coding region of a ceramidase gene

Preferably, the isolated nucleic acid of the present invention compnses a nucleotide sequence that consists of at least 8 consecutive nucleotides of (a) the nucleotide sequence of nucleotide position 1 to 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: 1 ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to amino acid position 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b). The present invention further provides a nucleic acid molecule, such as a probe or an oligonucleotide consisting of at least 8 nucleotides, wherein the nucleic acid molecule is hybridizable to at least a portion of: (a) the nucleotide sequence of nucleotide position 1 to 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: 1 ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to amino acid position 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a) or (b).

In a specific embodiment, a nucleic acid which is hybridizable to a ceramidase gene nucleic acid, or to a nucleic acid encoding a ceramidase derivative, under conditions of low stringency is provided. By way of example and not limitation, procedures using such conditions of low stringency are as follows (see also Shilo and Weinberg, 1981, Proc. Natl. Acad. Sci. USA 78:6789-6792): Filters containing DNA are pretreated for 6 h at 40°C in a solution containing 35% formamide, 5X SSC, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.1% PVP, 0.1% Ficoll, 1% BSA, and 500 μg/ml denatured salmon sperm DNA. Hybridizations are carried out in the same solution with the following modifications: 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 100 μg/ml salmon sperm DNA, 10% (wt/vol) dextran sulfate, and 5-20 X IO⁶ cpm ³²P-labeled probe is used. Filters are incubated in hybridization mixture for 18-20 h at 40 °C, and then washed for 1.5 h at 55 °C in a solution containing 2X SSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% SDS. The wash solution is replaced with fresh solution and incubated an additional 1.5 h at 60° C. Filters are blotted dry and exposed for autoradiography. If necessary, filters are washed for a third time at 65-68 °C and reexposed to film. Other conditions of low stringency which may be used are well known in the art (e.g., as employed for cross-species hybridizations).

In another specific embodiment, a nucleic acid which is hybridizable to a ceramidase gene under conditions of high stringency is provided. By way of example and not limitation, procedures using such conditions of high stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 h to overnight at 65 °C in buffer composed of 6X SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02%) BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65 °C in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20 X IO⁶ cpm of ²P-labeled probe. Washing of filters is done at 37 °C for 1 h in a solution containing 2X SSC, 0.01% PVP. 0.01% Ficoll, and 0.01% BSA. This is followed by a wash in 0.1X SSC at 50°C for 45 min before autoradiography. Other conditions of high stringency which may be used are well known in the art. For example, using a probe of around 500 base pair, the filters may be prehybridzed in 5ml of ExpressHyb (commercially available from Clonetech) solution at 68 °C overnight. The filters may be hybridized in 5-10 ml of the ExpresHyb solution at 68 °C overnight. The filters may be washed at room temperature and then followed by another wash at 65 °C for one hour.

In another specific embodiment, a nucleic acid, which is hybridizable to a ceramidase gene under conditions of moderate stringency is provided. By way of example and not limitation, procedures using such conditions of medium stringency are as follows: Prehybridization of filters containing DNA is carried out for 8 h to overnight at 55 °C, overnight in buffer 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml salmon sperm DNA. Filters are hybridized for 48 h at 55 °C in prehybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20 X 10⁶ cpm of ³²P-labeled probe. This is followed by washing twice in lxSSC 0.1%SDS at 60°C, for 30 min. before autoradiography. Other conditions of moderate stringency which may be used are well known in the art. For example, using a probe of around 500 base pair, the filters may be prehybridzed in 5ml of ExpressHyb (commercially available from Clonetech) solution at 60°C overnight. The filters may be hybridized in 5-10 ml of the ExpresHyb solution at 60 °C overnight. The filters may be washed at room temperature and then followed by another wash at 55 °C for one hour. Nucleic acids encoding fragments, derivatives and analogs of ceramidase proteins, and ceramidase antisense nucleic acids (see Section 5.5) are additionally provided. As is readily apparent, as used herein, a "nucleic acid encoding a fragment or portion of a ceramidase protein" shall be construed as referring to a nucleic acid encoding only the recited fragment or portion of the ceramidase protein and not the other contiguous portions of the ceramidase protein as a continuous sequence.

Fragments of ceramidase nucleic acids comprising functional domains, and regions conserved between (with homology to) other ceramidase nucleic acids, of the same or different species, are also provided. The ceramidase genes of Arabidospis thaliana (accession no. AAD32770), Mycobacterium tuberculosis (accession No. CAB09388), Dictyostelium discoideum (accession no. 2367392), and putative slug protein (accession no. 2367392) are not within the scope of the present invention. Nucleic acids encoding one or more ceramidase domains such as those described in Section 5.3 and in Table 1 are provided.

The present invention further provides nucleic acid molecules encoding deletion mutants of the ceramidase gene. In particular, the invention provides a nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: 1; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to amino acid position 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b); wherein said fragment displays one or more functional activities of ceramidase protein. The present invention also provides a nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of SEQ ID NO: 1; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b); wherein said nucleotide sequence of said deletion mutant comprises more than 791 nucleotides.

The cloned DNA or cDNA corresponding to the ceramidase gene can be analyzed by methods including but not limited to Southern hybridization (Southern, E.M., 1975, J. Mol. Biol. 98:503-517), Northern hybridization (see e.g., Freeman et al., 1983, Proc. Natl. Acad. Sci. U.S.A. 80:4094-4098), restriction endonuclease mapping (Maniatis, T., 1982, Molecular Cloning, A Laboratory, Cold Spring Harbor, New York), and DNA sequence analysis. Polymerase chain reaction (PCR; U.S. Patent Nos. 4,683,202, 4,683,195 and 4,889.818; Gyllenstein et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7652-7656; Ochman et al, 1988, Genetics 120:621-623; Loh et al., 1989, Science 243:217-220) followed by Southern hybridization with a ceramidase-specific probe can allow the detection of the ceramidase gene in DNA from various cell types. Methods of amplification other than PCR are commonly known and can also be employed. In one embodiment, Southern hybridization can be used to determine the genetic linkage of ceramidase. Northern hybridization analysis can be used to determine the expression of the ceramidase gene as described in Section 6.1. Various organelles, cell types, at various states of development or activity can be tested for ceramidase expression. The stringency of the hybridization conditions for both Southern and Northern hybridization can be manipulated to ensure detection of nucleic acids with the desired degree of relatedness to the specific ceramidase probe used. Modifications of these methods and other methods commonly known in the art can be used.

Restriction endonuclease mapping can be used to roughly determine the genetic structure of the ceramidase gene. Restriction maps derived by restriction endonuclease cleavage can be confirmed by DNA sequence analysis. DNA sequence analysis can be performed by any techniques known in the art, including but not limited to the method of Maxam and Gilbert (1980, Meth. Enzymol. 65:499-560), the Sanger dideoxy method (Sanger, F., et al., 1977, Proc. Natl. Acad. Sci. U.S.A. 74:5463), the use of T7 DNA polymerase (Tabor and Richardson, U.S. Patent No. 4,795,699), or use of an automated DNA sequenator (e.g., Applied Biosystems, Foster City, CA).

5.2. EXPRESSION OF THE CERAMIDASE GENES

Described herein are systems of vectors and host cells that can be used for the expression of ceramidase. The ceramidase cDNA of the invention was overexpressed in HEK 293 cells and MCF7 cells. Examples of vectors and host cells that were used in these studies are described in Section 6. The nucleotide sequence coding for a ceramidase protein or a functionally active analog or fragment or other derivative thereof, can be inserted into an appropriate expression vector, i.e., a vector which contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. A variety of expression vectors may be used in the present invention which include, but are not limited to, plasmids, cosmids, phage, phagemids, or modified viruses. Typically, such expression vectors also comprise a functional origin of replication for propagation of the vector in an appropriate host cell, one or more restriction endonuclease sites for insertion of the ceramidase gene sequence, and one or more selection markers. The necessary transcriptional and translational signals can also be supplied by the native ceramidase gene and/or its flanking regions. A variety of host-vector systems including but are not limited to mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, etc.); insect cell systems infected with virus (e.g., baculovirus); microorganisms such as yeast containing yeast vectors, or bacteria transformed with bacteriophage, DNA, plasmid DNA, or cosmid DNA, can be used. The expression elements of vectors vary in their strengths and specificities. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. In specific embodiments, the human ceramidase gene is expressed, or a sequence encoding a functionally active portion of human ceramidase is expressed. In yet another embodiment, a fragment of ceramidase comprising a domain of the ceramidase protein is expressed.

Any method for the insertion of DNA fragments into a vector may be used to construct expression vectors containing a ceramidase gene consisting of appropriate transcriptional/translational control signals and the protein coding sequences. These methods may include in vitro recombinant DNA and synthetic techniques and in vivo recombinants (genetic recombination). Expression of nucleic acid sequence encoding a ceramidase protein or peptide fragment may be regulated by a second nucleic acid sequence so that the ceramidase protein or peptide is expressed in a host transformed with the recombinant DNA molecule. For example, expression of a ceramidase protein may be controlled by any promoter/enhancer element known in the art. Vectors based on E. coli are the most popular and versatile systems for high level expression of foreign proteins (Makrides, 1996, Microbiol Rev, 60:512-538). Non-limiting examples of regulatory regions that can be used for expression in E. coli may include but not limited to lac, trp, lpp, phoA, recA, tac, T3, T7 and λP_L (Makrides, 1996, Microbiol Rev, 60:512-538). Non-limiting examples of prokaryotic expression vectors may include the λgt vector series such as λgtl 1 (Huynh et al., 1984 in "DNA Cloning Techniques", Vol. I: A Practical Approach (D. Glover, ed.), pp. 49-78, IRL Press, Oxford), and the pET vector series (Studier et al., 1990, Methods Enzymol, 185:60-89). However, a potential drawback of a prokaryotic host-vector system is the inability to perform many of the post-translational processing of mammalian cells. Thus, an eukaryotic host-vector system is preferred, a mammalian host-vector system is more preferred, and a human host-vector system is the most preferred.

Promoters which may be used to control ceramidase expression include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus

(Yamamoto, et al, 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al, 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al, 1982, Nature 296:39-42); prokaryotic expression vectors such as the β-lactamase promoter (Villa-Kamaroffi et al, 1978, Proc. Natl. Acad. Sci. U.S.A. 75:3727-3731), or the tac promoter (DeBoer, et al, 1983, Proc. Natl. Acad. Sci. U.S.A. 80:21-25); see also "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; plant expression vectors comprising the nopaline synthetase promoter region (Heπera-Estrella et al, Nature 303:209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner, et al, 1981, Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Heπera-Estrella et al, 1984, Nature 310:115-120); promoter elements from yeast or other fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, alkaline phosphatase promoter, and the following animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals: elastase I gene control region which is active in pancreatic acinar cells (Swift et al, 1984, Cell 38:639-646; Omitz et al, 1986, Cold Spring Harbor Symp. Quant. Biol. 50:399-409; MacDonald, 1987, Hepatology 7:425-515); insulin gene control region which is active in pancreatic beta cells (Hanahan, 1985, Nature 315:115-122), immunoglobulin gene control region which is active in lymphoid cells (Grosschedl et al, 1984, Cell 38:647-658; Adames et al, 1985, Nature 318:533-538; Alexander et al, 1987, Mol. Cell Biol 7:1436-1444), mouse mammary tumor virus control region which is active in testicular, breast, lymphoid and mast cells (Leder et al, 1986, Cell 45:485-495), albumin gene control region which is active in liver (Pinkert et al, 1987, Genes and Devel 1:268-276), alpha- fetoprotein gene control region which is active in liver (Krumlauf et al, 1985, Mol. Cell. Biol. 5:1639-1648; Hammer et al, 1987, Science 235:53-58; alpha 1-antitrypsin gene control region which is active in the liver (Kelsey et al, 1987, Genes and Devel. 1:161-171), beta-globin gene control region which is active in myeloid cells (Mogram et al, 1985, Nature 315:338-340; Kollias et al, 1986, Cell 46:89-94; myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (Readhead et al, 1987, Cell 48:703-712); myosin light chain-2 gene control region which is active in skeletal muscle (Sani, 1985, Nature 314:283- 286), and gonadotropic releasing hormone gene control region which is active in the hypothalamus (Mason et al, 1986, Science 234:1372-1378). In a specific embodiment, a vector is used that comprises a promoter operably linked to a ceramidase-encoding nucleic acid, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene). Expression vectors containing ceramidase gene inserts can be identified by three general approaches: (a) nucleic acid hybridization, (b) presence or absence of "marker" gene functions, and (c) expression of inserted sequences. In the first approach, the presence of a ceramidase gene inserted in an expression vector can be detected by nucleic acid hybridization using probes comprising sequences that are homologous to an inserted ceramidase gene. In the second approach, the recombinant vector/host system can be identified and selected based upon the presence or absence of certain "marker" gene functions (e.g., thymidine kinase activity, resistance to antibiotics, transformation phenotype, occlusion body formation in baculovirus, etc.) caused by the insertion of a ceramidase gene in the vector. For example, if the ceramidase gene is inserted within the marker gene sequence of the vector, recombinants containing the ceramidase insert can be identified by the absence of the marker gene function. In the third approach, recombinant expression vectors can be identified by assaying the ceramidase product expressed by the recombinant. Such assays can be based, for example, on the physical or functional properties of the ceramidase protein in in vitro assay systems, e.g., enzyme activity, binding with anti-ceramidase antibody.

In one aspect, expression constructs and vectors are introduced into host cells for the purpose of producing the ceramidase. Any cell type that can produce mammalian proteins and is compatible with the expression vector may be used, including those that have been cultured in vitro or genetically engineered. Host cells may be obtained from normal or affected subjects, including healthy humans, cancer patients, and patients infected with a virus, private laboratory deposits, public culture collections such as the American Type Culture Collection, or from commercial suppliers.

In another aspect, expression constructs are introduced into cancer cells for the purpose of gene therapy (see Section 5.8). Cells into which a ceramidase gene sequence can be introduced for purposes of production of the ceramidase in vivo may include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T lymphocytes, B lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc. For instance, the lentiviral vector was used for transduction of quiescent, primitive human hematopoietic progenitor cells and may provide therapeutically useful levels of gene transfer into human hematopoietic stem cells (Case et al, 1999, Proc. Natl. Acad. Sci. USA 96: p.2988-2993). The choice of cell type depends on the type of tumor being treated or prevented, and can be determined by one of skill in the art. In a particular embodiment, an expression construct comprising a ceramidase gene sequence is introduced into a preneoplastic or neoplastic cell. Different host cells have characteristic and specific mechanisms for the post- translational processing and modification of proteins. A host cell may be chosen which modifies and processes the expressed gene products in a specific fashion similar to the way the recipient processes its ceramidase. For the purpose of producing large amounts of ceramidase or a modified ceramidase for adminstration to a subject, it is preferable that the type of host cell used in the present invention has been used for expression of heterologous genes, and is reasonably well characterized and developed for large-scale production processes.

Prefeπed mammalian host cells include but are not limited to those derived from humans, monkeys and rodents, (see, for example, Kriegler M. in "Gene Transfer and Expression: A Laboratory Manual", New York, Freeman & Co. 1990).

A number of viral-based expression systems may also be utilized with mammalian cells to produce ceramidases. Vectors using DNA virus backbones have been derived from simian virus 40 (SV40) (Hamer et al, 1979, Cell 17:725), adenovirus (Van Doren et al, 1984, Mol Cell Biol 4:1653), adeno-associated virus (McLaughlin et al, 1988, J Virol 62:1963), and bovine papillomas virus (Zinn et al, 1982, Proc Natl Acad Sci

79:4897). In cases where an adenovirus is used as an expression vector, the donor DNA sequence may be ligated to an adenovirus transcription translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing heterologous products in infected hosts. (See e.g., Logan and Shenk, 1984, Proc. Natl Acad. Sci. (USA) 81 :3655-3659).

Bovine papillomavirus (BPV) can infect many higher vertebrates, including man, and its DNA replicates as an episome. A number of shuttle vectors have been developed for recombinant gene expression which exist as stable, multicopy (20-300 copies/cell) extrachromosomal elements in mammalian cells. Typically, these vectors contain a segment of BPV DNA (the entire genome or a 69% transforming fragment), a promoter with a broad host range, a polyadenylation signal, splice signals, a selectable marker, and "poisonless" plasmid sequences that allow the vector to be propagated in E. coli. Following construction and amplification in bacteria, the expression gene construct are transfected into cultured mammalian cells by, for example, the calcium phosphate coprecipitation technique. For those host cells that do not manifest a transformed phenotype, selection of transformants is achieved by use of a dominant selectable marker, such as histidinol and G418 resistance. For example, a ceramidase gene sequence can be inserted into BPV vectors, such as pBCMGSNeo and pBCMGHis (Karasuyama et al, Εur. J. Immunol. 18:97-104; Ohe et al, Human Gene Therapy, 6:325-33) which can then be transfected into a diverse range of cell types for expression of the ceramidase. Alternatively, the vaccinia 7.5K promoter may be used. (See, e.g., Mackett et al, 1982, Proc. Natl Acad. Sci. (USA) 79:7415-7419; Mackett et al, 1984, J. Virol 49:857-864; Panicali et al, 1982, Proc. Natl. Acad. Sci. 79:4927-4931.) In cases where a human host cell is used, vectors based on the Εpstein-Barr virus (ΕBV) origin (OriP) and ΕBV nuclear antigen 1 (ΕBNA-1; a trans-acting replication factor) can be used. Such vectors can be used with a broad range of human host cells, e.g., EBO-pCD (Spickofsky et al, 1990, DNA Prot Eng Tech 2:14-18); pDR2 and λDR2 (available from Clontech Laboratories).

Ceramidase may also be made with a retrovirus-based expression system. Retro viruses, such as Moloney murine leukemia virus, can be used since most of the viral gene sequence can be removed and replaced with ceramidase gene sequence while the missing viral functions can be supplied in trans. In contrast to transfection, retroviruses can efficiently infect and transfer genes to a wide range of cell types including, for example, primary hematopoietic cells. Moreover, the host range for infection by a retroviral vector can be manipulated by the choice of envelope used for vector packaging. For example, a retroviral vector can comprise a 5' long terminal repeat

(LTR), a 3' LTR, a packaging signal, a bacterial origin of replication, and a selectable marker. The ceramidase DNA is inserted into a position between the 5' LTR and 3' LTR, such that transcription from the 5' LTR promoter transcribes the cloned DNA. The 5' LTR comprises a promoter, including but not limited to an LTR promoter, an R region, a U5 region and a primer binding site, in that order. Nucleotide sequences of these LTR elements are well known in the art. A heterologous promoter as well as multiple drug selection markers may also be included in the expression vector to facilitate selection of infected cells. See, McLauchlin et al, 1990, Prog Nucleic Acid Res and Molec Biol 38:91-135; Morgenstern et al, 1990, Nucleic Acid Res 18:3587-3596; Choulika et al, 1996, J Virol 70:1792-1798; Boesen et al, 1994, Biotherapy 6:291-302; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 1993, Cuπ. Opin. in Genetics and Devel 3:110-114. Other useful eukaryotic host-vector system may include yeast and insect systems. In yeast, a number of vectors containing constitutive or inducible promoters may be used with Saccharomyces cerevisiae (baker's yeast), Schizosaccharomyces pombe (fission yeast), Pichia pastoris, and Hansenula polymorpha (methylotropic yeasts). For a review see, Cuπent Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al, Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al, 1987, Expression and

Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al, Cold Spring Harbor Press, Vols. I and II.

In an insect system, Autographa californica nuclear polyhidrosis virus (AcNPV) a baculovirus, can be used as a vector to express ceramidase in Spodoptera frugiperda cells. The ceramidase gene sequences may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). These recombinant viruses are then used to infect host cells in which the inserted DNA is expressed. (See e.g., Smith et al, 1983, J Virol 46:584; Smith, U.S. Patent No. 4,215,051.)

The efficiency of expression of the ceramidase in a host cell may be enhanced by the inclusion of appropriate transcription enhancer elements in the expression vector, such as those found in SV40 virus, Hepatitis B virus, cytomegalovirus, immunoglobulin genes, metallothionein, β-actin (see Bittner et al, 1987, Methods in Enzymol. 153:516-544; Gorman, 1990, Cuπ. Op. in Biotechnol. 1 :36-47).

The expression vector may also contain sequences that permit maintenance and replication of the vector in more than one type of host cell, or integration of the vector into the host chromosome. Such sequences may include but are not limited to replication origins, autonomously replicating sequences (ARS), centromere DNA, and telomere DNA. It may also be advantageous to use shuttle vectors which can be replicated and maintained in at least two types of host cells.

In addition, the expression vector may contain selectable or screenable marker genes for initially isolating, identifying or tracking host cells that contain DNA encoding a ceramidase. For long term, high yield production of ceramidase-peptide complexes, stable expression in mammalian cells is prefeπed. A number of selection systems may be used for mammalian cells, including but not limited to the Herpes simplex virus thymidine kinase (Wigler et al, 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalski and Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy et al, 1980, Cell 22:817) genes can be employed in tk^", hgprt^" or aprf cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for dihydrofolate reductase (dhfr), which confers resistance to methotrexate (Wigler et al, 1980, Natl. Acad. Sci. USA 77:3567; O'Hare et al, 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neomycin phosphotransferase (neo), which confers resistance to the aminoglycoside G-418 (Colbeπe- Garapin et al, 1981, J. Mol. Biol. 150:1); and hygromycin phosphotransferase (hyg), which confers resistance to hygromycin (Santeπe et al, 1984, Gene 30:147). Other selectable markers, such as but not limited to histidinol and Zeocin™ can also be used. Any of the cloning and expression vectors described herein may be synthesized and assembled from known DNA sequences by well known techniques in the art. The regulatory regions and enhancer elements can be of a variety of origins, both natural and synthetic. Some vectors and host cells may be obtained commercially. Non- limiting examples of useful vectors are described in Appendix 5 of Cuπent Protocols in Molecular Biology, 1988, ed. Ausubel et al, Greene Publish. Assoc. & Wiley Interscience, which is incorporated herein by reference; and the catalogs of commercial suppliers such as Clontech Laboratories, Stratagene Inc., and Invitrogen, Inc.

Endogenous ceramidase gene expression can also be reduced by inactivating or "knocking out" the gene or its promoter using targeted homologous recombination. (E.g., see Smithies et al, 1985, Nature 317:230-234; Thomas & Capecchi, 1987, Cell 51:503-512;

Thompson et al, 1989 Cell 5:313-321; each of which is incorporated by reference herein in its entirety). For example, a mutant, non-functional ceramidase gene (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous ceramidase gene (either the coding regions or regulatory regions of the ceramidase gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express ceramidase gene in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the ceramidase gene. Such approaches are particularly suited where modifications to ES (embryonic stem) cells can be used to generate animal offspring with an inactive ceramidase gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). Such techniques can also be utilized to generate animal models. It should be noted that this approach can be adapted for use in humans provided the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors, e.g., herpes virus vectors.

Alternatively, endogenous ceramidase gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the ceramidase gene (i.e., the ceramidase gene promoter and/or enhancers) to form triple helical structures that prevent transcription of the ceramidase gene in target cells in the body. (See generally, Helene, C. 1991, Anticancer Drug Des., 6(6):569-84; Helene, C, et al, 1992, Ann, N.Y. Acad. Sci., 660:27-36; and Maher, L.J., 1992, Bioassays 14(12):807-15).

In a different embodiment of the invention, transgenic non-human, preferably mammals, that have incorporated and express a functional ceramidase gene may be used as animal models of diseases and disorders involving hyperproliferation. Such animals can be used to screen for or test molecules for the ability to inhibit proliferation and thus treat or prevent such diseases and disorders.

5.3. THE CERAMIDASE GENE PRODUCTS

In another embodiment, the invention provides ceramidase proteins (interchangeably refeπed to as the ceramidase gene product), preferably human ceramidase protein, fragments, derivatives, and analogs thereof which comprise an antigenic determinant (i.e., can be recognized by an antibody) or which are otherwise functionally active, as well as nucleic acid sequences encoding the foregoing. In one embodiment, the ceramidase proteins are encoded by the ceramdiase nucleic acids described in Section 5.1 supra. In a specific embodiment, the amino acid sequence of a ceramidase protein of the invention consists of SEQ ID NO:2 as shown in Fig. 3.

The amino acid sequence of the full length ceramidase protein comprises one transmembrane domain between amino acids 505 and 525 (Figure 3) and three other putative transmembrane domains (amino acids, 176-196, 313-333, 431-451, 543-563). The sequence also revealed the presence of a signal peptide (amino acids 1-19), and a region of low compositional complexity (amino acids, 38-66). This region of low complexity showed features of a mitochondrial targeting sequence. Also, there is a putative myristoylation site, several putative phosphorylation sites (PKC, PKA, casein kinase 2) and putative N- glycosylation sites. The nucleotide position of these active sites are shown in Table 1. (Subseq: subsequence; Str. Loc: structure, location; # Res Matched: number of residues matched; Subseq. Found: subsequence found; CAMP PK site: cAMP-dependent protein kinase; Cas phos st: Casein Kinase phosphorylation site; Myristoyl: myristoylation site; PHOS2: phosphorylation site; PKC ph site: protein kinase C phosphorylation site).

Table 1 Putative Domains on Ceramidase Protein

The ceramidase cDNA of the invention was overexpressed in HEK 293 and MCF7 cells using the pcDNA3.1/Ηis-ceramidase construct, and ceramidase enzyme activity (at pH 9.5) increased by 50- and 12-fold, respectively. Using lysate of the overexpressing cells, it was confirmed that the enzyme catalyzes the hydrolysis of ceramide in the neutral alkaline range and is independent of cations. In addition, a green fluorescent protein- ceramidase fusion protein was constructed to investigate the localization of this enzyme. The results showed that the green fluorescent protein-ceramidase fusion protein presented a mitochondrial localization pattern and co-localized with mitochondrial specific probes. These results demonstrate that this novel ceramidase is a mitochondrial enzyme, and they suggest the existence of a topologically restricted pathways of sphingolipid metabolism.

Fragments, or proteins comprising fragments, lacking some or all of the foregoing regions of a ceramidase protein are also provided.

"Functionally active" ceramidase material as used herein refers to that material displaying one or more known functional activities associated with a full-length wild-type ceramidase protein, e.g., hydro lyze ceramide to form sphingosine, binding to a ceramidase substrate, antigenicity (binding to an anti-ceramidase antibody), immunogenicity, etc.

The production and use of fragments, derivatives and analogs related to ceramidase are within the scope of the present invention. In a specific embodiment, the derivative or analog is functionally active, i.e., capable of exhibiting one or more functional activities associated with a full-length, wild-type ceramidase protein. As one example, a ceramidase protein lacking a signal peptide is provided, e.g., such a ceramidase protein has the amino acid sequence of 17 to 761 of SEQ ID NO:2. Another example provides a ceramidase protein lacking the mitochondrial targeting sequence. Such a ceramidase protein has the amino acid sequence of residues 1 to 37 and residues 67 to 761 of SEQ ID NO:2. As another example, such fragments, derivatives or analogs which have the desired immunogenicity or antigenicity can be used, for example, in immunoassays, for immunization, for inhibition of ceramidase activity, etc. As another example, such derivatives or analogs which are phosphorylated or dephosphorylated, are provided. Fragments, derivatives or analogs that retain, or alternatively lack or inhibit, a desired ceramidase property of interest (e.g., binding to a ceramidase substrate), can be used as inducers, or inhibitors, respectively, of such property and its physiological coπelates. A specific embodiment relates to a ceramidase fragment that can be bound by an anti- ceramidase antibody. Fragments, derivatives or analogs of ceramidase can be tested for the desired activity by procedures known in the art, including but not limited to the assays described in Sections 5.10.

In specific embodiments, the invention provides fragments of a ceramidase protein consisting of at least 6 amino acids, 10 amino acids, 50 amino acids, or of at least 75 amino acids. In specific embodiments, such fragments are not larger than 35, 100 or 200 amino acids. Fragments, derivatives or analogs of ceramidase include but are not limited to those molecules comprising regions that are substantially homologous to ceramidase or fragments thereof (e.g., in various embodiments, at least 60%) or 70% or 80% or 90% or 95% identity over an amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is done by a computer homology program known in the art) or whose encoding nucleic acid is capable of hybridizing to a coding ceramidase sequence, under stringent, moderately stringent, or low stringency conditions.

Table 2 shows the alignment of the sequenced rat brain peptides to the human cloned protein. The peptide sequences obtained from the purified rat brain enzyme were aligned to the peptide sequences deduced from the cloned human ceramidase. Amino acids in bold show difference in sequence.

TABLE 2 Peptide Sequence

In particular aspects, the ceramidase proteins, derivatives, or analogs are of ceramidase proteins of animals, e.g., rat, pig, cow, dog, monkey, human, or of plants. The mouse homolog of the ceramidase protein is least prefeπed. Once a recombinant cell which expresses a ceramidase gene sequence is identified, the gene product can be analyzed. This is achieved by assays based on the physical or functional properties of the product, including radioactive labelling of the product followed by analysis by gel electrophoresis, immunoassay, etc. Once the ceramidase protein is identified, it may be isolated and purified by standard methods including chromatography (e.g., ion exchange, affinity, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. The functional properties may be evaluated using any suitable assays as described in Section 6.1. In another embodiment, native ceramidase proteins can be purified from natural sources, by methods such as those described in Section 6.1 and in El Bawab et al, 1999, J. Biol. Chem. 274(39): 27948-27955. In a specific embodiment, the ceramidase proteins can be purified from mitochondria.

The amino acid sequence of the ceramidase protein can be derived by deduction from the DNA sequence of a ceramidase gene, or alternatively, by direct sequencing of the protein, e.g., with an automated amino acid sequencer (e.g., see Hunkapiller, M., et al, 1984, Nature 310:105-111).

The ceramidase protein sequence can be further characterized by a hydrophilicity analysis (Hopp, T. and Woods, K., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:3824). A hydrophilicity profile can be used to identify the hydrophobic and hydrophilic regions of the ceramidase protein and the coπesponding regions of the gene sequence which encode such regions.

Secondary, structural analysis (Chou, P. and Fasman, G., 1974, Biochemistry 13:222) can also be done, to identify regions of ceramidase that assume specific secondary structures. Manipulation, translation, and secondary structure prediction, open reading frame prediction and plotting, as well as determination of sequence homologies, can also be accomplished using computer software programs available in the art.

Other methods of structural analysis can also be employed. These include but are not limited to X-ray crystallography (Engstom. A., 1974, Biochem. Exp. Biol. 11 :7- 13) and computer modeling (Fletterick, R. and Zoller, M. (eds.), 1986, Computer Graphics and Molecular Modeling, in Cuπent Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).

In particular, ceramidase fragments, derivatives or analogs, can be made by altering ceramidase sequences by conservative substitutions, additions or deletions that provide for functionally equivalent molecules. Due to the degeneracy of nucleotide coding sequences, other DNA sequences which encode substantially the same amino acid sequence as a ceramidase gene may be used in the practice of the present invention. These include but are not limited to nucleotide sequences comprising all or portions of ceramidase genes which are altered by the substitution of different codons that encode a functionally equivalent amino acid residue within the sequence, thus producing a functionally silent change. Likewise, the ceramidase derivatives of the invention include, but are not limited to, those containing, as a primary amino acid sequence, all or part of the amino acid sequence of a ceramidase protein including altered sequences in which functionally equivalent amino acid residues are substituted for residues within the sequence resulting in a functionally silent change. For example, one or more amino acid residues within the sequence can be substituted by another amino acid of a similar polarity which acts as a functional equivalent, resulting in a silent alteration. Substitutes for an amino acid within the sequence may be selected from other members of the class to which the amino acid belongs. For example, the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. The polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Accordingly, the present invention provides an isolated polypeptide, the amino acid sequence of which comprises SEQ ID NO: 2 with at least one conservative amino acid substitution. The ceramidase derivatives and analogs of the invention can be produced by various methods known in the art. The manipulations which result in their production can occur at the gene or protein level. For example, the cloned ceramidase gene sequence can be modified by any of numerous strategies known in the art (Maniatis, T., 1990, Molecular Cloning, A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York). The sequence can be cleaved at appropriate sites with restriction endonuclease(s), followed by further enzymatic modification if desired, isolated, and ligated in vitro. In the production of the gene encoding a derivative or analog of ceramidase, care should be taken to ensure that the modified gene remains within the same translational reading frame as ceramidase, uninterrupted by translational stop signals, in the gene region where the desired ceramidase activity is encoded.

Additionally, the ceramidase-encoding nucleic acid sequence can be mutated in vitro or in vivo, to create and/or destroy translation, initiation, and/or termination sequences, or to create variations in coding regions and/or form new restriction endonuclease sites or destroy preexisting ones, to facilitate further in vitro modification. Any technique for mutagenesis known in the art can be used, including but not limited to, chemical mutagenesis, in vitro site-directed mutagenesis (Hutchinson, C, et al, 1978, J. Biol. Chem 253:6551), use of TAB® linkers (Pharmacia), etc.

Manipulations of the ceramidase sequence may also be made at the protein level. Included within the scope of the invention are ceramidase protein fragments or other derivatives or analogs which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH₄; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.

In another embodiment, a ceramidase protein fragment can be made by sequential removal of amino acid residues from the amino and/or carboxyl termainl of the protein.

In addition, analogs and derivatives of ceramidase can be chemically synthesized. For example, a peptide coπesponding to a portion of a ceramidase protein which comprises the desired domain (see Section 5.6.1), or which mediates the desired activity in vitro, can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the ceramidase sequence. Non-classical amino acids include but are not limited to the D-isomers of the common amino acids, -amino isobutyric acid, 4- aminobutyric acid, Abu, 2-amino butyric acid, γ-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3 -amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline. cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methyl amino acids, C -methyl amino acids, N -methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary). In a specific embodiment, the ceramidase derivative is a chimeric, or fusion, protein comprising a ceramidase protein or fragment thereof (preferably consisting of at least a domain or motif of the ceramidase protein, or at least 6, 8, or 10 amino acids of the ceramidase protein) joined at its amino- or carboxy-terminus via a peptide bond to an amino acid sequence of a different protein. In one embodiment, such a chimeric protein is produced by recombinant expression of a nucleic acid encoding the protein (comprising a ceramidase-coding sequence joined in-frame to a coding sequence for a different protein). Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art. Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer. Chimeric genes comprising portions of ceramidase fused to any heterologous protein-encoding sequences may be constructed. A specific embodiment relates to a chimeric protein comprising a fragment of ceramidase of at least six amino acids.

Accordingly, the present invention provides a chimeric protein comprising a fragment of a ceramidase protein consisting of at least 6 amino acids fused via a covalent bond to an amino acid sequence of a second polypeptide.

In a specific embodiment, the invention relates to ceramidase derivatives and analogs that comprise one or more domains of a ceramidase protein, including but not limited to the ceramidase transmembrane domains, signal peptide, a region of low compositional complexity, putative myristoylation site, putative phosphorylation sites (PKC, PKA, casein kinase 2) and putative N-glycosylation, functional fragments of any of the foregoing, or any combination of the foregoing. Such domains in human and rat ceramidase proteins are identified in Figure 3. The ceramidase derivative can be a molecule comprising multiple regions of homology with a ceramidase protein. By way of example, in various embodiments, a first protein region can be considered "homologous" to a ceramidase domain or to a second protein region when the amino acid sequence of the first region is at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 95% identical, when compared to any sequence in the second region of an equal number of amino acids as the number contained in the first region or when compared to an aligned sequence of the second region that has been aligned by a computer homology program known in the art. For example, a molecule can comprise one or more regions homologous to a ceramidase domain or a portion thereof.

Accordingly, the present invention provides an isolated polypeptide which is at least 60% identical to the ceramidase polypeptide having the amino acid sequence of SEQ ID NO:2, and displays one or more functional activities of ceramidase protein.

In other aspects, the invention provides various phosphorylated and dephosphorylated forms of the ceramidase protein, derivative, or analog. Both phosphorylation and dephosphorylation of ceramidase can occur at different residues. Phosphorylation can be carried out by any methods known in the art, e.g., by use of a kinase. Dephosphorylation can be carried out by use of any methods known in the art, e.g., by use of a phosphatase. In another specific embodiment, a molecule is provided that comprises one or more domains (or functional portion thereof) of a ceramidase protein but that also lacks one or more domains (or functional portion thereof) of a ceramidase protein. In particular examples, ceramidase protein derivatives are provided that lack one or more transmembrane domain. By way of another example, such a protein may also lack all or a portion of the region of low compositional complexity or the mitochondrial targeting sequence such that the ability of the ceramidase protein to localize to mitochondrial is reduced or lost. In another embodiment, a molecule is provided that comprises one or more domains (or functional portion thereof) of a ceramidase protein, and that has one or more mutant (e.g., due to deletion or point mutation(s)) domains of a ceramidase protein (e.g., such that the mutant domain has decreased function). By way of example, the active site may be mutated so as to have reduced, absent, or increased ceramidase activity. Accordingly, the present invention provides an isolated polypeptide, the amino acid of which comprises at least one region selected from the group consisting of residues 1-19, 38-66, 176-196, 3131-333, 431-451, 505-525, and 543-563 of SEQ ID NO:2. The functional activity of ceramidase proteins, derivatives and analogs can be assayed by various methods including those described in Section 6.1.

In one embodiment, where one is assaying for the ability to bind or compete with wild-type ceramidase for binding to anti-ceramidase antibody or the substrate ceramide, various immunoassays known in the art can be used, including but not limited to competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labelled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.

5.4. ANTIBODIES TO CERAMIDASE PROTEINS AND DERIVATIVES THEREOF Antibodies against full length wild type or mutant ceramidase proteins, or against peptides coπesponding to portions of the proteins such as, for example, the active domains, are useful for a variety of purposes. The antibodies include but are not limited to polyclonal, monoclonal, Fab fragments, single chain antibodies, chimeric antibodies, humanized antibodies, single chain antidobies, Fab fragments, F(ab')₂ fragments, Fv fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragments of any of the above.

According to the invention, ceramidase protein, its fragments or other derivatives, or analogs thereof, may be used as an immunogen to generate antibodies which immunospecifically bind such an immunogen. Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments, and an Fab expression library. In a specific embodiment, antibodies to a human ceramidase protein are produced. In another embodiment, antibodies to a domain (e.g., the kinase domain) of a ceramidase protein are produced. In a specific embodiment, fragments of a ceramidase protein identified as hydrophilic are used as immunogens for antibody production.

Various procedures known in the art may be used for the production of polyclonal antibodies to a ceramidase protein or derivative or analog. In a particular embodiment, rabbit polyclonal antibodies to an epitope of a ceramidase protein encoded by a sequence of SEQ ID NO:2, or an immunogenic subsequence thereof, can be obtained. For the production of antibody, various host animals can be immunized by injection with the native ceramidase protein, or a synthetic version, or derivative (e.g., fragment) thereof, including but not limited to rabbits, mice, rats, etc. Various adjuvants may be used to increase the immunological response, depending on the host species, and including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum.

For preparation of monoclonal antibodies directed toward a ceramidase protein sequence or analog thereof, any technique which provides for the production of antibody molecules by continuous cell lines in culture may be used. For example, the hybridoma technique originally developed by Kohler and Milstein (1975, Nature 256:495- 497), as well as the trioma technique, the human B-cell hybridoma technique (Kozbor et al, 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilizing recent technology (PCT/US90/02545). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently prefeπed method of production.

According to the invention, human antibodies may be used, and such can be obtained by using human hybridomas (Cote et al, 1983, Proc. Natl. Acad. Sci. U.S.A. 80:2026-2030) or by transforming human B cells with EBV virus in vitro (Cole et al, 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, pp. 77-96). In fact, according to the invention, techniques developed for the production of "chimeric antibodies" (Morrison et al, 1984, Proc. Natl. Acad. Sci. U.S.A. 81:6851-6855; Neuberger et al, 1984, Nature 312:604-608; Takeda et al, 1985, Nature 314:452-454) by splicing the genes from a mouse antibody molecule specific for ceramidase together with genes from a human antibody molecule of appropriate biological activity can be used. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies. Alternatively, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778; Bird, 1988, Science 242:423-426; Huston et al, 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al, 1989, Nature 334:544-546) can be adapted to produce single chain antibodies against ceramidase gene products. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may also be used (Skeπa et al, 1988, Science 242:1038-1041).

Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments. Alternatively, Fab expression libraries may be constructed (Huse et al, 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. Accordingly, the present invention provides a molecule comprising a fragment of the antibody which binds a ceramidase protein.

According to the invention, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce ceramidase-specific single chain antibodies. An additional embodiment of the invention utilizes the techniques described for the construction of Fab expression libraries (Huse et al, 1989, Science

246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for ceramidase proteins, derivatives, or analogs. Antibody fragments which contain the idiotype of the molecule can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragment, the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent, and Fv fragments.

In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g. ELISA (enzyme-linked immunosorbent assay). For example, to select antibodies which recognize a specific domain of a ceramidase protein, one may assay generated hybridomas for a product which binds to a ceramidase fragment containing such domain. For selection of an antibody that specifically binds a first ceramidase homolog but which does not specifically bind a different ceramidase homolog, one can select on the basis of positive binding to the first ceramidase homolog and a lack of binding to the second ceramidase homolog. Antibodies specific to a domain of a ceramidase protein are also provided.

Also provided is an antibody preparation which binds a ceramidase protein.

The foregoing antibodies can be used in methods known in the art relating to the localization and activity of the ceramidase protein sequences of the invention, e.g., for imaging these proteins, measuring levels thereof in appropriate physiological samples, in diagnostic methods, etc.

In another embodiment, the present invention relates to the uses of antibodies or fragments thereof capable of specifically recognizing one or more epitopes of the ceramidase gene products, epitopes of conserved variants of the ceramidase gene products, epitopes of mutant ceramidase gene products, or peptide fragments of the ceramidase gene products. Such antibodies may include, but are not limited to, polyclonal antibodies, monoclonal antibodies (mAbs).

Such antibodies may be used, for example, in the detection of a ceramidase gene product in an biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal levels of ceramidase gene products, and/or for the presence of abnormal forms of the such gene products. Such antibodies may also be included as a reagent in a kit for use in a diagnostic or prognostic technique. Such antibodies may also be utilized in conjunction with, for example, compound screening schemes, as described, below, for the evaluation of the effect of test compounds on ceramidase gene product levels and/or activity. Antibodies to ceramidase gene product may be used in a method for the inhibition of abnormal ceramidase gene product activity. Thus, such antibodies may, therefore, be utilized as part of the treatment methods of the invention. Additionally, such antibodies can be used in conjunction with the gene therapy techniques described, below, to, for example, evaluate the normal and/or engineered ceramidase-expressing cells prior to their introduction into the patient.

Because ceramidase is an intracellular protein, it is prefeπed that internalizing antibodies be used. However, lipofectin or liposomes can be used to deliver the antibody or a fragment of the Fab region which binds to the ceramidase gene product epitope into cells. Where fragments of the antibody are used, the smallest inhibitory fragment which binds to the ceramidase activation domain(s) is prefeπed. For example, peptides having an amino acid sequence coπesponding to the domain of the variable region of the antibody that binds to the ceramidase activation domain(s) can be used. Such peptides can be synthesized chemically or produced via recombinant DNA technology using methods well known in the art (e.g., see Creighton, 1983, supra; and Sambrook et al, 1989, above). Alternatively, single chain antibodies, such as neutralizing antibodies, which bind to intracellular epitopes can also be administered. Such single chain antibodies can be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population by utilizing, for example, techniques such as those described in Marasco et al. (1993, Proc. Natl. Acad. Sci. USA 90:7889-7893).

5.5. CERAMIDASE ANTISENSE MOLECULES

The use of antisense molecules as inhibitors of gene expression is a specific, genetically based therapeutic approach (for a review, see Stein, in Ch. 69, Section 5 "Cancer: Principle and Practice of Oncology", 4th ed., ed. by DeVita et al, J.B. Lippincott, Philadelphia 1993). The present invention provides the therapeutic or prophylactic use of single-stranded nucleic acids of at least six nucleotides that are antisense to a gene or cDNA encoding ceramidase or a portion thereof. The invention further provides pharmaceutical compositions comprising an effective amount of the ceramidase antisense nucleic acids of the invention in a pharmaceutically acceptable carrier, as described infra.

In another embodiment, the invention is directed to methods for inhibiting the expression of a ceramidase nucleic acid sequence in a mammalian cell in vitro or in vivo comprising providing the cell with an effective amount of a composition comprising an ceramidase antisense nucleic acid of the invention.

The antisense nucleic acid of the invention may be complementary to a coding and/or noncoding region of a ceramidase mRNA. The antisense molecules will bind to the complementary ceramidase gene mRNA transcripts and reduce or prevent translation. Absolute complementarity, although prefeπed, is not required. A sequence "complementary" to a portion of an RNA, as refeπed to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. The human ceramidase promoter contains two CT repeats that represent potential triple helix regions (Mavrothalassitis et al, 1990, Oncogene 5:1337-1342). Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.

Nucleic acid molecules that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have recently shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.

Nucleic acid molecules complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense nucleic acid molecules complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of target or pathway gene mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects, the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides, at least 50 nucleotides, or at least 200 nucleotides. For example, nucleic acid molecules complementary to either the 5'- or 3'- non-translated, non-coding regions of the ceramidase gene, could be used in an antisense approach to inhibit translation of endogenous ceramidase gene mRNA. In one embodiment, the invention provides antisense ceramidase nucleic acid molecules, preferably RNA molecules, that are essentially single stranded nucleic acid molecules, and comprises a nucleotide sequence complementary to (a) the nucleotide sequence of the sense strand of the polynucleotide (i.e., SEQ ID NO:l) depicted in Figure 3, SEQ ID NO: 1 ; or (b) a nucleotide sequence that encodes the amino acid sequence shown in Figure 3 (i.e., SEQ ID NO:2).

The antisense ceramidase nucleic acid molecule of the invention is capable of hybridizing in vivo and in vitro to a portion of an ceramidase messenger RNA (mRNA) by virtue of some sequence complementarity. Such hybridization conditions may be highly stringent as exemplified above, or moderately stringent, e.g., washing in 0.2xSSC/0.1% SDS at 42°C (Ausubel F.M. et al, eds., 1989, Cuπent Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at page 2.10.3). In instances where the nucleic acid molecules are deoxyoligonucleotides ("oligos"), highly stringent conditions may refer, e.g., to washing in 6xSSC/0.05%> sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23 -base oligos).

Antisense nucleic acid molecules may be synthesized chemically or enzymatically, and delivered to cells that requires treatment by injection. Alternatively, antisense ceramidase RNA molecules can be synthesized in a cell by inserting the ceramidase gene or a fragment thereof in a manner such that the antisense RNA molecules are made, preferably in a controllable fashion. Furthermore, double-stranded RNA which has been shown to effectively block gene expression can also be used. Genetic interference by double-stranded RNA (RNA interference or RNA-i) has been successfully used to determine both the role of a specific gene and cells that express the specific gene (Misquitta and Paterson, 1999, Proc. Natl. Acad. Sc , 96: 1451-1456; Fire et al, 1998, Nature, 391 :

806-811).

These nucleic acid molecules may be used to interfere with ceramidase gene regulation, so as to modulate, for example, the phenotype and ceramide level of cells. Further, such sequences may be used as part of ribozyme and/or triple helix sequences, also useful for ceramidase gene regulation.

Regardless of the choice of target sequence, it is prefeπed that in vitro studies are first performed to quantitate the ability of the antisense molecule to inhibit gene expression. It is prefeπed that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also prefeπed that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide. It is prefeπed that the control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.

The antisense molecule can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The antisense molecule can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The antisense molecule may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, 1989, Proc. Natl Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al, 1988, BioTechniques 6:958- 976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the antisense molecule may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

The antisense molecule may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,

5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil- 5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.

The antisense molecule may also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense molecule comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet another embodiment, the antisense molecule is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al, 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al, 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBS Lett. 215:327-330).

As discussed above, antisense molecules of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al, 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.

While antisense nucleotides complementary to the ceramidase coding region, such as the ones described in Section 6.1, could be used, those complementary to the transcribed untranslated region are also prefeπed.

Accordingly, the present invention provides a nucleic acid molecule comprising a nucleotide sequence that hybridizes to the complement of the nucleic acid sequence of SEQ ID NO:l and encodes a polypeptide with one or more activities of a ceramidase protein, linked uninterrupted by stop codons to a coding sequence that encodes a heterologous protein or peptide.

The invention further provides a nucleic acid molecule that is single- stranded, and that hybridizes under highly stringent conditions to a nucleic acid probe having the nucleotide sequence of SEQ ID NO:l . The ceramidase antisense nucleic acids can be used to treat or prevent a disease or condition involving a cell type that expresses, or preferably overexpresses, ceramidase. Cell types which express or overexpress ceramidase RNA can be identified by various methods known in the art. Such methods include but are not limited to hybridization with a ceramidase-specific nucleic acid (e.g., by Northern hybridization, dot blot hybridization, in situ hybridization), detection of ceramidase gene product by immunoassays, etc. In a prefeπed aspect, primary tissue from a patient can be assayed for ceramidase expression prior to treatment, e.g., by immunocytochemistry or in situ hybridization. Pharmaceutical compositions of the invention comprising an effective amount of a ceramidase antisense nucleic acid in a pharmaceutically acceptable carrier, can be administered to a patient having a disease or disorder which is of a type that expresses or overexpresses ceramidase RNA or protein.

The amount of ceramidase antisense nucleic acid which will be effective in the treatment of a particular disorder or condition will depend on the nature of the cancer or condition, and can be determined by standard clinical techniques. Where possible, it is desirable to determine the antisense cytotoxicity of the tumor type to be treated in vitro, and then in useful animal model systems prior to testing and use in humans.

The antisense molecules should be delivered to cells which express the ceramidase gene in vivo. A number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense molecule linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systemically. Antisense molecules can be delivered to the desired cell population via a delivery complex. In a specific embodiment, pharmaceutical compositions comprising ceramidase antisense nucleic acids are administered via biopolymers (e.g., poly-β-l->4-N-acetylglucosamine polysaccharide), liposomes, microparticles, or microcapsules. In various embodiments of the invention, it may be useful to use such compositions to achieve sustained release of the ceramidase antisense nucleic acids. In a specific embodiment, it may be desirable to utilize liposomes targeted via antibodies to specific identifiable tumor antigens (Leonetti et al, 1990, Proc. Natl. Acad. Sci. U.S.A. 87:2448-2451; Renneisen et al. 1990, J. Biol. Chem. 265:16337-16342). 5.5.1 RIBOZYME MOLECULES

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA (For a review see, for example Rossi, J., 1994, Cuπent Biology 4:469- 471). The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by a endonucleolytic cleavage. The composition of ribozyme molecules must include one or more sequences complementary to the target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see U.S. Pat. No. 5,093,246, which is incorporated by reference herein in its entirety. As such, within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding target gene proteins.

Ribozyme molecules designed to auto-catalytically cleave ceramidase gene mRNA transcripts can also be used to prevent translation of ceramidase gene mRNA and expression of ceramidase target genes. (See, e.g., PCT International Publication

WO90/11364, published October 4, 1990; Sarver et al, 1990, Science 247:1222-1225). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy ceramidase gene mRNAs, the use of hammerhead ribozymes is prefeπed. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988. Nature, 334:585-591. Preferably the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the ceramidase gene mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non- functional mRNA transcripts.

The ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes") such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al, 1984, Science, 224:574-578;

Zaug and Cech, 1986, Science, 231 :470-475; Zaug, et al, 1986, Nature, 324:429-433; published International patent application No. WO 88/04300 by University Patents Inc.; Been and Cech, 1986, Cell, 47:207-216). The Cech-type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place. The invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in an ceramidase gene.

As in the antisense approach, the ribozymes can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express the ceramidase gene in vivo. A prefeπed method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous ceramidase gene messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.

Ribozyme, and triple helix molecules of the invention can be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides or by in vitro and in vivo transcription of DNA sequences encoding the ribozyme or triple helix molecule.

Accordingly, the present invention provides a nucleic acid comprising a nucleotide sequence encoding a ceramidase-specific ribozyme, which comprises an autocatalytic cleaving ribozyme, and a region that hybridizes under highly stringent conditions to a nucleic acid having the nucleotide sequence of SEQ ID NO: 1.

5.6. DIAGNOSTIC USES OF CERAMIDASE-RELATED REAGENTS

The present invention provides a variety of methods for the diagnostic and prognostic evaluation of cell hyperproliferation, vascular diseases, and inflammation and diseases associated with sphingolipid signal transduction. Such methods may, for example, utilize reagents such as the ceramidase nucleotide sequences, fusion protein (GFP-fusion protein), and antibodies directed against ceramidase gene products, including peptide fragments thereof, as described, above.

Specifically, such reagents may be used, for example, for: (1) the detection of the presence of ceramidase gene mutations, or the detection of either over- or under- expression of ceramidase gene mRNA in diseased cells relative to normal cells, or the qualitative or quantitative detection of other alleic forms of ceramidase transcripts which may coπelate with the phenotypes of various diseases, and (2) the detection of an over- abundance of ceramidase gene product relative to the non-disease state or the presence of a modified (e.g., less than full length) ceramidase gene product which coπelates with a diseased phenotype.

Accordingly, the present invention provides a method of diagnosing a disease or disorder characterized by an abeπant level of ceramidase RNA or protein in a subject, comprising measuring the level of ceramidase RNA or protein in a sample derived from the subject, in which an increase or decrease in the level of ceramidase RNA or protein, relative to the level of ceramidase RNA or protein found in an analogous sample not having the disease or disorder indicates the presence of the disease or disorder in the subject. One embodiment of the present invention is directed to a method of diagnosing or screening for the presence of or a predisposition for developing a disease or disorder involving cell oveφroliferation or dysfunctional sphingolipid signal transduction in a subject comprising measuring the level of ceramidase protein, ceramidase RNA or ceramidase functional activity in a sample derived from the subject, in which a decrease in the level of ceramidase protein, ceramidase RNA, or ceramidase functional activity in the sample, relative to the level of ceramidase protein, ceramidase RNA, or ceramidase functional activity found in an analogous sample not having the disease or disorder or a predisposition for developing the disease or disorder, indicates the presence of the disease or disorder or a predisposition for developing the disease or disorder. Another embodiment of the present invention is directed to a method of diagnosing or screening for the presence of or a predisposition for developing a disease or disorder involving cell oveφroliferation or dysfunctional sphingolipid signal transduction in a subject comprising detecting one or more mutations in ceramidase DNA, RNA or protein derived from the subject in which the presence of said one or more mutations indicates the presence of the disease or disorder or a predisposition for developing the disease or disorder.

The methods described herein may be applied to samples of cells or cellular materials taken directly from a patient. Any method known in the art for collection or isolation of the desired cells or materials can be used.

The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic test kits comprising at least one specific ceramidase nucleic acid or anti-ceramidase gene antibody reagent described herein, which may be conveniently used, e.g., in clinical settings or in home settings, to diagnose patients exhibiting preneoplastic or neoplastic abnormalities, and to screen and identify those individuals exhibiting a predisposition to such neoplastic changes.

In specific embodiments, the present invention is useful for the diagnosis and prognosis of malignant diseases in which the ceramidase gene or gene product is implicated or is suspected to be implicated. Such malignancies include but are not limited to cancer of the liver, ovary, breast, lung, bladder, kidney, colon, rectum, prostate gland and cervix. In one embodiment, the invention relates to a method for detecting in a sample the presence of a ceramidase nucleic acid, said method comprising: (a) contacting the sample with a nucleic acid probe capable of hybridizing to at least a portion of the nucleic acid molecule of claim 1 under hybridizing conditions; and (b) measuring the hybridization of the probe to the nucleic acids of the sample, thereby detecting the presence of the ceramidase nucleic acid.

In another embodiment, the invention relates to a method for detecting in a sample the presence of the ceramidase nucleic acid, said method comprising: (a) contacting the sample with two diffferent nucleic acid primers capable of hybridizing to at least a portion of the nucleic acid molecule of claim 1 under hybridizing conditions; (b) selectively amplifying the portion of the nucleic acid molecule of claim 1 flanked by the two nucleic acid primers; and (c) detecting the amplified nucleic acid, thereby detecting the presence of the ceramidase nucleic acid.

5.6.1 DETECTION OF CERAMIDASE GENE NUCLEIC ACID MOLECULES Quantitative and qualitative aspects of ceramidase gene expression can also be assayed. Nucleic acid from any nucleated cell can be used as the starting point for such assay techniques, and may be isolated according to standard nucleic acid preparation procedures which are well known to those of skill in the art. For the detection of ceramidase mutations, any nucleated cell can be used as a starting source for genomic nucleic acid. For the detection of ceramidase transcripts or ceramidase gene products, any cell type or tissue in which the ceramidase gene is expressed, such as, for example, breast cancer cells or cells from inflamed tissues, may be utilized. Diagnostic methods for the detection of ceramidase gene specific nucleic acid molecules, in patient samples or other appropriate cell sources, may involve the amplification of specific gene sequences, e.g., by the polymerase chain reaction (PCR; see Mullis, K.B., 1987, U.S. Patent No. 4,683,202), followed by the analysis of the amplified molecules using techniques well known to those of skill in the art.

The isolated cells can be derived from cell culture or from a patient. The analysis of cells taken from culture may be a necessary step in the assessment of cells to be used as part of a cell-based gene therapy technique or, alternatively, to test the effect of compounds on the expression of the ceramidase gene. Such analyses may reveal both quantitative and qualitative aspects of the expression pattern of the ceramidase gene, including activation or inactivation of ceramidase gene expression and presence of mutations. In one embodiment of such a detection scheme, a cDNA molecule is synthesized from an RNA molecule of interest by reverse transcription. All or part of the resulting cDNA is then used as the template for a nucleic acid amplification reaction, such as a PCR or the like. The nucleic acid reagents used as synthesis initiation reagents (e.g., primers) in the reverse transcription and nucleic acid amplification steps of this method are chosen from among the ceramidase gene nucleic acid reagents described in Section 5.1. The prefeπed lengths of such nucleic acid reagents are at least 9-30 nucleotides.

For detection of the amplified product, the nucleic acid amplification may be performed using radioactively or non-radioactively labeled nucleotides. In some cases, enough amplified product may be made such that the product may be visualized by standard ethidium bromide staining or by utilizing any other suitable nucleic acid staining method.

Such RT-PCR techniques can be utilized to detect differences in ceramidase transcript size which may be due to normal or abnormal alternative splicing. Additionally, such techniques can be performed using standard techniques to detect quantitative differences between levels of full length and/or alternatively spliced ceramidase transcripts detected in normal individuals relative to those individuals having cancer or exhibiting a predisposition toward neoplastic changes.

In the case where detection of specific alternatively spliced species or mutants is desired, appropriate primers and/or hybridization probes can be used, such that, in the absence of such sequence, no amplification would occur. Alternatively, primer pairs may be chosen utilizing the sequence data depicted in Figure 3 to choose primers which will yield fragments of differing size depending on whether a particular exon is present or absent from the ceramidase transcript, or the choice of poly A signal being utilized. As an alternative to amplification techniques, standard Northern analyses can be performed if a sufficient quantity of the appropπate cells can be obtained Utilizing such techniques, quantitative as well as size related differences between ceramidase transcπpts can also be detected Additionally, it is possible to perform such ceramidase gene expression assays "in situ", 1 e , directly upon tissue sections (fixed and/or frozen) of patient tissue obtained from biopsies or resections, such that no nucleic acid puπfication is necessary Nucleic acid reagents such as those descπbed m Section 5 1 may be used as probes and/or pπmers for such m situ procedures (see, for example, Nuovo, G J , 1992, "PCR In Situ Hybπdization Protocols And Applications", Raven Press, NY)

The results obtained by the methods descπbed herein may be combined with diagnostic test results based on other genes that are also implicated in the pathology of the cancer For example, K-tas and p53 mutations are often observed in patients

5.6.2 DETECTION OF CERAMIDASE GENE PRODUCTS

Antibodies directed against wild type or mutant ceramidase gene products or conserved vaπants or peptide fragments thereof, which are discussed above, may also be used as diagnostics and prognostics, as descπbed herein In another embodiment, GFP- ceramdiase fusion protein may be used as diagnostics and prognostics Such diagnostic methods, may be used to detect abnormalities m the level of ceramidase gene expression, or abnormalities in the structure and/or temporal, tissue, cellular, or subcellular location of ceramidase gene product

The tissue or cell type to be analyzed will generally include those which are known, or suspected, to express the ceramidase gene, such as, for example, breast cancer cells or mflammed cells The protein isolation methods employed herein may, for example, be such as those descπbed in Harlow and Lane (Harlow, E and Lane, D , 1988, "Antibodies A Laboratory Manual", Cold Spπng Harbor Laboratory Press, Cold Spπng Harbor, New York), which is mcoφorated herein by reference in its entirety The isolated cells can be deπved from cell culture or from a patient The analysis of cell taken from culture may be a necessary step to test the effect of compounds on the expression of the ceramidase gene

Prefeπed diagnostic methods for the detection of ceramidase gene products or conserved vaπants or peptide fragments thereof, may involve, for example, immunoassays wherein the ceramidase gene products or conserved variants, including gene products which are the result of alternatively spliced transcripts, or peptide fragments are detected by their interaction with an anti-ceramidase gene product-specific antibody.

For example, antibodies, or fragments of antibodies, such as those described, above, in Section 5.4, useful in the present invention may be used to quantitatively or qualitatively detect the presence of ceramidase gene products or conserved variants or peptide fragments thereof in a sample, inside a cell or even inside an organelle, such as the mitochondria. The antibodies (or fragments thereof) useful in the present invention may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of ceramidase gene products or conserved variants or peptide fragments thereof. In situ detection may be accomplished by removing a histological specimen from a patient, such as paraffin embedded sections of breast tissues and applying thereto a labeled antibody of the present invention. The antibody (or fragment) is preferably applied by overlaying the labeled antibody (or fragment) onto a biological sample. It may also be desirable to introduce the antibody inside the cell, for example, by making the cell membrane permeable. Through the use of such a procedure, it is possible to determine not only the presence of the ceramidase gene product, or conserved variants or peptide fragments, but also its distribution in the examined tissue. Using the present invention, those of ordinary skill will readily perceive that any of a wide variety of histological methods (such as staining procedures) can be modified in order to achieve such in situ detection. Similarly, GFP-ceramidase fusion protein may also be used for the detection of ceramidase gene product in tissues.

Immunoassays for ceramidase gene products or conserved variants or peptide fragments thereof will typically comprise incubating a sample, such as a biological fluid, a tissue extract, freshly harvested cells, or lysates of cells which have been incubated in cell culture, in the presence of a detectably labeled antibody capable of identifying ceramidase gene products or conserved variants or peptide fragments thereof, and detecting the bound antibody by any of a number of techniques well-known in the art.

The biological sample may be brought in contact with and immobilized onto a solid phase support or carrier such as nitrocellulose, or other solid support which is capable of immobilizing cells, cell particles or soluble proteins. The support may then be washed with suitable buffers followed by treatment with the detectably labeled ceramidase gene specific antibody or a GFP-ceramidase fusion protein. The solid phase support may then be washed with the buffer a second time to remove unbound antibody or fusion protein. The amount of bound label on solid support may then be detected by conventional means.

By "solid phase support or carrier" is intended any support capable of binding an antigen or an antibody. Well-known supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite. The nature of the carrier can be either soluble to some extent or insoluble for the puφoses of the present invention. The support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody. Thus, the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Prefeπed supports include polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation. The binding activity of a given lot of anti-ceramidase gene product antibody may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay conditions for each determination by employing routine experimentation.

In various embodiments, the present invention provides the measurement of ceramidase gene products, and the uses of such measurements in clinical applications. The measurement of ceramidase gene product of the invention can be valuable in detecting hypeφroliferative disease, cardiovascular disease or inflammation in a subject, in screening of hypeφroliferative disease, cardiovascular disease or inflammation in a population, in differential diagnosis of the physiological condition of a subject, and in monitoring the effect of a therapeutic treatment on a subject.

In specific embodiments, the present invention also provides for the detecting, or diagnosing of cancer, or the monitoring of treatment of cancer by measuring in addition to ceramidase gene product at least one other marker, such as receptors or differentiation antigens. For example, serum markers selected from, for example but not limited to, carcinoembryonic antigen (CEA), and prostate specific antigen (PSA) can be measured in combination with ceramidase gene product to detect, diagnose, stage, or monitor treatment of prostate cancer. In another embodiment, the prognostic indicator is the observed change in different marker levels relative to one another, rather than the absolute levels of the markers present at any one time. These measurements can also aid in predicting therapeutic outcome and in evaluating and monitoring the overall disease status of a subject.

5.7. THERAPEUTIC USE OF CERAMIDASE AND ITS ANALOGS

The invention provides for treatment or prevention of various diseases and disorders by administration of a therapeutic compound (termed herein "Therapeutic"). Such "Therapeutics" include but are not limited to: ceramidase proteins and analogs and derivatives (including fragments) thereof; antibodies thereto; nucleic acids encoding the ceramidase proteins, analogs, or derivatives; ceramidase antisense nucleic acids, ribozyme, triplex DNA, and ceramidase agonists and antagonists.

Ceramide modulates a number of biochemical and cellular responses to stress, including apoptosis, cell-cycle aπest and cell senescence. (For review, see Hannun et al, 2000, Trends in Cell Biol. 10:73-80; Mathias et al, 1998, Biochem. J. 335: 465-480). Several extracellular agents and stress stimuli, such as tumor necrosis factor α, chemotherapeutic agents and heat are known to cause ceramide accumulation. One way of accumulating ceramide is accomplished by regulating enzymes such as ceramidase in its metabolism. Also, a large number of agonists and stress signals increase the level of ceramide. These changes in the ceramide concentration are sufficient to reproduce many of the biological effects of cytokines and stress inducers that are coupled to ceramide accumulation. The accumulation of ceramides also reproduce most of the features of cell senescence. In many cell types, ceramides cause cell differentiation, both moφhologically and through the activation of biochemical programmes of cell differentiation. Ceramide also causes apoptosis in most cancer cells which can be accompanied by cell-cycle aπest. Furthermore, there is evidence which suggests that ceramide is closely associated with

TNFα-induced apoptosis. Thus, in the present invention, the inventors discovered that modulation of the levels of ceramide or sphingosine through the methods of the present invention can bring about treatment and prevention of diseases that are related to stress response and apoptosis. Several exemplary diseases and disorders are disclosed below which may be treated or prevented by the methods of the present invention.

Disorders involving cell oveφroliferation or dysfunctional sphingolipid signal transduction are treated or prevented by administration of a Therapeutic that inhibits ceramidase function. Disorders in which cell proliferation is deficient or is desired can be treated or prevented by administration of a Therapeutic that promotes ceramidase function.

Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the treated subject is prefeπed. Thus, in a prefeπed embodiment, a human ceramidase protein, derivative, or analog, or nucleic acid, or an antibody to a human ceramidase protein, is therapeutically or prophylactically administered to a human patient. All such methods involve modulating ceramidase gene activity and/or expression which in turn modulate the level of ceramide, for example, in a cell or an organelle. The above is described in detail in the subsections below. Descriptions and sources of Therapeutics that can be used according to the invention are found in Sections 5.1 through 5.7 herein.

Accordingly, the present invention provides a method of increasing the level of ceramide in a cell comprising contacting the cell with a compound that inhibits the ceramidase activity. In another embodiment, the invention relates to a method of inhibiting the formation of sphingosine in a cell comprising contacting the cell with a compound that inhibits the ceramidase activity such that the amount of sphingosine formed as a result of conversion from ceramide is reduced.

In an embodiment, the invention relates to a method of increasing the intracellular levels of ceramide in an animal comprising administering to the animal an effective amount of a compound that inhibits the ceramidase activity of the ceramidase protein in the animal's cells.

In another embodiment, the invention relates to a method of inhibiting the intracellular formation of sphingosine in an animal comprising administering to said animal an effective amount of compound that inhibits the ceramidase activity of the ceramidase protein in the animal's cells.

Diseases and disorders involving cell oveφroliferation that can be treated or prevented include but are not limited to malignancies, premalignant conditions (e.g., hypeφlasia, metaplasia, dysplasia), benign tumors, hypeφroliferative disorders, benign dysproliferative disorders, etc.

Cancer is characterized primarily by an increase in the number of abnormal cells derived from a given normal tissue, invasion of adjacent tissues by these abnormal cells, and lymphatic or blood-borne. Diseases and disorders involving cell oveφroliferation such as cancer are treated or prevented administration of a Therapeutic that inhibits (i e , decreases) ceramidase function Examples of such a Therapeutic include but are not limited to ceramidase proteins, deπ atives, or fragments that are functionally inactive Other Therapeutics that can be used, e g , ceramidase antagonists, can be identified using in vitro assays or animal models

In specific embodiments, Therapeutics that inhibits ceramidase function are administered therapeutically (including prophylactically) (1) in diseases or disorders involving an increased (relatι\ e to normal or desired) level of ceramidase protein or function, for example, in patients where ceramidase protein is biologically overactive or overexpressed, or (2) in diseases or disorders wherein in vitro (or in vivo) assays (see infra) indicate the utility of ceramidase antagonist administration The increased level in ceramidase protein or function can be readily detected, e g , by obtaining a patient tissue sample (e g , from biopsy tissue) and assaying it in vitro for RNA or protein levels, structure and/or activity of the expressed ceramidase RNA or protein Many methods standard in the art can be thus employed, including but not limited to ceramidase enzyme assays, immunoassays to detect and/or visualize ceramidase protein (e g , Western blot, lmmunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, lmmunocytochemistry, etc ) and/or hybπdization assays to detect ceramidase expression by detecting and/or visualizing ceramidase mRNA (e g , Northern assays, dot blots, in situ hybπdization, etc ), etc

Malignancies and related disorders that can be treated or prevented by administration of a Therapeutic that inhibits ceramidase function (for a review of such disorders, see Fishman et al , 1985, Medicine, 2d Ed , J B Lippmcott Co , Philadelphia)

TABLE 3 MALIGNANCIES AND RELATED DISORDERS Leukemia acute leukemia acute lymphocytic leukemia acute myelocytic leukemia myeloblastic promyelocytic myelomonocytic monocytic erythroleukemia chronic leukemia chronic myelocytic (granulocytic) leukemia chronic lymphocytic leukemia Polycythemia vera

Lymphoma

Hodgkm's disease non-Hodgkm's disease Multiple myeloma Waldenstrom's macroglobulmemia

Heavy chain disease Solid tumors sarcomas and carcinomas fibrosarcoma myxosarcoma hposarcoma chondrosarcoma osteogenic sarcoma chordoma angiosarcoma endothehosarcoma lymphangiosarcoma lymphangioendothehosarcoma synovioma mesothe oma

Ewmg's tumor leiomyosarcoma rhabdomyosarcoma colon carcinoma pancreatic cancer breast cancer ovaπan cancer prostate cancer squamous cell carcinoma basal cell carcinoma adenocarcmoma sweat gland carcinoma sebaceous gland carcinoma papillary carcinoma papillary adenocarcmomas cystadenocarcmoma medullary carcinoma bronchogemc carcinoma renal cell carcinoma hepatoma bile duct carcinoma choπocarcinoma seminoma embryonal carcinoma Wilms' tumor cervical cancer uterine cancer testicular tumor lung carcinoma small cell lung carcinoma bladder carcinoma epithelial carcinoma glioma astrocytoma medulloblastoma craniopharyngioma ependymoma pinealoma hemangioblastoma acoustic neuroma oligodendroglioma menangioma melanoma neuroblastoma retinoblastoma

In specific embodiments, malignancy or dysproliferative changes (such as metaplasias and dysplasias), or hypeφroliferative disorders, are treated or prevented in the bladder, breast, colon, lung, melanoma, pancreas, prostate or uterus. In other specific embodiments, sarcoma, or leukemia is treated or prevented.

The Therapeutics of the invention that inhibits ceramidase activity can also be administered to treat premalignant conditions and to prevent progression to a neoplastic or malignant state, including but not limited to those disorders listed in Table 3. Such prophylactic or therapeutic use is indicated in conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hypeφlasia, metaplasia, or most particularly, dysplasia has occuπed (for review of such abnormal growth conditions, see Robbins and Angell, 1976, Basic Pathology, 2d Ed., W.B. Saunders Co., Philadelphia, pp. 68-79.)

Alternatively or in addition to the presence of abnormal cell growth characterized as hypeφlasia, metaplasia, or dysplasia, the presence of one or more characteristics of a transformed phenotype, or of a malignant phenotype, displayed in vivo or displayed in vitro by a cell sample from a patient, can indicate the desirability of prophylactic/therapeutic administration of a Therapeutic that inhibits ceramidase function.

As mentioned supra, such characteristics of a transformed phenotype include moφhology changes, looser substratum attachment, loss of contact inhibition, loss of anchorage dependence, protease release, increased sugar transport, decreased serum requirement, expression of fetal antigens, etc. (see also id., at pp. 84-90 for characteristics associated with a transformed or malignant phenotype). Other disorders of proliferation that may benefit from inhibition of ceramidase include: psoriasis, autoimmune disorders such as lupus nephritis, glomerular diseases (with mesangial cell proliferation).

Vascular interventions, including angioplasty, stenting, atherectomy and grafting for the treatment of cardiovascular diseases are often complicated by undesirable effects. One of the adverse reactions to vascular intervention include endothelial and smooth muscle cell proliferation which can lead to hypeφlasia, or more specifically, restenosis which is the re-clogging of the artery, occlusion of blood vessels, reperfusion injury, platelet aggregation, and calcification. In this model, an injurious stimulus induces expression of growth-stimulatory cytokines such as interleukin 1 and tumor necrosis factor. Libby et al. , Cascade Model of Restenosis 1992, Circulation 86(6): III-47-III52. There is evidence which shows that ceramide inhibit the growth of endothelia and smooth muscle cells of the coronary artery.

Various therapies have been attempted to treat or prevent restenosis. However, there remains a great need for therapies directed to the prevention and treatment of cardiovascular diseases caused by hypeφlasia of endothelia and smooth muscle cells. Since it has been shown that ceramide inhibit the growth of endothelia and smooth muscle cells of the coronary artery, it is therefore desirable to raise the level of ceramide for the treatment and prevention of cardiovascular diseases. Recently, Kester et al. show that ceramide used in angioplasty prevents restenosis. Kester et al, 2000, Circ. Res. 87(4):282-8. Alternative, and more effectively, one aspect of the present invention provides treatment and prevention of restenosis by adjusting the level of ceramide through administering ceramidase inhibitors.

Accordingly, it is therefore desirable to raise the level of ceramide for the treatment and prevention of cardiovascular diseases. This can be accomplished by adjusting the intracellular level of ceramide by using the Therapeutics and methods of the invention.

The outcome of a treatment is to at least produce in a treated subject a healthful benefit, which in the case of cardiovascular diseases, includes but is not limited to a reduced risk of re-clogging of arteries after a vascular intervention procedure, and improved circulation.

Interleukin-1 is a major inducer of inflammation and TNF is an important regulator of the reaction. Both cytokines can activate ceramidase, and thus inhibiting the activity of ceramidase can result in an anti-inflammatory effect. This may involve the prevention of the formation of sphingosine and sphingosine phosphate which have pro- inflammatory effects. Also, inhibition of ceramidase may prevent the hypeφroliferation of immune cells that are important for inflammation. There is evidence which suggests that an increase in ceramide and a decrease in sphingosine leads to a decrease in sphingosine phosphate. Preliminary data show that in mouse fibroblast cells, L929, TNFα increases the level of ceramide and leads to PGE2 release from these cells. The release of PGE2 is also shown to be inhibited by D-(N-myristolyamino)-l -phenyl- 1-propanol), D-MAPP, which is an inhibitor of one of the ceramidase. This observation may be important for inhibiting inflammatory reactions that occur in conditions, such as but not limited to rheumatoid arthritis. Thus, it is possible to treat or prevent inflammation by regulating the level of cellular ceramide using the method of the invention. As discussed above, ceramide level can be increased by administering ceramidase antagonists such as a compound that inhibits ceramidase activity, ceramidase-antibodies, antisense and ribozyme molecules, and triple helix-forming molecules. The present invention also relates to the treatment of disorders involving deficient cell proliferation (growth) or in which cell proliferation is otherwise desired (e.g., degenerative disorders, growth deficiencies, lesions, physical trauma) by administering compounds that agonize, (promote) ceramidase function (e.g., ceramidase, agonist of ceramidase, nucleic acids that encode ceramidase). Other disorders that may benefit from activation of cermidase are neurodegenerative disorders (e.g., Alzheimer's disease), and disorders of aging such as immune dysfunction.

The gene of the human ceramidase of the invention is localized on chromosome 10 (lOql l)(i.e., LOC6392). Base on this location, ceramidase may be involved in diseases associated with this region, in addition to the disease and disorder discussed above, which include adenocarcinoma (thyroid), acute myeloid leukemia, and squamous cell cancer, especially that which is associated with the Nasopharynx region.

As discussed above, like treatment of neoplastic conditions, successful treatment of cardiovascular diseases, inflammation or the above-mentioned diseases can be brought about by techniques which serve to decrease ceramidase activity. Activity can be decreased by, for example, directly decreasing ceramidase gene product activity and/or by decreasing the level of ceramidase gene expression.

For example, compounds such as those identified through assays described in Section 5.10, which decrease ceramidase activity can be used in accordance with the invention to treat cardiovascular diseases such as restenosis. As discussed in Section 5.10, such molecules can include, but are not limited to peptides, including soluble peptides, and small organic or inorganic molecules, and can be refeπed to as ceramidase antagonists. Further, antisense and ribozyme molecules which inhibit ceramidase gene expression can also be used in accordance with the invention to reduce the level of ceramidase gene expression, thus effectively reducing the level of ceramidase gene product present, thereby decreasing the level of ceramidase activity. Still further, triple helix molecules can be utilized in reducing the level of ceramidase gene activity. Such molecules can be designed to reduce or inhibit either wild type, or if appropriate, mutant ceramidase activity. Techniques for the production and use of such molecules are well known to those of skill in the art.

In an embodiment, the present invention relates to a method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to said animal a compound that inhibits the ceramidase activity in an amount sufficient to effect said inhibition.

In another embodiment, the present invention relates to a method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to the animal an effective amount of the nucleic acid molecule of claim 13 that targets ceramidase transcripts, and interferes with translation of ceramidase transcripts.

In still another embodiment, the present invention relates to a method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to the animal an effective amount of the nucleic acid molecule of claim 14 that targets ceramidase transcripts, and interferes with translation of ceramidase transcripts.

Techniques for the determination of effective doses and administration of such compounds are described in Section 5.9.1. Any technique which serves to selectively administer nucleic acid molecules to a cell population of interest can be used, for example, by using a delivery complex. Such a delivery complex can comprise an appropriate nucleic acid molecule and a targeting means. Such targeting means can comprise, for example, sterols, lipids, viruses or target cell specific binding agents. Viral vectors that can be used with recombiant viruses include, but are not limited to adenovirus, adeno-associated virus, heφes simplex virus, vaccinia virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.

5.8. GENE THERAPY

Gene therapy refers to treatment or prevention performed by the administration of a nucleic acid to a subject. In this embodiment of the invention, the therapeutic nucleic acid produces intracellularly an antisense nucleic acid molecules that mediates a therapeutic effect by inhibiting ceramidase expression.

For general reviews of the methods of gene therapy, see Goldspiel et al, 1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIBTECH 11(5):155-215). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), 1993, Cuπent Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al. (eds.), 1994, Cuπent Protocols in Human Genetics, John Wiley & Sons, NY.

In one aspect, the therapeutic nucleic acid comprises an antisense ceramidase nucleic acid that is part of an expression vector that produces the antisense molecule in a suitable host. In particular, such a nucleic acid has a promoter operably linked to the antisense ceramidase sequence, said promoter being inducible or constitutive, and, optionally, tissue-specific.

In another particular embodiment, a nucleic acid molecule is used in which the antisense ceramidase sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antisense ceramidase nucleic acid (Koller and Smithies,

1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al, 1989, Nature 342:435-438). Delivery of the nucleic acid into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid-carrying vector or a delivery complex, or indirect, in which case, cells are first transformed with the nucleic acid in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.

Accordingly, the present invention provides a delivery complex comprising an expression construct comprising the nucleic acid sequence of ceramidase gene, antisense, ribozyme, variant, or analog, wherein the nucleotide sequence is operatively associated with a regulatory nucleotide sequence containing transcriptional and/or translational regulatory signals that controls expression of the nucleotide sequence in a host cell, and a targeting means. In a specific embodiment, the nucleic acid is directly administered in vivo, where it is expressed to produce the antisense nucleic acid molecule or encoded nonfunctional ceramidase gene product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by infection using a defective or attenuated retroviral or other viral vector (see U.S. Patent No.

4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in biopolymers (e.g., poly-β-l->4-N-acetylglucosamine polysaccharide; see U.S. Patent No. 5,635,493), encapsulation in liposomes, microparticles, or microcapsules, or by administering it in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432), etc. In another embodiment, a nucleic acid-ligand complex can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180 dated April 16, 1992 (Wu et al); WO 92/22635 dated December 23, 1992 (Wilson et al); WO92/20316 dated November 26, 1992 (Findeis et al); WO93/14188 dated July 22, 1993 (Clarke et al), WO 93/20221 dated October 14, 1993 (Young)). Alternatively, the nucleic acid can be introduced intracellularly and incoφorated within host cell DNA for expression, by homologous recombination (Koller and Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al, 1989, Nature 342:435-438). It is observed that it can be difficult to achieve intracellular concentrations of the antisense sufficient to suppress translation of endogenous mRNAs. Therefore a prefeπed approach utilizes a recombinant DNA construct in which the antisense oligonucleotide or polynucleotide is placed under the control of a strong promoter, some of which are described supra. The use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous ceramidase gene transcripts and thereby prevent translation of the ceramidase gene mRNA. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells. Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Any of the methods for gene therapy available in the art can be used. In a specific embodiment, a viral vector that contains the antisense ceramidase nucleic acid is used. For example, a retroviral vector can be used (see Miller et al, 1993, Meth. Enzymol. 217:581-599). These retroviral vectors have been modified to delete retroviral sequences that are not necessary for packaging of the viral genome and integration into host cell DNA. The antisense ceramidase nucleic acid to be used in gene therapy is cloned into the vector, which facilitates delivery of the gene into a patient. More detail about retroviral vectors can be found in Boesen et al, 1994, Biotherapy 6:291-302, which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al, 1994, J. Clin. Invest. 93:644-651; Kiem et al, 1994, Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-141; and Grossman and Wilson, 1993, Cuπ. Opin. in Genetics and Devel 3:110-114.

Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, 1993, Cuπent Opinion in Genetics and Development 3:499-503 present a review of adenovirus-based gene therapy. Bout et al, 1994, Human Gene Therapy 5:3-10 demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al, 1991, Science 252:431-434; Rosenfeld et al, 1992, Cell 68:143-155; and Mastrangeli et al, 1993, J. Clin. Invest. 91 :225- 234.

Adeno-associated virus (AAV) has also been proposed for use in gene therapy (Walsh et al, 1993, Proc. Soc. Exp. Biol. Med. 204:289-300.

The form and amount of therapeutic nucleic acid envisioned for use depends on the cancer, desired effect, patient state, etc., and can be determined by one skilled in the art.

5.9. PHARMACEUTICAL PREPARATION AND METHODS OF ADMINISTRATION

The compounds and nucleic acid sequences described herein can be administered to a patient at therapeutically effective doses to treat or prevent diseases and disorder discussed above. A therapeutically effective dose refers to that amount of a compound sufficient to result in a healthful benefit in the treated subject. Formulations and methods of administration that can be employed when the therapeutic composition comprises a nucleic acid are described supra.

5.9.1 EFFECTIVE DOSE

Toxicity and therapeutic efficacy of compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50%> of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. Compounds which exhibit large therapeutic indices are prefeπed. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography.

5.9.2 FORMULATIONS AND USE

Pharmaceutical compositions for use in accordance with the present invention can be formulated in conventional manner using one or more physiologically acceptable carriers or excipients. Thus, the compounds and their physiologically acceptable salts and solvents can be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or oral, buccal, parenteral or rectal administration.

For oral administration, the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch, polyvinylpyπolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain buffer salts, flavoring, coloring and sweetening agents as appropriate. Preparations for oral administration can be suitably formulated to give controlled release of the active compound.

For buccal administration the compositions can take the form of tablets or lozenges formulated in conventional manner. For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The compounds can be formulated for parenteral administration (i.e., intravenous or intramuscular) by injection, via, for example, bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

The compounds can also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the compounds can also be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt. 5.9.3 MONITORING THE EFFECT

OF A THERAPEUTIC TREATMENT

The present invention provides a method for monitoring the effect of a therapeutic treatment on a subject who has undergone the therapeutic treatment.

Clinicians very much need a procedure that can be used to monitor the efficacy of these treatments. Ceramidase gene product can be identified and detected in patients with hypeφroliferative disease, cardiovascular disease or inflammation, different manifestations of disease, providing a sensitive assay to monitor therapy. The therapeutic treatments which may be evaluated according to the present invention include but are not limited to radiotherapy, surgery, chemotherapy, vaccine administration, endocrine therapy, immunotherapy, and gene therapy, etc. The chemotherapeutic regimens include, but are not limited to administration of drugs such as, for example, fluorouracil and taxol

The method of the invention comprises measuring at suitable time intervals before, during, or after therapy, the amount of a ceramidase gene product. Any change or absence of change in the amount of the ceramidase gene product can be identified and coπelated with the effect of the treatment on the subject, such as, for example, a reduction of the disease phenotype of the patient.

In a prefeπed aspect, the approach that can be taken is to determine the levels of ceramidase gene product levels at different time points and to compare these values with a baseline level The baseline level can be either the level of the marker present in normal, disease free individuals; and/or the levels present prior to treatment, or during remission of disease, or during periods of stability. These levels can then be coπelated with the disease course or treatment outcome. Elevated levels of ceramidase gene product relative to the baseline level indicate a poor response to treatment.

5.10 SCREENING ASSAYS FOR COMPOUNDS

THAT MODULATE CERAMIDASE ACTIVITY The present invention further provides methods for the identification of compounds that may, through its interaction with the ceramidase gene or ceramidase gene product, provide a therapeutic benefit to the recipient, especially one suffers from cancer, cardiovascular disease, or inflammatory conditions. It is known that ceramidase. the substrate; and sphingosine, the product, bind the enzyme ceramidase. In addition, some phosphatidic acid and cardiolipin can modulate the activity of ceramidase. Hence, these compounds may bind to ceramidase.

The following assays are designed to identify: (i) compounds that inhibit ceramidase activity; (ii) compounds that bind to ceramidase gene products, including mammalian and non-mammalian homologs of ceramidase; (iii) compounds that bind to other intracellular proteins and/or segments of nucleic acid that interact with a ceramidase gene product, including mammalian and non-mammalian homologs of ceramidase; (iv) compounds that interfere with the interaction of the ceramidase gene product, including mammalian and non-mammalian homologs of ceramidase, with other intracellular proteins and/or segments of nucleic acid; and (iv) compounds that modulate the activity of ceramidase gene (i.e., modulate the level of ceramidase gene expression and/or modulate the level of ceramidase activity).

Assays may additionally be utilized which identify compounds which bind to ceramidase gene regulatory sequences (e.g., promoter sequences). See e.g., Platt, 1994, J. Biol. Chem. 269:28558-28562, which is incoφorated herein by reference in its entirety. Also provided is a method for identifying compounds that modulate ceramidase gene expression, comprising: (a) contacting a test compound with a cell or cell lysate containing a reporter gene operatively associated with a ceramidase gene regulatory element; and (b) detecting expression of the reporter gene product. Also provided is another method for identifying compounds that modulate ceramidase gene expression comprising: (a) contacting a test compound with a cell or cell lysate containing ceramidase transcripts; and (b) detecting the translation of the ceramidase transcript. Any reporter gene known in the art can be used, such as but limited to, green fluorescent protein, β-galactosidase, alkaline phosphatase, chloramphenicol acetyltransferase, etc.

Accordingly, an embodiment of the present invention is related to a method of identifying a compound that binds to a ligand selected from the group consisting of a ceramidase protein, a fragment of a ceramidase protein comprising a domain of the protein, and a nucleic acid encoding the protein or fragment, comprising: (a) contacting said ligand with a plurality of molecules under conditions conducive to binding between said ligand and the molecules; and (b) identifying a molecule within said plurality that binds to said ligand.

One embodiment of the present invention is related to a method for identifying compounds that modulate ceramidase gene expression comprising: (a) contacting a test compound with a cell or cell lysate comprising an expression construct comprising a ceramidase gene; and (b) detecting the transcription or translation of the nucleotide sequence of ceradmidase.

Another embodiment of the present invention is related to a method for identifying compounds that modulate ceramidase gene expression, comprising: (a) contacting a test compound with a cell or cell lysate containing a reporter gene operatively associated with the regulatory element of a ceradmidase gene; and (b) detecting expression of the reporter gene product.

An embodiment of the present invention relates to a method for identifying compounds that modulate the activity of ceramidase gene product or homolog of ceramidase gene product comprising: (a) contacting a test compound with an organism or a cell containing ceramidase gene product or homolog of ceramdiase; and (b) comparing the phenotype of the organism or cell with the phenotype of organism or cell that did not contact the test compound, wherein a change in phenotype indicates that the test compound is capable of modulating the activity of ceramidase gene product or homolog of ceramdiase gene product.

5.10.1 ENZYME ASSAYS FOR CERAMIDASE GENE PRODUCT Enzyme assays may be used to detect or measure the ceramidase activity of a test substance, see for example, Section 6.1. The test substance may be a patient sample, cell lysate. a purified preparation of the enzyme, a mutant, a variant, or an analog of ceramidase. This is useful in evaluating whether a given substance has ceramidase activity. For example, this assay may be used to detect whether a given mutant, variant, analog of ceramidase has the ability to hydro lyse ceramide into sphingosine.

The principle of the assays involves preparing a reaction mixture of the test substance and ceramide under conditions and for a time sufficient to allow the substance to convert the ceramide into sphingosine, if the substance has any ceramidase activity. The level of ceramide or sphingosine may be detected in the reaction mixture to determine the amount of ceramidase activity present in the test substance.

Also the assays may be used in screening for compounds that inhibit the enzyme activity. The enzyme assay can be carried out using purified enzyme or a preparation containing ceramidase activity in screening. The test compound can be added directly to the assay reaction, or can be pre-incubated with the ceramidase enzyme. If the ceramidase activity deceases in the presence of a test compound, the test compound has an inhibitory effect on the ceramidase enzyme. If the ceramidase activity increases in the presence of a test compound, the test compound has an agonistic effect on the ceramidase enzyme. Any method, technique or assay format, including high throughput methods known in the art may be used together with this assay for drug screening. It is contemplated that the ceramidase enzyme assays of the invention are used to identify specific inhibitors of the ceramidase protein. Non-specific inhibitors, such as dithiothreitol, are less prefeπed.

5.10.2 IN VITRO SCREENING ASSAYS FOR COMPOUNDS

THAT BIND TO THE CERAMIDASE GENE PRODUCT

In vitro systems may be designed to identify compounds capable of interacting with, e.g., binding to, the ceramidase gene products of the invention and homologs of ceramidase. Compounds identified may be useful, for example, in modulating the activity of wild type and/or mutant ceramidase gene products, may be useful in elaborating the biological function of the ceramidase gene product, may be utilized in screens for identifying compounds that disrupt normal ceramidase gene product interactions, or may in themselves disrupt such interactions.

The principle of the assays used to identify compounds that interact with the ceramidase gene product involves preparing a reaction mixture of the ceramidase gene product, or fragments thereof and the test compound under conditions and for a time sufficient to allow the two components to interact with, e.g., bind to, thus forming a complex, which can represent a transient complex, which can be removed and/or detected in the reaction mixture. These assays can be conducted in a variety of ways. For example, one method to conduct such an assay would involve anchoring ceramidase gene product or the test substance onto a solid phase and detecting ceramidase gene product/test compound complexes anchored on the solid phase at the end of the reaction. In one embodiment of such a method, the ceramidase gene product or fragment thereof may be anchored onto a solid surface, and the test compound, which is not anchored, may be labeled, either directly or indirectly.

In practice, microtitre plates may conveniently be utilized as the solid phase. The anchored component may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished by simply coating the solid surface with a solution of the protein and drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific for the protein to be immobilized may be used to anchor the protein to the solid surface. The surfaces may be prepared in advance and stored.

In order to conduct the assay, the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously nonimmobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the previously nonimmobilized component (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody). Alternatively, a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for ceramidase gene product or the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.

5.10.3 ASSAYS FOR INTRACELLULAR PROTEINS

THAT INTERACT WITH THE CERAMIDASE GENE PRODUCT

Any method suitable for detecting protein-protein interactions may be employed for identifying ceramidase protein-intracellular protein interactions, especially interactions mediated by the various domain of the ceramidase protein.

Among the traditional methods which may be employed are co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns. Surface display library and yeast-based two-hybrid system can also be utilized to isolate the gene encoding such ceramidase-binding proteins.

These methods allows the identification of molecules, including intracellular proteins, that interact with ceramidase gene products. Once isolated, such a protein can be sequenced using techniques well-known to those of skill in the art, such as by Edman degradation (see, e.g., Creighton, 1983, "Proteins: Structures and Molecular Principles," W.H. Freeman & Co., N.Y., pp.34-49). The amino acid sequence obtained may be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for gene sequences encoding such proteins. Screening made be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well-known. (See, e.g., Ausubel, supra, and 1990, "PCR Protocols: A Guide to Methods and Applications," Innis, et al, eds. Academic Press, Inc., New York).

Another method that detects protein interactions in vivo is the two-hybrid system, which is described here for illustration only and not by way of limitation. One example of this approach has been described (Chi en, et al., 1991, Proc. Natl Acad. Sci. USA, 88:9578-9582) and a kit is commercially available from Clontech (Palo Alto, CA).

The two-hybrid system or related methodologies may be used to screen activation domain libraries for proteins that interact with a "bait" gene product. By way of example, and not by way of limitation, ceramidase gene products may be used as the bait gene product. Total genomic or cDNA sequences are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of a bait ceramidase gene product fused to the DNA-binding domain are co-transformed into a yeast reporter strain, and the resulting transformants are screened for those that express the reporter gene. For example, a bait ceramidase gene sequence, such as the open reading frame of the ceramidase gene, can be cloned into a vector such that it is translationally fused to the DNA encoding the DNA-binding domain of the GAL4 protein. These colonies are purified and the library plasmids responsible for reporter gene expression are isolated. DNA sequencing is then used to identify the proteins encoded by the library plasmids.

A cDNA library of the cell line from which proteins that interact with bait ceramidase gene product are to be detected can be made using methods routinely practiced in the art. According to the particular system described herein, for example, the cDNA fragments can be inserted into a vector such that they are translationally fused to the transcriptional activation domain of GAL4. Such a library can be co-transformed along with the bait ceramidase gene-GAL4 fusion plasmid into a yeast strain that contains a lacZ gene driven by a promoter that contains GAL4 activation sequence. A cDNA encoded protein, fused to a GAL4 transcriptional activation domain that interacts with bait ceramidase gene product will reconstitute an active GAL4 protein and thereby drive expression of the HIS3 gene. Colonies that express HIS3 can be detected by their growth on petri dishes containing semi-solid agar based media lacking histidine. The cDNA can then be purified from these strains, and used to produce and isolate the bait ceramidase gene product-interacting protein using techniques routinely practiced in the art.

5.10.4 ASSAYS FOR COMPOUNDS THAT INTERFERE

WITH CERAMIDASE GENE PRODUCTTNTRACELLULAR MACROMOLECULAR INTERACTION

The ceramidase gene products of the invention, fragments thereof, and homologs of ceramidase may, in vivo, interact with one or more intracellular macromolecules, such as proteins and nucleic acid molecules. Such macromolecules may include, but are not limited to DNA, RNA (including polyadenylated (poly(A)) RNA and RNA with the 5' cap structure) and those proteins identified via methods such as those described, above, in Section 5.6.2. For puφoses of this discussion, such intracellular macromolecules are refeπed to herein as "interacting partners". Compounds that disrupt ceramidase interactions in this way may be useful in regulating the activity of the ceramidase gene product, including mutant ceramidase gene products. Such compounds may include, but are not limited to molecules such as peptides, and the like, which would be capable of gaining access to the intracellular ceramidase gene product.

The basic principle of the assay systems used to identify compounds that interfere with the interaction between the ceramidase gene product and its intracellular interacting partner or partners involves preparing a reaction mixture containing the ceramidase gene product, or fragments thereof, and the interacting partner under conditions and for a time sufficient to allow the two to interact and bind, thus forming a complex. In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound may be initially included in the reaction mixture, or may be added at a time subsequent to the addition of ceramidase gene product and its intracellular interacting partner. Control reaction mixtures are incubated without the test compound or with a vehicle or carrier. The formation of any complexes between the ceramidase gene product or fragments thereof and the intracellular interacting partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of the ceramidase gene protein and the interacting partner. Additionally, complex formation within reaction mixtures containing the test compound and normal ceramidase gene protein may also be compared to complex formation within reaction mixtures containing the test compound and a mutant ceramidase gene protein. This comparison may be important in those cases wherein it is desirable to identify compounds that disrupt interactions of mutant but not normal ceramidase gene proteins.

5.10.5 CELL-BASED ASSAYS FOR IDENTIFICATION OF

COMPOUNDS WHICH MODULATE CERAMIDASE ACTIVITY

Cell-based methods are presented herein which identify compounds capable of treating cancer cardiovasular diseases. Inflammation, or hypoproliferative disorders by modulating ceramidase activity. Specifically, such assays identify compounds which affect ceramidase-dependent processes, such as but not limited to changes in cell moφhology, cell division, differentiation, adhesion, motility, or tumorigenicity.

In another embodiment, the cell-based assays are based on expression of the ceramidase gene product in a mammalian cell and measuring the ceramidase-dependent process. Any mammalian cells that can express the ceramidase gene and allow the functioning of the ceramidase gene product can be used, in particular, cancer cells derived from the prostate gland. Other cancer cell lines such as those derived from prostate, liver, ovary, breast, lung, rectum, kidney and non-erythroid hemopoietic cells, may also be used provided that a detectable ceramidase gene product is produced. Recombinant expression of the ceramidase gene in these cells or other normal cells can be achieved by methods described above. In these assays, cells producing functional ceramidase gene products are exposed to a test compound for an interval sufficient for the compound to modulate the activity of the ceramidase gene product. The activity of ceramidase gene product can be measured directly or indirectly through the detection or measurement of ceramidase- dependent cellular processes such as, for example, the manifestation of a transformed phenotype. As a control, a cell not producing the ceramidase gene product may be used for comparisons. Depending on the cellular process, any techniques known in the art may be applied to detect or measure it.

6. EXAMPLE

Using peptide sequences obtained from a purified rat brain ceramidase, a human isoform of ceramidase is identified. This example demonstrates the cloning and expression of human ceramidase gene; and nucleic acid and amino acid sequence analysis of the human ceramidase gene. The human ceramidase gene product was found to be localized in the mitochondria. The experiment also showed that a ceramidase inhibitor inhibited ceramidase activity and reduced the viability of human breast cancer cells.

6.1. MATERIALS AND METHODS Frozen rat brains were purchased from Pel-Freez Biologicals (Rogers, AK).

Hitrap Q-Sepharose high performance, Hitrap blue Sepharose high performance. MonoS (H/R 5/5), MonoP (HR 5/5), and Superose 12 (HR 10/30) columns and phenyl-Sepharose high performance, polybuffer 96, and polybuffer 74 media were purchased from Amersham Pharmacia Biotech. Centriprep and Centricon sample concentrators were from Amicon, Inc. (Beverly, MA). Pro-blue staining and silver staining kits were from Owl Separation Systems (Portsmouth, NH). Triton X-100 was from Sigma. Bradford protein assay, isoelectric focusing gels (pH 3-10), isoelectric focusing standard mixture, and gel electrophoresis apparatus were from Bio-Rad. BCA protein assay, CHAPS, and β-octyl glucoside were from Pierce. Polyacrylamide gels were from Novex. [³H]C₁₆-ceramide, ceramdies with various chain length, sphingosine, and dihydrosphingosine were synthesized as described in Bielawska et al, 1996, J. Biol. Chem. 271 : 12646-12654, and other lipids were from Avanti Polar Lipids.

Human kidney rapid amplification of cDNA ends (RACE) library, human multitissue Northern blot, ExpressHyb solution, pEGFP-C3 vector, RACE DNA polymerase, and anti-GFP polyclonal antibody were from CLONTECH. Taq DNA polymerase and T4 DNA ligase were from Roche Molecular Biochemicals. The vector pcDNA3.1/HisC, TOPO TA cloning kit, and Nick translation kit were from Invitrogen. Kpnl and Apal restriction enzymes were from Promega. Polyvinylidene difluoride membranes were from Applied Biosystems. Bradford protein assay and gel electrophoresis apparatus were from Bio-Rad. Polyacrylamide gels were from Novex. Superfect was from

Qiagen. Mitotracker Red CMXRos and tetramethylrhodamine methylester (TMRM) were from Molecular Probes. α-³²P was from Amersham Pharmacia Biotech. [³H]C₁₆-ceramide was synthesized as described in Bielawska et al, 1996, J. Biol. Chem. 271 : 12646-12654.

Fractionation and Triton X-100 Extraction

Frozen rat brains (53-58g) were thawed in 150 ml of 20mM cold phosphate buffer (pH7.4) containing 0.25M sucrose, ImM EDTA, and 0.2mM phenylmethylsulfonyl fluoride (homogenization buffer). Brains were then homogenized using a Dounce homogenizer. The homogenate was centrifuged at 1 ,000 X g for 10 mins, and the pellet of this centrifugation was homogenized again using 80 ml of homogenization buffer. After centrifugation at 1,000 X g for 10 mins, the pellet was washed twice with 50 ml of homogenization buffer. All supernatants were combined and designated as the postnuclear supernatant fraction. The postnuclear supernatant fraction was then centrifuged at 10,000 X g for 30 mins. The pellet of this centrifugation was resuspended in 145 ml of Tris 20MM, pH 7.4, ImM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 0.5% Triton X-100. After stirring for 1 hr, the Triton X-100-solubilized fraction was obtained by centrifuging the mixture at 10,000 X g for 30 mins. The supernatant (Triton X-100 extreact) was used as a source for ceramidase purification. All steps were carried out at 4°C.

Purification of Rat CDase

The triton X-100 solubilized fraction was applied to a Q-Sepharose column equilibrated with buffer A. After washing the column, CDase activity was eluted with a linear gradient from 0 to 0.3M NaCl in buffer A. Fractions of 5ml were collected. The active fraction obtained from Q-sepharose (NaCl peak) was applied directly to a blue Sepharose Hitrap column equilibrated with buffer B. After washing the column, CDase activity was eluted with a linear gradient of NaCl from 0.075 to 0.4M. Fractions of 2 ml were collected. The active fractions obtained from blue Sepharose were adjusted to 0.6M NaCl and applied to a phenyl-Sepharose column equilibrated with buffer C. After washing the column with buffer C and eluting more proteins by decreasing the NaCl concentration, CDase activity was eluted with a Triton X-100 gradient (0-0.5%) in lOmM Tris buffer, pH 7.5. Fractions of 1 ml were collected. CDase activity and proteins were measured as described.

Peptide Sequences

Rat brain enzyme was purified as described above and also in El Bawab et al, 1999, J. biol Chem. 274: 27948-27955. Three preparations of 100-120 rat brains each were used. The purified protein from the last column was subjected to SDS-polyacrylamide gel electrophoresis, the gel was stained directly with Coomassie Blue or transfeπed to polyvinylidene difluoride membrane using CAPS buffer, pH 11 , as transfer buffer, and the membrane was then stained. The ceramidase (CDase) band was excised from the gel or from the membrane and subjected to digestion using AspN. The digest mixture was separated by microcapillary reversed phase HPLC, and selected peptides were submitted to Edman degradation and sequencing.

Cloning of ceramidase The sequences of the obtained peptides were used to search the Genbank data base. The peptides identified a putative slug protein (accession no. 2367392) and two human sequences (accession no. AA913512 and AC012131). The following primers were synthesized: forward primer based on the AC012131, CTGAGTGGCACTCACACTCATTCAGGT; and the reverse primer based on the EST AA913512, GGCTTCAGAATGTCCTGCTTCCGA. PCR amplification was performed using the human kidney RACE library as a template. A 1.8-kb fragment was obtained. New primers were then designated on the 5'- (reverse, ACCTGAATGAGTGTGAGTGCCACTCAG) and 3'- (forward, TTCGGGGATGTCCTGCAGCCAGCAAAACCTGAATACAG) ends of the 1.8-kb fragment to perform touch down PCR. After two RACE rounds, a 5 '-end fragment of 0.7kb and a 3'-end fragment of 0.6 kb were obtained. Assembling the 1.8-kb fragment and the 5'- and 3 '-ends fragments resulted in a fragment of around 2.5 kb, with a putative open reading frame of 2289 base pairs.

Construction of Full-length CDase Vectors

The full-length CDase fragment was generated by PCR using the forward primer ATGAGTGCCATCACAGTGGCCCTTCTC starting at the longest start codon and the reverse primer ACTAAATAGTTACAACTTCAAAAGCCGGG. The forward primer also contained the Kpnl site sequence, and the reverse primer contained the Apal site sequence. PCR amplification was performed at a denaturing temperature of 94 °C for 1 min followed by annealing at 65 °C for 2.5 min and extension at 72 °C for a total of 35 cycles. The amplified fragment (2289 base pairs) was separated by electrophoresis on 1.5% agarose gel. After purification, the full-length cDNA was subcloned into TOPO blunt end cloning vector. Sequencing, using T7 and Ml 3 reverse primers of the TOPO inserts, revealed multiple full-length clones in the sense and in the antisense direction.

The sense fragments were named TOPO-CDase and were used to construct the pcDNA3.1/ΗisC-CDase vector. To this end, TOPO-CDase vector was digested with Kpnl and Apal overnight. The resulting fragment was gel-isolated and subcloned into the same sites in pcDNA3.1/HisC vector, the His-tag being at the N terminus of ceramidase.

To construct pEGFPC3-CDase vector, the open reading frame of CDase cDNA was first amplified as described above. The amplified product was then digested by restriction enzymes Kpnl and Apal and cloned into Kpnl and Apal sites of the vector pEGFPC3, thus generating a GFP tag at the N terminus of ceramidase protein. The sequence and orientation of the fragments were then confirmed by sequencing.

Northern Blot Analysis Pre-made commercial Northern blot and hybridization solution were used in this experiment. The human EST AA913512 fragment (0.67 kb) was labeled by Nick translation using [³²P]dCTP. The labeled fragment was used to probe a human multi-tissue Northern blot as described in Sambrook et al, 1989, Molecular Clonging: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Each lane on the blot contained 2 μg of poly(A)^{^} RNA. The membrane was first prehybridized overnight at 65 °C in ExpreasHyb solution. The radioactive probe was then denaturated by boiling for 2 mm and added to the blot in ExpressHyb solution. Hybridization was carried out overnight at 65 °C. After washing, the blot was exposed to x-ray film for 5 days at - 80°C.

Transfection

HEK 293 cells, human embryonic kidney cells, and MCF-7 cells were seeded at 10⁵ cells/dish. Transfection with vector alone (pcDNA3.1/ΗisC) or vector containing full-length CDase (pcDNA3.1/HisC-CDase) was performed using Superfect and 3 μg of each plasmid/dish. After 3-4 h of incubation with the mixture, the cells were washed with phosphate-buffered saline and fresh medium was added. After 48 h, CDase activity was measured.

Protein Assay and SDS-Polyacrylamide Gel Electrophoresis

Protein concentration was determined using the Bradford assay. SDS- polyacrylamide electrophoresis was performed according to Laemmli, 1970, nature 227:

680-685.

53 - Western Blot

Cells were scraped in 1 ml of lysis buffer (50 mM Tris, pH 7.4, 5 mM EDTA, 1% Triton X-100. 300mM NaCI, 1 mM phenylmethylsulfonyl fluoride, and 2 μg/ml of leupeptin and aprotinin) and kept on ice for 10-15 mm. To remove insoluble material, lysates were centrifuged at 12,000 x g for 15 min. Samples (10 μg of lysates) were then boiled for 5 min, loaded onto a 7.5% SDS-polyacrylamide gel, electrophoresed, and transfeπed to a nitrocellulose membrane. The GFP-CDase fusion protein was detected by using anti-GFP affinity purified antibody at a dilution of 1 : 1000 and a anti-rabbit secondary antibody at a dilution of 1 :3000.

Immunoprecipitation

For immunoprecipitation, cell lysates were first precleared by incubating with 30 μl of a mixture of protein A/protein G agarose beads for 30 min followed by centrifugation at 12,000 x g for 1 min. The cleared lysates were then rocked in the presence of 5 μg of anti-GFP antibody or 5 μg of control IgG complexed to a mixture of protein

A/protein C agarose. After 2 h of incubation, the beads were centrifuged at 12,000 x g for 10 s, washed twice with 0.5 ml of lysis buffer without protease inhibitors and with only 0.1%) Triton X-100 (wash buffer). All steps were carried out at 4°C. Beads were finally resuspended in wash buffer, and ceramidase activity was measured.

Ceramidase Activity

CDase activity was measured as described in El Bawab et al, 1999, J. Biol. Chem. 274(39): 27948-27955; and Yavin et al, 1969, Biochem. 8: 1692-1698, using [³H]C₁₆-ceramide as substrate in a mixed micelle assay system. Briefly, lOnmol of [³H]C₁₆- ceramide were mixed with 1 OOμl of Triton X- 100 (0.2%) and 1 OOμl of sodium cholate

(0.4%) in chloroform/methanol (2:1), and the solvent was dried. The dried mixture was resuspended in water by heating at 80 °C for 5 seconds, and the appropriate buffer and amount of enzyme were added. The reaction was terminated by adding 2ml of isopropyl alcohol/heptane/1 N NaOH, 4:1:0.1 (Dole solution), followed by 1 ml of water and 1ml of heptane. After centrifugation, the upper phase was discarded, and the lower phase was washed twice with heptane. Finally, 1 ml of sulfuric acid (IN) and 2 ml of heptane were added, the mixture was centrifuged, and the upper phase containing the fatty acid was counted in liquid scintillation. In the experiments of enzyme characterization or where the effects of other lipids were tested, these lipids were dried with the substrate and then resuspended in lOOμl of Trinton X-100 (1%). The final Triton X-100 concentration in the assay was 0.5%. One unit of enzyme activity is defined as the amount of enzyme required to hydrolyze lnmol of ceramide/min at 37°C.

Microscopy

Cells were plated on 35-mm diameter glass coverslips. They were transfected with 1 μg of empty vector or vector-containing ceramidase as described above. After 48 h, the cells were loaded with 25 nM Mitotracker Red for 20 min and then washed with phosphate-buffered saline and fixed. For confocal microscopy, images were collected by Zeiss 410 LSCM system equipped with krypton Argon laser and a 60 X oil merge lens (N.A 1.4). After 48 h of transfection, cells plated on glass coverslips were mounted on a microscopy stage and maintained in phosphate-buffered saline buffer. GFP images were collected by excitation at 488 nm and emission at 516-560 nm. To label mitochondria, cells were subsequently co-loaded with 50 nM TMRM. The TMRM images were then taken by excitation at 568 nm and emission at 590 nm long-path emission filter. To avoid fluorescent cross-talking, green GFP and red TMRM fluorescence were taken sequentially.

Effect of Urea-C16-Ceramide on Ceramidase activity Ceramidase was purified from rat brain as described above. Ceramidase was shown to be inhibited by reducing agents such as dithiothreitol and β-mercaptoethanol (El Bawab et al, 1999, J. Biol. Chem. 274(39):27948-27955. Another inhibitor, Urea-C 16- Ceramide, was used to test its effect on ceramidase activity. The effect of Urea-C 16- Ceramide was then tested for inhibition using the purified enzyme (5-10 ng of protein in the assay) and [³H]-C₁₆-ceramide as substrate in a mixed micelles system as described above.

Results are expressed as % of control value, control being the activity in the absence of the Urea-C 16-ceramide.

Effect of Urea-C16-Ceramide on MCF7 cells The MCF7 cells were seeded in 100 mm dishes. Next day, the cells were treated with Urea-C 16-Ceramide at the indicated concentration for 18 h. Urea-C 16- Ceramide was delivered in a solution of ethanol containing 2 % dodecane. After 18 h, cell viability was assayed using a MTT assay. MTT Assay

This is a colorimetric assay that measures the reduction of

3-(4,5-dimethylthiazol-2-yl)-2,5,-diphenyl tetrazolium bromide (MTT) by mitochondrial succinate dehydrogenase. The MTT enters the cells and passes into the mitochondria where it is reduced to an insoluble, colored, formazen product. The cells are then solubilised with an organic solvent (isopropanol) and the released, solubilised formazen reagent is measured spectrophotometrically. Since reduction of MTT can only occur in metabolically active cells the level of activity is a measure of the viability of the cells. Mossman T., 1993, J. Immunol. Meth. 65: 55-63; Berridge et al, 993, Archives of Biochemistry & Biophysics 303: 474-482. Day 1 : 50 ul cells (-5,000 cell) were plated into each well of 96 well- plate; day 2: 50 ul of 2x concentration of Urea-C 16-Ceramide were added into each well; day 3: 25 ul of MTT from a stock of 5 mg/ml in PBS were added to each well and incubated for 5 hours; 100 ul of lysing buffer which contains: 20% SDS (w/v), 50% N,N Dimethyl formamide (v/v), 1% acetic acid (v/v), and 50 % water (v/v) were added to each well and let stand overnight; day 4: absorbance was read using a spectrophotometer at 595 nm.

6.2. RESULTS 6.2.1. Sequencing and Cloning of Cdase

A rat brain CDase was purified to homogeneity with a pH optimum in the neutral to alkaline range. El Bawab et al, 1999, J. Biol. Chem. 274:27948-27955. The scale up of the purification protocol was optimized to obtain high amounts of the protein. In each preparation (100-120 rat brains), 1-10 μg of CDase protein were obtained (visible by Coomassie Blue). After digestion and HPLC separation of the AspN digest, three peptide sequences of 14-17 amino acids (Table 2) were obtained. The data base of the GenBank™ was searched using peptides 1 and 2, and the same human EST sequence (accession no.

AA913512) was identified by both peptides. Using the human EST, all three peptides were searched and identified a putative slug protein (accession no. 2367392). The human EST aligned at the C terminus of the slug protein. Next, the slug protein was used to search the GenBank™ Data base, and this yielded a human genomic sequence of 15,960 kb (accession no. AC012131), which aligned with a region close to the N terminus of the slug protein.

Thus, by performing this search and based on the slug putative protein sequence, human nucleotide sequences were obtained that were localized close to the N and C terminus of the human protein. Based on these observations, a forward primer from this human genomic sequence (no. AC012131) and a reverse primer from the human EST (no. AA913512) sequence were designed, and PCR was performed using a human kidney library as template. Gel analysis of the PCR reaction showed that a 1.8-kb fragment was amplified, in close agreement to what was expected based on the slug sequence. This fragment was isolated, subcloned, and sequenced. It contains the human EST (accession no. AA913512), indicating that this 1.8-kb fragment coπesponds to part of the human CDase sequence.

New primers of both ends of the 1.8-kb human fragment were synthesized, and RACE-PCR was performed using a human kidney RACE library as template. After two rounds of PCR, a 5'-end fragment of 0.7 kb and a 3'-end fragment of 0.6 kb were obtained. These fragments were then gel-isolated, subcloned into TOPO vector, and sequenced. The fragments contained the primer sequences, part of the 1.8 kb-fragment, and did not identify any EST in the GenBank™ of known function, indicating that these fragments most probably coπespond to the extension of the 5'-end and the 3'-end of the 1.8-kb human fragment. The 5 '-end fragment contained multiple start ATG codons in frame, and the

3 '-end contained two stop codons next to each other. Taking the first ATG (longest) as start codon and the double stop codon at the 3 '-end as stop codon, an open reading frame of 2289 base pairs encoding a protein of 84 kDa was predicted.

Primers of both ends, starting at the predicted start and stop codons were made and used to amplify the full-length CDase cDNA from the human kidney library. The full-length CDase cDNA was finally subcloned into pcDNA3.1/HisC and pEGFP-C3 mammalian expression vectors, and the coπect sequence and orientation were identified by sequencing. The full-length CDase sequence and the predicted amino acid sequence are shown in Fig. 3, Fig. 3 also shows the position of the sequenced peptides obtained from rat brain, and Table 2 presents their identity to the cloned human enzyme.

Analysis of the protein sequence using the SMART program revealed one transmembrane domain between amino acids 505 and 525 (Fig. 3) and three other putative transmembrane domains (amino acids 176-196, 313-333, 431-451, and 543-563). The sequence also revealed the presence of a signal peptide (amino acids 1-19) and a region of low compositional complexity (amino acids 38-66). This region of low complexity showed some futures of a mitochondrial targeting sequence, it was rich in amino acids serine and alanine, contained two positively charged amino acids (arginine and histidine), and did not contain acidic residues (Claros et al, 1996, Eur. J. Biochem 241 : 779-786). Further analysis using the program PSORT at the Expasy Molecular Biology server showed that at a probability of 66% this peptide sequence would localize in mitochondria. Also, a putative myristoylation site (Fig. 3), several putative phosphorylation sites (protein kinase C, cAMP- dependent protein kinase, and casein kinase 2) and putative N-glycosylation sites were identified.

The CDase amino acid sequence showed no similarity to any known mammalian protein. The protein was homologous to three putative proteins from Arabidospis thaliana (accession no. AAD32770), Mycobacterium tuberculosis (accession no. CAB09388), and Dictyostelium discoideum (accession no. 2367392) (Fig. 4), indicating that these proteins may be ceramidases in those organisms. There were several blocks highly conserved in all of these proteins, and the overall homology between the human and those proteins ranged between 30 and 50%.

6.2.2. Northern Blot Analysis

To determine tissue distribution of this ceramidase, we performed Northern blot analysis using the 3 '-end of CDase cDNA (0.67 kb) as a probe and a human premade multitissue Northern blot, Fig. 5 shows the presence of a minor high size band at around 7 kb, a major band of 3.5 kb, and two other minor bands of 3.1 and 2.4 kb. The presence of multiple bands could be the result of alternative splicing. The major 3.5-kb ceramidase band was ubiquitously expressed in all tissue represented on the blot, with the highest expression in kidney, skeletal muscle, and heart.

6.2.3 Overexpression and Characterization of Cdase HEK 293 cells and MCF7 cells were transfected with empty vector

(ρcDNA3.1/HisC) or vector containing the full-length CDase (pcDNA3.1/HisC-CDase). Cells were then harvested, and ceramidase activity was measured on the lysates. As shown in Fig. 4A, overexpression of CDase in these cells increased CDase activity (at pH 9.5) 50- fold in HEK 293 cells and 12-fold in MCF7 cells as compared with control empty vector- transfected cells.

To ascertain that the cloned cDNA encodes ceramidase protein, a GFP- tagged ceramidase was constructed, in which the GFP was at the N terminus of ceramidase protein. 293 cells were transfected with this construct and performed Western blot and immunoprecipitation experiments using GFP antibody. As shown in Fig. 6B. cells overexpressing the fusion protein contain a GFP -positive band at around 123 kDa, this band being absent in control cells transfected with the pEGFPC3 empty vector. Based on GFP molecular mass (27 kDa), CDase molecular mass was deduced to be around 96 kDa. This was in agreement with 90 kDa mass on SDS-polyacrylamide gel electrophoresis of the rat brain purified enzyme. Further, immunoprecipitation of the fusion protein with anti-GFP antibody increased CDase specific activity by 8-fold in the immunoprecipitant, whereas control rabbit IgG failed to immunoprecipitate any activity. All together, these results clearly indicate that the cloned full-length cDNA encodes the CDase protein.

Next, the properties of this human enzyme were compared to the rat brain enzyme. To this end, 293 cells were transfected with the pcDNA3.1/HisC-CDase construct, and characterization experiments were performed using lysates of these over-expressing cells. Fig. 4C shows the pH profile of the human CDase. The enzyme catalyzed the hydrolysis of ceramide in a relatively broad range with a pH optimum between pH 7.5 and 9.5. The effect of EDTA, MgCl₂, and CaCl₂ (all at 10 mM) were tested and found that they did not affect significantly ceramidase activity. Dithiothreitol at 20 mM was found to inhibit the activity by 75% (Fig. 6D). Finally, the predicted isoelectric point value was 6.69. All these properties are in close agreement with the purified rat brain enzyme.

6.2.4. Localization of Ceramidase Previous results of tissue subfractionation, together with the putative mitochondrial targeting sequence suggested the possible localization of this ceramidase in mitochondria. To assess this hypothesis, MCF7 and HEK 293 cells were transfected with the GFP -tagged ceramidase construct. After transfection, cells were stained with Mitotracker Red, a specific mitochondrial probe. In MCF7 and HEK 293 cells, the GFP control signal (empty vector) was diffuse in all compartments whereas the GEP-ceramidase signal colocalized with the red mitochondrial probe (Fig. 8A). To further confirm these observations, similar experiments were performed using confocal microscopy. Results in MCF7 and HEK 293 pEGFPC3-Cdase-transfected cells showed a punctuate mitochondrial pattern of the GFP-ceramidase signal (Fig. 8B). The addition of a TMRM mitochondrial probe showed that the ceramidase fusion protein signal colocalizes again with this mitochondrial probe (Fig. 8B), clearly demonstrating that this ceramidase is localized in mitochondria. 6.2.5. Effect of Urea-C16-ceramide on ceramidase activity

In order to determine the effect of Urea-C ₁₆- Ceramide on ceramidase activity, ceramidase activity is measured with increasing concentration of Urea-C ₁₆-ceramide. Figure 9A is a graph expressed as ceramidase activity measured in % of control ceramidase activity verses concentration of Urea-C₁₆-ceramide. The effect of Urea-C ₁₆-ceramide was tested for inhibition using the purifed enzyme (5-10ng of protein in the assay) and [³H]-C₁₆-ceramide as substrate in a mixed micelles system as described above. The result shows that Urea-C, ₆- ceramide is an inhibitor of rat brain ceramidase. Increase in concentration of inhibitor decreases the ceramidase activity.

6.2.6. Effect of Urea-C₁₆-Ceramide on MCF7 cell viability

In order to determine the effect of Urea-C ₁₆-Ceramide on MCF7 cell viability. Viability of human breast cancer cell line MCF7 is measured with increasing concentration of Urea-C ₁₆-ceramide. Figure 9B is a graph expressed as cell viability measured in % of control cells verses concentration of Urea-C ₁₆-ceramide. Cell viability, determined by the MTT assay, decreases with increasing concentration of Urea-C, ₆- ceramide. This result shows that Urea-C, ₆-ceramide decreases the viability of human cancer cell line. This result together with the result in the inhibition assay using Urea-C, ₆-ceramide suggest that an inhibitor of ceramidase decreases the viability of human cancer cell line. \

6.3. DISCUSSION The first mammalian mitochondrial ceramidase was cloned and characterized as described above. The enzyme has characteristics similar to the rat brain purified enzyme in its estimated molecular mass, isoelectric point, optimum pH, and dependence on cations (El Bawab et al, 1999, J. Biol. Chem. 274: 27948-27955). Several ceramidase enzymes in bacteria, plant, and mammals have been reported. Okino et al. published the cloning of an alkaline ceramidase from Pseudomonas aeruginosa (accession no. 6594292). Okino et al, 1999, J. Biol Chem. 274:36616-36622. Tani et al. published the purification of a ceramidase protein from mouse liver (Tani et al, 2000, J. Biol. Chem. 275: 3462-3468). The sequence of this protein was also homologous to the M. tuberculosis GenBank™ putative protein.

In addition, Mao et al. reported the cloning of an alkaline ceramidase from the yeast Saccharomyces cerevisiae (Mao et al, 2000, J. Biol. Chem. 275:6876-6884). Two lines of evidence suggest that this yeast enzyme is different from the human mitochondrial ceramidase. First, amino acid comparison showed no homology between the two proteins. Second, the yeast enzyme failed to hydrolyze C_I6-ceramide but rather uses phytoceramide preferentially as a substrate. Further, the whole genome of S. cerevisiae has been reported. Very interestingly, no protein or DNA sequence from S. cerevisiae homologous to the human, slug, or mycobacterium ceramidase. It is very intriguing that lower organisms such as M. tuberculosis and P. aeruginosa harbor a mitochondrial ceramidase-like gene in their genome, whereas the eukaryotic genome of S. cerevisiae does not. On the other hand, in their reports, Mao et al. and Tani et al. have shown that the yeast ceramidase and the purified mouse ceramidase can also catalyze the reverse reaction by condensing phytosphingosine or sphingosine and a free fatty acid into phytoceramide or ceramide. Both enzymes failed to use fatty acyl-CoA as substrate. Using purified rat brain enzyme, it was also found that the purified enzyme catalyzes the synthesis of ceramide through a CoA-independent mechanism. These observations raise the important question of the physiological function of these enzymes in cells and their role in ceramide metabolism.

Finally, the present evidence indicating that the human enzyme localizes in mitochondria. This nearly exclusive presence of this ceramidase in mitochondria suggests the existence of a specific pool of ceramide in mitochondria. Given the emerging significance of both mitochondria and sphingolipid metabolism in the regulation of stress and apoptosis, this localization of ceramidase to mitochondria raises possibilities of a specific function of mitochondrial sphingolipids in cell regulation (Budihardjo et al, 1999, Annu. Rev. Cell. Dev. Biol. 15: 269-290; Hannun et al, 2000, Trends Cell. Biol 10: 73-80; and Mathias et al, 1998, Biochem. J. 335: 465-480).

7. DEPOSIT OF MICROORGANISM

Bacteria strain E. coli containing plasmid Mito-CDase-TOPO/BII was deposited on January 25, 2001 with the American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209, under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφoses of Patent Procedures, and assigned Accession No. . The present invention is not to be limited in scope by the microorganism deposited or the specific embodiments described herein. The specific embodiments described which are intended as single illustrations of individual aspects of the invention, and functionally equivalent methods and components are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

Various references are cited herein, the disclosures of which are incoφorated by reference in their entireties.

Claims

IN THE CLAIMS:

1. An isolated nucleic acid molecule comprising:

(a) the nucleotide sequence of SEQ ID NO: 1;

(b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2;

(c) the nucleotide sequence of a ceramidase gene contained in plasmid Mito- CDase-TOPO/BII as deposited with the ATCC; or

(d) the complement of the nucleotide sequence of (a), (b) or (c).

2. An isolated nucleic acid molecule comprising a nucleotide sequence that hybridizes under medium stringent condition to a nucleic acid probe consisting of:

(a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: l; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b); wherein said medium stringent condition comprising prehybridization for 8 h to overnight at 55 °C, in buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml salmon sperm DNA; hybridization for 48 h at 55 °C in a buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml denatured salmon sperm DNA; and washing twice for 30 min at 60°C in a buffer composed of lxSSC 0.1%SDS.

3. The isolated nucleic acid molecule of claim 1 or 2, which is genomic DNA, with the proviso that the isolated nucleic acid molecule does not consists of the nucleotide sequence of Genbank sequence accession no. AC 012131.

4. The isolated nucleic acid molecule of claim 1 or 2, which is cDNA.

5. The isolated nucleic acid molecule of claim 1 or 2, which is RNA.

6. An isolated nucleic acid comprising a nucleotide sequence that consists of at least 8 consecutive nucleotides of :

(a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: i ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to amino acid position 554 or amino acid position 750 to 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a), or (b).

7. A nucleic acid probe consisting of at least 8 nucleotides, wherein the nucleic acid probe is hybridizable under medium stringent condition to at least a portion of:

(a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: i ; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or (c) the complement of the nucleotide sequence of (a) or (b); wherein said medium stringent condition comprising prehybridization for 8 h to overnight at 55 °C, in buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml salmon sperm DNA; hybridization for 48 h at 55 °C in a buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml denatured salmon sperm DNA; and washing twice for 30 min at 60°C in a buffer composed of lxSSC 0.1%SDS.

8. A nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of nucleotide position 1 to nucleotide position 1702 or nucleotide position 2289 to nucleotide position 2583 of SEQ ID NO: l; (b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of amino acid position 1 to 554 or amino acid position 750 to amino acid position 761 of SEQ ID NO: 2; or

(c) the complement of the nucleotide sequence of (a), or (b); wherein said deletion mutant encodes a fragment of a ceramidase protein that displays one or more functional activities of ceramidase protein.

9. A nucleic acid molecule comprising the nucleotide sequence of a deletion mutant of : (a) the nucleotide sequence of SEQ ID NO: 1;

(b) a nucleotide sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2; or

(c) the complement of the nucleotide sequence of (a), or (b); wherein said nucleotide sequence of said deletion mutant comprises more than 791 nucleotides.

10. The nucleic acid molecule of claim 8 or 9 in which the transmembrane domain, the signal peptide, the region of low compositional complexity, the phosphorylation site, the N- glycosylation site, or a combination thereof, are deleted.

11. The nucleic acid molecule of claim 8 or 9 in which one or more amino acid residues within the transmembrane domain, the signal peptide, the region of low compositional complexity, the phosphorylation site, or the N-glycosylation site, are deleted.

12. A nucleic acid molecule comprising a nucleotide sequence that hybridizes to the complement of the nucleic acid sequence of SEQ ID NO.T and encodes a polypeptide with one or more activities of a ceramidase protein, linked uninterrupted by stop codons to a coding sequence that encodes a heterologous protein or peptide.

13. A nucleic acid molecule that is single-stranded, and that hybridizes under highly stringent conditions to a nucleic acid probe having the nucleotide sequence of SEQ ID NO:l.

14. A nucleic acid comprising a nucleotide sequence encoding a ceramidase-specific ribozyme, which comprises an autocatalytic cleaving ribozyme, and a region that hybridizes under highly stringent conditions to a nucleic acid having the nucleotide sequence of SEQ ID NO:l.

15. A recombinant vector comprising the nucleic acid molecule of Claim 1, 2, 6, 8, 9, or 12.

16. An expression construct comprising the nucleic acid molecule of Claim 1, 2, 6, 8, 9, or 12, wherein the nucleotide sequence is operatively associated with a regulatory nucleotide sequence containing transcriptional and/or translational regulatory signals that controls expression of the nucleotide sequence in a host cell.

17. A genetically engineered host cell containing the nucleic acid molecule of 1, 2, 6, 8, 9, or 12.

18. A genetically engineered host cell containing the nucleic acid molecule of 1, 2, 6, 8, 9, or 12, wherein the nucleotide sequence is operatively associated with a regulatory nucleotide sequence containing transcriptional and/or translational regulatory information that controls expression of the nucleotide sequence in the host cell.

19. A delivery complex comprising an expression construct comprising the nucleic acid molecule of Claim 1, wherein the nucleotide sequence is operatively associated with a regulatory nucleotide sequence containing transcriptional and/or translational regulatory signals that controls expression of the nucleotide sequence in a host cell, and a targeting means.

20. The delivery complex of claim 19, wherein the targeting means is selected from the group consisting of a sterol, a lipid, a virus, or a target cell specific binding agent.

21. A delivery complex comprising a nucleic acid molecule of Claim 13 or 14, and a targeting means.

22. The delivery complex of claim 21, wherein the targeting means is selected from the group consisting of a sterol, a lipid, a virus, or a target cell specific binding agent.

23. A transgenic non-human mammal in which the cells comprises a transgene encoding a ceradmidase protein having an amino acid sequence that is at least 60% identical to SEQ ID NO: 2, wherein the cells express the ceradmidase protein.

24. A transgenic non-human mammal whose somatic and germ cells comprise at least one genetically engineered disruption in a ceradmidase gene, wherein said ceradmidase gene hybridizes under medium stringency conditions to a nucleic acid molecule consisting of the nucleotide sequences of SEQ ID NO: 1, and wherein expression of ceradimase protein encoded by said ceradmidase gene is reduced; wherein said medium stringent condition comprising prehybridization for 8 h to overnight at 55 °C, in buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml salmon sperm DNA; hybridization for 48 h at 55 °C in a buffer composed of 6X SSC, 5x Denhart's with 0.5%SDS and 100 μg/ml denatured salmon sperm DNA; and washing twice for 30 min at 60 °C in a buffer composed of lxSSC 0.1%SDS.

25. A method for detecting in a sample the presence of a ceramidase nucleic acid, said method comprising:

(a) contacting the sample with a nucleic acid probe capable of hybridizing to at least a portion of the nucleic acid molecule of claim

1 under hybridizing conditions; and

(b) measuring the hybridization of the probe to the nucleic acids of the sample, thereby detecting the presence of the ceramidase nucleic acid.

26. A method for detecting in a sample the presence of the ceramidase nucleic acid, said method comprising:

(a) contacting the sample with two diffferent nucleic acid primers capable of hybridizing to at least a portion of the nucleic acid molecule of claim 1 under hybridizing conditions;

(b) selectively amplifying the portion of the nucleic acid molecule of claim 1 flanked by the two nucleic acid primers; and

(c) detecting the amplified nucleic acid, thereby detecting the presence of the ceramidase nucleic acid.

27. A method of making a ceramidase polypeptide comprising the steps of:

(a) culturing the cell of claim 18 under the appropriate conditions to produce ceramidase polypeptide; and (b) isolating the ceramidase polypeptide.

28. An isolated ceramidase polypeptide comprising:

(a) an amino acid sequence encoded by the coding region of the nucleotide sequence of SEQ ID NO:l;

(b) the amino acid sequence of SEQ ID NO:2; or

(c) the amino acid sequence encoded by the coding region of a ceramidase gene contained in plasmid Mito-CDase-TOPO/BII as deposited with the ATCC.

29. A polypeptide encoded by the nucleic acid molecule of claim 2.

30. An isolated polypeptide, the amino acid sequence of which comprises at least six consecutive residues of SEQ ID NO: 2.

31. An isolated polypeptide, the amino acid sequence of which comprises at least one region selected from the group consisting of residues 1 to 19, 38-66, 176-196, 313-333, 431- 451, 505-525, and 543-563 of SEQ ID NO: 2.

32. An isolated polypeptide, the amino acid sequence of which comprises SEQ ID NO: 2 with at least one conservative amino acid substitution.

33. An isolated polypeptide which is at least 60%> identical to the ceramidase polypeptide having the amino acid sequence of SEQ ID NO:2, and displays one or more functional activities of ceramidase protein.

34. A chimeric protein comprising a fragment of a ceramidase protein consisting of at least 6 amino acids fused via a covalent bond to an amino acid sequence of a second polypeptide.

35. A pharmaceutical preparation comprising a therapeutically effective amount of the polypeptide of claim 28 and a pharmaceutically acceptable carrier.

36. An antibody preparation which binds a ceramidase protein of claim 28.

37. A molecule comprising a fragment of the antibody of claim 36, which fragment binds a ceramidase protein.

38. The antibody preparation of claim 36 which comprises a monoclonal antibody.

39. A method of diagnosing a disease or disorder characterized by an abeπant level of ceramidase RNA or protein in a subject, comprising measuring the level of ceramidase RNA or protein in a sample derived from the subject, in which an increase or decrease in the level of ceramidase RNA or protein, relative to the level of ceramidase RNA or protein found in an analogous sample not having the disease or disorder indicates the presence of the disease or disorder in the subject.

40. A method of diagnosing or screening for the presence of or a predisposition for developing a disease or disorder involving cell oveφroliferation or sphingolipid signal transduction in a subject comprising measuring the level of ceramidase protein, ceramidase RNA or ceramidase functional activity in a sample derived from the subject, in which a decrease in the level of ceramidase protein, ceramidase RNA, or ceramidase functional activity in the sample, relative to the level of ceramidase protein, ceramidase RNA, or ceramidase functional activity found in an analogous sample not having the disease or disorder or a predisposition for developing the disease or disorder, indicates the presence of the disease or disorder or a predisposition for developing the disease or disorder.

41. A method of diagnosing or screening for the presence of or a predisposition for developing a disease or disorder involving cell oveφroliferation sphingolipid signal transduction in a subject comprising detecting one or more mutations in ceramidase DNA,

RNA or protein derived from the subject in which the presence of said one or more mutations indicates the presence of the disease or disorder or a predisposition for developing the disease or disorder.

42. A kit comprising in one or more containers a molecule selected from the group consisting of an anti-ceramidase antibody, a nucleic acid probe capable of hybridizing to a ceramidase RNA, or a pair of nucleic acid primers capable of priming amplification of at least a portion of a ceramidase nucleic acid.

43. A method of increasing the level of ceramide in a cell comprising contacting the cell with a compound that inhibits the ceramidase activity of the polypeptide of claim 28 in an amount sufficient to effect said inhibition.

44. A method of inhibiting the formation of sphingosine in a cell comprising contacting the cell with a compound that inhibits the ceramidase activity of the polypeptide of claim 28 in an amount sufficient to effect said inhibition.

45. A method of increasing the intracellular levels of ceramide in an animal comprising administering to said animal a compound that inhibits the ceramidase activity of the polypeptide of claim 28 in an amount sufficient to effect said inhibition.

46. A method of inhibiting the intracellular formation of sphingosine in an animal comprising administering to said animal a compound that inhibits the ceramidase activity of the polypeptide of claim 28 in an amount sufficient to effect said inhibition.

47. A method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to said animal a compound that inhibits the ceramidase activity of the polypeptide of claim 28 in an amount sufficient to effect said inhibition.

48. A method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to the animal an effective amount of the nucleic acid molecule of claim 13 that targets ceramidase transcripts. and interferes with translation of ceramidase transcripts.

49. A method of treating a disease or disorder associated with cell oveφroliferation or sphingolipid signal transduction in an animal comprising administering to the animal an effective amount of the nucleic acid molecule of claim 14 that targets ceramidase transcripts. and interferes with translation of ceramidase transcripts.

50. The method according to claim 47 in which the disease or disorder is selected from the group consisting of cancer, cardiovascular disorder, and inflammation.

51. The method according to claim 48 in which the disease or disorder is selected from the group consisting of cancer, cardiovascular disorder, and inflammation.

52. The method according to claim 49 in which the disease or disorder is selected from the group consisting of cancer, cardiovascular disorder, and inflammation.

53. A method of identifying a compound that binds to a ligand selected from the group consisting of a ceramidase protein, a fragment of a ceramidase protein comprising a domain of the protein, and a nucleic acid encoding the protein or fragment, comprising: (a) contacting said ligand with a plurality of molecules under conditions conducive to binding between said ligand and the molecules; and (b) identifying a molecule within said plurality that binds to said ligand.

54. A method for identifying compounds that modulate ceramidase gene expression comprising:

(a) contacting a test compound with a cell or cell lysate comprising an expression construct of claim 16; and

(b) detecting the transcription or translation of the nucleotide sequence of ceradmidase.

55. A method for identifying compounds that modulate ceramidase gene expression, comprising:

(a) contacting a test compound with a cell or cell lysate containing a reporter gene operatively associated with the regulatory element of a ceradmidase gene; and

(b) detecting expression of the reporter gene product.

56. A method for identifying compounds that modulate the activity of ceramidase gene product or homolog of ceramidase gene product comprising: (a) contacting a test compound with an organism or a cell containing ceramidase gene product or homolog of ceramdiase; and (b) comparing the phenotype of the organism or cell with the phenotype of organism or cell that did not contact the test compound, wherein a change in phenotype indicates that the test compound is capable of modulating the activity of ceramidase gene product or homolog of ceramdiase gene product.