WO2001055383A1 - A novel polypeptide, a human kinesin 9 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, a human kinesin 9, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammations etc. The invention also disclosed the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel human kinesin 9.

Description

 A new polypeptide-human kinesin 9 and polynucleotides encoding such polypeptides.

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide, human kinesin 9, and a polynucleotide sequence encoding the polypeptide. The invention also relates to a method and application for preparing such polynucleotides and polypeptides. Background technique

 Kinesin is a chemical kinetic protein that can use the energy generated by the hydrolysis of ATP to generate mechanical forces. In the presence of ATP, kinesin can bind to microtubules and move on them. Therefore, the drive protein is also called "molecular motor". Kinesin is present in almost all cells. Most kinesins are free in the cytoplasm, while some are related to different membrane-bound organelles, such as cell vesicles, endoplasmic reticulum, and some membrane structures between the endoplasmic reticulum and the Golgi apparatus. Injecting kines in heavy chain (KHC) antibodies into cells can inhibit the movement of lysosomal, Golgi-derived transport vesicles and membrane-bound pigment particles. Injecting antisense nucleic acids of KHC mRNA into cells can prevent anterograde axial transport of many proteins.

 Kinesin also exists in the ciliary and flagellar systems of eukaryotic cells and is closely related to its 9 + 2 microtubule structure, which may participate in the relative rotational movement of the two microtubule fibers located at the center of the 9 + 2 structure. Another kinesin-like protein, kinesin II (knes inl l), exists not only in the movable 9 + 2 cilia / flagellar movement system, but also in the immobile 9 + 0 cilia system, and a This type of transmission is called inter-flagellar transmission.

 In cell division, kinesin and other kinesin-related proteins (KRPs) provide motive power for spindle formation, maintenance, binding to chromosomes, and movement of chromosomes to the poles. Kinesins are indispensable in the formation of spindle poles and the arrangement of chromosomes in the equatorial plate. There is also evidence that kinesin can accelerate the depolymerization of microtubules, so kinesin may have a role in regulating the microtubule dynamics during mitosis. In addition, kinesin-spindle binding was also found in oocyte meiosis, which explained the role of kinesin in gamete formation.

Almost all kinesins contain a backbone composed of two alpha helix fibers intertwined with each other. Many kinesins have an additional polypeptide chain at one end, called a light chain. Therefore, kinesin is a heterotetrameric structure of α 2-β 2 composed of two heavy chains and two light chains. The kinesin family contains two main components: a dynamic domain and a carrier-binding domain. Kinesins are involved in the transport of cellular vesicles and organelles within neurons. The mutated kinesin in Drosophila leads to weakened or lost neuron function. To humans For example, defects in the gene encoding the kinesin can cause neuropathy and clinically important syndromes. Because kinesin provides motive power for chromosome movement during meiosis and mitosis, defects in meiosis kinesin can cause symptoms such as infertility, spontaneous abortion, neonatal chromosomal disorders, and non-integral multiples of chromosomes. Defects in mitotic kinesins can cause abnormalities in somatic cells or tumor formation.

 The polypeptide of the present invention contains a conserved sequence of a kinesin light chain, so it is considered to be a new kinesin, and it is inferred that it has similar biological functions, and is named human kinesin XX.

 Since human kinesin 9 protein plays an important role in important functions in the body as described above, and it is believed that a large number of proteins are involved in these regulatory processes, there has been a need in the art to identify more human kinesin 9 proteins involved in these processes, especially Is to identify the amino acid sequence of this protein. Isolation of the new human kinesin 9 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for the disease, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human kinesin 9 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human kinesin 9. It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding human kinesin 9.

 Another object of the present invention is to provide a method for producing human kinesin 9.

 Another object of the present invention is to provide an antibody against the polypeptide-human kinesin 9 of the present invention.

 Another object of the present invention is to provide mimetic compounds, antagonists, agonists, and inhibitors of the "human kinesin 9" directed to the polypeptide of the present invention.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities in human kinesin 9. The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to the polynucleotide ω;

(c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b). More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 2326-2571 in SEQ ID NO: 1; and (b) a sequence having 1-2965 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human kinesin 9 protein, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of a human kinesin 9 protein, comprising detecting a mutation in the polypeptide or a coding polynucleotide sequence thereof in a biological sample, or detecting a mutation in a biological sample. The amount or biological activity of a polypeptide of the invention.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention in the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human kinesin 9.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

"Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence. "Insertion" or "addition" refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.

 An "agonist" refers to a molecule that, when combined with human kinesin 9, causes a change in the protein to regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that binds human kinesin 9.

 An "antagonist" or "inhibitor" refers to a molecule that, when combined with human kinesin 9, can block or regulate the biological or immunological activity of human kinesin 9. Antagonists and inhibitors can include proteins, nucleic acids, carbohydrates or any other molecule that can bind human kinesin 9.

 "Regulation" refers to a change in the function of human kinesin 9, including an increase or decrease in protein activity, a change in binding properties, and any other biological, functional, or immune properties of human kinesin 9.

 By "substantially pure" is meant substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can purify human kinesin 9 using standard protein purification techniques. Substantially pure human drive protein 9 produces a single main band on a non-reducing polyacrylamide gel. The purity of the human kinesin 9 peptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of a nucleotide by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules may be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other specifically or selectively.

"Percent identity" refers to the percentage of sequences that are identical or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can be Methods such as the Clus ter method compare two or more sequences (Higgins, DG and PM Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence X 100

(The number of residues in sequence A-the number of spacer residues in sequence A-the number of spacer residues in sequence B) The percentage of identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645) ₀

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (') ₂ and?, Which specifically bind to the epitope of human kinesin 9.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are the same as other substances existing in the natural state. It is separated and purified, and it is isolated and purified.

 As used herein, "isolated human kinesin 9" means that human kinesin 9 is substantially free of other proteins, lipids, sugars, or other substances with which it is naturally associated. Those skilled in the art can purify human kinesin 9 using standard protein purification techniques. Substantially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human kinesin 9 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, human kinesin 9, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude starting methionine residues.

 The invention also includes fragments, derivatives and analogs of human kinesin 9. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human kinesin 9 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (Π) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (II I) Such a type in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a type in which the additional amino acid sequence is fused into the mature polypeptide and the polypeptide sequence is formed (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence with a total length of 2965 bases, and its open reading frame 2326-2571 encodes 81 amino acids. This polypeptide has the characteristic sequence of the kinesin light chain, and it can be deduced that the human kinesin 9 has the structure and function represented by the kinesin light chain.

The polynucleotide of the present invention may be in the form of DNA or RNA. DM forms include cDM, genomic DNA or synthetic DNA. DNA can be single-stranded or double-stranded. The DM can be a coding chain or a non-coding chain. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, "degenerate variant" means in the present invention that encodes a gene having the SEQ ID A protein or polypeptide of NO: 2 but a nucleic acid sequence different from the coding region sequence shown in SEQ ID NO: 1. The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1 ° / »SDS, 6 (TC; or ( 2) Add a denaturant during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol l, 42 ° C, etc .; or (3) only between the two sequences The hybridization occurs only when the identity between them is at least 95%, and more preferably 97%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function as the mature polypeptide shown in SEQ ID NO: 2 and Active.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 nuclei. Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human kinesin 9.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human kinesin 9 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DM fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DM sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. Isolate cDNA of interest The standard method is to isolate raRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for mRNA extraction, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manua, Cold Spruing Harbor Laboratory. New York, 1989). ¾ Commercially available cDNA libraries are available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybrids; (2) the presence or absence of marker gene functions; (3) measuring the level of human kinesin 9 transcripts; (4) passing Immunological techniques or assays for biological activity to detect gene-expressed protein products. The above methods can be used singly or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, the protein product of human kinesin 9 gene expression can be detected using immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA).

 A method (Saik i, et al. Science 1985; 230: 1 350-1354) using DNA technology to amplify DNA / RM is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used. The primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human kinesin 9 coding sequence, and a method for producing a polypeptide of the present invention by recombinant technology.

In the present invention, a polynucleotide sequence encoding human kinesin 9 may be inserted into a vector to constitute A recombinant vector having a polynucleotide according to the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al. Gene, 1987, 56: 125) expressed in bacteria; MSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in a host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human kinesin 9 and appropriate transcriptional / translational regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecul ar Cloning, a Labora tory Manua, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, and the early and late SV40 promoters , Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenoviral enhancers.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

In the present invention, a polynucleotide encoding human kinesin 9 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetically engineered host cell containing the polynucleotide or the recombinant vector. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells If fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 ₂ method used in the step are well known in the art. Alternatively, it is a MgCl _2. If If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.

 By conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant human kinesin 9 (Science, 1984; 224: 1431). Generally there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human kinesin 9 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be separated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 Fig. 1 is a diagram comparing amino acid sequences of the kinesin 9 and kinesin light chain functional domains of the present invention.

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human kinesin 9 isolated. 9KDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions in the following examples are generally performed according to the conventional conditions such as those described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Harbor Harbor Laboratory Press, 1989), or according to manufacturing conditions. Conditions recommended by the manufacturer. Example 1: Cloning of human kinesin 9

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RM using Quik raRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA forms cDM by reverse transcription. The Smart cDNA Cloning Kit (purchased from Clontech) was used to insert the cDM fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5α. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDNA sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0351c04 was a new DM. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results show that the full-length cDNA contained in the 0351c04 clone is 2965bp (as shown in Seq ID N0: 1), and has a 246bp open reading frame (0RF) from 2326bp to 2571bp, encoding a new protein (such as Seq ID NO : Shown in 2). We named this clone pBS-0351c04 and the encoded protein was named human kinesin 9.

Example 2: Domain analysis of cDNA clones

 The sequence of the human kinesin 9 of the present invention and the protein sequence encoded by the kinesin 9 of the present invention were profiled by GCF using the profil i le scan program (Basiclocal Al ignment search tool) [Al tschul, SF et al. J. Mol. Biol. 1990; 215: 403-10], performing domain analysis in a database such as ProSite. The human kinesin 9 of the present invention is homologous to the domain kinesin light chain, and the homology results are shown in FIG. 1.

Example 3: Cloning of a gene encoding human kinesin 9 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Pr imerl: 5'- GAGCTTTTTTTCTTAGGGCTTTTT -3 '(SEQ ID NO: 3)

 Primer 2: 5'- TTTTTTTTTTATATATTCCTATTAGC -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at ， lbp at 5, end of SEQ ID NO: 1;

 Pr imer2 is the 3, terminal reverse sequence of SEQ ID NO: 1.

Conditions for the amplification reaction: 50 μl of Kol, KCl, 10 mmol / L Tris-CI, (pH 8.5.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primer, 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55. C 30sec; 72. C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit and ligated to a pCR vector (Invitrogen) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2965bp shown in SEQ ID NO: 1.

Example 4: Northern blot analysis of human kinesin 9 gene expression:

Total RNA was extracted in one step [Ana l. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) Centrifuge after mixing. The aqueous layer was aspirated, isopropanol (0.8 vol) was added and the mixture was centrifuged to obtain RM precipitate. The resulting RNA was precipitated at 70 ° / °. Wash with ethanol, dry and dissolve in water. With 20 g MA, electrophoresis was performed on a 1.2% agarose gel containing 20 mM 3- (N-morpholino) propanesulfonic acid (pH 7.0)-5 mM sodium acetate-IraM EDTA-2. 2M formaldehyde. It was then transferred to a nitrocellulose membrane. A- ³² P dATP was used to prepare ³² P-labeled DNA probes by random primers. The DNA probe used was the PCR amplified human kinesin 9 coding region sequence (2326bp to 2571bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H ₂ P0 ₄ (pH7. 4) -5 SSC-5 Denhardt's solution and 20 (^ g / ml salmon sperm DNA. After hybridization, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then , Phosphor Imager was used for analysis and quantification.

Example 5: In vitro expression, isolation and purification of recombinant human kinesin 9

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Pr imer3: 5-CATGCTAGCATGAAGGCAAAATGGCATGAGAAA -3 '(Seq ID No: 5) Pr imer4: 5'- CATGGATCCCTAGATTTTCTCATCTACCAGCAG -3' (Seq ID No: 6) The 5 'ends of these two primers contain Nhel and BamHI restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Nhel and BamHI restriction sites correspond to the selection on the expression vector plasmid pET 28b (+) (Novagen, Cat. No. 69865. 3) Sex endonuclease site. The PCR reaction was performed using the pBS-0351c04 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS- 0351c04 plasmid, primers Primer 3 and Primer-4 points, and 'J was 10 pmol, Advantage polymerase Mix (Clontech) 1 μ1. Cycle parameters: 94. C 20s, 60 ° C 30s, 68. C 2 rain, a total of 25 cycles. Nhel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligation product was transformed into colibacillus DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were selected by colony PCR method and performed. Sequencing. A positive clone (pET-0351c04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pET-0351c04) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartr idge (product of Novagen) was used for chromatography. The purified human kinesin 9 was obtained. After SDS-PAGE electrophoresis, a single band was obtained at 9KDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2.

Example 6 Production of anti-human kinesin 9 antibodies

 A peptide synthesizer (product of PE company) was used to synthesize the following human kinesin-specific peptides:

NH2-Me t -Lys-A 1 a-Ly s-Trp-Hi s-Gl u-Ly s -Ser-Leu-Lys-Tyr-G 1 n- G 1 u- A 1 a-COOH (SEQ ID NO : 7). The peptide was coupled with hemocyanin and bovine serum albumin to form a complex. For methods, see: Avrameas, et al. Immunochemis try, 1969; 6: 43 ₀ 4 mg of the hemocyanin polymorphic complex with complete Freund's adjuvant Rabbits were immunized, and 15 days later they were boosted with hemocyanin polypeptide complex and incomplete Freund's adjuvant. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit sera using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to human kinesin-9.

Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in a variety of ways. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue or pathology. Whether the expression in tissue cells is abnormal.

The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Northern blotting, and copying methods. They all use the same steps of hybridization after fixing the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer, so that the non-specific binding site of the sample on the filter is saturated with the carrier and the synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes, and Incubation hybridizes the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment utilizes higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained. The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2, GC content is 30% -70%, non-specific hybridization increases when it exceeds;

 3, there should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other unknown genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5'- TGAAGGCAAAATGGCATGAGAAAAGTCTAAAGTATCAGGAA -3 '(SEQ ID NO: 8) Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1

 5-TGAAGGCAAAATGGCATGAGCAAAGTCTAAAGTATCAGGAA -3 '(SEQ ID NO: 9) For other common reagents and their preparation methods not listed in the following specific experimental procedures, please refer to the literature: DNA PROBES GH Kel ler; MM Manak; S tockton Pres s, 1989 (USA) and more commonly used molecular cloning laboratory manuals such as the "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press. ·

 Sample Preparation:

 1.Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in ice and hold phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Tissue should be kept moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the pellet (approximately 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 mmol / LnaCl; 25 mmol / L MgCl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1 to 5 ml per 0.1 g of the original tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet in lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash cells with 1-10 ml of cold PBS and centrifuge at 1000 g for 10 minutes. 2) Resuspend the pelleted cells (1 X 1G ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is directly added to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) Incubate at 50 ° C for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. At -20. C Let stand for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, each ^1-5χ 10 ό extracted cells plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100ug / ral, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K, the final concentrations are 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the water phase, add 180 vols of 2mol / L sodium acetate and 2.5 vols of cold ethanol, and mix well at -20 ° C for 1 hour. Time. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determine A ₂₆ . And A _28β to detect DNA purity and yield. 15) Store at -20 ° C after dispensing. Preparation of sample film:

 1) Take 4x2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe, so that they can be used in the following experimental steps. The film was washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HCl (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

 4) Clamp it in clean filter paper and wrap it with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μ 1), add 2 μ IKinase buffer, 8-10 uCi y- ³² P-dATP + 2U Kinase, to make up to a final volume of 20 μ 1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) The ³² P- Probe (the second peak is free γ- ³² P- dATP) after the collection of the first peak is combined. ₀

 Pre-hybridization

 Put the sample film in a plastic bag, add 3-10 mg of prehybridization solution (lOxDenhardt-s; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA).), After sealing the bag, 68 ° C water Luo Shake for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

3) Wash in 0.1xSSC, 0.1 SDS for 15 minutes at 40 ° C (twice). 4) 0.1xSSC, 0.1% SDS, 55. Wash for 30 minutes (twice) and dry at room temperature.

 Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1 ° / oSDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

 X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger. To the radioactive intensity of the hybridization spot of another probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1.

Example 8 DNA Microarray

 Gene chip or gene microarray (DM 'Microarray) is a new technology currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases . The specific method steps have been reported in the literature. M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μm. The spotted slides were hydrated, dried, and cross-linked in a UV cross-linker. After elution, the slides were fixed on the glass slides to prepare chips. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

2. 0.2% SDS was washed for 1 minute; 3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from normal liver and liver cancer in one step, and the mRNA was purified using Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5-Amino- propargyl-2'-deoxyuridine 5) was separately reverse-transcribed. '-triphate coupled to Cy3 fluorescent dye (purchased from Amersham Pharaacia Biotech) was used to label the mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargyl ~ 2'-deoxyuridine 5'-triphate coupled to Cy5 fluorescent dye, purchased from (Amersham Phamacia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see:

Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614- 10619. Schena, M., Shalon, Dari., Davis, R. Ψ (1995) Science. 270. (20): 467-480.

(Three) cross

 The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChein) for 16 hours, and then washed with a washing solution (lx SSC, 0.2% SDS) at room temperature and scanned with ScanArray 3000. Instrument (purchased from General Scanning Company, USA) for scanning, and the scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA), and the Cy3 / Cy5 ratio of each point was calculated. The points with the ratio less than 0.5 and greater than 2 were considered as Differentially expressed genes.

The experimental results show that Cy3 signal = 1846.33 (average of four experiments), Cy5signal = 1457.41 (average of four experiments), Cy3 / Cy5 = 1.26686, the polynucleotide of the present invention in the above two tissues No significant difference in expression.

Claims

Claim

1. An isolated polypeptide-human kinesin 9, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, wherein the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

 (a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence shown in SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 2326-2571 in SEQ ID NO: 1 or the sequence of positions 1-2965 in SEQ ID NO: 1. sequence.

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 with a plasmid, virus or a carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with any of the polynucleotides of claim 4-6.

9. A method for preparing a polypeptide having human kinesin 9 activity, characterized in that the method includes:

(a) culturing the engineered host cell according to claim 8 under the condition of expressing human kinesin 9;

(b) Isolating a polypeptide having human kinesin 9 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human kinesin 9.

 11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human kinesin 9.

12. The compound according to claim 11, characterized in that it is an antisense sequence of the polynucleotide sequence shown in SEQ ID NO: 1 or a fragment thereof.

13. An application of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human kinesin 9 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human kinesin 9; or for peptide fingerprinting Identification.

16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for the production of a gene Chip or microarray.

 17. The use of the polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or mimetic, agonist, The antagonist or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human kinesin 9 abnormality.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Diseases, · ν Infectious and immune diseases and drugs of various inflammations.