WO2001048212A1 - A novel polypeptide, phosphoribosyl pyrophosphate synthetase protein 11 and the polynucleotide encoding the polypeptide - Google Patents

Abstract

The present invention discloses a novel polypeptide, phosphoribosyl pyrophosphate synthetase protein 11, the polynucleotide encoding the polypeptide and the method for producing the polypeptide by DNA recombinant technology. The invention also discloses the uses of the polypeptide in methods for treating various diseases, such as malignant tumour, hemopathy, HIV infection, immunological disease, and various inflammations, etc. The invention also discloses the agonists against the polypeptide and the therapeutic action thereof. The invention also discloses the uses of the polynucleotide encoding the novel phosphoribosyl pyrophosphate synthetase protein 11.

Description

 A new polypeptide-phosphoribosyl pyrophosphate synthase protein 11 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a novel polypeptide monophosphate ribophosphate pyrophosphate synthase protein 11 and a polynucleotide sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and the polypeptide.

technical background

 Phosphoribosyl pyrophosphate synthase (PRPP synthetase) catalyzes the combination of 5-phosphate ribose and ATP in the body to produce phosphoribosyl pyrophosphate. Phosphoribosyl pyrophosphate is involved in various important biosynthetic pathways in the body, such as the synthesis of purine, pyrimidine, histidine, and tyrosine. These substances are important components of genetic information DNA and protein, respectively, and play an important role directly or indirectly in biological genetics and various metabolic processes. It can be seen from the above that, as a catalytic regulator for the synthesis of phosphoribosyl pyrophosphate, phosphoribosyl pyrophosphate synthase also plays a very important role in the body. The stability and activity of this enzyme require the presence of inorganic phosphate and magnesium ions.

 There are three isozymes of phosphoribose pyrophosphate synthase in mammals, while at least four isozymes of phosphoribose pyrophosphate synthase exist in yeast. These enzymes have different configurations in the body, but have similar functional characteristics.

 Analysis of phosphoribosyl pyrophosphate synthetase from E. coli and rats found that the N-terminus of these protein sequences contained a highly conserved consensus sequence fragment of 16 amino acid residues. The conserved sequence fragment is as follows Show:

 D- [LI] -H- [SA] -X-Q- [IMST]-[QM] -G- [FY] -F-X (2) -P- [LIVMFC] -D;

 This sequence fragment involves the binding of an enzyme to a divalent cation, which contains two conserved asparagine residues and a histidine residue. These three conserved amino acid residues form a coordination bond with the divalent cation to bind to Together, they jointly regulate protein expression. These divalent cations include: magnesium ions and the like. Therefore, this sequence fragment is the central region where the enzyme forms a normal active conformation and exerts catalytic activity. Usually, the combination of enzyme and magnesium ion will form an activated catalytic active center to promote the synthesis of phosphoribosyl pyrophosphate; if the conserved sequence is combined with calcium ion, it will inhibit the enzyme's catalytic activity, that is, the protein synthesis process. It is in this way that organisms regulate the synthesis rate and content of phosphoribosyl pyrophosphate in the body to regulate a series of biosynthetic processes related to it. Mutations in this region will lead to abnormal or inactive enzyme expression, which will affect a series of related biosynthetic processes [Bower SG, Har iow KW et a l., 1989, J Bio l Chem, 264: 10287-10291] .

From the above, it can be known that the phosphoribosyl pyrophosphate synthetase mainly catalyzes the phosphoribosyl pyrophosphate in vivo. To regulate various biosynthetic processes associated with it. Abnormal expression will lead to abnormal synthesis of phosphoribosyl pyrophosphate, which will cause excessive expression or abnormal synthesis, which will affect a series of biological metabolic processes related to the organism and cause various related diseases. The abnormal expression of the enzyme in the body is usually associated with the occurrence of some amino acid metabolic disorders, nucleic acid metabolic disorders and related material metabolic disorders.

 As described above, the phosphoribosyl pyrophosphate synthase protein 11 protein plays an important role in important functions of the body, and it is believed that a large number of proteins are involved in these regulatory processes, so there has been a need in the art to identify more phosphoribosyl pyrophosphates involved in these processes. Synthetase 11 protein, especially the amino acid sequence of this protein is identified. The isolation of the new phosphoribosyl pyrophosphate synthase protein 11 protein-coding gene also provides the basis for research to determine the role of the protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so isolating its coding DNA is important.

Object of the invention

 It is an object of the present invention to provide isolated novel polypeptide monophosphate ribose pyrophosphate synthase protein 11 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a phosphoribosyl pyrophosphate synthase protein 11.

 It is another object of the present invention to provide a genetically engineered host cell containing a polynucleotide encoding a phosphoribosyl pyrophosphate synthase protein 11.

 Another object of the present invention is to provide a method for producing phosphoribosyl pyrophosphate synthase protein 11.

 Another object of the present invention is to provide a polypeptide monophosphate ribose pyrophosphate synthase protein directed to the present invention.

11 antibodies.

 Another object of the present invention is to provide a ribose monophosphate pyrophosphate synthase protein directed against the polypeptide of the present invention.

11 mimetic compounds, antagonists, agonists, inhibitors.

 Another object of the present invention is to provide a method for diagnosing and treating diseases related to abnormalities of phosphoribosyl pyrophosphate synthase protein 11.

Summary of invention

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2;

 (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 46-348 in SEQ ID NO: 1; and (b) a sequence having 1-3903 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The present invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of phosphoribosyl pyrophosphate synthase protein 11 protein, which comprises utilizing the polypeptide of the present invention. The invention also relates to compounds obtained by this method.

 The present invention also relates to a method for in vitro detection of a disease or susceptibility to disease associated with abnormal expression of the phosphoribosyl pyrophosphate synthase protein 11 protein, which comprises detecting a mutation in the polypeptide or a polynucleotide sequence encoding the same in a biological sample, Detection of the amount or biological activity of a polypeptide of the invention in a biological sample.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of phosphoribosyl pyrophosphate synthase protein 11.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein.

BRIEF DESCRIPTION OF THE DRAWINGS

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of a characteristic sequence of a phosphoribosyl pyrophosphate synthetase protein 11 of 53-11 in a domain 11-63 of the present invention. The upper sequence is the phosphoribosyl pyrophosphate synthase protein 11 and the lower sequence is the characteristic sequence domain of the phosphoribosyl pyrophosphate synthase protein. Ί "and": "and". "Indicate that the probability of the same amino acid appearing between two sequences decreases in sequence.

Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of the isolated phosphoribosyl pyrophosphate synthase protein 11. lKDa is the molecular weight of the protein. The arrow indicates the isolated protein band. Summary of the invention

 The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or R, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

 A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as the replacement of isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with phosphoribosyl pyrophosphate synthase protein 11, can cause changes in the protein and thereby regulate the activity of the protein. An agonist may include a protein, a nucleic acid, a carbohydrate, or any other molecule that can bind to phosphoribosyl pyrophosphate synthase protein 11.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of phosphoribosyl pyrophosphate synthase protein 11 when combined with phosphoribosyl pyrophosphate synthase protein 11. Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates or any other molecule that can bind to phosphoribosyl pyrophosphate synthase protein 11.

 "Regulation" refers to a change in the function of phosphoribosyl pyrophosphate synthase protein 11, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties, functions, or immunity of phosphoribosyl pyrophosphate synthase protein 11. Change of nature.

"Substantially pure '" means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Quality. Those skilled in the art can purify the phosphoribosyl pyrophosphate synthase protein 11 using standard protein purification techniques. The essentially pure phosphoribosyl pyrophosphate synthase protein 11 produces a single main band on a non-reducing polyacrylamide gel. The purity of the phosphoribosyl pyrophosphate synthase protein 11 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G-A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

 "Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. This inhibition of hybridization can be detected by performing hybridization (Southern or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Clus ter method (Higgins, D. G. and P. M. Sharp (1988)

Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by:

Match between the sequences and the sequence number of residues _χ ^ blue

Number of residues in sequence ^-number of interval residues in sequence ^-number of interval residues in sequence ^X

 The percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in enzymology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitution, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

"Antisense" refers to a nucleotide sequence that is complementary to a particular DNA or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand". "Derivative" refers to HFP or a chemical modification of its nucleic acid. This chemical modification may be the replacement of a hydrogen atom with an alkyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa,? (^ ') ₂ and?, Which specifically bind to the epitope of phosphoribosyl pyrophosphate synthase protein 11.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

 The term "isolated" refers to the removal of matter from its original environment (for example, its natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist in the natural system. Such a polynucleotide may be part of a vector, or such a polynucleotide or polypeptide may be part of a composition. Since the carrier or composition is not part of its natural environment, they are still isolated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated phosphoribosyl pyrophosphate synthase protein 11" means that the phosphoribosyl pyrophosphate synthase protein 11 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify the phosphoribosyl pyrophosphate synthase protein 11 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the phosphoribosyl pyrophosphate synthase protein 11 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a novel polypeptide monophosphate ribose pyrophosphate synthase protein 11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

The present invention also includes fragments, derivatives and analogs of phosphoribosyl pyrophosphate synthase protein 11. As used in the present invention, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the phosphoribosyl pyrophosphate synthase protein 11 of the present invention. Fragments of the polypeptide of the invention, The derivative or analog may be: (I) a type in which one or more amino acid residues are replaced with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substituted amino acid may be or may be Not encoded by the genetic code; or (Π) such a type in which a group on one or more amino acid residues is substituted with another group to include a substituent; or (Π Ι) such a type in which it is mature Fusion of the polypeptide to another compound, such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol; or

(IV) A polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) formed by fusing additional amino acid sequences into a mature polypeptide. As set forth herein, such fragments, derivatives and analogs are considered to be within the knowledge of those skilled in the art.

 The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes a nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 3903 bases in length and its open reading frame 46-348 encodes 100 amino acids. This polypeptide has a characteristic sequence of a characteristic sequence of a phosphoribosyl pyrophosphate synthetase protein, and it can be deduced that the phosphoribosyl pyrophosphate synthase protein 11 has a structure and a function represented by the characteristic sequence of a phosphoribosyl pyrophosphate synthase protein.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. D can be single-stranded or double-stranded. The DM can be a coding chain or a non-coding chain. The coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

The invention also relates to a polynucleotide that hybridizes to the sequence described above (with at least two sequences between 50%, preferably 70% identity). The invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions. In the present invention, "strict conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60 ° C; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficol 1, 42 ° C, etc .; or (3) only between the two sequences Hybridization occurs only when the identity is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

 The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, and most preferably at least 100 cores Glycylic acid or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques (such as PCR) to identify and / or isolate polynucleotides encoding phosphoribosyl pyrophosphate synthase protein 11.

 The polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the phosphoribosyl pyrophosphate synthase protein 11 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DM is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRM from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. There are many mature techniques for extracting mRNA, and kits are also commercially available (Q i agene :). And the construction of cDNA libraries is also a common method (Sambrook, et al., Moleculiar Cloning, A Labora tory Manual, Colldsp Harbor Harboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Cl on Tech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DM-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of transcripts of phosphoribosyl pyrophosphate synthase protein 1 1 (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably Is at least 50 Nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1 000 nucleotides. The probe used here is usually a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes. DNA probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELI SA) can be used to detect the protein products expressed by the phosphoribosyl pyrophosphate synthase protein 11 gene expression.

 A method (Sa iki, et al. Science 1985; 230: 1 350- 1 354) using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-Rapid Amplification of cDNA Ends) can be preferably used, and the primers for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein Select and synthesize using conventional methods. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be measured by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDM sequence, sequencing needs to be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector of the present invention or directly using a phosphoribosyl pyrophosphate synthase protein 1 1 coding sequence, and recombinant technology to produce the Said method of polypeptide.

 In the present invention, the polynucleotide sequence encoding the phosphoribosyl pyrophosphate synthase protein 11 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Na thans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

Methods known to those skilled in the art can be used to construct expression vectors containing a DM sequence encoding a phosphoribosyl pyrophosphate synthase protein 11 and appropriate transcription / translation regulatory elements. These methods include in vitro Recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular

Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory. New York,

1989). The D sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers and adenovirus enhancers on the late side of the origin of replication.

 In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture. Fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding a ribophosphate pyrophosphate synthase protein 11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host cell containing the polynucleotide or the recombinant vector. . The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: Escherichia coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with the CaCl ₂ method. The steps used are well known in the art. Alternatively, MgCl ₂ is used. If necessary, transformation can also be performed by electroporation. When the host is a eukaryote, the following DM transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

Using conventional recombinant DNA technology, the polynucleotide sequence of the present invention can be used to express or produce recombinant phosphoribosyl pyrophosphate synthase protein 11 (Science, 1984; 224: 1431). Generally speaking There are the following steps:

 (1) using the polynucleotide (or variant) encoding human phosphoribosyl pyrophosphate synthase protein 11 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

 In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

 The polypeptides of the present invention, as well as the antagonists, agonists and inhibitors of the polypeptides, can be directly used in the treatment of diseases, for example, they can be used to treat malignant tumors, adrenal deficiency, skin diseases, various types of inflammation, HIV infection, and immunological diseases.

 Phosphoribosyl pyrophosphate synthase (PRPP synthetase) catalyzes the combination of 5-phosphate ribose and ATP in the body to produce phosphoribosyl pyrophosphate. Phosphoribosyl pyrophosphate is involved in various important biosynthetic pathways in the body, such as the synthesis of purine, pyrimidine, histidine, and tyrosine. These substances are important components of genetic information DNA and protein, respectively, and play an important role directly or indirectly in biological genetics and various metabolic processes. Phosphoribosyl-pyrophosphate synthetase-specific conserved sequences are required to form its active mot if.

 It can be seen that abnormal expression of the specific phosphoribosyl pyrophosphate synthetase mot if will cause abnormal function of the polypeptide containing the mot if of the present invention, resulting in the synthesis of purines, pyrimidines, nucleotides, histidine and tyrosine Acid abnormalities, which in turn affect the regulation and expression of genetic information, and produce related diseases such as tumors, embryonic developmental disorders, growth and development disorders, inflammation, histidine metabolism deficiency diseases, and tyrosine metabolism deficiency diseases such as albinism.

 It can be seen that abnormal expression of the phosphoribosyl pyrophosphate synthase protein 11 of the present invention will produce various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, inflammation, histidine metabolism deficiency diseases, and tyrosine metabolism defects. Diseases such as albinism, these diseases include but are not limited to:

Embryonic developmental disorders: congenital abortion, cleft palate, limb absentness, limb differentiation disorders, hyaline membrane disease, Pulmonary insufficiency, polycystic kidney disease, double ureter, cryptorchidism, congenital inguinal hernia, double uterus, vaginal atresia, hypospadias, hermaphroditism, atrial septal defect, ventricular septal defect, pulmonary stenosis, open ductus arteriosus, neural tube Defects, congenital hydrocephalus, iris defects, congenital cataracts, congenital glaucoma or cataracts, congenital deafness

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, mental retardation, familial cerebral nucleus dysplasia syndrome, strabismus, skin, fat and muscular dysplasia such as congenital skin laxity, premature aging Disease, congenital keratosis, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation

 Tumors of various tissues: gastric cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, Colon cancer, melanoma, adrenal cancer, bladder cancer, bone cancer, osteosarcoma, myeloma, bone marrow cancer, brain cancer, uterine cancer, endometrial cancer, gallbladder cancer, colon cancer, thymic tumor, nasal cavity and sinus tumor, nose Pharyngeal cancer, Laryngeal cancer, Tracheal tumor, Fibroma, Fibrosarcoma, Lipoma, Liposarcoma, Leiomyoma

 Inflammation: allergic reaction, bronchial asthma, allergic pneumonia, adult respiratory distress syndrome, sarcoidosis, rheumatoid arthritis, rheumatoid arthritis, osteoarthritis, cholecystitis, glomerulonephritis, immune complex Types of glomerulonephritis, acute anterior uveitis, dermatomyositis, urticaria, atopic dermatitis, hemochromatosis, polymyositis, Addison's disease, chronic active hepatitis, emergency bowel syndrome, atrophy Gastritis, systemic lupus erythematosus, myasthenia gravis, cerebrospinal spinal multiple sclerosis, Guillain-Barre syndrome, intracranial granuloma, pancreatitis, myocarditis, and inflammation caused by infections and trauma

 Abnormal expression of the phosphoribosyl pyrophosphate synthase protein 11 of the present invention will also produce certain hereditary, hematological and immune system diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used for the treatment of diseases, for example, it can treat various diseases, especially tumors, embryonic developmental disorders, growth and development disorders, inflammation, and histidine metabolism deficiency diseases. Defects of tyrosine metabolism, such as albinism, some hereditary, blood diseases and immune system diseases.

 The invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) phosphoribosyl-pyrophosphate synthase protein 11. Agonists increase biological functions such as phosphoribosyl-pyrophosphate synthase protein 11 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers. For example, mammalian cells or membrane preparations expressing phosphoribosyl pyrophosphate synthase protein 11 can be cultured with labeled phosphoribosyl pyrophosphate synthase protein 11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.

Antagonists of phosphoribosyl pyrophosphate synthase protein 11 include antibodies, compounds, and Body deletions and the like. Antagonists of phosphoribosyl pyrophosphate synthase protein 11 can bind to and eliminate the function of phosphoribosyl pyrophosphate synthase protein 11, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide so that the polypeptide cannot function biological functions.

 When screening compounds as antagonists, ribophosphate pyrophosphate synthase protein 11 can be added to a bioanalytical assay to determine the compound by measuring the effect of the compound on the interaction between the phosphoribosyl pyrophosphate synthase protein π and its receptor. Whether it is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same way as for screening compounds described above. Polypeptide molecules capable of binding to phosphoribosyl pyrophosphate synthase protein 11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. Phosphoribosyl pyrophosphate synthase protein

11 molecules are labeled.

 The present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be polyclonal or monoclonal antibodies. The present invention also provides antibodies against the epitope of phosphoribosyl pyrophosphate synthase protein 11. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by direct injection of phosphoribosyl pyrophosphate synthase protein 11 into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to Freund's Adjuvant, etc. Techniques for preparing monoclonal antibodies to phosphoribosyl pyrophosphate synthase protein 11 include, but are not limited to, hybridoma technology (Kohler and Mistein. Nature, 1975, 256: 495-497), triple tumor technology, human B-cell hybridization Tumor technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human-derived variable regions can be produced using existing techniques (Morrison et al., PNAS, 1985, 81: 6851). The existing technology for producing single chain antibodies (U.S. Pat No. 4946778) can also be used to produce single chain antibodies against phosphoribose pyrophosphate synthase protein 11.

 Antibodies against phosphoribosyl pyrophosphate synthase protein 11 can be used in immunohistochemical techniques to detect phosphoribosyl pyrophosphate synthase protein 11 in biopsy specimens.

 Monoclonal antibodies that bind to phosphoribosyl pyrophosphate synthase protein 11 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, high-affinity monoclonal antibodies such as phosphoribosyl pyrophosphate synthase protein 11 can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.). A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill Inactivate phosphoribosyl pyrophosphate synthase protein 11-positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to the phosphoribosyl pyrophosphate synthase protein 1 1. Administration of an appropriate dose of antibody can stimulate or block the production or activity of phosphoribosyl pyrophosphate synthase protein 11.

 The invention also relates to a diagnostic test method for quantitative and localized detection of the level of phosphoribosyl pyrophosphate synthase protein 11. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of phosphoribosyl pyrophosphate synthase protein 11 detected in the test can be used to explain the importance of phosphoribosyl pyrophosphate synthase protein 1 1 in various diseases and to play a role in diagnosing phosphoribosyl pyrophosphate synthase protein 11 Disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

 The polynucleotide encoding the phosphoribosyl pyrophosphate synthase protein 1 1 can also be used for a variety of therapeutic purposes. Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of phosphoribosyl-pyrophosphate synthase protein 11. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated phosphoribosyl pyrophosphate synthase protein 11 to inhibit endogenous phosphoribosyl pyrophosphate synthase protein 1 1 activity. For example, a mutated phosphoribosyl pyrophosphate synthase protein 11 may be a shortened phosphoribosyl pyrophosphate synthase protein 11 lacking a signaling domain. Although it can bind to downstream substrates, it lacks signaling activity. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of phosphoribosyl pyrophosphate synthase protein 11. Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding a phosphoribosyl pyrophosphate synthase protein 11 into a cell. Methods for constructing recombinant viral vectors carrying a polynucleotide encoding a phosphoribosyl pyrophosphate synthase protein 11 can be found in existing literature (Sambrook, et al.). In addition, a recombinant polynucleotide encoding a phosphoribosyl pyrophosphate synthase protein 11 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit the phosphoribosyl pyrophosphate synthase protein 1 1 mRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that can specifically decompose a specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase phosphorus The technology of synthesizing oligonucleotides by acid amide chemical synthesis has been widely used. Antisense RNA molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RM polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

Polynucleotides encoding phosphoribosyl pyrophosphate synthase protein 11 can be used to diagnose diseases related to phosphoribosyl pyrophosphate synthase protein 11. The polynucleotide encoding the phosphoribosyl pyrophosphate synthase protein 1 1 can be used to detect the expression of phosphoribosyl pyrophosphate synthase protein 11 or the abnormal expression of phosphoribosyl pyrophosphate synthase protein 11 in a disease state. For example, the DNA sequence encoding the phosphoribosyl pyrophosphate synthase protein 11 can be used to hybridize biopsy specimens to determine the expression status of the phosphoribosyl pyrophosphate synthase protein 11. Hybridization include Southern blotting _k Nor _thern blotting, in situ hybridization. These techniques and methods are publicly available and mature, and related kits are commercially available. A part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Phosphoribosyl-pyrophosphate synthase protein 11 specific primers can be used to perform RM-polymerase chain reaction (RT-PCR) in vitro amplification to detect transcription products of phosphoribosyl-pyrophosphate synthase protein 11.

 Detection of mutations in the phosphoribosyl pyrophosphate synthase protein 11 gene can also be used to diagnose diseases related to phosphoribosyl pyrophosphate synthase protein 11. Phosphoribosyl pyrophosphate synthase protein 11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type phosphoribosyl pyrophosphate synthase protein 11 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DM sequence analysis, PCR and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. This sequence will specifically target a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manu l of Basic Techniques, Pergamon Pres s, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in V. Mckusick, Mendel ian Inherance in Man (available online with Johns Hopkins University Wetch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which prompts permission for administration on the human body by government agencies that produce, use, or sell. In addition, the polypeptides of the invention can be used in combination with other therapeutic compounds.

The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Phosphoribosyl pyrophosphate synthase protein II is administered in an amount effective to treat and / or prevent a particular indication. The amount and dose range of ribophosphate pyrophosphate synthase protein 11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician. Examples

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods in the following examples are not marked with specific conditions, usually according to conventional conditions such as Sambrook et al., Molecular cloning: the conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Pres s, 1989), or according to the manufacturing conditions Conditions recommended by the manufacturer.

 Example 1 Cloning of Ribophosphate Pyrophosphate Synthase Protein 11

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Poly (A) mRNA was isolated from total RNA using Quik mRNA Isolat ion Kit (product of Qiegene). 2ug poly (A) mRNA is reverse transcribed to form cDNA. Smart cDNA cloning kit (purchased from Clontech | cDNA fragment was inserted into the multicloning site of pBSK (+) vector (Clontech)) to transform DH5 a to form a cDNA library. Dye terminate cyc le react ion Sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) determined the 5 'and 3' ends of all clones. The determined cDNA sequences were compared with existing public DNA sequence databases (Genebank ), The result showed that the cloned cDNA sequence of one of the clones 0043h03 was new DNA. A series of primers were synthesized to determine the inserted cDNA fragment in both directions. The results showed that the full length cDNA contained in the 0043h03 clone was 3903bp ( As shown in Seq ID N0: 1), there is a 303bp open reading frame (0RF) from 46bp to 348bp, which encodes a new protein (as shown in Seq ID NO: 2). We named this clone pBS- 0043h03, the encoded protein is named as phosphoribosyl pyrophosphate synthase protein 11. Example 2 Domain analysis of cDNA clones

 The sequence of the phosphoribosyl pyrophosphate synthase protein 11 and its encoded protein sequence of the present invention were analyzed by the GCG prof i le scan program (Basic loca lal ignment search tool) [Al tschul, SF et a l. J. Mol. Biol. 1990; 215: 403-10], domain analysis was performed in databases such as Prote. The phosphoribose pyrophosphate synthase protein Π of the present invention is homologous with the characteristic sequence of the domain phosphoribose pyrophosphate synthetase protein at 11-63, and the homology result is shown in FIG. 1 with a homology of 0.28 and a score of 15 08; The threshold is 14.86. Example 3 Cloning of the gene encoding the phosphoribosyl-pyrophosphate synthase protein 11 by RT-PCR The total RNA of fetal brain cells was used as a template, and oligo-dT was used as a primer for reverse transcription reaction to synthesize cDNA. , Using the following primers for PCR amplification:

 Pr imerl: 5'- ATATGTCCCACACTTGGTTAAATT -3 '(SEQ ID NO: 3)

Pr imer2: 5'- TTTTGCAGTTGCAAGATGTAATAG -3 '(SEQ ID NO: 4) Primerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification reaction conditions: 50 mmol / L KC1, 10 ramol / L Tris-HCl, pH 8.5, 1.5 mmol / L MgCl ₂ , 200 _μ ηιο1 / 1 dNTP, lOpmol primer, 1U Taq DNA in 50 μ1 reaction volume Polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perkin-Elmer) for 25 cycles under the following conditions: 94. C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-actin was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The result of D sequence analysis showed that the DNA sequence of the PCR product was exactly the same as 1-3903bp shown in SEQ ID NO: 1. Example 4 Northern blot analysis of the expression of the phosphoribosyl pyrophosphate synthase protein 11 gene Total RNA was extracted by a one-step method. Biochem 1987, 162, 156-159] ₀ This method involves acid guanidinium thiocyanate-chloroform extraction. That is, the tissue is homogenized with 4M guanidine isothiocyanate-25mM sodium citrate, 0.2M sodium acetate (pH4.0), and 1 time volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1 ), Mix and centrifuge. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. With _20μ ε RNA, electrophoresed on containing 20mM 3- (N- morpholino) propanesulfonic acid (pH7.0) 1.2% agarose gel -5mM -ImM EDTA-2.2M sodium acetate formaldehyde. It was then transferred to a nitrocellulose membrane. ³² P dATP labeled probe ³² P- DM prepared by the random primer SYSTEM - with c. The DM probe used is the PCR-amplified phosphoribosyl pyrophosphate synthase protein 11 coding region sequence (46bp to 348bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / ml) was hybridized with a nitrocellulose membrane to which the RNA was transferred at 42 ° C overnight in a solution containing 50 ° /. Formamide-25mM KH ₂ P0 ₄ (pH7.4)-5 x SSC-5 x Denhardt, s solution and 20 g / ml salmon sperm DNA. After hybridization, the filter was placed at 1 X SSC-0.1 ° /. Wash the SDS at 55 ° C for 30 min. Then, use Phosphor Imager for analysis and quantification. Example 5 In vitro expression, isolation and purification of recombinant phosphoribosyl pyrophosphate synthase protein 11 According to SEQ ID NO: 1 and Figure 1 The coding region sequence was designed with a pair of specific amplification primers, the sequence is as follows:

Primer3: 5'- CCCCATATGATGACAGCTAACTTATGGAGAGGT -3 '(Seq ID No: 5) Primer4: 5'- CATGGATCCCTAACTATAGACATAGGTAAGGAG -3' (Seq ID No: 6) The 5 'ends of these two primers contain Ndel and BamHI restriction sites, respectively. The coding sequences of the 5 'and 3' ends of the gene of interest are followed, respectively. The Ndel and BamHI restriction sites correspond to the selectivity within the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Digestion site. With full length The pBS-0043h03 plasmid of the target gene was used as a template for PCR reaction. PCR reaction conditions were: 1 in a total volume of ₅₀ μ plasmid pBS- 0043h03 containing 10pg, Primer-3 and Primer Pr imer-4 were l Opmol, Advantage polymerase Mix (Clontech Products) 1 _μ 1. Cycle parameters: 94. C 20s, 60. C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH5 ct by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 (g / ml)), positive colonies were screened by colony PCR method and sequenced. The correct positive clone (pET-0043h03) was used to transform the recombinant plasmid into E. coli BL21 (DE3) plySs (product of Novagen) by calcium chloride method. Cultured in LB liquid containing kanamycin (final concentration 30 _μ§ / ιη1) the group, the host bacteria BL21 _(P ET-0043h03) cultured at 37 ° C to logarithmic phase, IPTG was added to a final concentration of lmmol / L, incubation was continued for 5 hours. harvested by centrifugation, broken by ultrasonic bacteria harvested by centrifugation The supernatant was chromatographed using an affinity chromatography column His s. Bind Quick Cartr idge (product of Novagen) capable of binding 6 histidines (6His-Tag) to obtain a purified target protein, phosphoribosyl pyrophosphate. Synthetase protein 11. After SDS-PAGE electrophoresis, a single band was obtained at 11 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by Edams hydrolysis method. The result was N- 15 amino acids with N-terminus shown in SEQ ID NO: 2 The 15 terminal amino acid residues are exactly the same. Example 6 Production of anti-phosphoribose pyrophosphate synthase protein 11 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following specific peptides of phosphoribosyl pyrophosphate synthase protein 11:

NH ₂ -Met-Thr-Ala-Asn-Leu-Trp-Arg-Gly-Gly-Gln-Lys-Ala-Ser-Lys-Leu-COOH (SEQ ID NO: 7). The polypeptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For the method, see: Avrameas, et al. I Ranghua chemi st ry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once. A titer plate coated with a 15 g / ml bovine serum albumin peptide complex was used as an ELISA to determine antibody titers in rabbit serum. Total IgG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sepharose4B column, and anti-peptide antibodies were separated from the total IgG by affinity chromatography. The immunoprecipitation method proved that the purified antibody could specifically bind to phosphoribosyl pyrophosphate synthase protein 11. Example 7 Application of the polynucleotide fragment of the present invention as a hybridization probe

Selecting suitable oligonucleotide fragments from the polynucleotides of the present invention has various uses as hybridization probes, such as using the probes to hybridize to genomic or cDNA libraries of normal tissues or pathological tissues from different sources. In order to identify whether it contains a polynucleotide sequence of the present invention and detect a homologous polynucleotide sequence, the probe may further be used to detect the polynucleotide sequence of the present invention or a homologous polynucleotide sequence thereof in normal tissue or Whether the expression in pathological tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature) to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this example, the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

 First, the selection of the probe

 The selection of oligonucleotide fragments for use as hybridization probes from the polynucleotide SEQ ID NO: 1 of the present invention should follow the following principles and several aspects to be considered:

 1. The preferred range of probe size is 18-50 nucleotides;

 2. The GC content is 30% -70%, and the non-specific hybridization increases when it exceeds;

 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt) 5'- TGACAGCTAACTTATGGAGAGGTGGGCAGAAAGCCTCCAAG -3 '(SEQ ID NO: 8) Probe 1 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment or its complementary fragment of SEQ ID NO: 1:

 5'- TGACAGCTAACTTATGGAGTGGTGGGCAGAAAGCCTCCAAG -3 '(SEQ ID NO: 9) For other commonly used reagents and their preparation methods not related to the following specific experimental steps, please refer to the literature: DM PROBES GHKeller; MMManak; Stockton Press, 1989 (USA ) And more commonly used molecular cloning experiment manual books such as "Molecular Cloning Experiment Guide" (Second Edition 1998) [US] Sambrook et al., Science Press.

 Sample Preparation:

 1. Extract DNA from fresh or frozen tissue

Steps: 1) Place fresh or freshly thawed normal liver tissue in plain HL immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation. 2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with cold homogenization buffer (0.25 mol / L sucrose; 25 μl / L Tris-HCl, pH 7.5; 25 raraol / L NaCl; 25 mmol / LM _g Cl ₂ ). 4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (1-5 ml per 0.1 g of the initial tissue sample), and centrifuge at 1,000 g for 10 minutes. 7) Resuspend the pellet with lysis buffer (1 ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

 2, DNA phenol extraction method

Steps: 1) Wash the cells with 10 ml of cold PBS and centrifuge at 1000 _g for 10 minutes. 2) Resuspend the pelleted cells with cold cell lysate (lx 10 ⁸ cells / ml) and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / ml. 5) 50. C. Incubate for 1 hour or shake gently at 37 ° C overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. Purification of DM and ethanol precipitation were then performed.

 3. Purification of DNA and ethanol precipitation

Steps: 1) Add 10 volume of 2mol / L sodium acetate and 1 volume of cold 100% ethanol to the DM solution and mix well. At -20. C Leave for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. use Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every ^1- 5 χ 10 ό extracted cells plus about lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100 ug / ml, 37. C was held for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase and re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, and mix well--20 ° C for 1 hour. 13) Wash the pellet with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Measure person ₂₆ . And ^ ₈ . To check the purity and yield of DM. 15) Store at -20 after packing. C.

 Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number on it with a pencil. Two NC membranes are required for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Pipette and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper infiltrated with 0.1mol / L NaOH, 1.5fflol / L NaCl for 5 minutes (twice), and dry in 0.5mol / L Tris-HCl (pH7.0), 3mol / L NaCl filter paper for 5 minutes (twice) and allowed to dry.

 4) Clamped in clean filter paper, wrapped in aluminum foil, and dried under vacuum at 60-80 ° C for 2 hours.

 Labeling of probes

1) 3μ1 Probe (0.1OD / Ιθμΐ), add 2μ1 Kinase buffer, 8-10 uCi γ- ³² P-dATP + 2U Kinase, to make up to a final volume of 20μ1.

 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of Bromophenol Blue Indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Start collecting the first peak before ³² P-Probe washes out (can be monitored by Monitor :).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator.

8) After the collection of the first peak is combined, the ³² P-Probe to be prepared (the second peak is free γ- ³² P- dATP).

 Pre-hybridization

 The sample membrane was placed in a plastic bag, and a 3-1 Omg pre-hybridization solution (1 OxDenhards; 6xSSC, 0.1 mg / ml CT DM (calf thymus DM)) was added. After sealing the mouth of the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, 40. C wash for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice).

 4) 0.1 x SSC, 0.1 ° /. SDS, 55. Wash for 30 minutes (twice) and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° / oSDS, wash at 37 ° C for 15 minutes (twice).

 3) Wash in 0.1xSSC, 0.1% SDS at 37 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 40 ° C for 15 minutes (twice), and dry at room temperature.

X-ray auto-development:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

 The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactive intensity of the above two probes. However, in the hybridization experiments performed under high-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than that of hybridization spots. The radioactive intensity of the hybridization spot of the other probe. Therefore, the presence and differential expression of the polynucleotide of the present invention in different tissues can be analyzed qualitatively and quantitatively with the probe 1. Example 8 DNA Mi croarray

Gene chip or gene micro matrix (DNA Mi croarray) is a new technology that many national laboratories and large pharmaceutical companies are currently developing and developing. It refers to the orderly and high density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as Targeting DNA for gene chip technology for high-throughput research on new gene functions; finding and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases. The specific method steps have been reported in the literature. For example, refer to the literature DeRi si, JL, Lyer, V. & Brown, P. 0. (1997) Science 278, 680-686. And the literature Hel le, RA, Schema, M., Cha i, A., Sha lom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR, and the concentration of the amplified product was adjusted to about 500ng / ul after purification. The spots were spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 μηι. The spotted slides were hydrated, dried, and cross-linked in an ultraviolet cross-linker. After elution, the slides were fixed to fix the DM on the glass slides to prepare chips. The specific method steps have been reported in the literature. The sample post-processing steps in this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2. 0.2% SDS was washed for 1 minute;

3. ddH ₂ 0 was washed twice for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 1 minute;

6. 0. 2 ^e /. Wash with SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (Two) probe marking

 Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified with Oligotex mRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino- pr opa rgy 1- 2. · -deoxyur i dine 5'-tr iphate coupled to Cy3 f luorescent dye, purchased from Amersham Phamacia Biotech Company, was used to label mRNA of normal liver tissue, and the fluorescent reagent Cy5dUTP (5-Amino-propargy 1-2 · -deoxyur i dine 5'-tr iphate coupled to Cy5 f luorescent dye (purchased from Amersham Phamac ia Biotech) was used to label liver cancer tissue mRNA, and the probe was prepared after purification. For specific steps and methods, see

 Schena, M., Shalon, D., Hel ler, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shal on, Dar i., Dav is , RW (1995) Sc ience. 270 (20): 467-480.

 (Three) cross

Combine the probes from the two tissues with the chips at UniHyb ™ Hybr idizat ion Solut ion (purchased from TeleChem) hybridization solution for 16 hours. After washing at room temperature with a washing solution (1 x SSC, 0.2% SDS), scan with a ScanArray 3000 scanner (purchased from General Scanning, USA) for scanning. The scanned images were analyzed and processed with Imagene software (Biodiscovery, USA) to calculate the Cy3 / Cy5 ratio of each point, and the points with the ratio less than 0.5 and greater than 2 were considered to be genes with differential expression.

 The experimental results show that Cy3 signa l = 7577. 35 (take the average of four experiments), Cy5 signal = 55292. 74 (take the average of four experiments), Cy3 / Cy5 = 0. 13704, the present invention The expression of the polynucleotide in the above two tissues is significantly different, indicating that the polynucleotide of the present invention is related to liver cancer.

Claims

Rights request

1. An isolated polypeptide-phosphoribosyl pyrophosphate synthase protein 11, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative thereof.

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having an amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to the polynucleotide; or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises the sequence of positions 46-348 in SEQ ID NO: 1 or the sequence of positions 1-3903 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having phosphoribosyl pyrophosphate synthase protein 11 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under the condition of expressing phosphoribosyl pyrophosphate synthase protein 11;

 (b) Isolating a polypeptide having phosphoribosyl pyrophosphate synthase protein 11 activity from the culture.

 10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to a phosphoribosyl pyrophosphate synthase protein 11.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of phosphoribosyl pyrophosphate synthase protein 11.

12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 13. The use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of phosphoribosyl pyrophosphate synthase protein 11 in vivo and in vitro.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1-3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of phosphoribosyl pyrophosphate synthase protein 11; or Identification of peptide fingerprints.

 * 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for producing a gene Chip or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist is used Or the inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with abnormality of phosphoribosyl pyrophosphate synthase protein 11.

 18. The use of a polypeptide, polynucleotide or compound according to any one of claims 1-6 and 11, characterized in that the polypeptide, polynucleotide or compound is used for preparing for treating malignant tumors, blood, etc. Disease, HIV infection and immune diseases and drugs of various inflammations.