WO2001041784A1 - Methods and compositions for use in the treatment of filovirus mediated disease conditions - Google Patents

Methods and compositions for use in the treatment of filovirus mediated disease conditions Download PDF

Info

Publication number
WO2001041784A1
WO2001041784A1 PCT/US2000/033403 US0033403W WO0141784A1 WO 2001041784 A1 WO2001041784 A1 WO 2001041784A1 US 0033403 W US0033403 W US 0033403W WO 0141784 A1 WO0141784 A1 WO 0141784A1
Authority
WO
WIPO (PCT)
Prior art keywords
filovirus
cell
agent
cells
entry
Prior art date
Application number
PCT/US2000/033403
Other languages
French (fr)
Inventor
Mark A. Goldsmith
Stephen Y. Chan
Original Assignee
The Regents Of The University Of California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Regents Of The University Of California filed Critical The Regents Of The University Of California
Priority to AU22568/01A priority Critical patent/AU2256801A/en
Publication of WO2001041784A1 publication Critical patent/WO2001041784A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/162—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/82—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving vitamins or their receptors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • Filoviruses belong to a virus family called Fikrvmdae and can cause severe hemorrhagic fever in humans and non-human p ⁇ mates So far, only two members of this virus family have been identified Marburg virus and Ebola virus Four subtypes of Ebola virus have been identified Ivory Coast, Sudan, Zaire, and Reston The Reston subtype is the only known filovirus that does not cause severe disease m humans, however, it can be fatal m monkeys
  • Filoviruses including the Marburg and Ebola viruses, cause sporadic epidemics of human disease characterized by systemic hemorrhage, multi-organ failure and death m most instances In an outbreak or isolated case among humans, just how the virus is transmitted from the natural reservoir to a human is unknown Once a human is infected, however, person-to-person transmission is the means by which further infections occur Specifically, transmission mvolves close personal contact between an infected individual or their body fluids, and another person Du ⁇ ng recorded outbreaks of hemorrhagic fever caused by filovirus infection, persons who cared for or worked very closely with infected individuals were especially at risk of becoming infected themselves Nosocomial transmission through contact with infected body fluids, e g , via re-use of unste ⁇ hzed syringes, needles, or other medical equipment contaminated with these fluids - has also been an important factor m the spread of disease When close contact between umnfected and infected persons is minimized, the
  • hemorrhagic manifestations are common and mclude petechiae as well as frank bleeding, which can arise from any part of the gastrointestinal tract and from multiple other sites.
  • Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host.
  • an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry is administered to the host.
  • the subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.
  • the invention further provides agents useful in treating a filovirus-mediated disease condition, as well as compositions comprising the agents.
  • Agents include those that inhibit filovirus binding to a folate receptor on the cell surface, agents that reduce the level of folate receptor on the cell surface, and agents that modulate the folate receptor such that binding of a filovirus to the folate receptor is reduced.
  • the invention further provides screening methods for identifying agents that reduce filovirus entry into a susceptible cell. Both cell-free and cell-based assay methods are provided.
  • Figs . 1 A to 1 C provide graphical results showing that co-expression of an envelope negative HTV clone with a gene encoding Marburg or Ebola Zaire envelope glycoproteins leads to the generation of infectious virion particles with properties of the parental filovirus.
  • Figs. 2A and 2B provide a graphical representation of the results of a permissivity screening assay.
  • Fig. 3 provides a graphical representation of the efficiency of infection of Jurkat EctR with a retroviral cDNA library.
  • Fig. 4 provides a table of the results of viability assay in which Jurkat EctR cells were challenged with a retroviral cDNA library and HTV blasti-pseudotype viruses after selection in 40 ⁇ g/ml blasticidin S .
  • Fig 5 provides graphical results from an assay in which Jurkat EctR batches selected for blasticidrn S were rechallenged with VSV, Ebola-Zaire and Marburg luciferase pseudotype viruses
  • Fig 6 provides the graphical results of an assay in which the infection of Jurkat EctR cells transiently expressing truncated human folate receptor alpha with a Marburg pseudotype virus was studied
  • Fig 7 provides a graphical representation of an assay m which the infection of target cells by Marburg and Ebola-Zaire pseudotype viruses after phosphohpase C treatment was studied
  • Fig 8 provides the graphical results of an assay in which infection of a Jurkat EctR clone derived from the initial blasticidrn selection following infection with Marburg psedutotype virus was completely inhibited by a commercially available rabbit polyclonal antiserum (from Biogenesis) raised against the human folate binding prote
  • Fig 9 provides the graphical results of an assay in which infection of Vero E6 cells b ⁇ MBG lucerfase virus, but notby VSV luciferase virus, is inhibited in the presence of polyclonal rabbit anti- bovme folate binding protem, but not by normal rabbit serum
  • Fig 10 provides the graphical results of an assay, showmg that entry by MBG, but not VSV, luciferase virus mto Jurkat-EctR F10 cells is specifically abrogated in the presence of mouse monoclonal anti-FR, compared to lsotype control, antibody
  • Fig 11 provides the graphical results of an assay, showing that entry by MBG, but not Ampho, luciferase virus mto human osteosarcoma cells is specifically inhibited by extracellular fohc acid
  • Figure 12 provides the results of an assay showing that mfection of HOS cells by MBG, but not VSV, luciferase virus specifically decreases in the presence of soluble bovme FBP
  • Figures 13A-D provide the graphical results of assays showmg that expression of FR- ⁇ m Jurkat-EctR cells reconstitutes permissivity to entry mediated by either MBG or EBO-Z GP
  • Figure 13A shows that pre-treatment of HeLa cells with phosphohpase C resulted in complete abrogation of entry by EBO-Z luciferase virus
  • Figure 13B shows that the reconstituted Jurkat-EctR cell clone A7- 1, selected after challenge by EBO-Z-blasti virus and transduced with a cDNA encodmg FR- ⁇ , is infectable by both MBG and EBO-Z luciferase viruses, unlike Jurkat-EctR parental cells
  • Figure 13C shows that Jurkat-EctR F10 cells reconstituted for infection by MBG-blasti virus and transduced with a cDNA encodmg a truncated FR- ⁇ , are infect
  • Figures 14A-C provide the graphical results of assays showmg that inhibition of vi ⁇ on access to FR- ⁇ inhibits entry of EBO-Z luciferase virus in naturally infectable HOS and Vero E6 cells
  • Figure 14A shows that entry by EBO-Z, but not Ampho, luciferase virus mto HOS cells is specifically inhibited by extracellular folic acid.
  • Figure 14B shows that infection of HOS cells by EBO-Z, but not VSV, luciferase virus specifically decreases in the presence of soluble bovine FBP.
  • Figure 14C shows that entry by EBO-Z, but not VSV, luciferase virus into Vero E6 cells is completely abrogated in the presence of polyclonal rabbit anti-bovine FBP, compared with levels observed in normal rabbit sera.
  • subject or “individual” or “host” or “patient,” which terms are used interchangeably herein, is meant any subject, particularly a mammalian subject, for whom diagnosis or therapy is desired, particularly humans.
  • Other subjects may include non-human primates, cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.
  • a filovirus-mediated disease condition encompasses a condition which is a direct result of filovirus infection; and a condition which is an indirect result, e.g., a sequela, of a filovirus infection.
  • Such conditions include, but are not limited to, fever, internal hemorrhaging, edema, organ failure, headache, malaise, myalgia, nausea, vomiting, bleeding of needle puncture sites, hematemesis, melena, petechiae, ecchymosis, maculopapular rash, disseminated intravascular coagulation, shock, jaundice, conjunctivitis, diarrhea, pharyngitis, convulsions, delirium, coma, oligura, and epistaxis.
  • an immune response is meant to encompass cellular and/or humoral immune responses that are sufficient to inhibit or prevent infection, or prevent or inhibit onset of disease symptoms caused by a filovirus, and to reduce the likelihood of an infection by a filovirus.
  • the terms "peptide,” “oligopeptide,” “polypeptide,” “polyprotein,” and “protein”, are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones.
  • fusion proteins including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
  • a polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at http://ww.ncbi.nlm.nih.gov/BLAST/. Another alignment algorithm is FASTA, available in the Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA, a wholly owned subsidiary of Oxford Molecular Group, Inc.
  • GCG Genetics Computing Group
  • the program has default parameters determined by the sequences inputted to be compared
  • the sequence identity is determined usmg the default parameters determined by the program This program is available also from Genetics Computing Group (GCG) package, from Madison, Wisconsm, USA
  • GCG Genetics Computing Group
  • One parameter for determining percent sequence identity is the "percentage of the alignment region length" where the strongest alignment is found. The percentage of the alignment region length is calculated by counting the number of residues of the individual sequence found m the region of strongest alignment This number is divided by the total residue length of the target or query polynucleotide sequence to find a percentage An example is shown below Target sequence GCGCGAAATACTCACTCGAGG I
  • the region of alignment begms at residue 9 and ends at residue 19
  • the total length of the target sequence is 20 residues
  • the percent of the alignment region length is 11 divided by 20 or 55%, for example Percent sequence identity is calculated by counting the number of residue matches between the target and query polynucleotide sequence and dividing total number of matches by the number of residues of the target or query sequence found in the region of strongest alignment. For the example above, the percent identity would be 10 matches divided by 11 residues, or approximately, 90.9%
  • the percent of the alignment region length is typically at least about 55% of total length of the sequence, more typically at least about 58%, and even more typically at least about 60% of the total residue length of the sequence. Usually, percent length of the alignment region can be as great as about 62%, more usually as great as about 64% and even more usually as great as about 66%.
  • epitopes are well understood in the art and refer to the portion of a macromolecule which is specifically recognized by a component of the immune system, e.g. , an antibody or a T-cell antigen receptor. Epitopes are recognized by antibodies in solution, e.g., free from other molecules. Epitopes are recognized by T-cell antigen receptor when the epitope is associated with a class I or class II major histocompatibility complex molecule.
  • Antibody specificity in the context of antibody-antigen interactions, is a term well understood in the art, and indicates that a given antibody binds to a given antigen, wherein the binding can be inhibited by that antigen or an epitope thereof which is recognized by the antibody, and does not substantially bind to unrelated antigens. Methods of determining specific antibody binding are well known to those skilled in the art, and can be used to determine the specificity of antibodies of the invention for a FR ⁇ polypeptide.
  • Antibody binding to an epitope on a specific FR polypeptide is preferably stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest, e.g., binds more strongly to a specific FR epitope than to a different FR epitope so that by adjusting binding conditions the antibody binds almost exclusively to the specific FR epitope and not to any other FR epitope, and not to any other FR polypeptide which does not comprise the epitope.
  • Antibodies which bind specifically to an FR polypeptide may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g. by use of appropriate controls.
  • antibodies of the invention which bind to a specific FR polypeptide with a binding affinity of 10 7 mole/1 or more, preferably 10 8 mole/liters or more are said to bind specifically to the specific FR polypeptide.
  • an antibody with a binding affinity of 10 6 mole/liters or less is not useful in that it will not bind an antigen at a detectable level using conventional methodology currently used.
  • antisense polynucleotide is meant a polynucleotide having a nucleotide sequence complementary to a given polynucleotide sequence (e g, a polynucleotide sequence encodmg a FR polypeptide) including polynucleotide sequences associated with the transcnption or translation of the given polynucleotide sequence (e g , a promoter of a polynucleotide encodmg FR polypeptide), where the antisense polynucleotide is capable of hyb ⁇ dizmg to a FR polypeptide-encoding polynucleotide sequence
  • antisense polynucleotide capable of inhibiting transcnption and/
  • transformation is meant a permanent or transient genetic change mduced m a cell followmg incorporation of new DNA (1 e , DNA exogenous to the cell) Genetic change can be accomplished either by incorporation of the new DNA mto the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA mto the genome of the cell
  • construct is meant a recombmant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombmant nucleotide sequences
  • isolated is meant to descnbe a compound of mterest (e g , a virus, a peptide, etc ) that is m an environment different from that m which the compound naturally occurs "Isolated” is meant to mclude compounds that are within samples that are substantially ennched for the compound of mterest and/or m which the compound of interest is partially or substantially punfied
  • the term "substantially punfied” refers to a compound that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated
  • the terms “treatment”, “treating”, and the like refer to obtaining a desired pharmacologic and/or physiologic effect The effect may be prophylactic m terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic m terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease
  • Treatment covers any treatment of a disease in a mammal, particularly in a human, and mcludes (a) preventing the disease from occumng m a subject which may be predisposed to the disease, or which may be susceptible to the disease, but has not yet been diagnosed as having it (e g , where the subject is susceptible to infection by a pathogen, but has not yet been infected by the
  • a "biological sample” encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay.
  • the term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
  • the term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components.
  • the term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids and tissue samples.
  • immunologically active refers to the capability of a natural, recombinant or synthetic FR polypeptide, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies.
  • antigenic amino acid sequence means an amino acid sequence that, either alone or in association with a carrier molecule, can elicit an antibody response in a mammal.
  • mimetic refers to a non-natural compound which exhibits one or more properties of a naturally occurring compound.
  • Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host.
  • an effective amount of an agent that at least reduces the amount of folate receptor-mediated filovirus cell entry is administered to the host.
  • the subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.
  • the present invention provides methods of treating a filovirus-mediated disease condition in an individual.
  • the methods generally comprise aclministering to an individual an effective amount of an agent that reduces a level of folate receptor-mediated viral entry into a cell in the individual.
  • the invention provides methods of inhibiting binding of a filovirus to an FR receptor on the surface of a susceptible cell.
  • the invention provides methods for reducing a level of FR receptor on the surface of a cell that normally expresses FR receptor on its cell surface.
  • the invention provides methods for modulating an FR receptor on a surface of a cell such that filovirus binding to the FR receptor is reduced.
  • filovirus refers to any known filovirus, including but not limited to, Marburg virus and Ebola virus, and subtypes of any known filovirus. Four subtypes of Ebola virus have been identified: Ivory Coast, Sudan, Zaire, and Reston. The nucleotide sequence of the complete genome of Ebola virus is found under GenBank Accession number NC_002549. The nucleotide sequence of the complete genome of Marburg virus is found under GenBank Accession No. NC_001608.
  • a "susceptible cell” (also referred to herein as a “permissive cell”) is therefore any eukaryotic cell which expresses a FR on its cell surface such that a filovirus can bind to the cell surface FR and enter the cell.
  • a susceptible cell is a primate cell, e.g., a human cell or a monkey cell.
  • a "susceptible cell” includes, but is not limited to, a susceptible in an animal, e.g., a primate; a susceptible cell in an organ from the animal (e.g., an organ removed from the animal); a susceptible cell in a biological sample derived from an animal; a susceptible cell in in vitro culture, e.g., a cell isolated from an animal; a susceptible cell which is made susceptible by virtue of having been transformed with a nucleic acid construct comprising a nucleic acid sequence that encodes a FR, e.g.
  • a cell line which does not normally express FR on its cell surface but which does so after introduction into the cell line of a construct which results in expression of FR on the cell surface, as described in the Examples; and a susceptible cell which is a cell line that is naturally permissive to filovirus infection, including, but not limited to, HeLa cells and VeroE6 cells. Whether a cell is susceptible to infection by a filovirus can be determined by any known method, including those described in the Examples.
  • an "effective amount" of an agent that reduces FR-mediated entry into a cell is one that reduces filovirus entry into a susceptible cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90, or at least about 100%, when compared to a susceptible cell m the absence of the agent
  • an "effective amount" of an agent is contacted with a population of susceptible cells, where an "effective amount” is an amount that reduces the proportion of cells m the population that is infected by the filovirus by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%), at least about 70%, at least about 80%, at least about 90, or at least about 100%, when compared
  • a method of treatmg a filovirus-mediated disease condition m an mdividual comp ⁇ ses administering to an mdividual an effective amount of a substance that inhibits bmdmg of a filovirus to a FR on the surface of a susceptible cell m the individual
  • the term "agent" refers to any substance that inhibits bmdmg of a filovirus to FR, including, but not limited to, antibody specific for FR, fo c acid and its de ⁇ vatives, and soluble FR
  • these methods mvolve blockmg a bmdmg event between a filovirus and an FR
  • the methods provide for inhibiting bmdmg of a filovirus to an FR on
  • the level of FR on the cell surface can be determined (e g , measured) usmg any known method, mcludmg, but not limited to, contacting a cell with a detectably labeled antibody specific for FR, and determining the amount of bound antibody usmg. e g , fluorescence activated cell sorting (FACS), radiohgand bmdmg, lmmunofluorescence.
  • FACS fluorescence activated cell sorting
  • radiohgand bmdmg radiohgand bmdmg
  • lmmunofluorescence lmmunofluorescence.
  • Reduction m a level of FR receptor displayed on the surface of a cell that normally expresses FR receptor on its cell surface may be accomplished by a vanety of means, mcludmg, but not limited to, reducmg the level of transcnption of a gene encodmg the FR, reducmg the level of FR-encoding mRNA available to be translated, reducmg the level of translation of an FR-encoding mRNA, reducmg formation of a GPl linkage on the FR, thereby resultmg in secretion of the FR from the cell, rather than placement m the cell membrane, reducmg the rate and/or level of any cell biological process that normally results in expression of FR on the cell surface
  • the method is specific or relatively specific to FR, e g , the method does not reduce the level of any other protem on the cell surface
  • Reduction m expression of an FR-encoding gene may be accomplished by usmg antisense to the FR
  • Antisense molecules can be used to down-regulate expression of FR-encodmg genes m cells
  • the anti-sense reagent may be antisense ohgodeoxynucleotides (ODN), particularly synthetic ODN havmg chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA
  • ODN antisense ohgodeoxynucleotides
  • the antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products
  • Antisense molecules inhibit gene expression through vanous mechanisms, e g by reducmg the amount of mRNA available for translation, through activation of RNAse H, or stenc hindrance
  • One or a combmation of antisense molecules may be administered, where a combmation may compnse two or more different sequences
  • Antisense molecules may be produced by expression of all or a part of the target gene sequence m an appropnate vector, where the transc ⁇ ptional initiation is o ⁇ ented such that an antisense strand is produced as an RNA molecule
  • the antisense molecule is a synthetic ohgonucleotide
  • Antisense ohgonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides m length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides m length, where the length is governed by efficiency of inhibition, specificity, mcludmg absence of cross-reactivity, and the like It has been found that short ohgonucleotides, of from 7 to 8 bases m length, can be strong and selective inhibitors of gene expression (see Wagner et al (1996) Nature Biotechnology 14 840- 844)
  • a specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence
  • Selection of a specific sequence for the ohgonucleotide may use an empincal method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model A combmation of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation
  • Antisense ohgonucleotides may be chemically synthesized by methods known m the art (see Wagner et al (1993) supra ) Preferred ohgonucleotides are chemically modified from the native phosphodiester structure, m order to increase their mtracellular stability and bmdmg affinity Such modifications have been previously discussed with respect to the use of probes
  • catalytic nucleic acid compounds e g nbozymes, anti-sense conjugates, etc may be used to inhibit gene expression Ribo
  • the mvention provides methods for modulating an FR receptor on a surface of a cell such that filovirus bmdmg to the FR receptor is reduced
  • the agent may modulate the configuration of the surface membrane-associated FR such that it no longer bmds filovirus
  • the agent may be one that modulates trafficking, clustering, or lnternalization of FR
  • the agent may be one that inhibits glycosylation of FR Roberts et al (1998) Arch Biochem Biophys 351 227-235
  • more than one agent may be admmistered to an mdividual m need of treatment
  • a mixture of two or more monoclonal antibodies specific for distmct, non- overlapping epitopes on an FR may be admmistered to the mdividual Mixtures of two or more different agents, e g , a monoclonal antibody specific for an FR and a folate receptor gand, may also be admmistered
  • An agent is administered to an mdividual using any available method and route suitable for drug delivery, mcludmg in vivo and ex vivo methods, as well as systemic and localized routes of admmistration
  • Conventional and pharmaceutically acceptable routes of admmistration mclude intranasal, intramuscular, lntratracheal, intratumoral, subcutaneous, intradermal, topical application, mtravenous, rectal, nasal, oral and other parenteral routes of administration Routes of admimstration may be combined, if desired, or adjusted dependmg upon the agent used and/or the desired effect
  • An agent can be admmistered to a host usmg any available conventional methods and routes suitable for delivery of conventional drugs, mcludmg systemic or localized routes
  • routes of administration contemplated by the invention include, but are not necessarily limited
  • Parenteral routes of administration other than inhalation aclministration include, but are not necessarily limited to, topical, transdermal, subcutaneous, intramuscular, intraorbital, intracapsular, intiaspinal, intrastemal, and intravenous routes, i. e. , any route of a ⁇ nistration other than through the alimentary canal.
  • Parenteral admimstration can be carried to effect systemic or local delivery of the agent. Where systemic delivery is desired, aclministration typically involves invasive or systemically absorbed topical or mucosal a ⁇ ninistration of pharmaceutical preparations.
  • An agent can also be delivered to the subject by enteral administration.
  • Enteral routes of a ⁇ ministration include, but are not necessarily limited to, oral and rectal (e.g., using a suppository) delivery.
  • Methods of administration of an agent through the skin or mucosa include, but are not necessarily limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection and epidermal administration.
  • the invention also contemplates opthalmic administration of an agent, which generally involves invasive or topical application of a pharmaceutical preparation to the eye. Eye drops, topical cremes and injectable liquids are all examples of suitable formulations for delivering drugs to the eye.
  • a suitable dosage range is one which provides up to about 1 ⁇ g to about 1,000 ⁇ g or about 10,000 ⁇ g of agent can be a ⁇ ministered in a single dose.
  • a target dosage of agent can be considered to be about 1-10 ⁇ M in a sample of host blood drawn within the first 24-48 hours after administration of the agent.
  • an agent is administered in an amount within the range from about 0.002 mg/kg to about 10 mg kg, or from about 0.01 mg/kg to about 3 mg/kg body weight.
  • an agent is to be administered intravenously, it will be formulated in conventional vehicles, such as distilled water, saline, Ringer's solution or other conventional carriers.
  • the invention further provides methods for immunizing a host against a filovirus med ated disease condition.
  • the methods involve administering to a host an effective amount of an immunogen that causes said host to mount an immune response against membrane bound folate receptors, where antibodies are generated that inhibit filovirus binding to the FR, thereby reducing entry of the filovirus into a permissive cell.
  • the immunogen is a membrane bound folate receptor or fragment thereof.
  • Methods of generating an immune response in a host are known in the art and need not be elaborated upon here. Whether an individual has mounted an immune response to a membrane bound folate receptor can be readily determined. For example, a biological sample, such as a blood or serum sample, is removed from the individual, and the presence of antibodies that specifically bind to membrane bound FR and block or inhibit filovirus binding to the FR is detected using assays such as those described in the Examples.
  • Antibodies generated in a human in the manner described above may be isolated and used prophylactically in a passive immunization protocol to protect another human against a filovirus- mediated disease condition.
  • a health care worker or other medical personnel or support staff who anticipate being in a situation which puts him/her at risk for exposure to filovirus may be treated prophylactically with anti-FR antibodies generated in another human.
  • short- term protection of such individuals may be adequate to protect the individual from filovirus infection, or may reduce symptoms during infection (e.g., attenuation of disease).
  • the invention provides a method of a identifying a cell surface receptor used by a virus for entry into a cell.
  • the methods generally comprise: (a) identifying a cell line that is non-permissive for entry of the virus; (b) transfecting a population of said non-permissive cell line with a genomic or a cDNA library obtained from a cell line permissive for entry of the virus; (c) identifying at least one cell from said transfected cell population which is permissive for entry of the virus; and (d) identifying at least one gene of the permissive cell line in the genome of the transfected permissive cell.
  • These methods are useful for identifying a cell surface receptor for a filovirus.
  • a population of non-permissive cells is transfected with a cDNA library made from a permissive cell such that a member of the cDNA library are expressed in a cell of the transfected non-permissive cell population.
  • a pseudotype virus may be employed, in which an envelope-negative mutant virus carrying a selectable marker is engineered to contain a filovirus envelope glycoprote n.
  • a pseudovirus as described in the Examples is used.
  • an agent that is suitable for treating a filovirus-mediated disease condition is one that inhibits binding of a filovirus to an FR ⁇ on the surface of a susceptible cell.
  • an FR antagonist is any agent that inhibits a bmdmg event between a filovirus and a membrane-bound FR, mcludmg, but not limited to, a soluble FR, an antibody specific for an FR, a filovirus-de ⁇ ved FR gand, an FR hgand, and a fragment, denvative, or mimetic of any of the foregomg
  • an agent is one that modulates trafficking, clustering, or mternalization of membrane bound folate receptors
  • an agent is one that modulates expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced
  • FR is a protem encoded by a gene that is a member of the folate receptor family Members of this gene family have a high affinity for fohc acid and for several reduced fohc acid denvatives, and mediate delivery of 5-methyltetrahydrofolate to the mtenor of eukaryotic cells
  • the gene is composed of 7 exons exons 1-4 encode the 5' untranslated region and exons 4 through 7 encode the open readmg frame Due to the presence of 2 promoters, multiple transcnption start sites, and alternative splicing of exons, at least 8 transc ⁇ pt vanants are denved from this gene These vanants differ m the length of 5 ' and 3 ' UTR, but they encode an identical amino acid sequence Elwood et al (1997) Biochem 36 1467-1478
  • Human FR ⁇ (also referred to as folate bmdmg protem) is synthesized m cells as an integral membrane-associated protem and as a soluble protem Sadavisan and Rothenberg (1989) J Bwl Chem 264 5806-5811
  • the ammo acid sequence of human FR ⁇ is provided under GenBank Accession No NM_016731
  • the membrane-associated form is a glycosyl phosphatidyl mositol linked protem, while the secreted form lacks the GPl moiety
  • Nucleotide and ammo acid sequences of FR from other species are also publicly available under GenBank
  • the terms "folate receptor " and "folate bmdmg protem” are used interchangeably herem and refer to FR from any of a variety of species, mcludmg, but not limited to, human, murme (mouse or rat), bov e.
  • an FR is a human FR ⁇ havmg the ammo acid sequence set forth m GenBank Accession No NM_016731
  • an FR is a polypeptide comp ⁇ smg an ammo acid sequence that shares at least about 50%), at least about 60%, at least about 75%, at least about 80%, at least about 90%, or at least about 95% or more sequence identity with the sequence set forth in GenBank NM_016731
  • the FR admmistered to the mdividual does not elicit an immune reaction
  • the mdividual to the FR "FR" also encompasses fragments of an FR that inhibit bmdmg of a filovirus to an FR on the surface of a susceptible cell
  • Full length FR is a protem of about 226 ammo acids
  • FR is a fragment of from about 15 to about 20, from about 20 to about 25, from about 25 to about 50,
  • FR or may be an FR made recombinantly "FR" also encompasses mrmetics of a naturally occumng FR, and peptoids Methods of synthesizing peptoids, and peptoid hbra ⁇ es, and methods of screening same are found in, e g , U S Patent No 5,965,695, and 6,075,121
  • FR may be made recombinantly usmg standard techmques of molecular biology, may be made synthetically usmg standard techmques of protem synthesis, may be isolated from a source m which it naturally occurs (e g , milk or other body fluids), or a combmation of any of the foregomg FR polypeptides can be isolated from a biological source, using affinity chromatography, e g , usmg antibodies specific for FR which are immobilized on a solid support
  • the polypeptides may be expressed m prokaryotes or eukaryotes m accordance with conventional ways, depending upon the purpose for expression
  • a unicellular organism such as E coll, B subtihs, S cerevisiae, insect cells m combmation with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e g COS 7 cells, CHO cells, HEK293 cells, HeLa cells, and the like, may be used as the expression host cells
  • the polypeptide can then be isolated from cell culture supernatant or from cell lysates using affinity chromatography methods or anion exchange/size exclusion chromatography methods, as descnbed above
  • an FR may be admmistered m a formulation m association with (e g , chemically associated, or m admixture with) another macromolecule, mcludmg, but not limited to, a protem, mcludmg, but not limited to, albumin, a nanoparticle, a hpid, mcludmg, but not limited to hposomes, a polysacchande, a polyalcohol, mcludmg, but not limited to, a polyethylene glycol, a glycoprotem, and combmations of the for
  • a folate receptor hgand may be fohc acid (5- methyl tetrahydrofohc acid), or a derivative thereof, mcludmg, but not limited to, dihydrofolate, tetrahydrofolate, 5-methyltetrahydrofolate, 5,10-methylenetetrahydrofolate, 5,10- methenyltetrahydrofolate, 5,10-fo ⁇ ruimnotetrahydrofolate, 5-formyltetrahydrofolate (leucovo ⁇ n), and 10-fo ⁇ nyltetrahydrofolate
  • Filovirus-denved folate receptor ligands mclude, but are not limited to, a filovirus envelope glycoprotem Marburg envelope glycoprotem is desc ⁇ bed m Xu et al (1998) Nat Med 4 37-42, and Ebola virus Zaire envelope glycoprotem is desc ⁇ bed m GenBank accession number U31033 "Filovirus envelope glycoprotem," as used herem m the context of an agent that inhibits bmdmg of a filovirus to a membrane-bound FR, encompasses full- length filovirus envelope glycoprotem (GP), fragments of a filovirus envelope GP which mediate bmdmg to an FR
  • GP full- length filovirus envelope glycoprotem
  • an agent that inhibits bmdmg of a filovirus to an FR on the surface of a susceptible cell may be an antibody
  • the term "antibodies” mcludes antibodies of any isotype, fragments of antibodies which retain specific bmdmg to antigen, mcludmg, but not limited to, Fab, Fv, scFv, and Fd fragments, chimenc antibodies, humamzed antibodies, smgle-cham antibodies, and fusion protems compnsmg an antigen-binding portion of an antibody and a non-antibody protem
  • the antibodies may be detectably labeled, e g , with a radioisotope, an enzyme that generates a detectable product, a green fluorescent protem, and the like
  • the antibodies may be further conjugated to other moieties, such as members of specific bmdmg pairs, e g , biotm (member of biotin-avidin specific bmdmg pair),
  • Antibodies generated to an FR may be screened for the ability to inhibit bmdmg of a filovirus to an FR, usmg, e g , the methods desc ⁇ bed m the Examples Agent that modulate trafficking, clustering, or mternahzation of membrane bound folate receptors
  • Agents that modulate trafficking, clustering, or mternahzation of membrane-bound FR m include, but are not limited to, an agent that inhibits or mterferes with glycohpid anchors, e g , phosphohpase-C, an agent that inhibits or mterferes with glycosylation of an FR, agents that disrupt the pathway to construct GPl anchors m the endoplasmic reticulum, agents that disrupt acidification of vesicles, agents that inhibit recyclmg of GPI-linked protems such as FR, agents that prevent multimenzation of FR at the cell surface (e g , FR fragments that bmd to multime ⁇ zation domains, and agents that prevent endocytosis of FR or GPI-hnked protems Agents that modulate expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced
  • Agents that modulate expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced include, but are not limited to, antisense molecules (as discussed above), ⁇ bozymes (as discussed above), compounds that selectively reduce transcnption of a FR gene, and dommant-negative forms of FR which reduce and/or prevent proper bmdmg, foldmg, or multimenzation of FR on the cell surface
  • compositions compnsmg an agent of the invention may mclude a buffer, which is selected accordmg to the desired use of the agent, and may also mclude other substances appropnate to the intended use Those skilled m the art can readily select an appropnate buffer, a wide vanety of which are known m the art, suitable for an mtended use
  • the composition can compnse a pharmaceutically acceptable excipient, a vanety of which are known m the art and need not be discussed m detail herem
  • Pharmaceutically acceptable excipients have been amply desc ⁇ bed m a vanety of publications, mcludmg, for example, A Gennaro (1995) "Remington The Science and Practice of Pharmacy", 19th edition, Lippmcott, Williams, & Wilkins
  • compositions can be prepared m vanous forms, such as granules, tablets, pills, supposito ⁇ es, capsules, suspensions, salves, lotions and the like
  • Pharmaceutical grade organic or inorganic earners and or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds
  • Diluents known to the art mclude aqueous media, vegetable and ammal oils and fats Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents Screening Assays
  • the present invention provides methods of screening for candidate agents that are useful in treating a filovirus-mediated disease condition.
  • methods are provided for screening for candidate agents that inhibit binding of a filovirus to a FR on the surface of a susceptible cell.
  • methods are provided for screening for candidate agents that reduce a level of FR on the surface of a susceptible cell.
  • candidate agent is used interchangeably herein with the terms “candidate substance” and “candidate compound”.
  • a “candidate agent,” as used herein, describes any molecule, e.g. protein; peptide; natural or synthetic inorganic or organic compound, or pharmaceutical, with the capability of reducing filovirus entry into a susceptible cell, as described above.
  • a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
  • one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
  • Candidate agents encompass numerous chemical classes, and may be natural or synthetic inorganic or organic molecules, which may be small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons.
  • Candidate agents may comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized ohgonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries.
  • pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, glycosylation, amidification, etc. to produce structural analogs.
  • the screening assay is a binding assay
  • one or more of the molecules may be joined to a label, where the label can directly or indirectly provide a detectable signal.
  • Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like.
  • Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc.
  • the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
  • reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40 °C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
  • methods are provided for identifying a candidate agent that inhibits filovirus binding to FR.
  • the methods are cell-free methods, m other embodiments, the methods are cell-based methods.
  • the methods described below are in vitro screening methods.
  • Candidate agents identified by the methods described below include those that act to block binding of a filovirus to an FR; and those that act to modulate a configuration of an FR such that filovirus binding is reduced.
  • Candidate agents of interest are those that reduce filovirus entry into a cell. Accordingly, in some embodiments, the methods provide for identifying a candidate agent that reduces filovirus entry into a cell.
  • determining includes “measuring” and “detecting,” e.g., the determination may be quantitative or semi-quantitative (e.g., “measuring”) or qualitative (e.g., "detecting”).
  • Agents which decrease FR-filovirus binding to the desired extent may be selected for further study, and assessed for cellular availability, cytotoxicity, biocompatibility, etc.
  • candidate agents that inhibit FR-filovirus binding by at least about 10%, at least about 15%, at least about 20%, at least about 25%, more preferably at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, at least about 100%, or 2-fold, at least about 5-fold, or at least about 10-fold or more when compared to a suitable control.
  • a candidate agent which inhibits FR-filovirus binding can also be one that abrogates measurable FR- filovirus binding completely.
  • candidate agents that reduce filovirus entry into a cell susceptible to filovirus infection by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, at least about 100%, or 2-fold, at least about 5-fold, or at least about 10-fold or more when compared to a suitable control.
  • a candidate agent which inhibits FR-filovirus entry can also be one that abrogates measurable FR-filovirus entry completely.
  • Cell-free methods are also be one that abrogates measurable FR-filovirus entry completely.
  • a cell-free method to identify candidate agents that inhibit binding of a filovirus to an FR generally comprise: a) contacting a candidate agent with a sample containing an FR and a filovirus; and b) determining whether binding between the FR and the filovirus is reduced.
  • the screening methods will employ a filovirus envelope glycoprotein.
  • the term "filovirus,” in the context of screening assays of the invention, encompasses a filovirus envelope glycoprotein.
  • the methods comprise contacting a candidate agent with a sample containing an FR and a filovirus envelope glycoprotein; and dete ⁇ nining whether FR-filovirus envelope glycoprotein binding is reduced, compared to binding in the absence of the candidate agent.
  • Marburg envelope glycoprotein is described in Xu et al. (1998) Nat. Med. 4 :37-42; and Ebola virus Zaire envelope glycoprotein is described in GenBank accession number U31033.
  • "Filovirus envelope glycoprotein,” as used herein, encompasses full-length filovirus envelope glycoprotein (GP); fragments of a filovirus envelope GP which mediate binding to an FR; fusion proteins comprising the filovirus envelope GP (or fragment thereof), including, but not limited to, epitope-tagged filovirus envelope GP.
  • the filovirus envelope GP may be detectably labeled.
  • Determining whether FR-filovirus binding is reduced can be accomplished in a variety of ways, including, but not limited to, any known immunological assay method, including, but not limited to, an immunological assay in which FR-filovirus binding is detected using antibody to the FR, to the filovirus (where the antibody is not one that inhibits FR-filovirus binding), to an epitope tag moiety of an FR fusion protein, or to an epitope tag moiety of a filovirus envelope GP; an enzyme-linked immunological assay; an immunological assay in which the FR and/or the filovirus is detectably labeled.
  • any known immunological assay method including, but not limited to, an immunological assay in which FR-filovirus binding is detected using antibody to the FR, to the filovirus (where the antibody is not one that inhibits FR-filovirus binding), to an epitope tag moiety of an FR fusion protein, or to an epitope tag moiety of a filovirus envelope
  • the screening assays are cell-based assays.
  • the methods generally comprise contacting a cell susceptible to infection by a filovirus with a candidate agent; and determining an effect, if any, on filovirus binding to the cell.
  • the methods generally comprise contacting a cell susceptible to infection by a filovirus with a candidate agent; and determining an effect, if any, on filovirus entry into the cell.
  • Cells suitable for use in these methods are any permissive eukaryotic cell, including cells that are naturally permissive, including, but not limited to, those cells shown in Figure 2 that were shown to be permissive for filovirus infection (e.g., HOS, HeLa, VeroE6, CHO; and cells that are modified to be permissive for filovirus entry, including, but not limited to, cells as described in the Examples.
  • a pseudotype virus e.g., an HTV-1 virus engineered to contain a nucleotide sequence encoding a filovirus envelope glycoprotein, such as described in the Examples, may be employed.
  • filovirus encompasses pseudotype virus comprising a nucleotide sequence encoding a filovirus envelope glycoprotein. Whether filovirus binds to and enters the cell can be determined using any known assay method, including, but not limited to, assays described in the Examples. As described in the Examples, a pseudotype virus can be engineered to comprise a filovirus envelope GP and a nucleotide sequence encoding a selectable marker, or a detectable gene product (e.g., luciferase, GFP, and the like). Filovirus entry into the cell can then be determined by, e.g., measuring the amount of detectable gene product in the cell. The assay can also be conducted so as to determine the number of cells in a cell population that are infected.
  • a pseudotype virus can be engineered to comprise a filovirus envelope GP and a nucleotide sequence encoding a selectable marker, or a detectable gene product (e.g., luciferas
  • Methods of screening for candidate agents that reduce a level of FR on the surface of a susceptible cell comprise contacting a susceptible cell with a candidate agent; and determining the effect, if any, on the level of
  • Cells which may be employed are as described above, and are generally cells that are susceptible to filovirus infection by virtue of expressing an FR on the cell surface.
  • Methods for dete ⁇ mning whether a candidate agent reduces a level of FR on the cell surface include methods of measuring or detecting filovirus entry into the cell, as described above.
  • Determination of whether a candidate agent reduces FR gene expression can be carried out using any known assay.
  • a polymerase chain reaction PCR
  • PCR polymerase chain reaction
  • Another method which may be employed involves an assay in which a cell is transfected with a construct comprising an FR promoter driving transcription of a reporter gene, and the effect of the candidate agent on the level of transcription of the reporter gene is determined.
  • EXPERIMENTAL EXAMPLE 1 Identification of a cofactor for entry of Marburg and Ebola viruses into susceptible cells
  • HOS Human osteosarcoma
  • HeLa HeLa
  • 293T Vero E6, and CHO-K1 cells were cultured as recommended by the American Type Culture Collection (ATCC).
  • Jurkat T-cells stably expressing the ecotropic murine leukemia virus (MLV) receptor Jurkat-EctR, kindly provided by Dr. G. Nolan, Stanford University were cultured as recommended for Jurkat T-cells by the ATCC.
  • the NIH-3T3 based MLV packaging cell line PT67 (Clontech, Palo Alto, CA) was cultured as previously described (Miller and Chen (1996) J. Virol. 70, 5564-5571.
  • GHOST Human osteosarcoma
  • GFP green fluorescent protein
  • Plasmids and cDNA library amplification The molecular clone pNL-Luc-E"R" (Connor et al., (1995) Virology 206, 935-944), the HTV-l NL4-3 provirus carrying a luciferase reporter gene driven by the 5' LTR (along with mutations in env, nef, and vpr), was a gift of Dr. N. Landau (Salk Institute) via the AIDS Research and Reference Reagent Program. HJV-blasti, an HTV-l proviral construct carrying the blasticidrn S deaminase gene driven by the 5 ' LTR along with null mutations in env and nef, was provided by Dr.
  • VSV-G vesicular stomatitis virus-G
  • pMULV-A encoding the amphotropic (Ampho) murine leukemia virus (MLV) env
  • MBV amphotropic murine leukemia virus
  • a bacterial glycerol stock transformed with the MLV retroviral cDNA library (pLib MLV backbone) derived from HeLa cells (2x10 6 independent clones) was plated on LB agar (100 ⁇ g/ml ampicillin) plates as described by the manufacturer (Clontech, Palo Alto, CA). Approximately 8x10 6 bacterial colonies were amplified in LB liquid broth, and library DNA was extracted for subsequent virus packaging and transduction into Jurkat-EctR cells. The plasmid pLib-GFP encoding the green fluorescent protein in the MLV backbone was used as a marker for quantitating efficiency of transduction. Antibodies.
  • convalescent guinea pig antisera to MBG virus (Musoke) was generated.
  • FITC-conjugated anti-guinea pig secondary antisera was purchased.
  • polyclonal rabbit antisera raised against FBP in bovine milk (Biogenesis, Poole, England, UK) and normal rabbit sera (kindly provided by Dr. O. Keppler, Gladstone Institute of Virology and Immunology, CA) were compared.
  • monoclonal mouse IgGl ascites raised against human FR- ⁇ (kindly provided by Dr. W.
  • HTV-l pseudotype virus carrying the luciferase gene (Luc + ) with the Ampho, VSV-G, MBG, or EBO-Z GP pNL-Luc-E " R- (2 ⁇ g/well) was co- transfected with each envelope glycoprotein expression vector (2 ⁇ g/well) using the CaP0 method in 293T cells as previously described (Chan et al., (1999) J. Virol. 73, 2350-2358).
  • HTV-l pseudotype virus carrying the blasticidin S deaminase gene (blasti)
  • 293T cells (400,000 cells/well in 6-well plates) were transiently co-transfected using the CaP0 4 method with pHTV-blasti (2 ⁇ g/well) and an envelope GP expression vector encoding MBG GP (2 ⁇ g/well), EBO- Z GP (2 ⁇ g/well), or VSV-G GP (2 ⁇ g/well) as above.
  • Viral stocks were sterile filtered (0.2 ⁇ m) and harvested after 36 h in a BSL3 facility. Protocol for genetic reconstitution of permissivity to filovirus entry.
  • library DNA (3 ⁇ g/well) or pLib-GFP (3 ⁇ g/well) reporter plasmid was packaged into pseudovirions by transiently co-transfecting PT67 packaging cells (300,000 cells/well in 6-well plates) along with pVSV-G (1 ⁇ g/ml) using the CaP0 4 method and harvesting culture supernatants on day 2 post-transfection.
  • approximately 1.2 X 10 s Jurkat-EctR cells were transduced with libraiy-containing viral supernatants via spin infection (1.3xl0 6 RPM, 32°C, 2 h) in 6 separate batches.
  • Jurkat-EctR cells were transduced with pseudovirions carrying pLib GFP.
  • library infection was optimized to achieve reproducible 30-40% transduction efficiency.
  • selectable MBG-blasti or VSV-blasti pseudotype virus was harvested and used to challenge parental cells or cells transduced with the library.
  • GHOST cells (250,000 cells/well) were inoculated with 1 ml of selectable pseudotype HTV virus, since they are permissive to entry by MBG, EBO-Z, and VSV viruses (Chan et al., (2000) J. Virol. 74, 4933-4937).
  • GHOST cells express the GFP reporter only in the presence of HTV-l Tat protein (Trkola et al., (1998) J. Virol. 72, 1876- 1885), and thus after successful infection by HTV-l pseudotype virions. Therefore, two days following challenge, by quantitating the percent of GFP -positive GHOST cells as previously described (Chan et al., (2000) J. Virol. 74, 4933-4937), relative levels of active MBG-blasti and VSV-blasti viruses were estimated as the percent of permissive cells that are infected using a given virus stock.
  • the transduced Jurkat-EctR cells challenged with the same virus stock were transfened into medium containing blasticidin S (ICN, 40 ⁇ g/ml). After selection for 2 weeks, cells were monitored for viability by Trypan blue exclusion and counted on a hemacytometer. Selected cells were expanded and subjected to limiting dilution to obtain monoclonal cell populations.
  • ICN blasticidin S
  • a separate culture of 6 batches of Jurkat- EctR cells (total of 1.2 X 10 8 cells) were transduced with HeLa cDNA library following the above protocol. After 2 d, transduced cells were challenged with EBO-Z-blasti virus and selected in blasticidin S. Viable cells were detected in selected cultures by Trypan blue exclusion, expanded, and grown by limiting dilution as monoclonal cell populations.
  • Jurkat-EctR cells were plated in 24-well dishes (200,000 cells/well), incubated with constant inocula of HTV-l Luc + pseudotype viruses for 48 h, and luciferase expression was quantitated as previously described ((Chan et al, (2000) J. Virol. 74, 4933- 4937)).
  • Vero-E6 parental Jurkat-EctR and reconstituted Jurkat-EctR (F10 clone) cells were inoculated with MBG (Musoke isolate) at increasing multiplicity of infection (MOI) of 0.1, 1, and 10 .
  • MOI multiplicity of infection
  • PCR recovery of retroviral library cDNA insert from transduced Jurkat-EctR cells To recover cDNA library inserts from Jurkat-EctR cell clones permissive to MBG entry, genomic DNA was extracted by the "Easy DNA” method as instructed by the manufacturer (Invitrogen). Extracted DNA (50 ng) was used as template for PCR-based amplification using the Expand PCR kit (Roche Molecular Biochemicals, Indianapolis, IN) and ohgonucleotide primers (Clontech, Palo Alto, CA) derived from the retroviral sequences flanking the cDNA inserts in the cDNA library.
  • RNA STAT 60 method Tel-Test, Inc., Friendswood, TX.
  • RT-PCR was performed using ALV reverse transcriptase kit as recommended by the manufacturer (Roche Molecular Biochemicals) followed by PCR of resulting cDNA strands using the Expand PCR kit and primers derived from the same retroviral sequences flanking the library inserts as above. Subsequent cloning and sequencing of inserts were performed as described previously.
  • Jurkat-EctR F10 cells 100,000 cells/well in 24-well plates
  • Vero E6 cells 30,000 cells/well in 24-well plates
  • FBP polyclonal rabbit anti-folate binding protein
  • Cells were then challenged in the presence of antisera with equivalent inocula of pseudotype luciferase viruses at 37°C. Luciferase expression was then quantitated after 72 h.
  • Jurkat-EctR F10 cells were pre-incubated with media containing monoclonal mouse anti-FR (IgGl) or monoclonal mouse anti-HIV Gag p24 (IgGl) for 15 minutes at 4°C. Cells were challenged with pseudotype luciferase viruses in the presence of antisera and luciferase expression was assessed as above.
  • virus challenge of target cells was performed the absence of fetal bovme serum which car ⁇ es high concentrations of fohc acid Therefore, 12 h after co- transfection of 293T cells with pNL-Luc E R and envelope GP expression vector to produce pseudotype luciferase viruses, media was replaced with RPMI 1640 containmg no fetal bovme serum (FBS) and no exogenously added fohc acid (Life Technologies, Inc , Grand Island, NY), and virus supernatant was harvested after 36 h HOS target cells (30,000 cells/well in 24-well plates) were pre- incubated with RPMI 1640 m the absence of FBS and either in the absence or presence of exogenously added fohc acid (1 mg/L) for 15 mrnutes at 4°C Cells were then challenged with fohc acid-free pseudotype
  • MBG GP bmds FR- ⁇ CHO-K1 cells, which do not express detectable levels of FR- ⁇ , were transiently transfected with MBG GP or negative control Ampho GP (1 ⁇ g/well in a 6-well plate) usmg LipofectAMTNE as desc ⁇ bed by the manufacturer (Life Technologies, Inc ) After 12 hours.
  • transfected cells were trypsmized and replated (70,000 cells/chamber) on 4-well Permanox chamber slides (Nalge Nunc International, Naperville, IL) coated with poly-L-lysme (Sigma) as previously descnbed (Allan, 2000) to ensure minimal cell detachment during staining After 24 h.
  • soluble bovme FBP (33 ⁇ g/ml) was mcubated m the presence of a polyclonal goat anti-bovine FBP (250 ⁇ g/ml), known to be non-neutrahzrng for MBG entry, for 15 mmutes at 4°C m RPMI 1640 containing no FBS or exogenous fohc acid
  • Transfected CHO-K1 cells were then mcubated m the presence of the FBP/anti-FBP mixture or m the presence of anti-FBP alone for 30 mmutes at 4°C Cells were washed 3 times with ice cold PBS and fixed in 2% paraformaldehyde for 15 mmutes at 4°C After 3 washes with ice cold PBS, cells were cubated with fluorescein-conjugated rabbit anti- goat IgG Fc secondary antibody (4 ⁇ g/ml)) for 45 mmutes at 25°C in the dark Cells were washed 3 tunes, mounted
  • a cDNA encoding the Marburg (MBG) or Ebola-Zaire (EBZ) envelope glycoproteins (GP) was used to generate pseudotype viruses based on an envelope-negative clone of the human immunodeficiency virus type 1 (HTV-l) that had been engineered to contain a firefly luciferase gene (pNL4-3LucR-E-,provided by Dr. Nathaniel Landau, Salk Institute).
  • the envelope cDNAs pGEM- MBG, Xu et al., Nat. Med. 4(l):37-42, 1998; pGEM-EBO-Z, unpublished
  • Dr. Anthony Sanchez Special Pathogens Branch, CDC.
  • a Jurkat derivative known as Jurkat-EctR (from Dr. Garry Nolan, Stanford Univ) was used.
  • Jurkat-EctR cells were modified genetically by introduction of a cDNA library derived from HeLa cells. This library (purchased from Clontech, in the pLib Moloney-based vector) was introduced into Jurkat-EctR cells using a retroviral vector system that was optimized to achieve 30-40% transduction efficiency (Fig. 3). Cells that had been transduced with this library were "challenged" with a selectable MBG pseudotype virus.
  • selectable pseudotype viruses a modified pseudotype strategy was used in which the MBG GP was introduced into 293T cells by co-transfection along with an alternate HTV-l proviral clone pHTV-blasti
  • this cDNA (subcloned mto a mammalian expression vector, pCMV4Neo) was introduced transiently by electroporation mto Jurkat-EctR cells These cells were then challenged with pseudotype luciferase viruses and scored for luciferase signal as a marker of infection Cells transfected with clone 4-1, but not empty vector, exhibited a significant luciferase signal (Fig.
  • monkey Vero E6 cells which are typically used to passage MBG virus m cell culture (Peters et al , (1996) Filovindae Marburg and Ebola Viruses Fields Virology, Third Edition, eds BN Fields, DM Knipe, PM Howley, et al 1161-1176) and express significant levels of FR- ⁇ by Northern blot analysis, were challenged m the presence of anti-FBP Entry by MBG was substantially inhibited by the anti-FBP antiserum ( Figure 9) Thus, similar inhibition of MBG entry was achieved on both genetically reconstituted human cells and untransduced monkey cells m the presence of polyclonal anti-FBP, mdicatmg that FR- ⁇ is important m infection m different cell types and m different mammalian species
  • FR- ⁇ mediates entry by EBO-Z virus
  • RT-PCR was performed usmg mRNA isolated from A7-1 cells and primers recognizing the library retroviral sequences flanking the insert
  • a cDNA insert carrying 100% identity with the full-length FR- ⁇ was isolated, mcludmg the natural methiomne initiation codon, suggestmg that FR- ⁇ mediates infection by EBO-Z as well as by MBG virus
  • the subject invention provides important new means of modulating and even inhibiting filovirus entry mto permissive cells
  • the subject mvention provides new means of treatmg the devastating illness mediated by filoviruses Therefore, the subject mvention represents a significant cont ⁇ bution to the art

Abstract

Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host. In the subject methods, an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry is administered to the host. The subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.

Description

METHODS AND COMPOSITIONS FOR USE IN THE TREATMENT OF FILOVIRUS
MEDIATED DISEASE CONDITIONS
CROSS-REFERENCE TO RELATED APPLICAΉONS This application claims pπonty under 35 U S C § 119(e) to provisional patent applications
Serial Nos 60/170,004, filed December 9, 1999 and 60/237,421, filed October 2, 2000, each of which is incorporated herem by reference m its entirety
FIELD OF THE INVENTION The field of this mvention is virology, and m particular filoviruses
BACKGROUND OF THE INVENΗON
Filoviruses belong to a virus family called Fikrvmdae and can cause severe hemorrhagic fever in humans and non-human pπmates So far, only two members of this virus family have been identified Marburg virus and Ebola virus Four subtypes of Ebola virus have been identified Ivory Coast, Sudan, Zaire, and Reston The Reston subtype is the only known filovirus that does not cause severe disease m humans, however, it can be fatal m monkeys
Filoviruses, including the Marburg and Ebola viruses, cause sporadic epidemics of human disease characterized by systemic hemorrhage, multi-organ failure and death m most instances In an outbreak or isolated case among humans, just how the virus is transmitted from the natural reservoir to a human is unknown Once a human is infected, however, person-to-person transmission is the means by which further infections occur Specifically, transmission mvolves close personal contact between an infected individual or their body fluids, and another person Duπng recorded outbreaks of hemorrhagic fever caused by filovirus infection, persons who cared for or worked very closely with infected individuals were especially at risk of becoming infected themselves Nosocomial transmission through contact with infected body fluids, e g , via re-use of unsteπhzed syringes, needles, or other medical equipment contaminated with these fluids - has also been an important factor m the spread of disease When close contact between umnfected and infected persons is minimized, the number of new filovirus infections m humans usually declines Although in the laboratory the viruses display some capability of mfection through small-particle aerosols, airborne spread among humans has not been clearly demonstrated
The onset of illness is abrupt, and initial symptoms resemble those of an influenza-like syndrome Fever, headache, general malaise, myalgia, jomt pain, and sore throat are commonly followed by diarrhea and abdominal pain A transient morbilhform skin rash, which subsequently desquamates, often appears at the end of the first week of illness Other physical findings mclude pharyngitis, which is frequently exudative, and occasionally conjunctivitis, jaundice, and edema
After the third day of illness, hemorrhagic manifestations are common and mclude petechiae as well as frank bleeding, which can arise from any part of the gastrointestinal tract and from multiple other sites.
There is currently no accepted vaccine or direct therapy for the clinical manifestations of infection, other than general supportive measures. Interferon and ribavirin show no in vitro effect against these agents. The case-fatality rate has been estimated to range from 30% to 80%.
In view of the foregoing discussion, there is a need for the development of vaccine and/or treatment protocols for these types of disease conditions. The present invention addresses this need. Representative Literature
Xu et al. (1998) Nat. Med. 4:37-42.
SUMMARY OF THE INVENTION Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host. In the subject methods, an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry is administered to the host. The subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.
The invention further provides agents useful in treating a filovirus-mediated disease condition, as well as compositions comprising the agents. Agents include those that inhibit filovirus binding to a folate receptor on the cell surface, agents that reduce the level of folate receptor on the cell surface, and agents that modulate the folate receptor such that binding of a filovirus to the folate receptor is reduced.
The invention further provides screening methods for identifying agents that reduce filovirus entry into a susceptible cell. Both cell-free and cell-based assay methods are provided.
BRIEF DESCRIPTION OF THE FIGURES
Figs . 1 A to 1 C provide graphical results showing that co-expression of an envelope negative HTV clone with a gene encoding Marburg or Ebola Zaire envelope glycoproteins leads to the generation of infectious virion particles with properties of the parental filovirus.
Figs. 2A and 2B provide a graphical representation of the results of a permissivity screening assay.
Fig. 3 provides a graphical representation of the efficiency of infection of Jurkat EctR with a retroviral cDNA library.
Fig. 4 provides a table of the results of viability assay in which Jurkat EctR cells were challenged with a retroviral cDNA library and HTV blasti-pseudotype viruses after selection in 40 μg/ml blasticidin S . Fig 5 provides graphical results from an assay in which Jurkat EctR batches selected for blasticidrn S were rechallenged with VSV, Ebola-Zaire and Marburg luciferase pseudotype viruses Fig 6 provides the graphical results of an assay in which the infection of Jurkat EctR cells transiently expressing truncated human folate receptor alpha with a Marburg pseudotype virus was studied
Fig 7 provides a graphical representation of an assay m which the infection of target cells by Marburg and Ebola-Zaire pseudotype viruses after phosphohpase C treatment was studied
Fig 8 provides the graphical results of an assay in which infection of a Jurkat EctR clone derived from the initial blasticidrn selection following infection with Marburg psedutotype virus was completely inhibited by a commercially available rabbit polyclonal antiserum (from Biogenesis) raised against the human folate binding prote
Fig 9 provides the graphical results of an assay in which infection of Vero E6 cells b\ MBG lucerfase virus, but notby VSV luciferase virus, is inhibited in the presence of polyclonal rabbit anti- bovme folate binding protem, but not by normal rabbit serum Fig 10 provides the graphical results of an assay, showmg that entry by MBG, but not VSV, luciferase virus mto Jurkat-EctR F10 cells is specifically abrogated in the presence of mouse monoclonal anti-FR, compared to lsotype control, antibody
Fig 11 provides the graphical results of an assay, showing that entry by MBG, but not Ampho, luciferase virus mto human osteosarcoma cells is specifically inhibited by extracellular fohc acid
Figure 12 provides the results of an assay showing that mfection of HOS cells by MBG, but not VSV, luciferase virus specifically decreases in the presence of soluble bovme FBP
Figures 13A-D provide the graphical results of assays showmg that expression of FR-α m Jurkat-EctR cells reconstitutes permissivity to entry mediated by either MBG or EBO-Z GP Figure 13A shows that pre-treatment of HeLa cells with phosphohpase C resulted in complete abrogation of entry by EBO-Z luciferase virus Figure 13B shows that the reconstituted Jurkat-EctR cell clone A7- 1, selected after challenge by EBO-Z-blasti virus and transduced with a cDNA encodmg FR- α, is infectable by both MBG and EBO-Z luciferase viruses, unlike Jurkat-EctR parental cells Figure 13C shows that Jurkat-EctR F10 cells reconstituted for infection by MBG-blasti virus and transduced with a cDNA encodmg a truncated FR- α, are infectable by both MBG and EBO-Z luciferase viruses, unlike Jurkat-EctR parental cells Figure 13D shows that entry by EBO-Z luciferase virus mto Jurkat-EctR F10 cells is specifically abrogated in the presence of monoclonal mouse anti-FR IgGl compared with levels observed with isotype antι-p24 IgGl
Figures 14A-C provide the graphical results of assays showmg that inhibition of viπon access to FR- α inhibits entry of EBO-Z luciferase virus in naturally infectable HOS and Vero E6 cells Figure 14A shows that entry by EBO-Z, but not Ampho, luciferase virus mto HOS cells is specifically inhibited by extracellular folic acid. Figure 14B shows that infection of HOS cells by EBO-Z, but not VSV, luciferase virus specifically decreases in the presence of soluble bovine FBP. Figure 14C shows that entry by EBO-Z, but not VSV, luciferase virus into Vero E6 cells is completely abrogated in the presence of polyclonal rabbit anti-bovine FBP, compared with levels observed in normal rabbit sera.
Definitions
By "subject" or "individual" or "host" or "patient," which terms are used interchangeably herein, is meant any subject, particularly a mammalian subject, for whom diagnosis or therapy is desired, particularly humans. Other subjects may include non-human primates, cattle, dogs, cats, guinea pigs, rabbits, rats, mice, horses, and so on.
As used herein, the term "a filovirus-mediated disease condition" encompasses a condition which is a direct result of filovirus infection; and a condition which is an indirect result, e.g., a sequela, of a filovirus infection. Such conditions include, but are not limited to, fever, internal hemorrhaging, edema, organ failure, headache, malaise, myalgia, nausea, vomiting, bleeding of needle puncture sites, hematemesis, melena, petechiae, ecchymosis, maculopapular rash, disseminated intravascular coagulation, shock, jaundice, conjunctivitis, diarrhea, pharyngitis, convulsions, delirium, coma, oligura, and epistaxis.
As used herein, "an immune response" is meant to encompass cellular and/or humoral immune responses that are sufficient to inhibit or prevent infection, or prevent or inhibit onset of disease symptoms caused by a filovirus, and to reduce the likelihood of an infection by a filovirus. The terms "peptide," "oligopeptide," "polypeptide," "polyprotein," and "protein", are used interchangeably herein, and refer to a polymeric form of amino acids of any length, which can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides having modified peptide backbones. The term includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; and the like.
A polynucleotide or polypeptide has a certain percent "sequence identity" to another polynucleotide or polypeptide, meaning that, when aligned, that percentage of bases or amino acids are the same when comparing the two sequences. Sequence similarity can be determined in a number of different manners. To determine sequence identity, sequences can be aligned using the methods and computer programs, including BLAST, available over the world wide web at http://ww.ncbi.nlm.nih.gov/BLAST/. Another alignment algorithm is FASTA, available in the Genetics Computing Group (GCG) package, from Madison, Wisconsin, USA, a wholly owned subsidiary of Oxford Molecular Group, Inc. Other techniques for alignment are described in Methods m Enzymology, vol 266 Computer Methods for Macromolecular Sequence Analysis (1996), ed Doohttle, Academic Press, Inc , a division of Harcourt Brace & Co , San Diego, California, USA Of particular interest are alignment programs that permit gaps in the sequence The Smith-Waterman is one type of algonthm that permits gaps in sequence alignments See Meth Mol Bwl 70 173-187 (1997) Also, the GAP program usmg the Needleman and Wunsch alignment method can be utilized to align sequences See J Mol Bwl 48 443-453 (1970)
Of mterest is the BestFit program usmg the local homology algonthm of Smith Waterman (Advances m Applied Mathematics 2 482-489 (1981) to determine sequence identity The gap generation penalty will generally range from 1 to 5, usually 2 to 4 and m many embodiments will be 3 The gap extension penalty will generally range from about 0 01 to 0 20 and m many mstances will be 0 10 The program has default parameters determined by the sequences inputted to be compared Preferably, the sequence identity is determined usmg the default parameters determined by the program This program is available also from Genetics Computing Group (GCG) package, from Madison, Wisconsm, USA Another program of interest is the FastDB algonthm FastDB is descπbed in Current
Methods m Sequence Companson and Analysis, Macromolecule Sequencmg and Synthesis, Selected Methods and Applications, pp 127-149, 1988, Alan R Liss, Inc Percent sequence identity is calculated by FastDB based upon the following parameters Mismatch Penalty 1 00, Gap Penalty 1 00,
Gap Size Penalty 0 33, and
Joining Penalty 30 0
One parameter for determining percent sequence identity is the "percentage of the alignment region length" where the strongest alignment is found The percentage of the alignment region length is calculated by counting the number of residues of the individual sequence found m the region of strongest alignment This number is divided by the total residue length of the target or query polynucleotide sequence to find a percentage An example is shown below Target sequence GCGCGAAATACTCACTCGAGG I | | I I I M I I I
Query sequence TATAGCCCTAC . CACTAGAGTCC
1 5 10 15
The region of alignment begms at residue 9 and ends at residue 19 The total length of the target sequence is 20 residues The percent of the alignment region length is 11 divided by 20 or 55%, for example Percent sequence identity is calculated by counting the number of residue matches between the target and query polynucleotide sequence and dividing total number of matches by the number of residues of the target or query sequence found in the region of strongest alignment. For the example above, the percent identity would be 10 matches divided by 11 residues, or approximately, 90.9% The percent of the alignment region length is typically at least about 55% of total length of the sequence, more typically at least about 58%, and even more typically at least about 60% of the total residue length of the sequence. Usually, percent length of the alignment region can be as great as about 62%, more usually as great as about 64% and even more usually as great as about 66%.
The terms "antigen" and "epitope" are well understood in the art and refer to the portion of a macromolecule which is specifically recognized by a component of the immune system, e.g. , an antibody or a T-cell antigen receptor. Epitopes are recognized by antibodies in solution, e.g., free from other molecules. Epitopes are recognized by T-cell antigen receptor when the epitope is associated with a class I or class II major histocompatibility complex molecule.
"Antibody specificity", in the context of antibody-antigen interactions, is a term well understood in the art, and indicates that a given antibody binds to a given antigen, wherein the binding can be inhibited by that antigen or an epitope thereof which is recognized by the antibody, and does not substantially bind to unrelated antigens. Methods of determining specific antibody binding are well known to those skilled in the art, and can be used to determine the specificity of antibodies of the invention for a FRα polypeptide. The term "binds specifically," in the context of antibody binding, refers to high avidity and/or high affinity binding of an antibody to a specific polypeptide i.e., epitope of an FR polypeptide. Antibody binding to an epitope on a specific FR polypeptide (also referred to herein as "an FR epitope") is preferably stronger than binding of the same antibody to any other epitope, particularly those which may be present in molecules in association with, or in the same sample, as the specific polypeptide of interest, e.g., binds more strongly to a specific FR epitope than to a different FR epitope so that by adjusting binding conditions the antibody binds almost exclusively to the specific FR epitope and not to any other FR epitope, and not to any other FR polypeptide which does not comprise the epitope. Antibodies which bind specifically to an FR polypeptide may be capable of binding other polypeptides at a weak, yet detectable, level (e.g., 10% or less of the binding shown to the polypeptide of interest). Such weak binding, or background binding, is readily discernible from the specific antibody binding to the compound or polypeptide of interest, e.g. by use of appropriate controls. In general, antibodies of the invention which bind to a specific FR polypeptide with a binding affinity of 107 mole/1 or more, preferably 108 mole/liters or more are said to bind specifically to the specific FR polypeptide. In general, an antibody with a binding affinity of 106 mole/liters or less is not useful in that it will not bind an antigen at a detectable level using conventional methodology currently used. By "antisense polynucleotide" is meant a polynucleotide having a nucleotide sequence complementary to a given polynucleotide sequence (e g, a polynucleotide sequence encodmg a FR polypeptide) including polynucleotide sequences associated with the transcnption or translation of the given polynucleotide sequence (e g , a promoter of a polynucleotide encodmg FR polypeptide), where the antisense polynucleotide is capable of hybπdizmg to a FR polypeptide-encoding polynucleotide sequence Of particular mterest are antisense polynucleotides capable of inhibiting transcnption and/or translation of a FR-encodmg polynucleotide either in vitro or in vivo
By "transformation" is meant a permanent or transient genetic change mduced m a cell followmg incorporation of new DNA (1 e , DNA exogenous to the cell) Genetic change can be accomplished either by incorporation of the new DNA mto the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA mto the genome of the cell
By "construct" is meant a recombmant nucleic acid, generally recombinant DNA, that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used in the construction of other recombmant nucleotide sequences
As used herem the term "isolated" is meant to descnbe a compound of mterest (e g , a virus, a peptide, etc ) that is m an environment different from that m which the compound naturally occurs "Isolated" is meant to mclude compounds that are within samples that are substantially ennched for the compound of mterest and/or m which the compound of interest is partially or substantially punfied
As used herem, the term "substantially punfied" refers to a compound that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally associated As used herem, the terms "treatment", "treating", and the like, refer to obtaining a desired pharmacologic and/or physiologic effect The effect may be prophylactic m terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic m terms of a partial or complete cure for a disease and/or adverse affect attributable to the disease "Treatment", as used herem, covers any treatment of a disease in a mammal, particularly in a human, and mcludes (a) preventing the disease from occumng m a subject which may be predisposed to the disease, or which may be susceptible to the disease, but has not yet been diagnosed as having it (e g , where the subject is susceptible to infection by a pathogen, but has not yet been infected by the pathogen), including, but not limited to, reducmg the nsk of disease and/or death followmg infection by a filovirus, reducmg the incidence of disease and/or death following infection by a filovirus, reducmg the mcidence or πsk of infection by a filovirus, and reducing the extent of disease followmg infection by a filovirus; (b) inhibiting the disease, i.e., arresting its development, slowing its progression; and (c) relieving the disease, i.e., causing regression of the disease.
A "biological sample" encompasses a variety of sample types obtained from an organism and can be used in a diagnostic or monitoring assay. The term encompasses blood and other liquid samples of biological origin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components. The term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids and tissue samples. The term "immunologically active" refers to the capability of a natural, recombinant or synthetic FR polypeptide, or any oligopeptide thereof, to induce a specific immune response in appropriate animals or cells and to bind with specific antibodies. As used herein, "antigenic amino acid sequence" means an amino acid sequence that, either alone or in association with a carrier molecule, can elicit an antibody response in a mammal. The term "mimetic," as used herein, refers to a non-natural compound which exhibits one or more properties of a naturally occurring compound.
DESCRIPTION OF THE SPECIFIC EMBODIMENTS Methods and compositions are provided for at least slowing the progression of a filovirus mediated disease condition in a host. In the subject methods, an effective amount of an agent that at least reduces the amount of folate receptor-mediated filovirus cell entry is administered to the host. The subject methods find use in both the prevention and treatment of filovirus associated disease conditions, including Marburg and Ebola-Zaire virus mediated disease conditions.
Before the subject invention is further described, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims.
In this specification and the appended claims, the singular forms "a," "an," and "the" mclude plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. METHODS OF TREATING A FlLO VIRUS-MEDIATED DISEASE CONDITION
The present invention provides methods of treating a filovirus-mediated disease condition in an individual. The methods generally comprise aclministering to an individual an effective amount of an agent that reduces a level of folate receptor-mediated viral entry into a cell in the individual. In some embodiments, the invention provides methods of inhibiting binding of a filovirus to an FR receptor on the surface of a susceptible cell. In other embodiments, the invention provides methods for reducing a level of FR receptor on the surface of a cell that normally expresses FR receptor on its cell surface. In other embodiments, the invention provides methods for modulating an FR receptor on a surface of a cell such that filovirus binding to the FR receptor is reduced. As used herein, the term "filovirus" refers to any known filovirus, including but not limited to, Marburg virus and Ebola virus, and subtypes of any known filovirus. Four subtypes of Ebola virus have been identified: Ivory Coast, Sudan, Zaire, and Reston. The nucleotide sequence of the complete genome of Ebola virus is found under GenBank Accession number NC_002549. The nucleotide sequence of the complete genome of Marburg virus is found under GenBank Accession No. NC_001608.
It has now been found that filovirus entry into a susceptible cell is mediated by a folate receptor (FR), e.g., folate receptor alpha (FRα). A "susceptible cell" (also referred to herein as a "permissive cell") is therefore any eukaryotic cell which expresses a FR on its cell surface such that a filovirus can bind to the cell surface FR and enter the cell. In general, a susceptible cell is a primate cell, e.g., a human cell or a monkey cell. A "susceptible cell" includes, but is not limited to, a susceptible in an animal, e.g., a primate; a susceptible cell in an organ from the animal (e.g., an organ removed from the animal); a susceptible cell in a biological sample derived from an animal; a susceptible cell in in vitro culture, e.g., a cell isolated from an animal; a susceptible cell which is made susceptible by virtue of having been transformed with a nucleic acid construct comprising a nucleic acid sequence that encodes a FR, e.g. cell line which does not normally express FR on its cell surface but which does so after introduction into the cell line of a construct which results in expression of FR on the cell surface, as described in the Examples; and a susceptible cell which is a cell line that is naturally permissive to filovirus infection, including, but not limited to, HeLa cells and VeroE6 cells. Whether a cell is susceptible to infection by a filovirus can be determined by any known method, including those described in the Examples.
The methods generally comprise administering to an individual an effective amount of an agent that reduces a level of folate receptor-mediated viral entry into a susceptible cell in the individual. In some embodiments, an "effective amount" of an agent that reduces FR-mediated entry into a cell is one that reduces filovirus entry into a susceptible cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90, or at least about 100%, when compared to a susceptible cell m the absence of the agent In other embodiments, an "effective amount" of an agent is contacted with a population of susceptible cells, where an "effective amount" is an amount that reduces the proportion of cells m the population that is infected by the filovirus by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%), at least about 70%, at least about 80%, at least about 90, or at least about 100%, when compared with the population not contacted by the agent
It has further been shown that filovirus entry mto a susceptible cell can be inhibited by inhibiting bmdmg of a filovirus to a FR on the surface of a susceptible cell Accordingly, m some embodiments, a method of treatmg a filovirus-mediated disease condition m an mdividual compπses administering to an mdividual an effective amount of a substance that inhibits bmdmg of a filovirus to a FR on the surface of a susceptible cell m the individual As used herem, the term "agent" refers to any substance that inhibits bmdmg of a filovirus to FR, including, but not limited to, antibody specific for FR, fo c acid and its deπvatives, and soluble FR Generally, these methods mvolve blockmg a bmdmg event between a filovirus and an FR The methods provide for inhibiting bmdmg of a filovirus to an FR on the surface of a susceptible cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, when compared to the amount of filovirus that binds to an FR on the surface of a control cell, e g , a cell not contacted with the agent In other embodiments, the mvention provides methods for reducmg a level of FR receptor on the surface of a cell that normally expresses FR receptor on its cell surface, compnsmg contacting the cell with an effective amount of an agent that reduces a level of FR on the cell surface In these embodiments, an "effective amount" of an agent is an amount that is effective m reducmg the level of FR on the cell surface by at least about 10%, at least about 20%, at least about 30%, at least about 40%), at least about 50%, at least about 60%. at least about 70%, at least about 80%, at least about 90%, or at least about 100%, when compared to the level of FR expressed on the cell surface of a control cell not contacted with the agent The level of FR on the cell surface can be determined (e g , measured) usmg any known method, mcludmg, but not limited to, contacting a cell with a detectably labeled antibody specific for FR, and determining the amount of bound antibody usmg. e g , fluorescence activated cell sorting (FACS), radiohgand bmdmg, lmmunofluorescence. Northern (RNA) blotting, Western (protem) blotting, and in situ hybndization
Reduction m a level of FR receptor displayed on the surface of a cell that normally expresses FR receptor on its cell surface may be accomplished by a vanety of means, mcludmg, but not limited to, reducmg the level of transcnption of a gene encodmg the FR, reducmg the level of FR-encoding mRNA available to be translated, reducmg the level of translation of an FR-encoding mRNA, reducmg formation of a GPl linkage on the FR, thereby resultmg in secretion of the FR from the cell, rather than placement m the cell membrane, reducmg the rate and/or level of any cell biological process that normally results in expression of FR on the cell surface In some cases it may be preferably that the method is specific or relatively specific to FR, e g , the method does not reduce the level of any other protem on the cell surface Reduction m expression of an FR-encoding gene may be accomplished by usmg antisense to the FR-encodmg gene Vaπous denvatives of the antisense sequence may be prepared, where the phosphates may be modified, where oxygens may be substituted with sulfur and nitrogen, the sugars may be modified, and the like The antisense sequences may be used by themselves or m conjunction with vaπous toxic moieties, such as metal chelates, sensitizers, πbozymes, and the like Antisense and/or nbozyme sequences may be used to inhibit FR gene expression Antisense polynucleotides, and methods of usmg such, are described m numerous publications, mcludmg. e g , "Antisense Technology A Practical Approach" Lichtenstein and Nellen, eds (1997) IRL Press
Antisense molecules can be used to down-regulate expression of FR-encodmg genes m cells The anti-sense reagent may be antisense ohgodeoxynucleotides (ODN), particularly synthetic ODN havmg chemical modifications from native nucleic acids, or nucleic acid constructs that express such anti-sense molecules as RNA The antisense sequence is complementary to the mRNA of the targeted gene, and inhibits expression of the targeted gene products Antisense molecules inhibit gene expression through vanous mechanisms, e g by reducmg the amount of mRNA available for translation, through activation of RNAse H, or stenc hindrance One or a combmation of antisense molecules may be administered, where a combmation may compnse two or more different sequences
Antisense molecules may be produced by expression of all or a part of the target gene sequence m an appropnate vector, where the transcπptional initiation is oπented such that an antisense strand is produced as an RNA molecule Alternatively, the antisense molecule is a synthetic ohgonucleotide Antisense ohgonucleotides will generally be at least about 7, usually at least about 12, more usually at least about 20 nucleotides m length, and not more than about 500, usually not more than about 50, more usually not more than about 35 nucleotides m length, where the length is governed by efficiency of inhibition, specificity, mcludmg absence of cross-reactivity, and the like It has been found that short ohgonucleotides, of from 7 to 8 bases m length, can be strong and selective inhibitors of gene expression (see Wagner et al (1996) Nature Biotechnology 14 840- 844)
A specific region or regions of the endogenous sense strand mRNA sequence is chosen to be complemented by the antisense sequence Selection of a specific sequence for the ohgonucleotide may use an empincal method, where several candidate sequences are assayed for inhibition of expression of the target gene in an in vitro or animal model A combmation of sequences may also be used, where several regions of the mRNA sequence are selected for antisense complementation Antisense ohgonucleotides may be chemically synthesized by methods known m the art (see Wagner et al (1993) supra ) Preferred ohgonucleotides are chemically modified from the native phosphodiester structure, m order to increase their mtracellular stability and bmdmg affinity Such modifications have been previously discussed with respect to the use of probes As an alternative to anti-sense inhibitors, catalytic nucleic acid compounds, e g nbozymes, anti-sense conjugates, etc may be used to inhibit gene expression Ribozymes may be synthesized in vitro and admmistered to the patient, or may be encoded on an expression vector, from which the nbozyme is synthesized m the targeted cell (for example, see International patent application WO 9523225, and Beigelman et al (1995) Nucl Acids Res 23 4434-42) Examples of ohgonucleotides with catalytic activity are descπbed m WO 9506764 Conjugates of anti-sense ODN with a metal complex, e g terpyπdylCu(II), capable of mediatmg mRNA hydrolysis are described m Bashkin et al (1995) Appl Biochem Bwtechnol 54 43-56
In other embodiments, the mvention provides methods for modulating an FR receptor on a surface of a cell such that filovirus bmdmg to the FR receptor is reduced The agent may modulate the configuration of the surface membrane-associated FR such that it no longer bmds filovirus
Alternatively, the agent may be one that modulates trafficking, clustering, or lnternalization of FR The agent may be one that inhibits glycosylation of FR Roberts et al (1998) Arch Biochem Biophys 351 227-235
In any of the above-descπbed methods of the mvention for treatmg a filovirus-mediated disease condition, more than one agent may be admmistered to an mdividual m need of treatment Thus, for example, a mixture of two or more monoclonal antibodies specific for distmct, non- overlapping epitopes on an FR may be admmistered to the mdividual Mixtures of two or more different agents, e g , a monoclonal antibody specific for an FR and a folate receptor gand, may also be admmistered
Routes of admmistration
An agent is administered to an mdividual using any available method and route suitable for drug delivery, mcludmg in vivo and ex vivo methods, as well as systemic and localized routes of admmistration Conventional and pharmaceutically acceptable routes of admmistration mclude intranasal, intramuscular, lntratracheal, intratumoral, subcutaneous, intradermal, topical application, mtravenous, rectal, nasal, oral and other parenteral routes of administration Routes of admimstration may be combined, if desired, or adjusted dependmg upon the agent used and/or the desired effect A composition compπsmg an agent can be admmistered in a smgle dose or m multiple doses An agent can be admmistered to a host usmg any available conventional methods and routes suitable for delivery of conventional drugs, mcludmg systemic or localized routes In general, routes of administration contemplated by the invention include, but are not necessarily limited to, enteral, parenteral, or inhalational routes.
Parenteral routes of administration other than inhalation aclministration include, but are not necessarily limited to, topical, transdermal, subcutaneous, intramuscular, intraorbital, intracapsular, intiaspinal, intrastemal, and intravenous routes, i. e. , any route of aαπύnistration other than through the alimentary canal. Parenteral admimstration can be carried to effect systemic or local delivery of the agent. Where systemic delivery is desired, aclministration typically involves invasive or systemically absorbed topical or mucosal aα^ninistration of pharmaceutical preparations.
An agent can also be delivered to the subject by enteral administration. Enteral routes of aα^ministration include, but are not necessarily limited to, oral and rectal (e.g., using a suppository) delivery.
Methods of administration of an agent through the skin or mucosa include, but are not necessarily limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection and epidermal administration. The invention also contemplates opthalmic administration of an agent, which generally involves invasive or topical application of a pharmaceutical preparation to the eye. Eye drops, topical cremes and injectable liquids are all examples of suitable formulations for delivering drugs to the eye.
Dosages
Although the dosage used will vary depending on the clinical goals to be achieved, a suitable dosage range is one which provides up to about 1 μg to about 1,000 μg or about 10,000 μg of agent can be aαministered in a single dose. Alternatively, a target dosage of agent can be considered to be about 1-10 μM in a sample of host blood drawn within the first 24-48 hours after administration of the agent.
In general, an agent is administered in an amount within the range from about 0.002 mg/kg to about 10 mg kg, or from about 0.01 mg/kg to about 3 mg/kg body weight. Where an agent is to be administered intravenously, it will be formulated in conventional vehicles, such as distilled water, saline, Ringer's solution or other conventional carriers.
METHODS FOR IMMUNIZING A HOST
The invention further provides methods for immunizing a host against a filovirus med ated disease condition. In general, the methods involve administering to a host an effective amount of an immunogen that causes said host to mount an immune response against membrane bound folate receptors, where antibodies are generated that inhibit filovirus binding to the FR, thereby reducing entry of the filovirus into a permissive cell. In some embodiments, the immunogen is a membrane bound folate receptor or fragment thereof. Methods of generating an immune response in a host are known in the art and need not be elaborated upon here. Whether an individual has mounted an immune response to a membrane bound folate receptor can be readily determined. For example, a biological sample, such as a blood or serum sample, is removed from the individual, and the presence of antibodies that specifically bind to membrane bound FR and block or inhibit filovirus binding to the FR is detected using assays such as those described in the Examples.
Antibodies generated in a human in the manner described above may be isolated and used prophylactically in a passive immunization protocol to protect another human against a filovirus- mediated disease condition. For example, a health care worker or other medical personnel or support staff who anticipate being in a situation which puts him/her at risk for exposure to filovirus may be treated prophylactically with anti-FR antibodies generated in another human. In some instances, e.g., where medical personnel is exposed to filovirus for a short period, e.g., 1-7 days, or 1-4 weeks, short- term protection of such individuals, such as may be afforded by passive immunization, may be adequate to protect the individual from filovirus infection, or may reduce symptoms during infection (e.g., attenuation of disease).
METHOD FOR IDENTIFYING A VIRAL CELL SURFACE RECEPTOR
The invention provides a method of a identifying a cell surface receptor used by a virus for entry into a cell. The methods generally comprise: (a) identifying a cell line that is non-permissive for entry of the virus; (b) transfecting a population of said non-permissive cell line with a genomic or a cDNA library obtained from a cell line permissive for entry of the virus; (c) identifying at least one cell from said transfected cell population which is permissive for entry of the virus; and (d) identifying at least one gene of the permissive cell line in the genome of the transfected permissive cell. These methods are useful for identifying a cell surface receptor for a filovirus. In particular embodiments, a population of non-permissive cells is transfected with a cDNA library made from a permissive cell such that a member of the cDNA library are expressed in a cell of the transfected non-permissive cell population. To determine which cell(s) of the transfected non-permissive population are now permissive for filovirus infection, a pseudotype virus may be employed, in which an envelope-negative mutant virus carrying a selectable marker is engineered to contain a filovirus envelope glycoprote n. In a particular embodiment, a pseudovirus as described in the Examples is used.
AGENTS EFFECTIVE FOR TREATING A FILOVIRUS-MEDIATED DISEASE CONDITION
The present invention provides agents for treating a filovirus-mediated disease condition. In some embodiments, an agent that is suitable for treating a filovirus-mediated disease condition is one that inhibits binding of a filovirus to an FRα on the surface of a susceptible cell. As used herein, "an FR antagonist" is any agent that inhibits a bmdmg event between a filovirus and a membrane-bound FR, mcludmg, but not limited to, a soluble FR, an antibody specific for an FR, a filovirus-deπved FR gand, an FR hgand, and a fragment, denvative, or mimetic of any of the foregomg In other embodiments, an agent is one that modulates trafficking, clustering, or mternalization of membrane bound folate receptors In other embodiments, an agent is one that modulates expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced
Fohc acid receptor
FR is a protem encoded by a gene that is a member of the folate receptor family Members of this gene family have a high affinity for fohc acid and for several reduced fohc acid denvatives, and mediate delivery of 5-methyltetrahydrofolate to the mtenor of eukaryotic cells The gene is composed of 7 exons exons 1-4 encode the 5' untranslated region and exons 4 through 7 encode the open readmg frame Due to the presence of 2 promoters, multiple transcnption start sites, and alternative splicing of exons, at least 8 transcπpt vanants are denved from this gene These vanants differ m the length of 5 ' and 3 ' UTR, but they encode an identical amino acid sequence Elwood et al (1997) Biochem 36 1467-1478
Human FRα (also referred to as folate bmdmg protem) is synthesized m cells as an integral membrane-associated protem and as a soluble protem Sadavisan and Rothenberg (1989) J Bwl Chem 264 5806-5811 The ammo acid sequence of human FRα is provided under GenBank Accession No NM_016731 The membrane-associated form is a glycosyl phosphatidyl mositol linked protem, while the secreted form lacks the GPl moiety Nucleotide and ammo acid sequences of FR from other species are also publicly available under GenBank
As used herem, the terms "folate receptor " and "folate bmdmg protem" are used interchangeably herem and refer to FR from any of a variety of species, mcludmg, but not limited to, human, murme (mouse or rat), bov e. or other mammalian species In some embodiments, an FR is a human FRα havmg the ammo acid sequence set forth m GenBank Accession No NM_016731 In some embodiments, an FR is a polypeptide compπsmg an ammo acid sequence that shares at least about 50%), at least about 60%, at least about 75%, at least about 80%, at least about 90%, or at least about 95% or more sequence identity with the sequence set forth in GenBank NM_016731 It is generally preferred that the FR admmistered to the mdividual does not elicit an immune reaction m the mdividual to the FR "FR" also encompasses fragments of an FR that inhibit bmdmg of a filovirus to an FR on the surface of a susceptible cell Full length FR is a protem of about 226 ammo acids In some embodiments, FR is a fragment of from about 15 to about 20, from about 20 to about 25, from about 25 to about 50, from about 50 to about 75, from about 75 to about 100, from about 100 to about 125, from about 125 to about 150, from about 150 to about 175, or from about 175 to about 200 ammo acid, up to the full length protem "FR" also encompasses fusion protems, wherem an FR is fused in-frame to a fusion partner which is a heterologous protem, 1 e , a non-FR protem Fusion partners mclude, but are not limited to, immunological tags, cytokines, earner protems (e g , albumin), antibody (mcludmg antibody fragments), cytotoxic agents, protem domains that cause multimeπzation, and the like "FR" may be an FR isolated from a source in which it naturally occurs, may be a synthetic
FR, or may be an FR made recombinantly "FR" also encompasses mrmetics of a naturally occumng FR, and peptoids Methods of synthesizing peptoids, and peptoid hbraπes, and methods of screening same are found in, e g , U S Patent No 5,965,695, and 6,075,121
FR may be made recombinantly usmg standard techmques of molecular biology, may be made synthetically usmg standard techmques of protem synthesis, may be isolated from a source m which it naturally occurs (e g , milk or other body fluids), or a combmation of any of the foregomg FR polypeptides can be isolated from a biological source, using affinity chromatography, e g , usmg antibodies specific for FR which are immobilized on a solid support
The polypeptides may be expressed m prokaryotes or eukaryotes m accordance with conventional ways, depending upon the purpose for expression For large scale production of the protem, a unicellular organism, such as E coll, B subtihs, S cerevisiae, insect cells m combmation with baculovirus vectors, or cells of a higher organism such as vertebrates, particularly mammals, e g COS 7 cells, CHO cells, HEK293 cells, HeLa cells, and the like, may be used as the expression host cells In some situations, it is desirable to express the gene m eukaryotic cells, where the protem will benefit from native foldmg and post-translational modifications The polypeptide can then be isolated from cell culture supernatant or from cell lysates using affinity chromatography methods or anion exchange/size exclusion chromatography methods, as descnbed above
One may employ solid phase peptide synthesis techmques, where such techmques are known to those of skill m the art See Jones, The Chemical Synthesis of Peptides (Clarendon Press, Oxford)(l 994) Generally, m such methods a peptide is produced through the sequential additional of activated monomeπc units to a solid phase bound growing peptide chain
With the availability of the protem or fragments thereof m large amounts, by employing an expression host, the protem may be isolated and punfied m accordance with conventional ways A lysate may be prepared of the expression host and the lysate punfied usmg HPLC, exclusion chromatography, gel electrophoresis, affinity chromatography, or other punfication technique For use m the methods of the mvention, an FR may be admmistered m a formulation m association with (e g , chemically associated, or m admixture with) another macromolecule, mcludmg, but not limited to, a protem, mcludmg, but not limited to, albumin, a nanoparticle, a hpid, mcludmg, but not limited to hposomes, a polysacchande, a polyalcohol, mcludmg, but not limited to, a polyethylene glycol, a glycoprotem, and combmations of the foregomg Folate receptor ligands
Agents that inhibit bmdmg of a filovirus to a membrane bound FR also mclude folate receptor ligands, and deπvatives and mimetics thereof A folate receptor hgand may be fohc acid (5- methyl tetrahydrofohc acid), or a derivative thereof, mcludmg, but not limited to, dihydrofolate, tetrahydrofolate, 5-methyltetrahydrofolate, 5,10-methylenetetrahydrofolate, 5,10- methenyltetrahydrofolate, 5,10-foπruimnotetrahydrofolate, 5-formyltetrahydrofolate (leucovoπn), and 10-foπnyltetrahydrofolate
Filovirus-deπved folate receptor ligands
Agents that inhibit bmdmg of a filovirus to a membrane-bound FR further mclude filovirus molecules that bmd to FR, which reduce bmdmg of a filovirus to the FR, and which therefore reduce FR-mediated filovirus entry mto a permissive cell Filovirus-denved folate receptor ligands mclude, but are not limited to, a filovirus envelope glycoprotem Marburg envelope glycoprotem is descπbed m Xu et al (1998) Nat Med 4 37-42, and Ebola virus Zaire envelope glycoprotem is descπbed m GenBank accession number U31033 "Filovirus envelope glycoprotem," as used herem m the context of an agent that inhibits bmdmg of a filovirus to a membrane-bound FR, encompasses full- length filovirus envelope glycoprotem (GP), fragments of a filovirus envelope GP which mediate bmdmg to an FR, fusion proteins compπsmg the filovirus envelope GP (or fragment thereof Those skilled m the art, usmg any known method, mcludmg those descnbed herem, can readily determine any fragment of a filovirus envelope glycoprotem that can inhibit bmdmg of a filovirus to a membrane-bound FR
Antibodies
An agent that inhibits bmdmg of a filovirus to an FR on the surface of a susceptible cell may be an antibody As used herem, the term "antibodies" mcludes antibodies of any isotype, fragments of antibodies which retain specific bmdmg to antigen, mcludmg, but not limited to, Fab, Fv, scFv, and Fd fragments, chimenc antibodies, humamzed antibodies, smgle-cham antibodies, and fusion protems compnsmg an antigen-binding portion of an antibody and a non-antibody protem The antibodies may be detectably labeled, e g , with a radioisotope, an enzyme that generates a detectable product, a green fluorescent protem, and the like The antibodies may be further conjugated to other moieties, such as members of specific bmdmg pairs, e g , biotm (member of biotin-avidin specific bmdmg pair), and the like
Methods of generating an antibody to an FR are well known m the art and need not be elaborated upon herem Such methods are found in a vanety of standard textbooks, such as Antibodies A Laboratory Manual. E Harlow and D Lane, eds 1988, Cold Spnng Harbor Laboratory Press Antibodies generated to an FR may be screened for the ability to inhibit bmdmg of a filovirus to an FR, usmg, e g , the methods descπbed m the Examples Agent that modulate trafficking, clustering, or mternahzation of membrane bound folate receptors
Agents that modulate trafficking, clustering, or mternahzation of membrane-bound FR mclude, but are not limited to, an agent that inhibits or mterferes with glycohpid anchors, e g , phosphohpase-C, an agent that inhibits or mterferes with glycosylation of an FR, agents that disrupt the pathway to construct GPl anchors m the endoplasmic reticulum, agents that disrupt acidification of vesicles, agents that inhibit recyclmg of GPI-linked protems such as FR, agents that prevent multimenzation of FR at the cell surface (e g , FR fragments that bmd to multimeπzation domains, and agents that prevent endocytosis of FR or GPI-hnked protems Agents that modulate expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced
Agents that modulate expression or configuration of a membrane-bound folate receptor such that bmdmg to a filovirus is reduced include, but are not limited to, antisense molecules (as discussed above), πbozymes (as discussed above), compounds that selectively reduce transcnption of a FR gene, and dommant-negative forms of FR which reduce and/or prevent proper bmdmg, foldmg, or multimenzation of FR on the cell surface
COMPOSITIONS
The present mvention further provides compositions compnsmg an agent of the invention These compositions may mclude a buffer, which is selected accordmg to the desired use of the agent, and may also mclude other substances appropnate to the intended use Those skilled m the art can readily select an appropnate buffer, a wide vanety of which are known m the art, suitable for an mtended use In some mstances, the composition can compnse a pharmaceutically acceptable excipient, a vanety of which are known m the art and need not be discussed m detail herem Pharmaceutically acceptable excipients have been amply descπbed m a vanety of publications, mcludmg, for example, A Gennaro (1995) "Remington The Science and Practice of Pharmacy", 19th edition, Lippmcott, Williams, & Wilkins
Pharmaceutical compositions can be prepared m vanous forms, such as granules, tablets, pills, suppositoπes, capsules, suspensions, salves, lotions and the like Pharmaceutical grade organic or inorganic earners and or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds Diluents known to the art mclude aqueous media, vegetable and ammal oils and fats Stabilizing agents, wetting and emulsifying agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents Screening Assays
The present invention provides methods of screening for candidate agents that are useful in treating a filovirus-mediated disease condition. In some embodiments, methods are provided for screening for candidate agents that inhibit binding of a filovirus to a FR on the surface of a susceptible cell. In other embodiments, methods are provided for screening for candidate agents that reduce a level of FR on the surface of a susceptible cell.
The term "candidate agent" is used interchangeably herein with the terms "candidate substance" and "candidate compound". A "candidate agent," as used herein, describes any molecule, e.g. protein; peptide; natural or synthetic inorganic or organic compound, or pharmaceutical, with the capability of reducing filovirus entry into a susceptible cell, as described above. Generally a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection.
Candidate agents encompass numerous chemical classes, and may be natural or synthetic inorganic or organic molecules, which may be small organic compounds having a molecular weight of more than 50 and less than about 2,500 daltons. Candidate agents may comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Candidate agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized ohgonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries.
Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, glycosylation, amidification, etc. to produce structural analogs. Where the screening assay is a binding assay, one or more of the molecules may be joined to a label, where the label can directly or indirectly provide a detectable signal. Various labels include radioisotopes, fluorescers, chemiluminescers, enzymes, specific binding molecules, particles, e.g. magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.
A variety of other reagents may be included in the screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc. may be used. The mixture of components are added in any order that provides for the requisite binding. Incubations are performed at any suitable temperature, typically between 4 and 40 °C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically between 0.1 and 1 hours will be sufficient.
Methods of identifying candidate agents that inhibit filovirus binding to FR In some embodiments, methods are provided for identifying a candidate agent that inhibits filovirus binding to FR. In some of these embodiments, the methods are cell-free methods, m other embodiments, the methods are cell-based methods. In general, the methods described below are in vitro screening methods. Candidate agents identified by the methods described below include those that act to block binding of a filovirus to an FR; and those that act to modulate a configuration of an FR such that filovirus binding is reduced. Candidate agents of interest are those that reduce filovirus entry into a cell. Accordingly, in some embodiments, the methods provide for identifying a candidate agent that reduces filovirus entry into a cell.
As used herein, "determining" includes "measuring" and "detecting," e.g., the determination may be quantitative or semi-quantitative (e.g., "measuring") or qualitative (e.g., "detecting").
Agents which decrease FR-filovirus binding to the desired extent may be selected for further study, and assessed for cellular availability, cytotoxicity, biocompatibility, etc.
Of interest are candidate agents that inhibit FR-filovirus binding by at least about 10%, at least about 15%, at least about 20%, at least about 25%, more preferably at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, at least about 100%, or 2-fold, at least about 5-fold, or at least about 10-fold or more when compared to a suitable control. A candidate agent which inhibits FR-filovirus binding can also be one that abrogates measurable FR- filovirus binding completely.
Also of interest are candidate agents that reduce filovirus entry into a cell susceptible to filovirus infection by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, at least about 100%, or 2-fold, at least about 5-fold, or at least about 10-fold or more when compared to a suitable control. A candidate agent which inhibits FR-filovirus entry can also be one that abrogates measurable FR-filovirus entry completely. Also of interest are candidate agents that reduce the number of cells in a population of susceptible cells that are infected by filovirus by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 50%, or at least about 100%, when compared to a suitable control. Cell-free methods
A cell-free method to identify candidate agents that inhibit binding of a filovirus to an FR generally comprise: a) contacting a candidate agent with a sample containing an FR and a filovirus; and b) determining whether binding between the FR and the filovirus is reduced. In some embodiments, the screening methods will employ a filovirus envelope glycoprotein.
Thus, the term "filovirus," in the context of screening assays of the invention, encompasses a filovirus envelope glycoprotein. Thus, in these embodiments, the methods comprise contacting a candidate agent with a sample containing an FR and a filovirus envelope glycoprotein; and deteπnining whether FR-filovirus envelope glycoprotein binding is reduced, compared to binding in the absence of the candidate agent.
Marburg envelope glycoprotein is described in Xu et al. (1998) Nat. Med. 4 :37-42; and Ebola virus Zaire envelope glycoprotein is described in GenBank accession number U31033. "Filovirus envelope glycoprotein," as used herein, encompasses full-length filovirus envelope glycoprotein (GP); fragments of a filovirus envelope GP which mediate binding to an FR; fusion proteins comprising the filovirus envelope GP (or fragment thereof), including, but not limited to, epitope-tagged filovirus envelope GP. In addition, the filovirus envelope GP may be detectably labeled.
Determining whether FR-filovirus binding is reduced can be accomplished in a variety of ways, including, but not limited to, any known immunological assay method, including, but not limited to, an immunological assay in which FR-filovirus binding is detected using antibody to the FR, to the filovirus (where the antibody is not one that inhibits FR-filovirus binding), to an epitope tag moiety of an FR fusion protein, or to an epitope tag moiety of a filovirus envelope GP; an enzyme-linked immunological assay; an immunological assay in which the FR and/or the filovirus is detectably labeled.
Cell-based assays
In some embodiments, the screening assays are cell-based assays. In some of these embodiments, the methods generally comprise contacting a cell susceptible to infection by a filovirus with a candidate agent; and determining an effect, if any, on filovirus binding to the cell. In other of these embodiments, the methods generally comprise contacting a cell susceptible to infection by a filovirus with a candidate agent; and determining an effect, if any, on filovirus entry into the cell. Cells suitable for use in these methods are any permissive eukaryotic cell, including cells that are naturally permissive, including, but not limited to, those cells shown in Figure 2 that were shown to be permissive for filovirus infection (e.g., HOS, HeLa, VeroE6, CHO; and cells that are modified to be permissive for filovirus entry, including, but not limited to, cells as described in the Examples. In some embodiments, a pseudotype virus, e.g., an HTV-1 virus engineered to contain a nucleotide sequence encoding a filovirus envelope glycoprotein, such as described in the Examples, may be employed. Thus, in the context of a cell-based screening assay of the invention, "filovirus" encompasses pseudotype virus comprising a nucleotide sequence encoding a filovirus envelope glycoprotein. Whether filovirus binds to and enters the cell can be determined using any known assay method, including, but not limited to, assays described in the Examples. As described in the Examples, a pseudotype virus can be engineered to comprise a filovirus envelope GP and a nucleotide sequence encoding a selectable marker, or a detectable gene product (e.g., luciferase, GFP, and the like). Filovirus entry into the cell can then be determined by, e.g., measuring the amount of detectable gene product in the cell. The assay can also be conducted so as to determine the number of cells in a cell population that are infected.
Methods of screening for candidate agents that reduce a level of FR on the surface of a susceptible cell In general, methods for reducing a level of FR on the surface of a susceptible cell comprise contacting a susceptible cell with a candidate agent; and determining the effect, if any, on the level of
FR on the surface of the cell.
Cells which may be employed are as described above, and are generally cells that are susceptible to filovirus infection by virtue of expressing an FR on the cell surface. Methods for deteπmning whether a candidate agent reduces a level of FR on the cell surface include methods of measuring or detecting filovirus entry into the cell, as described above.
Determination of whether a candidate agent reduces FR gene expression can be carried out using any known assay. For example, a polymerase chain reaction (PCR) can be carried out on mRNA isolated from a cell, using a primer pair specific for an FR-encoding transcript. A cDNA copy of the population of isolated mRNA, and PCR performed on the cDNA. Another method which may be employed involves an assay in which a cell is transfected with a construct comprising an FR promoter driving transcription of a reporter gene, and the effect of the candidate agent on the level of transcription of the reporter gene is determined.
The following examples are offered by way of illustration and not by way of limitation. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celcius, and pressure is at or near atmospheric.
EXPERIMENTAL EXAMPLE 1: Identification of a cofactor for entry of Marburg and Ebola viruses into susceptible cells
Materials and Methods
Cell lines. Human osteosarcoma (HOS), HeLa, 293T, Vero E6, and CHO-K1 cells were cultured as recommended by the American Type Culture Collection (ATCC). Jurkat T-cells stably expressing the ecotropic murine leukemia virus (MLV) receptor (Jurkat-EctR, kindly provided by Dr. G. Nolan, Stanford University) were cultured as recommended for Jurkat T-cells by the ATCC. The NIH-3T3 based MLV packaging cell line PT67 (Clontech, Palo Alto, CA) was cultured as previously described (Miller and Chen (1996) J. Virol. 70, 5564-5571. Human osteosarcoma (GHOST) indicator cell lines carrying a human green fluorescent protein (GFP) reporter gene driven by an HTV-2 Tat-dependent LTR (provided by Dr. D. Littman, Skirball Institute) were cultured as previously described (Trkola et al., (1998) J. Virol. 72, 1876-1885).
Plasmids and cDNA library amplificationThe molecular clone pNL-Luc-E"R" (Connor et al., (1995) Virology 206, 935-944), the HTV-l NL4-3 provirus carrying a luciferase reporter gene driven by the 5' LTR (along with mutations in env, nef, and vpr), was a gift of Dr. N. Landau (Salk Institute) via the AIDS Research and Reference Reagent Program. HJV-blasti, an HTV-l proviral construct carrying the blasticidrn S deaminase gene driven by the 5 ' LTR along with null mutations in env and nef, was provided by Dr. R. Sutton (Baylor University). Mammalian expression plasmid pVSV-G encoding the vesicular stomatitis virus-G (VSV-G) protein was provided by Dr. J. Burns (University of California, San Diego), and pMULV-A encoding the amphotropic (Ampho) murine leukemia virus (MLV) env (Landau et al., (1991) J. Virol. 65, 162-169) was provided by Dr. K. Page (University of California, San Francisco). The cDNA clones encoding MBG GP and EBO-Z GP were provided by Dr. A. Sanchez (Centers for Disease Control and Prevention) and cloned into the pCMV4neo expression vector (Goldsmith et al., (1994) J. Biol. Chem. 269, 14698-14704) as previously described (Chan et al., (2000) J. Virol. 74, 4933-4937). The full length and 3' truncated cDNA (E4-1) encoding FR-α was recovered by PCR from the HeLa retroviral library as described below, ligated by TA cloning into pCR2.1, and subcloned into the mammalian expression vector. The bicistronic mammalian expression vector pIRES2-EGFP (Clontech, Palo Alto, CA) was used to assess transfection efficiency in Jurkat-EctR cells.
A bacterial glycerol stock transformed with the MLV retroviral cDNA library (pLib MLV backbone) derived from HeLa cells (2x106 independent clones) was plated on LB agar (100 μg/ml ampicillin) plates as described by the manufacturer (Clontech, Palo Alto, CA). Approximately 8x106 bacterial colonies were amplified in LB liquid broth, and library DNA was extracted for subsequent virus packaging and transduction into Jurkat-EctR cells. The plasmid pLib-GFP encoding the green fluorescent protein in the MLV backbone was used as a marker for quantitating efficiency of transduction. Antibodies. For detection of wildtype MBG virus infection, convalescent guinea pig antisera to MBG virus (Musoke) was generated. FITC-conjugated anti-guinea pig secondary antisera was purchased. For inhibition of pseudotype virus entry, polyclonal rabbit antisera raised against FBP in bovine milk (Biogenesis, Poole, England, UK) and normal rabbit sera (kindly provided by Dr. O. Keppler, Gladstone Institute of Virology and Immunology, CA) were compared. Similarly, monoclonal mouse IgGl ascites raised against human FR-α (kindly provided by Dr. W. Franklin, University of Colorado Health Sciences Center) and monoclonal mouse IgGl ascites raised against HTV-l Gag p24 antigen were compared. For assessing binding of FBP to CHO-K1 cells expressing virus GP by immunofluorescence, polyclonal goat anti-bovine FBP antibody and fluorescein- conjugated rabbit anti-goat IgG Fc were used for staining (Rockland, Gilbertsville, PA). Preparation of pseudotype virus stocks. To prepare HTV-l pseudotype virus carrying the luciferase gene (Luc+) with the Ampho, VSV-G, MBG, or EBO-Z GP, pNL-Luc-E"R- (2 μg/well) was co- transfected with each envelope glycoprotein expression vector (2 μg/well) using the CaP0 method in 293T cells as previously described (Chan et al., (1999) J. Virol. 73, 2350-2358). To prepare selectable HTV-l pseudotype virus carrying the blasticidin S deaminase gene (blasti), 293T cells (400,000 cells/well in 6-well plates) were transiently co-transfected using the CaP04 method with pHTV-blasti (2 μg/well) and an envelope GP expression vector encoding MBG GP (2 μg/well), EBO- Z GP (2 μg/well), or VSV-G GP (2 μg/well) as above. Viral stocks were sterile filtered (0.2 μm) and harvested after 36 h in a BSL3 facility. Protocol for genetic reconstitution of permissivity to filovirus entry. To reconstitute permissivity for MBG virus entry, library DNA (3 μg/well) or pLib-GFP (3 μg/well) reporter plasmid was packaged into pseudovirions by transiently co-transfecting PT67 packaging cells (300,000 cells/well in 6-well plates) along with pVSV-G (1 μg/ml) using the CaP04 method and harvesting culture supernatants on day 2 post-transfection. Subsequently, approximately 1.2 X 10s Jurkat-EctR cells were transduced with libraiy-containing viral supernatants via spin infection (1.3xl06 RPM, 32°C, 2 h) in 6 separate batches. In parallel, Jurkat-EctR cells were transduced with pseudovirions carrying pLib GFP. By quantitating GFP -positive Jurkat-EctR cells two days after transduction, library infection was optimized to achieve reproducible 30-40% transduction efficiency. Two days later, selectable MBG-blasti or VSV-blasti pseudotype virus was harvested and used to challenge parental cells or cells transduced with the library. In parallel, GHOST cells (250,000 cells/well) were inoculated with 1 ml of selectable pseudotype HTV virus, since they are permissive to entry by MBG, EBO-Z, and VSV viruses (Chan et al., (2000) J. Virol. 74, 4933-4937). GHOST cells express the GFP reporter only in the presence of HTV-l Tat protein (Trkola et al., (1998) J. Virol. 72, 1876- 1885), and thus after successful infection by HTV-l pseudotype virions. Therefore, two days following challenge, by quantitating the percent of GFP -positive GHOST cells as previously described (Chan et al., (2000) J. Virol. 74, 4933-4937), relative levels of active MBG-blasti and VSV-blasti viruses were estimated as the percent of permissive cells that are infected using a given virus stock. When virus inocula achieved entry in more than 50% of the GHOST cell culture, the transduced Jurkat-EctR cells challenged with the same virus stock were transfened into medium containing blasticidin S (ICN, 40 μg/ml). After selection for 2 weeks, cells were monitored for viability by Trypan blue exclusion and counted on a hemacytometer. Selected cells were expanded and subjected to limiting dilution to obtain monoclonal cell populations.
To select for cells permissive to EBO-Z virus entry, a separate culture of 6 batches of Jurkat- EctR cells (total of 1.2 X 108 cells) were transduced with HeLa cDNA library following the above protocol. After 2 d, transduced cells were challenged with EBO-Z-blasti virus and selected in blasticidin S. Viable cells were detected in selected cultures by Trypan blue exclusion, expanded, and grown by limiting dilution as monoclonal cell populations.
Challenge of cells with pseudotype viruses and replication-competent filoviruses. To determine permissivity to entry by pseudotype viruses, Jurkat-EctR cells were plated in 24-well dishes (200,000 cells/well), incubated with constant inocula of HTV-l Luc+ pseudotype viruses for 48 h, and luciferase expression was quantitated as previously described ((Chan et al, (2000) J. Virol. 74, 4933- 4937)).
To determine permissivity to entry by wildtype MBG virus, Vero-E6, parental Jurkat-EctR and reconstituted Jurkat-EctR (F10 clone) cells were inoculated with MBG (Musoke isolate) at increasing multiplicity of infection (MOI) of 0.1, 1, and 10 . On days 1, 3 and 6 post-infection cells were washed, dried on spot-slides, fixed with acetone, irradiated, and then immunostained with convalescent guinea pig antisera to MBG followed by FITC-conjugated anti-guinea pig antisera. Positive cells were counted by fluorescence microscopy.
To determine reconstitution of permissivity to MBG entry by expression of FR-α, parental Jurkat-EctR cells (1.5xl07 cells) were electroporated (270 kV, 950 μF) with a mammalian expression vector (pCMV4neo) carrying no insert, a truncated (E4-1) cDNA, or full-length cDNA encoding FR- α. Transfection efficiency was quantitated in parallel using an expression plasmid encoding GFP (pIRES2-EGFP) and assessing percentage of GFP-positive cells by flow cytometry (10-20% positive). After recovery for 48 hours, transfected cells were plated in 24-well plates (300,000 live cells/well), challenged with pseudotype luciferase viruses, and luciferase expression was quantitated after 72 hours.
PCR recovery of retroviral library cDNA insert from transduced Jurkat-EctR cells. To recover cDNA library inserts from Jurkat-EctR cell clones permissive to MBG entry, genomic DNA was extracted by the "Easy DNA" method as instructed by the manufacturer (Invitrogen). Extracted DNA (50 ng) was used as template for PCR-based amplification using the Expand PCR kit (Roche Molecular Biochemicals, Indianapolis, IN) and ohgonucleotide primers (Clontech, Palo Alto, CA) derived from the retroviral sequences flanking the cDNA inserts in the cDNA library. Specific DNA bands amplified in experimental samples, but not control samples, were extracted from agarose gels and used in conventional TA cloning steps using the pCR2.1 vector (Invitrogen). Insert sequences were verified by ABI Prism Dye terminator cycle sequencing (Perkin-Elmer, Foster City, CA) and were compared to known genomic and cDNA sequences using Entrez BLAST software.
To recover cDNA library inserts from Jurkat-EctR cell clones permissive to EBO-Z entry, total RNA was extracted from cells by the RNA STAT 60 method (Tel-Test, Inc., Friendswood, TX). Using total RNA as a template, RT-PCR was performed using ALV reverse transcriptase kit as recommended by the manufacturer (Roche Molecular Biochemicals) followed by PCR of resulting cDNA strands using the Expand PCR kit and primers derived from the same retroviral sequences flanking the library inserts as above. Subsequent cloning and sequencing of inserts were performed as described previously.
Inhibition of pseudotype virus entry by blocking FR-α on target cells. To cleave glycolipid membrane-anchored proteins such as FR-α from the cell surface, HeLa cells (30,000 cells/well in 24- well plates) or reconstituted Jurkat-EctR F10 cells (100,000 cells/well in 24-well plates) were pre- incubated with phosphohpase C (ICN Pharmaceuticals, Inc., Costa Mesa, CA) for 2 h at 37°C. Cells were washed with phosphate buffered saline (PBS) and challenged with pseudotype luciferase viruses for 4 h at 37°C. Culture medium was then removed and replaced, followed by assessment of luciferase expression after 72 h.
To block epitopes necessary for binding ligand to FR- α using antibodies raised against FR- α, Jurkat-EctR F10 cells (100,000 cells/well in 24-well plates) or Vero E6 cells (30,000 cells/well in 24-well plates) were pre-incubated with media containing polyclonal rabbit anti-folate binding protein (FBP) or normal rabbit sera for 15 minutes at 4°C. Cells were then challenged in the presence of antisera with equivalent inocula of pseudotype luciferase viruses at 37°C. Luciferase expression was then quantitated after 72 h. Similarly, Jurkat-EctR F10 cells were pre-incubated with media containing monoclonal mouse anti-FR (IgGl) or monoclonal mouse anti-HIV Gag p24 (IgGl) for 15 minutes at 4°C. Cells were challenged with pseudotype luciferase viruses in the presence of antisera and luciferase expression was assessed as above. To determine if epitopes on FR- α which bmd its natural hgand fohc acid are necessary for MBG or EBO-Z GP-mediated entry, virus challenge of target cells was performed the absence of fetal bovme serum which carπes high concentrations of fohc acid Therefore, 12 h after co- transfection of 293T cells with pNL-Luc E R and envelope GP expression vector to produce pseudotype luciferase viruses, media was replaced with RPMI 1640 containmg no fetal bovme serum (FBS) and no exogenously added fohc acid (Life Technologies, Inc , Grand Island, NY), and virus supernatant was harvested after 36 h HOS target cells (30,000 cells/well in 24-well plates) were pre- incubated with RPMI 1640 m the absence of FBS and either in the absence or presence of exogenously added fohc acid (1 mg/L) for 15 mrnutes at 4°C Cells were then challenged with fohc acid-free pseudotype luciferase viruses for 4 h at 37°C Virus was removed, replaced with RPMI 1640 containmg 10% fetal bovme serum and exogenous fohc acid (1 mg/L), and luciferase expression was quantitated after 72 h
Inhibition of pseudotype virus entry by binding virion GP with soluble FR- α (FBP). To competitively inhibit interaction of vinon-anchored MBG or EBO-Z GP with membrane-anchored FR- α, soluble bovme FBP (FBP, Sigma. 1 mg/ml reconstituted stock m PBS) was pre-mcubated with pseudotype virus supernatant harvested m RPMI 1640 in the absence of FBS or exogenous fohc acid for 15 minutes at 4°C HOS cells (30,000 cells/well in a 24-well plate) were challenged with virus mthe presence of FBP (lOμg/ml final concentration) for 4 h at 37°C Cells were then washed with PBS, media was replaced with Dulbecco's Minimum Essential Medium containmg 10% FBS, and luciferase expression was assessed after 72 hours
Binding of membrane-anchored MBG GP with FBP To provide further evidence that MBG GP bmds FR- α, CHO-K1 cells, which do not express detectable levels of FR- α, were transiently transfected with MBG GP or negative control Ampho GP (1 μg/well in a 6-well plate) usmg LipofectAMTNE as descπbed by the manufacturer (Life Technologies, Inc ) After 12 hours. transfected cells were trypsmized and replated (70,000 cells/chamber) on 4-well Permanox chamber slides (Nalge Nunc International, Naperville, IL) coated with poly-L-lysme (Sigma) as previously descnbed (Allan, 2000) to ensure minimal cell detachment during staining After 24 h. soluble bovme FBP (33 μg/ml) was mcubated m the presence of a polyclonal goat anti-bovine FBP (250 μg/ml), known to be non-neutrahzrng for MBG entry, for 15 mmutes at 4°C m RPMI 1640 containing no FBS or exogenous fohc acid Transfected CHO-K1 cells were then mcubated m the presence of the FBP/anti-FBP mixture or m the presence of anti-FBP alone for 30 mmutes at 4°C Cells were washed 3 times with ice cold PBS and fixed in 2% paraformaldehyde for 15 mmutes at 4°C After 3 washes with ice cold PBS, cells were cubated with fluorescein-conjugated rabbit anti- goat IgG Fc secondary antibody (4 μg/ml)) for 45 mmutes at 25°C in the dark Cells were washed 3 tunes, mounted m Vectashield medium (Vector Laboratories, Inc , Burlmgame, CA), and analyzed for staining by fluorescence microscopy Results
A cDNA encoding the Marburg (MBG) or Ebola-Zaire (EBZ) envelope glycoproteins (GP) was used to generate pseudotype viruses based on an envelope-negative clone of the human immunodeficiency virus type 1 (HTV-l) that had been engineered to contain a firefly luciferase gene (pNL4-3LucR-E-,provided by Dr. Nathaniel Landau, Salk Institute). The envelope cDNAs (pGEM- MBG, Xu et al., Nat. Med. 4(l):37-42, 1998; pGEM-EBO-Z, unpublished) were provided by Dr. Anthony Sanchez (Special Pathogens Branch, CDC). By quantitating infections using this indicator gene product, it was found that co-expressing the pNL4-31ucR-E and envelope construct led to production of infectious virions with the properties of the parental virus (Marburg or Ebola, respectively) (Figures 1A-C). Numerous human and other cell lines were then screened for permissivity, and it was found that nearly all cells were permissive with the exception of several human T-cell lines (including Jurkat, MT-2,SupTl and C8166; Figures 2A and 2B).
For subsequent cloning experiments, a Jurkat derivative known as Jurkat-EctR (from Dr. Garry Nolan, Stanford Univ) was used. Jurkat-EctR cells were modified genetically by introduction of a cDNA library derived from HeLa cells. This library (purchased from Clontech, in the pLib Moloney-based vector) was introduced into Jurkat-EctR cells using a retroviral vector system that was optimized to achieve 30-40% transduction efficiency (Fig. 3). Cells that had been transduced with this library were "challenged" with a selectable MBG pseudotype virus. To prepare selectable pseudotype viruses, a modified pseudotype strategy was used in which the MBG GP was introduced into 293T cells by co-transfection along with an alternate HTV-l proviral clone pHTV-blasti
(provided by Dr. Richard Sutton Baylor College of Medicine) containing the blasticidin S deaminase gene from Aspergillus terreus rather than the luciferase gene. Pseudotype virions produced from these co-transfections were then used to "challenge" Jurkat-EctR cells. Two days following challenge, the cells were transfened into medium containing blasticidin S (ICN, 40 μg/ml) and monitored for viability (Fig. 4). In negative control samples (pseudovirions lacking envelope GP), all cells died within 8 days and no viable cells were recoverable over a 3 -week interval. In positive control samples (pseudovirions containing envelope G-glycoprotein from vesicular stomatitis virus,VSV), numerous viable cells were evident. In the experimental samples (pseudovirions containing MBG GP), small numbers of viable cells were detected. These cells were expanded for additional study. In a key validation experiment, recovered cells were re-challenged with MBG GP pseudotype virus containing the luciferase gene, which confirmed that these cells were permissive for infection via the MBG envelope, unlike the parental cells (Fig. 5). Subsequently, these cells were subjected to limiting dilution to obtain individual cell clones.
In the next step, individual MBG-permissive clones were used to isolate genomic DNA by the "Easy DNA" method (Invitrogen) method. Genomic DNA was used as template for PCR-based amplification using ohgonucleotide primers derived from the sequences flanking the cDNA inserts in the cDNA library In experimental samples, but not control samples, specific DNA bands were amplified These bands were extracted from agarose gels and used m conventional TA cloning steps usmg the pCR2 1 vector (Invitrogen) 12 Clones with mdependent inserts were recovered, and automated DNA sequencmg was used to determine the sequences of these inserts Based upon sequencmg from two directions and assemblage of a contig based on overlappmg sequences from these sequences runs, one insert (clone 4-1) showed perfect identity with the 3' two-thirds of known cDNAs recognized as encoding human FR-α
To venfy that this molecule serves as a receptor for MBG, a transfection experiment was performed m which this cDNA (subcloned mto a mammalian expression vector, pCMV4Neo) was introduced transiently by electroporation mto Jurkat-EctR cells These cells were then challenged with pseudotype luciferase viruses and scored for luciferase signal as a marker of infection Cells transfected with clone 4-1, but not empty vector, exhibited a significant luciferase signal (Fig. 6) Finally, we found that treatment of permissive cells with phosphohpase C virtually abolished infection by MBG pseudotype, a finding that is consistent with the GPl (glycophosphatidylmositol) type of membrane linkage that is characteπstic of folate receptor-alpha (Fig. 7) These findings confirm that the human FR-α as a receptor that mediates cellular entry by MBG
Finally, pretreatments of JurkatEctR cells with a commercially available rabbit polyclonal antiserum raised agamst human folate binding protem (Biogenesis), a cleaved form of full-length FR- α, completely abolished infection by MBG pseudotype virus (Fig. 8) To confirm these findings m a naturally infectable cell type, monkey Vero E6 cells, which are typically used to passage MBG virus m cell culture (Peters et al , (1996) Filovindae Marburg and Ebola Viruses Fields Virology, Third Edition, eds BN Fields, DM Knipe, PM Howley, et al 1161-1176) and express significant levels of FR- α by Northern blot analysis, were challenged m the presence of anti-FBP Entry by MBG was substantially inhibited by the anti-FBP antiserum (Figure 9) Thus, similar inhibition of MBG entry was achieved on both genetically reconstituted human cells and untransduced monkey cells m the presence of polyclonal anti-FBP, mdicatmg that FR- α is important m infection m different cell types and m different mammalian species
To determine if other antibodies that recognize relevant epitopes of FR- α similarly abrogated MBG entry, Jurkat-EctR F10 cells were challenged with pseudotype viruses mthe presence of a monoclonal antibody preparation (No 458) raised agamst human FR- α (Figure 10) VSV entry was not inhibited m the presence of anti-FR- α compared with control ascites fluid containmg lsotype-matched monoclonal antibody recognizing an melevant HTV p24 antigen, while MBG mfection was specifically and potently reduced by anti-FR- α The specific inhibition of MBG entry by polyclonal or monoclonal antibodies raised separately agamst bovme FBP and human FR- α, respectively, further defines FR- α as a highly conserved mediator of MBG virus entry m multiple cell types and mammalian species To test whether fohc acid, a natural hgand of FR- α, is a specific inhibitor of MBG entry, pseudotype luciferase viruses were prepared m media containmg neither fetal bovme serum (FBS) nor fohc acid Target cells (HOS) were then challenged with these virus preparations m the presence or absence of fohc acid and a reduced form of fohc acid, 5-methyltetrahydrofohc acid (10 μM), which is known to bmd at high affinity to FR- α Exposure to fohc acid resulted m very slight alteration of entry by negative control Ampho luciferase pseudotypes However, MBG virus entry was reduced by nearly 80% m the presence of fohc acid (Figure 11) This specific inhibition by folate compounds mdicates that FR- α is important in MBG virus entry Soluble FR- α inhibits MBG entry by interaction with virion GP Another approach seeking to confirm a role for FR- α entailed usmg soluble FR- α to compete for the bmdmg of MBG GP expressed on the viπon envelope Secreted FBP purified from bovme milk was pre-mcubated with pseudotype luciferase viruses prepared m media lacking FBS or fohc acid HOS cells were then moculated with these mixtures, and mfection level was compared with that of uncomplexed virus The results are shown m Figure 12 VSV entry was not sigmficantly altered m the presence of FBP while MBG entry was inhibited by more than 50% in the presence of FBP Therefore, these results indicate that FR- α is an important factor that b ds MBG vmons at the cell surface
To obtain direct evidence that MBG GP can bmd FR- α, lmmunofluorescence microscopy was used to visualize FBP bound to the surface of cells expressmg MBG GP Since they express very low levels of FR- α (Weitman et al , (1992) Cancer Res 52, 3396-3401, Orr and Kamen, (1995) Cancer Res 55, 847-852), CHO-K1 cells were selected as target cells and were transfected with expression vectors encodmg either MBG or Ampho GP Two days followmg transfection, cells were mcubated with bovme FBP and an anti-bovine FBP antibody that we found to be non-neutrahzmg for MBG entry Samples were then fixed and stamed with an anti-goat lg fluorescein-conjugated secondary antibody m order to highlight selectively those cells with FBP bound to their surface Transfected cells did not stam sigmficantly when exposed to anti-FBP and secondary antibody in the absence of FBP, indicating that the low endogenous levels of FR- α on CHO-K1 cells cause little background staining Additionally, cells transfected with Ampho GP exhibited only a low level of background staining m the presence of FBP In contrast, cells expressmg MBG GP and mcubated with FBP displayed a πng-like cell surface staining of sigmficantly higher intensity The significant and specific staining of cells expressmg MBG GP by FBP provides direct evidence that MBG GP can bmd FBP, which further substantiates a role for FR- α m entry by MBG MBG GP and EBO-Z GP share common target cell factors for mediating virus entry We examined the mechanisms of target cell entry utilized by EBO As with MBG, cellular entry controlled by the EBO-Z GP was pH dependent (Wool-Lewis and Bates, (1998) J Virol 72, 3155- 3160 , Chan et al , (2000) J Virol 74, 4933-4937) Pre-treatment of HeLa cells with phosphohpase C abolished entry by EBO-Z pseudotype virus, but not by Ampho virus (Figure 13A) These results raised the possibility that entry by EBO-Z is also mediated by a GPI-hnked protem
The genetic complementation protocol descnbed earlier was adapted for use in identifying host protems that mediate entry by EBO-Z virus Previous studies had demonstrated that HeLa cells, but not Jurkat cells, are permissive to entry mediated by EBO-Z GP (Chan et al , (2000) J Virol 74 4933-4937) Therefore, after delivery of the retroviral HeLa cDNA library mto Jurkat-EctR cells, transduced Jurkat-EctR cells were challenged with pseudotype virus packaged by EBO-Z GP with the pHTV-blasti backbone (EBO-Z-blasti), and then selected m blasticidrn S Only the library- transduced cultures that had been challenged by EBO-Z-blasti virus yielded viable cells that survived selection Subsequently, mdividual cell clones were expanded by limiting dilution and re-challenged with pseudotype luciferase viruses For example, cell clone A7-1, which had been selected for EBO- Z permissivity, was mdeed infectable by EBO-Z luciferase virus while parental cells were not (Figure 13B) Importantly, A7-1 was also found to be permissive for entry by MBG luciferase virus Therefore, by genetically complementmg the deficiency of permissivity to EBO-Z virus entry, MBG entry was concurrently restored Similarly, the Jurkat-EctR F10 cell clone that had been selected for MBG permissivity was infectable by MBG and EBO-Z luciferase viruses (Figure 13C) Thus, m two mdependent iterations of library transduction and virus challenge followed by selection, one approach utilizing MBG pseudotypes and the other utilizing EBO-Z pseudotypes, recovered cells were found to be permissive for both MBG and EBO-Z infection These results suggest that MBG and EBO-Z viruses depend on at least one common factor m target cells to gam entry
FR- α mediates entry by EBO-Z virus To identify the cDNA insert m A7-1 cells responsible for reconstituting permissivity of MBG and EBO-Z infection, RT-PCR was performed usmg mRNA isolated from A7-1 cells and primers recognizing the library retroviral sequences flanking the insert A cDNA insert carrying 100% identity with the full-length FR- α was isolated, mcludmg the natural methiomne initiation codon, suggestmg that FR- α mediates infection by EBO-Z as well as by MBG virus
To mvestigate the importance of FR- α for entry by EBO-Z virus, Jurkat-EctR F10 cells were challenged with pseudotype luciferase viruses in the presence of monoclonal anti-FR- α antibody or isotype-matched control antibody While VSV control pseudotype infection levels were unaffected, infection by EBO-Z pseudotype virus decreased sigmficantly m the presence of the anti-FR- α preparation (Figure 13D) This result provides biochemical evidence that FR- α is a mediator of EBO-Z entry
Further strategies to identify FR- α as a mediator of EBO-Z infection mcluded moculatmg HOS cells with luciferase viruses m the presence or absence of fohc acid While infection by Ampho virus did not sigmficantly decrease m the presence of fohc acid, entry by EBO-Z virus was inhibited sigmficantly (Figure 14 A) In addition, virus challenge of HOS cells mthe presence of FBP caused no significant decrease m entry by VSV pseudotypes but a substantial inhibition of EBO-Z infection (Figure 14B) Therefore, minoπng the inhibition profiles observed for MBG virus, EBO-Z pseudotype virus entry was specifically abrogated m the presence of agents expected to disrupt mteractions between vmon GP and FR- α Finally, to assess the role of FR- α m mediatmg EBO-Z entry in naturally permissive cell types routmely used for study of filovirus infection (Peters et al , (1996) Filovindae Marburg and Ebola Viruses Fields Virology, Third Edition, eds BN Fields, DM Knipe. PM Howley, et al 1161- 1176 ), Vero E6 cells were challenged with EBO-Z luciferase virus m the presence of either polyclonal rabbit anti-bovme FBP antibody or normal rabbit sera VSV entry decreased margmally m the presence of anti-FR- α, while EBO-Z entry was completely abrogated m the presence of the anti- FR- α preparation (Figure 14C) Therefore, as with MBG mfection, EBO-Z entry was specifically inhibited m the presence of monoclonal or polyclonal anti-FR- α antibodies, fohc acid, or soluble FBP Considered together with the recovery of independent cDNA inserts encodmg FR- α from separate library transductions challenged with either MBG or EBO-Z-blasti viruses, we conclude that FR- α is a cofactor for cellular entry by either MBG or EBO-Z virus
The above results and discussion mdicate that the subject invention provides important new means of modulating and even inhibiting filovirus entry mto permissive cells As such, the subject mvention provides new means of treatmg the devastating illness mediated by filoviruses Therefore, the subject mvention represents a significant contπbution to the art
All publications and patent applications cited in this specification are herem incorporated by reference as if each mdividual publication or patent application were specifically and individually mdicated to be incorporated by reference The citation of any publication is for its disclosure pnor to the fihng date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of pnor mvention
Although the foregomg mvention has been descnbed m some detail by way of illustration and example for purposes of claπty of understanding, it is readily apparent to those of ordinary skill m the art m light of the teachings of this mvention that certain changes and modifications may be made thereto without departing from the spmt or scope of the appended claims

Claims

CLAIMS What is claimed is
1 A method of at least slowing the progression of a filovirus associated disease condition m a host, said method compnsmg administering to said host an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry m said host, whereby the progression of said filovirus associated disease condition is at least slowed
2 The method accordmg to Claim 1, wherem said agent is a folate receptor antagonist
3 The method accordmg to Claim 1, wherem said agent is a filovirus-denved folate receptor bmdmg fragment, denvative or mimetic thereof
4 The method according to Claim 1, wherem said agent is a soluble folate receptor
5 The method accordmg to Claim 1, wherem said agent modifies expression or configuration of membrane bound folate receptors so as to at least reduce their filovirus bmdmg activity
6 The method accordmg to Claim 1, wherem said agent is a monoclonal antibody, polyclonal antibody, mixture of antibodies, or bmdmg fragment or mimetic thereof
7 The method accordmg to Claim 1, wherem said agent at least reduces the expression of membrane bound folate receptors m said host
8 The method according to Claim 1, wherem said agent is an agent that modulates traffickmg, clustering or mternahzation of membrane bound folate receptors in said host
9 The method accordmg to Claim 1, wherem said host is a mammal
10 The method accordmg to Claim 9, wherem said mammal is a human
11 The method accordmg to Claim 1, wherem said method treats a filovirus associated disease condition
12 The method accordmg to Claim 1, wherem said method prevents a filovirus associated disease condition m a mammalian host
13. A method for deteπmning the ability of a test compound to at least slow the progression of a filovirus associated disease condition, said method comprising: contacting a folate receptor or filovirus binding derivative or mimetic thereof with a filovirus or folate receptor binding derivative or mimetic thereof and said test compound; and detemnning the effect of said compound on the binding interaction between said folate receptor and said filovirus; whereby the ability of said test compound to at least slow the progression of a filovirus associated disease condition is determined.
14. The method according to Claim 13, wherein said method is a cell based method, and said folate receptor is membrane bound and presented on the cell surface.
15. The method according to Claim 13, wherein said method is a cell free method.
16. A pharmaceutical preparation for use in at least slowing the progression of a filovirus mediated disease condition, said preparation comprising: an effective amount of an agent that at least reduces the amount of folate receptor mediated filovirus cell entry in a mammalian host.
17. The pharmaceutical preparation according to Claim 16, wherein said agent is a folate receptor antagonist.
18. The pharmaceutical preparation according to Claim 16, wherein said agent is a soluble folate receptor or a filovirus binding fragment, derivative or mimetic thereof.
19. The pharmaceutical preparation according to Claim 16, wherein said agent modifies expression or configuration of membrane bound folate receptors so as to at least reduce their filovirus binding activity.
20. The pharmaceutical preparation according to Claim 16, wherein said agent is a monoclonal antibody, polyclonal antibody, mixture of antibodies, or binding fragment or mimetic thereof.
21. The pharmaceutical preparation according to Claim 16, wherein said agent at least reduces the expression of membrane bound folate receptors in said host. 22 The pharmaceutical agent accordmg to Claim 16, wherem said agent is an agent that modulates traffickmg, clustermg or mternahzation of membrane bound folate receptors m said host
23 A method for immumzmg a host agamst a filovirus mediated disease condition, said method compnsmg administering to said host an effective amount of an immunogen that causes said host to mount an immune response agamst membrane bound folate receptors
24 The method accordmg to Claim 23, wherem said immunogen is a membrane bound folate receptor or fragment thereof
25 The method according to claim 23, wherein said immunization is passive immunization
26 A method of a identifymg a cell surface receptor used by a virus for entry mto a cell, said method compnsmg
(a) identifymg a cell line that is non-permissive for entry of said virus,
(b) transfecting a population of said non-permissive cell l e with a genomic library obtained from a cell lme permissive for entry of said virus,
(c) identifymg at least one cell from said transfected cell population which is permissive for entry of said virus, and
(d) identifymg at least one gene of said permissive cell lme m the genome of said transfected permissive cell
PCT/US2000/033403 1999-12-09 2000-12-07 Methods and compositions for use in the treatment of filovirus mediated disease conditions WO2001041784A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU22568/01A AU2256801A (en) 1999-12-09 2000-12-07 Methods and compositions for use in the treatment of filovirus mediated disease conditions

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US17000499P 1999-12-09 1999-12-09
US60/170,004 1999-12-09
US23742100P 2000-10-02 2000-10-02
US60/237,421 2000-10-02

Publications (1)

Publication Number Publication Date
WO2001041784A1 true WO2001041784A1 (en) 2001-06-14

Family

ID=26865593

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/033403 WO2001041784A1 (en) 1999-12-09 2000-12-07 Methods and compositions for use in the treatment of filovirus mediated disease conditions

Country Status (2)

Country Link
AU (1) AU2256801A (en)
WO (1) WO2001041784A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008156853A2 (en) * 2007-06-20 2008-12-24 The Board Of Regents Of The University Of Texas System Inhibition of filovirus entry into cells and uses thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5416016A (en) * 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5447851A (en) * 1992-04-02 1995-09-05 Board Of Regents, The University Of Texas System DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells
US5837533A (en) * 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US6093382A (en) * 1998-05-16 2000-07-25 Bracco Research Usa Inc. Metal complexes derivatized with folate for use in diagnostic and therapeutic applications

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5416016A (en) * 1989-04-03 1995-05-16 Purdue Research Foundation Method for enhancing transmembrane transport of exogenous molecules
US5447851A (en) * 1992-04-02 1995-09-05 Board Of Regents, The University Of Texas System DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells
US5447851B1 (en) * 1992-04-02 1999-07-06 Univ Texas System Board Of Dna encoding a chimeric polypeptide comprising the extracellular domain of tnf receptor fused to igg vectors and host cells
US5837533A (en) * 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US6093382A (en) * 1998-05-16 2000-07-25 Bracco Research Usa Inc. Metal complexes derivatized with folate for use in diagnostic and therapeutic applications

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008156853A2 (en) * 2007-06-20 2008-12-24 The Board Of Regents Of The University Of Texas System Inhibition of filovirus entry into cells and uses thereof
WO2008156853A3 (en) * 2007-06-20 2009-02-26 Univ Texas Inhibition of filovirus entry into cells and uses thereof

Also Published As

Publication number Publication date
AU2256801A (en) 2001-06-18

Similar Documents

Publication Publication Date Title
Naniche et al. Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus
Belz et al. A previously unrecognized H-2Db-restricted peptide prominent in the primary influenza A virus-specific CD8+ T-cell response is much less apparent following secondary challenge
Chan et al. Folate receptor-α is a cofactor for cellular entry by Marburg and Ebola viruses
Sullivan et al. Determinants of human immunodeficiency virus type 1 envelope glycoprotein activation by soluble CD4 and monoclonal antibodies
Marker et al. Studies on cell-mediated immunity to lymphocytic choriomeningitis virus in mice
Townsend et al. Cytotoxic T lymphocytes recognize influenza haemagglutinin that lacks a signal sequence
Johnson et al. Free major histocompatibility complex class I heavy chain is preferentially targeted for degradation by human T-cell leukemia/lymphotropic virus type 1 p12I protein
Ohka et al. Receptor (CD155)-dependent endocytosis of poliovirus and retrograde axonal transport of the endosome
Matsuura et al. Characterization of pseudotype VSV possessing HCV envelope proteins
KR101514463B1 (en) Methods and compositions for the treatment of persistent infections and cancer by inhibiting the programmed cell death 1 (pd-1) pathway
EP1660638B1 (en) Lipoparticles comprising proteins, methods of making, and using the same
Mangeat et al. Influenza virus partially counteracts restriction imposed by tetherin/BST-2
Polyak et al. Impaired class II expression and antigen uptake in monocytic cells after HIV-1 infection.
CA2109093A1 (en) Cationized antibodies against intracellular proteins
US20020168361A1 (en) Methods and compositions for inhibiting inflammation and angiogenesis comprising a mammalian CD97 alpha subunit
Hober et al. Antibody-dependent enhancement of coxsackievirus B4 infectivity of human peripheral blood mononuclear cells results in increased interferon-α synthesis
Ikuta et al. Expression of human immunodeficiency virus type 1 (HIV-1) gag antigens on the surface of a cell line persistently infected with HIV-1 that highly expresses HIV-1 antigens
WO1996009380A1 (en) Method of enhancing expression of mhc class i molecules bearing endogenous peptides
Schneider-Schaulies et al. Receptor (CD46) modulation and complement-mediated lysis of uninfected cells after contact with measles virus-infected cells
Wang et al. N-linked glycosylation in the CXCR4 N-terminus inhibits binding to HIV-1 envelope glycoproteins
CN104168903B (en) For treating by the inhibitor of disease, composition and vaccine caused by enveloped virus
Fujinaga et al. Extracellular Nef protein regulates productive HIV-1 infection from latency.
Bounou et al. Attachment of human immunodeficiency virus-1 (HIV-1) particles bearing host-encoded B7-2 proteins leads to nuclear factor-κB-and nuclear factor of activated T cells-dependent activation of HIV-1 long terminal repeat transcription
Firsching et al. Measles virus spread by cell-cell contacts: uncoupling of contact-mediated receptor (CD46) downregulation from virus uptake
US7803555B2 (en) Methods and compositions for use in the treatment of filovirus mediated disease conditions

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP