WO2001040486A1 - Novel polypeptide---human atp-dependent serine protease 48 and polynucleotide encoding it - Google Patents

Abstract

The invention concerns human ATP-dependent serine protease 48 and polynucleotide encoding it. The invention also concerns the process of producing the polypeptide by recombinant DNA technique. The methods for treating many diseases e.g. malignant tumor, hemopathy, infection of HIV, immunological diseases and pruritus utilizing the polypeptide are disclosed. The invention discloses the antagonist against the polypeptide and therapeutics thereof. The invention also discloses the uses of the polynucleotide, which encodes the novel human ATP-dependent serine protease 48.

Description

 A new polypeptide-one human ATP-dependent serine protease 48 and a polynucleotide encoding the polypeptide TECHNICAL FIELD

 The present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, a human ATP-dependent serine protease 48, and a polynucleotide sequence encoding the polypeptide. The invention also relates to methods and applications for preparing such polynucleotides and polypeptides. Background technique

 In mammals and yeast, members of the Lon-type proteolytic enzyme family catalyze the ATP-dependent degradation of mitochondrial matrix proteins. People have cloned a variety of members of the Lon proteolytic enzyme family from bacteria, yeast, and humans, and found that human LON proteolytic enzymes are expressed in various tissues, and these proteins are encoded in the nucleus of the cell. The N-terminus of the amino acid sequence contains a potential mitochondrial prelocalization sequence [Wang N., Got tesman S. eta l., 1993, Prog Na tl Acad Sci USA, 90: 11247-11251].

 In 1998, Baraka t S. et al. Cloned L0N1 protein from maize, which is a new member of the Lon-type proteolytic enzyme family. The L0N1 protein has high similarity in protein sequence with known bacteria and human Lon proteolytic enzymes, and both have a conserved substrate binding domain and an ATP binding domain; and the protein is related to the Lon protein family. The other members have similar biological functions and are closely related to the biological respiration process in vivo, which can maintain the integrity of mitochondrial DNA, but is not a component of the cytochrome complex [Baraka t S., Pearce DA. eta l., 1998, Plant Ant Biol, 37: 141-154]. It can be known from the above that members of the Lon proteolytic enzyme family have a wide range of biological functions in the body. Abnormal expression will cause abnormal mitochondrial DNA structure, and affect the function of the respiratory chain, resulting in abnormal metabolism of materials and energy.

 Members of the Lon proteolytic enzyme family rely on the energy released by ATP hydrolysis and their serine active sites in their catalytic active centers to exert their enzymatic activities. The N-terminus of the members of the enzyme family contains a conserved ATP-binding domain, which is responsible for binding to ATP in the body to hydrolyze ATP and provide the energy required for the enzyme to function; in addition, the enzyme family The members also contain the following conservative consensus sequence fragments:

 DG- [PD] -SA- [GS]-[LIVMCA]-[TA]-[LIVM] (where S is the active serine site); The sequence fragment is the catalytic active center of the enzyme, and it plays a normal physiological function in the process of the enzyme Plays an important role. Mutations in this sequence will affect the catalytic activity of the enzyme in the organism.

The novel human ATP-dependent serine proteolytic enzyme of the present invention and the L0N 1 protein in Zea Mays: The proteinases have 54% identity and 71% similarity at the protein level, and both have an ATP-binding domain and a conserved sequence fragment of the enzyme catalytic center; therefore, both of them are of the Lon proteolytic enzyme family. Members, and have similar biological functions, are related to the occurrence of mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development in the body.

 As mentioned above, the human ATP-dependent serine protease 48 protein plays an important role in regulating important functions of the body such as cell division and embryo development, and it is believed that a large number of proteins are involved in these regulatory processes, so more needs to be identified in the art The human ATP-dependent serine protease 48 protein involved in these processes, in particular, identifies the amino acid sequence of this protein. Isolation of the newcomer's ATP-dependent serine protein hydrolase 48 protein-encoding gene also provides the basis for research to determine its role in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic drugs for diseases, so it is important to isolate its coding DNA. Disclosure of invention

 It is an object of the present invention to provide isolated novel polypeptides-human ATP-dependent serine protease 48 and fragments, analogs and derivatives thereof.

 Another object of the invention is to provide a polynucleotide encoding the polypeptide.

 Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme 48.

Another object of the present invention is to provide a genetically engineered host cell containing a polynucleotide encoding a human ATP-dependent serine proteolytic enzyme ⁴ 8.

 Another object of the present invention is to provide a method for producing human ATP-dependent serine proteolytic enzyme 48. Another object of the present invention is to provide antibodies against the polypeptide of the present invention-human ATP-dependent serine protease 48.

 Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors against the human ATP-dependent serine protease 48 of the polypeptide of the present invention.

Another object of the present invention is to provide a method of diagnosing and treating human ATP-dependent serine proteolytic enzyme of ⁴⁸ diseases related to abnormal.

 The present invention relates to an isolated polypeptide, which is of human origin and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2, or a conservative variant, biologically active fragment or derivative thereof. Preferably, the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.

 The invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID No. 2; (b) a polynucleotide complementary to polynucleotide (a);

 (c) A polynucleotide having at least 70% identity to a polynucleotide sequence of (a) or (b).

 More preferably, the sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 802-2100 in SEQ ID NO: 1; and (b) a sequence having 1-2295 in SEQ ID NO: 1 Sequence of bits.

 The invention further relates to a vector, in particular an expression vector, containing the polynucleotide of the invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; and a method comprising culturing said Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.

 The invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.

 The invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit human ATP-dependent serine proteolytic enzyme 48 protein activity, which comprises utilizing the polypeptide of the invention. The invention also relates to compounds obtained by this method.

 The invention also relates to a method for in vitro detection of a disease or susceptibility to a disease associated with abnormal expression of human ATP-dependent serine protease 48 protein, comprising detecting mutations in the polypeptide or a sequence encoding a polynucleotide thereof in a biological sample, Alternatively, the amount or biological activity of a polypeptide of the invention in a biological sample is detected.

 The invention also relates to a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.

 The present invention also relates to the use of the polypeptide and / or polynucleotide of the present invention for the preparation of a medicament for treating cancer, developmental disease or immune disease or other diseases caused by abnormal expression of human ATP-dependent serine proteolytic enzyme 48.

 Other aspects of the invention will be apparent to those skilled in the art from the disclosure of the techniques herein. The following terms used in this specification and claims have the following meanings unless specifically stated: "Nucleic acid sequence" refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genomic or synthetic DNA or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand. Similarly, the term "amino acid sequence" refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof. When the "amino acid sequence" in the present invention relates to the amino acid sequence of a naturally occurring protein molecule, such "polypeptide" or "protein" does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .

A protein or polynucleotide "variant" refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence. Variants can have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine Variants can also have non-conservative changes, such as replacing glycine with tryptophan.

 "Deletion" refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.

 "Insertion" or "addition" means that a change in the amino acid sequence or nucleotide sequence results in an increase in one or more amino acids or nucleotides compared to a molecule that exists in nature. "Replacement" refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.

 "Biological activity" refers to a protein that has the structure, regulation, or biochemical function of a natural molecule. Similarly, the term "immunologically active" refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response and to bind specific antibodies in a suitable animal or cell.

 An "agonist" refers to a molecule that, when combined with human ATP-dependent serine proteolytic enzyme 48, causes the protein to change, thereby regulating the activity of the protein. Agonists can include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ATP-dependent serine protease 48.

 An "antagonist" or "inhibitor" refers to a molecule that can block or regulate the biological or immunological activity of human ATP-dependent serine protease 48 when combined with human ATP-dependent serine protease 48 . Antagonists and inhibitors may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind human ATP-dependent serine protease 48.

 "Regulation" refers to a change in the function of human ATP-dependent serine protease 48, including an increase or decrease in protein activity, a change in binding characteristics, and any other biological properties and functions of human ATP-dependent serine protease 48 Or changes in immune properties.

 "Substantially pure '" means essentially free of other proteins, lipids, sugars or other substances with which it is naturally associated. Those skilled in the art can use standard protein purification techniques to purify human ATP-dependent serine protease 48 The substantially pure human ATP-dependent serine protease 48 can generate a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP-dependent serine protease 48 polypeptide can be analyzed by amino acid sequence.

 "Complementary" or "complementary" refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature. For example, the sequence "C-T-G-A" can be combined with the complementary sequence "G_A-C-T". The complementarity between two single-stranded molecules can be partial or complete. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.

"Homology" refers to the degree of complementarity and can be partially homologous or completely homologous. "Partial homology" refers to a partially complementary sequence that at least partially inhibits hybridization of a fully complementary sequence to a target nucleic acid. Inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Nort hern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not imply a reduction in stringency Low conditions allow non-specific binding because conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.

 "Percent identity" refers to the percentage of sequences that are the same or similar in the comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as by the MEGALIGN program (Lasergene software package, DNASTAR, Inc., Madison Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P.M. Sharp (1988) Gene 73: 237-244). The Clus ter method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups. The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula:

 Number of matching residues between sequence A and sequence B

 X 100 Number of residues in sequence A-number of spacer residues in sequence A-number of spacer residues in sequence B

 The percent identity between nucleic acid sequences can also be determined by the Cluster method or by methods known in the art, such as Jotun Hein (Hein J., (1990) Methods in emzumology 183: 625-645).

 "Similarity" refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences. Amino acids used for conservative substitutions, for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.

 "Antisense" refers to a nucleotide sequence that is complementary to a particular D or RNA sequence. "Antisense strand" refers to a nucleic acid strand that is complementary to the "sense strand".

 "Derivative" refers to a chemical modification of HFP or a nucleic acid encoding it. Such a chemical modification may be the replacement of a hydrogen atom with an alkyl group, an acyl group or an amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological characteristics of natural molecules.

"Antibody" refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') ₂ and Fv, which can specifically bind to the epitope of human ATP-dependent serine protease 48.

 A "humanized antibody" refers to an antibody in which the amino acid sequence of a non-antigen binding region is replaced to become more similar to a human antibody, but still retains the original binding activity.

The term "isolated" refers to the removal of a substance from its original environment (for example, its natural environment if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide is not isolated when it is present in a living animal, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system. Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not its natural environment The ingredients, they are still separated.

 As used herein, "isolated" refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and peptides in the natural state of living cells are not isolated and purified, but the same polynucleotides or peptides are separated and purified if they are separated from other substances existing in the natural state. .

 As used herein, "isolated human ATP-dependent serine protease 48" means that human ATP-dependent serine protease 48 is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. Those skilled in the art can purify human ATP-dependent serine proteolytic enzymes 48 using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the human ATP-dependent serine protease 48 polypeptide can be analyzed by amino acid sequence.

 The present invention provides a new polypeptide, a human ATP-dependent serine proteolytic enzyme 48, which basically consists of the amino acid sequence shown in SEQ ID NO: 2. The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide. The polypeptides of the present invention can be naturally purified products or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may also include or exclude the initial methionine residue.

 The invention also includes fragments, derivatives, and analogs of human ATP-dependent serine protease 48. As used herein, the terms "fragment", "derivative" and "analog" refer to a polypeptide that substantially maintains the same biological function or activity of the human ATP-dependent serine proteolytic enzyme 48 of the present invention. A fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution The amino acid may or may not be encoded by a genetic codon; or (II) a type in which a group on one or more amino acid residues is substituted by another group to include a substituent; or (Π Ι) Such a polypeptide sequence in which the mature polypeptide is fused with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol); or (IV) a polypeptide sequence in which an additional amino acid sequence is fused into the mature polypeptide (Such as a leader sequence or a secreted sequence or a sequence used to purify this polypeptide or a protease sequence) As set forth herein, such fragments, derivatives, and analogs are considered to be within the knowledge of those skilled in the art.

The present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2. The polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1. The polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 2295 bases in length and its open reading frame (8 02-2 1 00) encodes 4 32 amino groups Sour. According to the amino acid sequence homology comparison, it was found that this polypeptide has 54% homology with the L0N1 proteolytic enzyme in Zea Mays. It can be concluded that the human ATP-dependent serine proteolytic enzyme 48 has the L0N1 proteolytic enzyme in Zea May Similar structure and function.

 The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be coding or non-coding. The coding region sequence encoding the mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant. As used herein, a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 but different from the coding region sequence shown in SEQ ID NO: 1 in the present invention.

 The polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.

 The term "polynucleotide encoding a polypeptide" refers to a polynucleotide that includes the polypeptide and a polynucleotide that includes additional coding and / or non-coding sequences.

 The invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention. This polynucleotide variant can be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .

 The invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences). The present invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 60. C; or (2) adding a denaturant during hybridization, such as 50 ° / »(v / v) formamide, 0.1% calf serum / 0.1% F i co ll, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.

The invention also relates to nucleic acid fragments that hybridize to the sequences described above. As used herein, a "nucleic acid fragment" contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least SO-SO nucleotides, and most preferably at least 100 More than nucleotides. Nucleic acid fragments can also be used in nucleic acid amplification techniques, such as PCR, to identify and / or isolate polynucleotides encoding human ATP-dependent serine protease 4 8. The polypeptides and polynucleotides of the present invention are preferably provided in isolated form and are more preferably purified to homogeneity. The specific polynucleotide sequence encoding the human ATP-dependent serine proteolytic enzyme 48 of the present invention can be obtained by various methods. For example, polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or cDNA libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.

 The DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DNA sequence to obtain the double-stranded DNA of the polypeptide.

 Of the methods mentioned above, genomic DNA isolation is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences. The standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library. Various methods have been used to extract mRNA, and kits are also commercially available (Qiagene). The construction of cDNA libraries is also a common method (Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory. New York, 1989). Commercially available cDNA libraries are also available, such as different cDNA libraries from Clontech. When combined with polymerase reaction technology, even very small expression products can be cloned.

 The genes of the present invention can be selected from these cDNA libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DNA or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of the level of human ATP-dependent serine protease 48 transcripts (4) Detecting protein products expressed by genes through immunological techniques or measuring biological activity. The above methods can be used alone or in combination.

 In the method (1), the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides. In addition, the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides. The probe used here is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention. The genes or fragments of the present invention can of course be used as probes.

DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).

 In the (4) method, immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect protein products expressed by the human ATP-dependent serine proteolytic enzyme 48 gene.

A method of amplifying DNA / RNA by PCR (Saiki, et al. Science 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention. In particular, when it is difficult to obtain a full-length cDNA from a library, the RACE method (RACE-rapid amplification of cDNA ends) may be preferably used. The primers used for PCR may be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and use regular Method synthesis. The amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.

 The polynucleotide sequence of the gene of the present invention or various DM fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDNA sequence of multiple clones in order to splice into a full-length cDNA sequence.

 The present invention also relates to a vector comprising a polynucleotide of the present invention, and a host cell genetically engineered using the vector of the present invention or directly using a human ATP-dependent serine proteolytic enzyme 48 coding sequence, and the recombinant technology to produce the described Polypeptide method.

 In the present invention, a polynucleotide sequence encoding a human ATP-dependent serine proteolytic enzyme 48 may be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention. The term "vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors expressed in bacteria (Rosenberg, et al. Gene, 1987, 56: 125); pMSXND expression vectors expressed in mammalian cells ( Lee and Nathans, J Bio Chem. 263: 3521, 1988) and baculovirus-derived vectors expressed in insect cells. In short, as long as it can be replicated and stabilized in the host, any plasmid and vector can be used to construct a recombinant expression vector. An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.

 Methods known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding human ATP-dependent serine protein hydrolase 48 and appropriate transcription / translation regulatory elements. These methods include in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be operably linked to an appropriate promoter in the expression vector to guide mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E. coli; the PL promoter of lambda phage; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, Retroviral LTRs and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation, a transcription terminator, and the like. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors for DNA expression, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Examples include 100 to 270 base pair SV40 enhancers on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers.

In addition, the expression vector preferably contains one or more selectable marker genes to provide Phenotypic traits of host cells such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E. coli.

 Those of ordinary skill in the art will know how to select appropriate vector / transcription control elements (such as promoters, enhancers, etc.) and selectable marker genes.

 In the present invention, a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 48 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to form a genetically engineered host containing the polynucleotide or the recombinant vector. cell. The term "host cell" refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples are: E. coli, Streptomyces; bacterial cells such as Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells such as fly S2 or Sf 9; animal cells such as CH0, COS or Bowes melanoma cells.

Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, competent cells capable of absorbing DA can be harvested after the exponential growth phase and treated with CaC I using procedures well known in the art. The alternative is to use MgC l ₂ . If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging.

 Using conventional recombinant DNA technology, the polynucleotide sequences of the present invention can be used to express or produce recombinant human ATP-dependent serine protease 48 (Scence, 1984; 224: 1431). Generally speaking, there are the following steps:

 (1) using the polynucleotide (or variant) encoding human human ATP-dependent serine protease 48 of the present invention, or transforming or transducing a suitable host cell with a recombinant expression vector containing the polynucleotide;

 (2) culturing host cells in a suitable medium;

 (3) Isolate and purify protein from culture medium or cells.

 In step (2), depending on the host cell used, the medium used in the culture may be selected from various conventional mediums. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

In step (3), the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell. If desired, recombinant proteins can be isolated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation treatment, protein precipitant treatment (salting out method), centrifugation, osmotic disruption, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion Exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods. Brief description of the drawings

 The following drawings are used to illustrate specific embodiments of the invention, but not to limit the scope of the invention as defined by the claims.

 FIG. 1 is a comparison diagram of amino acid sequence homology of the ATP-dependent serine proteolytic enzyme 48 and LON1 protein hydrolase in Zea Mays of the present inventors. The upper sequence is human ATP-dependent serine protease 48, and the lower sequence is L0N1 protease in Zea Mays. Identical amino acids are represented by single-character amino acids between the two sequences, and similar amino acids are represented by "+".

 Figure 2 shows the polyacrylamide gel electrophoresis (SDS-PAGE) of human ATP-dependent serine protease 48. 48kDa is the molecular weight of the protein. The arrow indicates the isolated protein band. The best way to implement the invention

 The present invention is further described below with reference to specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. In the following examples, the experimental methods without specific conditions are usually performed according to conventional conditions such as Sambrook et al., Molecular Cloning: The conditions described in the laboratory manual (New Yor Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's instructions. Suggested conditions.

 Example 1: Cloning of human ATP-dependent serine protease 48

 Human fetal brain total RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform. Using QuikmRNA Isolation Kit

(Qiegene product) Isolate poly (A) mRNA from total RNA. 2ug poly (A) mRNA was reverse-transcribed to form cDNA. The Smart cDNA cloning kit (purchased from Clontech) was used to insert the cDNA fragments into the multiple cloning site of pBSK (+) vector (Clontech) to transform DH5a. The bacteria formed a cDNA library. Dye terminate cycle react ion sequencing kit (Perkin-Elmer) and ABI 377 automatic sequencer (Perkin-Elmer) were used to determine the sequences at the 5 'and 3' ends of all clones. The determined cDM sequence was compared with the existing public DNA sequence database (Genebank), and it was found that the cDNA sequence of one of the clones 0360G11 was new DNA. The inserted cDNA fragment contained in this clone was determined in both directions by synthesizing a series of primers. The results showed that the full-length cDNA contained in the 0360G11 clone was 2295bp (as shown in Seq ID N0: 1), and there was a 1299bp open reading frame (0RF) from 802bp to 2100bp. : Shown in 2). We named this clone PBS-0360G11 and encoded the protein as human ATP-dependent serine protease 48. Example 2: Homologous search of cDNA clones

Combining the sequence of the human ATP-dependent serine protease 48 of the present invention and the protein sequence encoded by it, The Blast program (Basiclocal Alignment search tool) [Altschul, SF et al. J. Mol. Biol. 1990; 215: 403-10] was used to perform homology search in databases such as Genbank and Swissport. The gene with the highest homology to the human ATP-dependent serine proteolytic enzyme 48 of the present invention is a known LON1 proteolytic enzyme in Zea Mays, and the accession number encoded by the protein in Genbank is U85494. The protein homology results are shown in Figure 1. The two are highly homologous, with 54% identity; 71% similarity. Example 3: Cloning of a gene encoding human ATP-dependent serine protease 48 by RT-PCR

 CDNA was synthesized using fetal brain total RNA as a template and oligo-dT as a primer.

After purification of Qiagene's kit, PCR amplification was performed with the following primers:

 Priraerl: 5,-GTTTTTATTTCATGCCACACTCTAC -3, (SEQ ID NO: 3)

 Primer2: 5'- TTTTTATCAGTTTACTAAATCAAC -3 '(SEQ ID NO: 4)

 Primerl is a forward sequence starting at lbp at the 5 'end of SEQ ID NO: 1;

 Primer2 is the 3 'end reverse sequence in SEQ ID NO: 1.

Amplification conditions: 50 mmol / L KC1, 10 mmol / L Tris-Cl, (pH 8.5), 1.5 mmol / L MgCl ₂ , 200 μ mol / L dNTP, lOpmol primers in a reaction volume of 50 μ 1 , 1U Taq DNA polymerase (Clontech). The reaction was performed on a PE9600 DNA thermal cycler (Perk in-Elmer) under the following conditions for 25 cycles: 94 ° C 30sec; 55 ° C 30sec; 72 ° C 2min. During RT-PCR, β-act in was set as a positive control and template blank was set as a negative control. The amplified product was purified using a QIAGEN kit, and ligated to a pCR vector (Invitrogen product) using a TA cloning kit. The DNA sequence analysis results showed that the DNA sequence of the PCR product was exactly the same as that of 1-2295bp shown in SEQ ID NO: 1. Example 4: Northern blot analysis of human ATP-dependent serine protease 48 gene expression: Total RNA was extracted in one step [Anal. Biochem 1987, 162, 156-159]. This method involves acid guanidinium thiocyanate phenol-chloroform extraction. I.e. with 4M guanidinium isothiocyanate - tissue was homogenized 25mM sodium citrate, 0.2M sodium acetate (pH ⁴ 0.), 1 volume of phenol and 1/5 volume of chloroform - isoamyl alcohol (49: 1) Centrifuge after mixing. Aspirate the aqueous layer, add isopropanol (0.8 vol) and centrifuge the mixture to obtain RNA precipitate. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water. With 20 g RNA containing ² 0mM 3- (N- morpholino) propanesulfonic acid (PH7 0.) - carried out on a 1.2% agarose gel 5mM sodium acetate -ImM EDTA- 2.2M formaldehyde electrophoresis. It was then transferred to a nitrocellulose membrane. Preparation cc- ³² P dATP with ³² P- DNA probe labeled by the random primer method. The DNA probe used was the PCR amplified human ATP-dependent serine protease 48 coding region sequence (802bp to 2100bp) shown in FIG. 1. A 32P-labeled probe (approximately 2 x 10 ⁶ cpm / nil) was hybridized with a nitrocellulose membrane to which RNA was transferred at 42 ° C overnight in a solution containing 50% formamide-25mM H ₂ P0 ₄ (pH 7.4)-5 x SSC- 5 x Denhardt's solution and 200 μg / mi salmon sperm DNA. Cross After that, the filter was washed in 1 x SSC-0.1% SDS at 55 ° C for 30 minutes. Then, Phosphor Imager was used for analysis and quantification. Example 5: In vitro expression, isolation and purification of recombinant human ATP-dependent serine protease 48

 Based on SEQ ID NO: 1 and the coding region sequence shown in Figure 1, a pair of specific amplification primers were designed, the sequence is as follows:

Primer 3: 5'- CATGCTAGCATGCCTGGTCGCATCATCAACGGC -3, (Seq ID No: 5) Primer4: 5'- CCCAAGCTTCTACAGTTTGCTATTTAACAGACC -3, (Seq ID No: 6) The 5 'ends of these two primers contain Nhel and Hindlll restriction sites, respectively , Followed by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively. The Nhel and Hindlll restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site. PCR was performed using the PBS-0360G11 plasmid containing the full-length target gene as a template. The PCR reaction conditions were as follows: a total volume of 50 μ1 containing 10 pg of pBS-0360Gll plasmid, and primers Primer-3 and Primer-4 were lOpmol, Advantage polymeraseMix (Clontech) 1 μ1, respectively. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68. C 2 min, a total of 25 cycles. Nhel and Hindlll were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase. The ligated product was transformed into E. coli DH50C using the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 30 g / ml), positive clones were screened by colony PCR and sequenced. A positive clone (pET-0360G11) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method. In LB liquid medium containing kanamycin (final concentration 30 g / ml), the host bacteria BL21 (pET-0360G11) was cultured at 37 ° C to the logarithmic growth phase, and IPTG was added to a final concentration of 1 mmol / L, and continued Incubate for ⁵ hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used for chromatography to obtain 6 histidines (6His-Tag). A purified human ATP-dependent serine protease 48 of interest was purified. After SDS-PAGE electrophoresis, a single band was obtained at 48 kDa (Figure 2). The band was transferred to a PVDF membrane and the N-terminal amino acid sequence was analyzed by the Edams hydrolysis method. As a result, the 15 amino acids at the N-terminus were completely identical to the 15 amino acid residues at the N-terminus shown in SEQ ID NO: 2. Example 6 Production of anti-human ATP-dependent serine protease 48 antibody

 A peptide synthesizer (product of PE company) was used to synthesize the following human ATP-dependent serine protease 48 specific peptides:

ΝΗ, -Met-Pro-Gly-Arg-Ile-Ile-Asn-Gly-Leu-Lys-Thr-Val-Gly-Val-Asn-COOH (SEQ ID NO: 7). The peptide is coupled to hemocyanin and bovine serum albumin to form a complex, respectively. For methods, see: Avramea s, etal. Immunochemi s try, 1969; 6: 43. Rabbits were immunized with 4 mg of the above-mentioned jk cyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost the immunity once. A 15 g / ml bovine serum albumin peptide complex-coated titer plate was used as the ELI SA to determine the antibody titer in rabbit serum. Total I gG was isolated from antibody-positive rabbit serum using protein A-Sepharose. The peptide was bound to a cyanogen bromide-activated Sephar _{0 S} e4B column, and the anti-peptide antibody was separated from the total I gG by affinity chromatography. The immunoprecipitation method demonstrated that the purified antibody could specifically bind to human ATP-dependent serine protease 48.

Example 7: Application of the polynucleotide fragment of the present invention as a hybridization probe

 Suitable oligonucleotide fragments selected from the polynucleotides of the present invention are used as hybridization probes in various aspects. For example, the probes can be used to hybridize to genomic or cDNA libraries of normal tissue or pathological tissue from different sources to It is determined whether it contains the polynucleotide sequence of the present invention and a homologous polynucleotide sequence is detected. Further, the probe can be used to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissues or Whether the expression in tissue cells is abnormal.

 The purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method. Acid sequence or a homologous polynucleotide sequence thereof. Filter hybridization methods include dot blotting, Southern blotting, Nor thern blotting, and copying methods, etc. They are all used to fix the polynucleotide sample to be tested on the filter and then hybridize using basically the same steps. These same steps are as follows: The sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding sites of the sample on the filter with the carrier and synthetic polymer. The pre-hybridization solution is then replaced with a hybridization buffer containing the labeled probe and incubated to hybridize the probe to the target nucleic acid. After the hybridization step, the unhybridized probes are removed by a series of membrane washing steps. In this embodiment, higher-intensity washing conditions (such as lower salt concentration and higher temperature) are used to reduce the hybridization background and retain only strong specific signals. The probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention The polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment. In this embodiment, the dot blot method is used to fix the sample on the filter membrane. Under high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.

First, the selection of the probe

 The selection of oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention as hybridization probes should follow the following principles and several aspects to be considered:

1. The preferred range of probe size is 18-50 nucleotides;

2, GC content is 30 »/. -70%, non-specific hybridization increases; 3. There should be no complementary regions inside the probe;

 4. Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complements The regions are compared for homology. If the homology with the non-target molecular region is greater than 85% or there are more than 15 consecutive bases, the primary probe should not be used;

 5. Whether the preliminary selection probe is finally selected as a probe with practical application value should be further determined by experiments.

 After completing the above analysis, select and synthesize the following two probes:

 Probe 1 (probel), which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt):

 5,-CATTATCTAAATGTGGCCTTTGACCTTTCTCAAGTTCTTTT- 3 '

 Probe 2 (probe2), which belongs to the second type of probe, is equivalent to the replacement mutation sequence (41Nt) of the gene fragment of SEQ ID NO: 1 or its complementary fragment:

 5 '-CAATCGGTAAATGTGGAGAGTGACCTTTCTCAAGATCGTTT-3'

 Please refer to the literature for other commonly listed reagents and their preparation methods related to the following specific experimental procedures: DNA PROBES GH Keller; MM Manak; Stockton Pres s, 1989 (USA) and more commonly used molecular cloning experiment manual books such as "Molecular Guide to Cloning Experiments, Second Edition, U998) [US] Sambrook, et al., Science Press.

 Sample Preparation:

1. Extract DNA from fresh or frozen tissue

 Steps: 1) Place fresh or freshly thawed normal liver tissue in a plate immersed in ice and filled with phosphate buffered saline (PBS). Cut the tissue into small pieces with scissors or a scalpel. Keep tissue moist during operation.

2) Centrifuge the tissue at 1,000 g for 10 minutes. 3) Suspend the precipitate (about 10 ml / g) with a cold homogenization buffer (0.25 mol / L sucrose; 25 mmol / L Tris-HCl, pH 7.5; 25 with ol / LnaCl; 25 mmol / L MgCl ₂ ).

4) Homogenize the tissue suspension at 4 ° C at full speed with an electric homogenizer until the tissue is completely broken. 5) Centrifuge at 1000g for 10 minutes. 6) Resuspend the cell pellet (add 1-5ml per 0.1 g of the original tissue sample), and centrifuge at 1000g for 10 minutes. 7) Resuspend the pellet in lysis buffer (add 1ml per 0.1 g of the initial tissue sample), and then follow the phenol extraction method below.

2, DNA phenol extraction method

Steps: 1) Wash the cells with 1-10 ml of cold PBS and centrifuge at 1000g for 10 minutes. 2) Resuspend the pelleted cells (1 × 10 ⁸ cells / ml) with cold cell lysate and apply a minimum of 100ul lysis buffer. 3) Add SDS to a final concentration of 1%. If SDS is added directly to the cell pellet before resuspending the cells, the cells may form large clumps that are difficult to break, and reduce the overall yield. This is particularly serious when extracting> 10 ⁷ cells. 4) Add proteinase K to a final concentration of 200ug / mi. 5) Incubate at 50 ° C for 1 hour or light at 37 ° C Shake gently overnight. 6) Extract with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge in a small centrifuge tube for 10 minutes. The two should be clearly separated, otherwise centrifuge again. 7) Transfer the water phase to a new tube. 8) Extract with an equal volume of chloroform: isoamyl alcohol (24: 1) and centrifuge for 10 minutes. 9) Transfer the DNA-containing aqueous phase to a new tube. The DNA was then purified and ethanol precipitated.

3, DNA purification and ethanol precipitation

Steps: 1) Add 1/10 volume of 2mol / L sodium acetate and 2 volumes of cold 100% ethanol to the DNA solution and mix. Leave at -20 C for 1 hour or overnight. 2) Centrifuge for 10 minutes. 3) Carefully aspirate or pour out the ethanol. 4) Wash the pellet with 500ul of 70% cold ethanol and centrifuge for 5 minutes. 5) Carefully aspirate or pour out the ethanol. Wash the pellet with 500ul of cold ethanol and centrifuge for 5 minutes. 6) Carefully aspirate or pour out the ethanol, then invert on the absorbent paper to drain off the residual ethanol. Air dry for 10-15 minutes to allow the surface ethanol to evaporate. Be careful not to allow the pellet to dry completely, otherwise it will be more difficult to re-dissolve. 7) Resuspend the DNA pellet in a small volume of TE or water. Low-speed vortexing or pipetting, with a dropper, while gradually increasing the TE, mixed until fully dissolved DNA, every 1-5 X 10 ⁶ cells extracted about plus lul.

 The following steps 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.

8) Add RNase A to the DNA solution to a final concentration of 100u _g / ml, and incubate at 37 ° C for 30 minutes. 9) Add SDS and proteinase K to the final concentration of 0.5% and 100ug / ml. Incubate at 37 ° C for 30 minutes. 10) Extract the reaction solution with an equal volume of phenol: chloroform: isoamyl alcohol (25: 24: 1) and centrifuge for 10 minutes. 11) Carefully remove the aqueous phase, re-extract with an equal volume of chloroform: isoamyl alcohol (24: 1), and centrifuge for 10 minutes. 12) Carefully remove the aqueous phase, add 1/10 volume of 2mol / L sodium acetate and 2.5 volumes of cold ethanol, mix and let stand at -20 ° C for 1 hour. 13) Wash the precipitate with 70% ethanol and 100% ethanol, air dry, and resuspend the nucleic acid. The process is the same as steps 3-6. 14) Determination of A _26Q and A ₂₈ . To detect the purity and yield of DNA. 15) Store at -20 ° (:. Preparation of sample film:

 1) Take 4 x 2 pieces of nitrocellulose membranes (NC membranes) of appropriate size, and mark the spotting position and sample number lightly with a pencil. Two NC membranes are needed for each probe for subsequent experiments. In the step, the film is washed with high-strength conditions and strength conditions, respectively.

 2) Aspirate and control 15 microliters each, spot on the sample film, and dry at room temperature.

 3) Place on filter paper impregnated with 0.1 mol / L NaOH, 1.5 mol / L NaCl for 5 minutes (twice), dry and place on filter paper impregnated with 0.5 mol / L Tris-HC1 (pH 7.0), 3 mol / L NaCl Allow to dry for 5 minutes (twice).

⁴ ) Clamp in clean filter paper and wrap with aluminum foil, 60-80. C was dried under vacuum for 2 hours.

 Labeling of probes

1) 3 μl Probe (0.10D / 10 μi), add 2 μ iKinase buffer, 8-i 0 uC i γ- ³² P-dATP + 2l; Kinase, to make up to a final volume of 20 μ i. 2) Incubate at 37 ° C for 2 hours.

 3) Add 1/5 volume of bromophenol blue indicator (BPB).

 4) Pass through a Sephadex G-50 column.

5) Before the ³² P-Probe is washed out, start collecting the first peak (can be monitored by Monitor).

 6) 5 drops / tube, collect 10-15 tubes.

 7) Monitor the amount of isotope with a liquid scintillator

8) After combining the collection solutions of the first peak, the ³² P-Probe (the second peak is free γ- ³² P-dATP) is prepared.

 Pre-hybridization

 Place the sample membrane in a plastic bag and add 3-10 mg of prehybridization solution UOxDenhardt's; 6xSSC, 0.1 mg / ml CT DNA (calf thymus DNA). ) After sealing the bag, shake at 68 ° C for 2 hours.

 Cross

 Cut a corner of the plastic bag, add the prepared probe, seal the bag, and shake it at 42 ° C in a water bath overnight. Wash film:

 High-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, wash at 40 ° C for 15 minutes (twice).

 4) Wash in 0.1xSSC, 0.1% SDS at 55 ° C for 30 minutes (twice), and dry at room temperature. Low-intensity washing film:

 1) Take out the hybridized sample membrane.

 2) 2xSSC, 0.1 ° / oSDS, 37. C wash for 15 minutes (twice).

 3) 0.1xSSC, 0.1% SDS, 37. C wash for 15 minutes (twice).

 4) 0.1xSSC, 0.1 ° /. In SDS, wash at 40 ° C for 15 minutes (twice) and dry at room temperature.

X-ray autoradiography:

 -70 ° C, X-ray autoradiography (pressing time depends on the radioactivity of the hybrid spot).

 Experimental results:

The hybridization experiments performed under low-intensity membrane washing conditions showed no significant difference in the radioactivity of the above four probe hybrid spots; while the hybridization experiments performed under low-intensity membrane washing conditions, the radioactive intensity of probe 1 was significantly stronger than The radioactivity of the other three probe hybridization spots. Therefore, probe 1 can be used to qualitatively and quantitatively analyze the presence and differential expression of the polynucleotide of the present invention in different tissues. Example 8 DNA Microarray

 Gene microarray or DNA microarray is a new technology that many national laboratories and large pharmaceutical companies are working on. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass. , Silicon and other carriers, and then use fluorescence detection and computer software to compare and analyze the data, in order to achieve the purpose of rapid, efficient, high-throughput analysis of biological information. The polynucleotide of the present invention can be used as a target DM for gene chip technology for high-throughput research of new gene functions; searching for and screening new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as genetic diseases . The specific method steps have been reported in the literature. For example, see DeRisi, J. L., Lyer, V. & Brown, P.0.

 (1997) Science 278, 680-68 and literature Helle, R. A., Schema, M., Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.

 (A) spotting

 A total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotides of the present invention. They were respectively amplified by (as described in Example 3) PCR. After the purified amplified products were purified, the concentration was adjusted to about 500ng / ul, and spotted with a Cartesian 7500 spotting instrument (purchased from Cartesian, USA) at On glass media, the distance between points is 280 μη! . The spotted slide was hydrated, dried, and cross-linked in a UV cross-linker. After elution, the DNA was fixed on a glass slide to prepare a chip. The specific method steps have been variously reported in the literature, and the specific method steps have been variously reported in the literature. The spot post-processing steps of this embodiment are:

 1. Hydration in a humid environment for 4 hours;

 2- 0.2% SDS for 1 minute;

3. Wash twice with ddH ₂ 0 for 1 minute each time;

4. NaBH _{4 is} blocked for 5 minutes;

 5. 95 ° C water for 2 minutes;

 6. Wash with 0.2% SDS for 1 minute;

7. Rinse twice with ddH ₂ 0;

 8. Dry and store at 25 ° C in the dark for future use.

 (2) Probe marking

Total mRNA was extracted from normal liver and liver cancer in one step, and mRNA was purified using Oligotex niRNA Midi Kit (purchased from QiaGen). The fluorescent reagent Cy3dUTP (5- Amino-propargy -2 '-deoxyur id ine 5 · -tr ipha te coupled to Cy3 fluorescent dye, purchased from Amersham Phamacia Biotech) mRM labeled normal tissue, ij Cy5dUTP (5-Amino-propargyl-2 ^, -deoxyur idine 5--tr iphate coupled to Cy5 fluorescent dye, purchased from Amersham Phamacia Biotech) The liver cancer tissue mRNA was labeled, and the probe was prepared after purification. Specific steps refer to and methods Schena, M., Shalon, D., Heller, R. (1996) Proc. Natl. Acad. Sci. USA. Vol. 93: 10614-10619. Schena, M., Shalon, Dari., Davis, RW (1995) Science. 270. (20): 467-480.

 (Three) cross

The probes from the two types of tissues and the chips were hybridized in a UniHyb ™ Hybridization Solution (purchased from TeleChem) hybridization solution for 16 hours, washed with a washing solution (1 ^x SSC, 0.2% SDS) at room temperature, and then scanned with ScanArray 3000. Scanner (purchased from General Scanning Company, USA) for scanning. The scanned image was analyzed and processed with Imagene software (Biodiscovery Company, USA) to calculate the Cy3 / Cy5 ratio of each point. The point where the ratio is less than 0.5 and greater than 2 is considered Genes with differential expression.

The experimental results show that Cy3 signal = 1980.63 (take the average of four experiments), Cy5signal-3281.8 (take the average of four experiments),

The expression of the polynucleotide of the present invention in the above two tissues is not significantly different. Industrial applicability

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.

 Members of the Lon-type proteolytic enzyme family catalyze the ATP-dependent degradation of mitochondrial matrix proteins. The Lon protein family is closely related to the respiration process of organisms in the body. It can maintain the integrity of mitochondrial DNA, but it is not a component of the cytochrome complex. Abnormal expression can cause abnormal mitochondrial DNA structure and affect the function of the respiratory chain, leading to abnormal metabolism of matter and energy.

 It can be seen that the abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will produce various diseases, especially mitochondrial diseases, metabolic disorders related to energy and material metabolism, and disorders of growth and development. These diseases include, but are not Limited to:

 Organic acidemia: isovaleric acidemia, propionic acidemia, methylmalonic aciduria, combined carboxylase deficiency, glutaric acid type I, etc.

Amino acid metabolism deficiency diseases: Phenylketonuria, tyrosine metabolism deficiency diseases such as albinism, amino acid metabolism deficiency diseases containing tryptophan, tryptophan metabolism deficiency diseases such as tryptophanemia, branch amino acid metabolism deficiency disease, glycine Acid metabolism deficiency diseases such as glycineemia, hypersarcosinemia, proline and hydroxyproline metabolism deficiency diseases, glutamate metabolism deficiency diseases, metabolic deficiency diseases of the urea cycle, histidine metabolism deficiency diseases, Lai Defects in amino acid metabolism, and other amino acid metabolism defects.

 Mucopolysaccharidosis and other marginal diseases: Mucopolysaccharidosis types I-VII, mucopolysaccharidosis borderline diseases such as rheumatoid mucopolysaccharidosis and mucolipid storage disease.

 Purine and Pyrimidine Metabolism Defects: Abnormal purine metabolisms such as Ray-niney syndrome, xanthineuria, and abnormal pyrimidine metabolisms such as orotic aciduria and adenosine deaminase deficiency.

 Abnormal lipid metabolism: hyperlipoproteinemia, familial hyperc-lipoproteinemia, familial non-beta-lipoproteinemia, familial hypo-p-lipoproteinemia, familial lecithin-cholesterol acetyltransferase Deficiency.

 Glucose metabolism defects: Congenital sugar digestion and absorption defects such as congenital lactose intolerance, hereditary fructose intolerance, monosaccharide metabolism defects such as galactosemia, fructose metabolism defects, glycogen metabolism diseases such as glycogen storage Backlog.

 Growth and development disorders: mental retardation, cerebral palsy, brain development disorders, familial cerebral nucleus dysplasia syndrome, skin, fat and muscular dysplasias such as congenital skin relaxation, premature aging, congenital horn Malformation, various metabolic defects such as various amino acid metabolic defects, stunting, dwarfism, sexual retardation, etc.

 Congenital malformations: spina bifida, craniocerebral fissure, anencephaly deformity, cerebral bulge, foramen malforma, Down syndrome, congenital hydrocephalus, aqueduct malformation, dwarfism of cartilage hypoplasia, spinal epiphyseal dysplasia, Pseudochondral dysplasia, Langer-G i ed i on syndrome, funnel chest, gonad hypoplasia, congenital adrenal hyperplasia, urethral fissure, cryptic, with short statures such as Coi ad i syndrome and Danbo l t-Clos s syndrome, congenital glaucoma or cataract, congenital lens position abnormality, congenital blepharoplasia, retinal dysplasia, congenital optic nerve atrophy, congenital sensorineural hearing loss, cracked hands and cracked feet, deformity Fetus, Wi lli ams syndrome, Al ag ille syndrome, Bayer syndrome, etc.

 Abnormal expression of the human ATP-dependent serine proteolytic enzyme of the present invention will also generate certain tumors, certain hereditary, hematological diseases, and immune system diseases.

 The polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat various diseases, especially mitochondrial disease, metabolic disorders related to energy and material metabolism, and growth and development disorders. Diseases, congenital malformations, certain tumors, certain hereditary, hematological and immune system diseases, etc.

The invention also provides methods of screening compounds to identify agents that increase (agonist) or suppress (antagonist) human ATP-dependent serine protease 48. Agonists enhance human ATP-dependent serine protease 48 to stimulate biological functions such as cell proliferation, while antagonists prevent and treat disorders related to cell proliferation, such as various cancers. For example, mammalian cells or human ATP-dependent can be expressed in the presence of drugs The membrane preparation of serine protease 48 was cultured with labeled human ATP-dependent serine protease 48. The ability of the drug to increase or block this interaction is then determined.

 Antagonists of human ATP-dependent serine protease 48 include screened antibodies, compounds, receptor deletions, and the like. Antagonists of human ATP-dependent serine protease 48 can bind to human ATP-dependent serine protease 48 and eliminate its function, or inhibit the production of the polypeptide, or bind to the active site of the polypeptide to make the polypeptide Cannot perform biological functions.

 When screening compounds as antagonists, human ATP-dependent serine protease 48 can be added to a bioanalytical assay by measuring the effect of the compound on the interaction between human ATP-dependent serine protease 48 and its receptor Determine if the compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human ATP-dependent serine proteolytic enzyme 48 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, generally 48 molecules of human ATP-dependent serine protein hydrolase should be labeled.

 The present invention provides a method for producing an antibody using a polypeptide, a fragment, a derivative, an analog thereof, or a cell thereof as an antigen. These antibodies can be polyclonal or monoclonal antibodies. The invention also provides antibodies directed against human ATP-dependent serine protease 48 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.

 Polyclonal antibodies can be produced by injecting human ATP-dependent serine protease 48 directly into immunized animals (such as rabbits, mice, rats, etc.). A variety of adjuvants can be used to enhance the immune response, including but not limited to 'S adjuvant and so on. Techniques for preparing monoclonal antibodies to human ATP-dependent serine protease 48 include, but are not limited to, hybridoma technology (Kohler and Mi is te in. Nature, 1975, 256: 495-497), triple tumor technology, human Beta-cell hybridoma technology, EBV-hybridoma technology, etc. Chimeric antibodies that bind human constant regions and non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851). Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human ATP-dependent serine protease 48.

 Antibodies against human ATP-dependent serine protease 48 can be used in immunohistochemistry to detect human ATP-dependent serine protease 48 in biopsy specimens.

 Monoclonal antibodies that bind to human ATP-dependent serine protease 48 can also be labeled with radioisotopes and injected into the body to track their location and distribution. This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.

Antibodies can also be used to design immunotoxins that target a particular part of the body. For example, human ATP-dependent serine protease 48 high affinity monoclonal antibodies can interact with bacterial or plant toxins (such as diphtheria toxin, ricin Protein, ormosine, etc.) covalently bind. A common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds. This hybrid antibody can be used to kill human ATP-dependent serine proteolytic enzymes. Positive cells.

 The antibodies of the present invention can be used to treat or prevent diseases related to human ATP-dependent serine protease 48. Administration of an appropriate dose of the antibody can stimulate or block the production or activity of human ATP-dependent serine protease 48.

 The invention also relates to a diagnostic test method for quantitative and localized detection of human ATP-dependent serine proteolytic enzyme 48 levels. These tests are well known in the art and include FI SH assays and radioimmunoassays. The level of human ATP-dependent serine protease 48 detected in the test can be used to explain the importance of human ATP-dependent serine protease 48 in various diseases and to diagnose human ATP-dependent serine protease 48 A working disease.

 The polypeptide of the present invention can also be used for peptide mapping analysis. For example, the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.

Polynucleotides encoding human ATP-dependent serine protease 48 can also be used for a variety of therapeutic purposes. Gene therapy techniques can be used to treat abnormal cell proliferation, development, or metabolism caused by the non-expression or abnormal / inactive expression of human ATP-dependent serine protease 48. Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutant human ATP-dependent serine protease 48 to inhibit endogenous human ATP-dependent serine protease 48 activity. For example, a variant human ATP-dependent serine protease 48 may be a shortened human ATP-dependent serine protease 48 lacking a signaling domain, although it can bind to downstream substrates, but lacks signal transduction. active. Therefore, recombinant gene therapy vectors can be used to treat diseases caused by abnormal expression or activity of human ATP-dependent serine protease 48. Virus-derived expression vectors such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex virus, parvovirus, etc. can be used to transfer a polynucleotide encoding human ATP-dependent serine protease 48 into a cell. A method for constructing a recombinant viral vector carrying a polynucleotide encoding human ATP-dependent serine proteolytic enzyme 48 can be found in the existing literature ( _Sarabook , _{et al} .). In addition, a recombinant polynucleotide encoding human ATP-dependent serine protease 48 can be packaged into liposomes and transferred into cells.

 Methods for introducing a polynucleotide into a tissue or cell include: directly injecting the polynucleotide into a tissue in vivo; or introducing the polynucleotide into a cell in vitro through a vector (such as a virus, phage, or plasmid), and then transplanting the cell Into the body and so on.

Oligonucleotides (including antisense RNA and DNA) and ribozymes that inhibit human ATP-dependent serine protease 48 raRNA are also within the scope of the present invention. A ribozyme is an enzyme-like RNA molecule that specifically decomposes specific RNA. Its mechanism of action is that the ribozyme molecule specifically hybridizes with a complementary target RNA for endonucleation. Antisense RNA and DNA and ribozymes can be obtained using any existing RNA or DNA synthesis technology, such as solid phase The technology of phosphate amide chemical synthesis to synthesize oligonucleotides has been widely used. Antisense RM molecules can be obtained by in vitro or in vivo transcription of a DNA sequence encoding the RNA. This DNA sequence has been integrated downstream of the RNA polymerase promoter of the vector. In order to increase the stability of a nucleic acid molecule, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the ribonucleoside linkages should use phosphate thioester or peptide bonds instead of phosphodiester bonds.

 The polynucleotide encoding human ATP-dependent serine protease 48 can be used for the diagnosis of diseases related to human ATP-dependent serine protease 48. The polynucleotide encoding human ATP-dependent serine protease 48 can be used to detect the expression of human ATP-dependent serine protease 48 or the abnormal expression of human ATP-dependent serine protease 48 in a disease state. For example, a DNA sequence encoding human ATP-dependent serine protease 48 can be used to hybridize biopsy specimens to determine the expression of human ATP-dependent serine protease 48. Hybridization techniques include Southern blotting, Nor thern blotting, and in situ hybridization. These techniques and methods are all mature and open technologies, and related kits are commercially available. Some or all of the polynucleotides of the present invention can be used as probes to be fixed on a microarray or a DNA chip (also known as a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues. Human ATP-dependent serine protease 48 specific primers for RNA-polymerase chain reaction (RT-PCR) in vitro amplification can also detect human ATP-dependent serine protease 48 transcripts.

 Detection of mutations in the human ATP-dependent serine protease 48 gene can also be used to diagnose human ATP-dependent serine protease 48-related diseases. Human ATP-dependent serine protease 48 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human ATP-dependent serine protease 48 DNA sequence. Mutations can be detected using existing techniques such as Southern blotting, DNA sequence analysis, PCR, and in situ hybridization. In addition, mutations may affect the expression of proteins. Therefore, Nor thern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.

 The sequences of the invention are also valuable for chromosome identification. The sequence specifically targets a specific position on a human chromosome and can hybridize to it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for marking chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DM sequences on a chromosome.

 In short, PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing the human gene corresponding to the primer will produce amplified fragments.

PCR localization of somatic hybrid cells is a quick way to localize DNA to specific chromosomes. Using the oligonucleotide primers of the present invention, by a similar method, a set of fragments from a specific chromosome can be utilized Or a large number of genomic clones to achieve sublocalization. Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and hybrid pre-selection to construct chromosome-specific cDNA libraries.

 Fluorescent in situ hybridization (FISH) of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

 Once the sequence is located at the exact chromosomal location, the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendel ian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.

 Next, the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution) Capacity and each 20kb corresponds to a gene).

 The polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier. These carriers can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof. The composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients that do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.

 The present invention also provides a kit or kit containing one or more containers containing one or more ingredients of the pharmaceutical composition of the present invention. Along with these containers, there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders permit their administration on the human body by government agencies that manufacture, use, or sell them. In addition, the polypeptide of the present invention can be used in combination with other therapeutic compounds.

 The pharmaceutical composition can be administered in a convenient manner, such as by a topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration. Human ATP-dependent serine protease 48 is administered in an amount effective to treat and / or prevent a specific indication. The amount and range of human ATP-dependent serine protease 48 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Claims

 1. An isolated polypeptide-human ATP-dependent serine protease 48, characterized in that it comprises: a polypeptide having the amino acid sequence shown in SEQ ID NO: 2, or an active fragment, analog, or derivative of a polypeptide thereof .

 2. The polypeptide according to claim 1, characterized in that the amino acid sequence of the polypeptide, analog or derivative has at least 95% identity with the amino acid sequence shown in SEQ ID NO: 2.

 3. The polypeptide according to claim 2, characterized in that it comprises a polypeptide having an amino acid sequence shown in SEQ ID NO: 2.

 4. An isolated polynucleotide, characterized in that said polynucleotide comprises one selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 or a fragment, analog, or derivative thereof;

 (b) a polynucleotide complementary to polynucleotide (a); or

 (c) A polynucleotide that is at least 70% identical to (a) or (b).

 5. The polynucleotide according to claim 4, wherein the polynucleotide comprises a polynucleotide encoding an amino acid sequence represented by SEQ ID NO: 2.

 6. The polynucleotide according to claim 4, characterized in that the sequence of the polynucleotide comprises a sequence of positions 802-2100 in SEQ ID NO: 1 or a sequence of positions 1-2295 in SEQ ID NO: 1. .

 7. A recombinant vector containing an exogenous polynucleotide, characterized in that it is a recombinant constructed from the polynucleotide according to any one of claims 4 to 6 and a plasmid, virus or carrier expression vector Carrier.

 8. A genetically engineered host cell containing an exogenous polynucleotide, characterized in that it is selected from one of the following host cells:

 (a) a host cell transformed or transduced with the recombinant vector of claim 7; or

 (b) a host cell transformed or transduced with a polynucleotide according to any one of claims 4-6.

9. A method for preparing a polypeptide having human ATP-dependent serine protease 48 activity, characterized in that the method comprises:

 (a) culturing the engineered host cell according to claim 8 under conditions that express human ATP-dependent serine proteolytic enzyme 48;

 (b) Isolating a polypeptide having human ATP-dependent serine proteolytic enzyme 48 activity from the culture.

10. An antibody capable of binding to a polypeptide, characterized in that said antibody is an antibody capable of specifically binding to human ATP-dependent serine proteolytic enzyme 48.

11. A class of compounds that mimic or regulate the activity or expression of a polypeptide, characterized in that they are compounds that mimic, promote, antagonize or inhibit the activity of human ATP-dependent serine proteolytic enzyme 48.

 12. The compound according to claim 11, characterized in that it is an antisense sequence of a polynucleotide sequence or a fragment thereof as shown in SEQ ID NO: 1.

 1 3. A use of the compound according to claim 11, characterized in that the compound is used for a method for regulating the activity of human ATP-dependent serine protease 48 in vitro and in vivo.

 14. A method for detecting a disease or susceptibility to a disease associated with a polypeptide according to any one of claims 1-3, characterized in that it comprises detecting the expression level of the polypeptide, or detecting the activity of the polypeptide Or detecting a nucleotide variation in a polynucleotide that causes abnormal expression or activity of the polypeptide.

 15. Use of a polypeptide according to any one of claims 1 to 3, characterized in that it is used for screening mimetics, agonists, antagonists or inhibitors of human ATP-dependent serine proteolytic enzyme 48; or For identification of peptide fingerprints.

 16. The use of a nucleic acid molecule according to any one of claims 4-6, characterized in that it is used as a primer for a nucleic acid amplification reaction, or as a probe for a hybridization reaction, or for manufacturing a gene chip Or microarray.

 17. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that said polypeptide, polynucleotide or mimetic, agonist, antagonist The agent or inhibitor is composed of a safe and effective dose with a pharmaceutically acceptable carrier as a pharmaceutical composition for diagnosing or treating a disease associated with human ATP-dependent serine protease 48 abnormality.

18. Use of a polypeptide, polynucleotide or compound according to any one of claims 1 to 6 and 1 1, characterized in that the polypeptide, polynucleotide or compound is used for preparing a treatment such as a malignant tumor, Hematological diseases, HIV infection and immune diseases and drugs of various inflammations.

vHaiAaaiMAniHwasTicndAasia ^ iN-aacniA ^ DiioAMHvviA ^ oiAOOAcnAio eis: iofqs

Π> VVN1AHai3SVlAdSiaD) iAN0d 103ial3NH) id 11 Λ0) ΙΊ0ν) 1ΗννΐΛ (ϋ (I OOAdlAID ζζί) ^ .ign () ¾11Wa01WViaV> IA) [¾ SmSAlVlA11AOVSdOaS OV + VHNVOVNddHOVdd A + lAOVSdOaN AVOVddH + Hia ++ 11 +

 ¾llIH0IWVAaS¾Aiy0S £ nSV131AIlA0VSd0ailAV0VddHlHiaiNanadS0dVN 6Z: ^ 3n () S £ S1NiaW¾VlAAnVl () VSa¾IAaOli) OnHiaO¾OAWVlVHAd () AaOOAS69

+ i v + ¾ + M ++ vi vsa¾ + Aaoi0on i o + o w + v3Ad +300+ ΙΛ ΊΟ ++ ΛΟ

1763 n0A3) ivMsrasi viHvsamaoiOonnDoaoa svaAdwi aooidMvio 1 VAO SZZ

£ 69 dsvA¾avvg¾aad¾ddoiA) [3iwvaaAiwdSdNeAiNSiaHawdiAaNHAa9oaviisai H9 n rqs d ++ ¾ + a ++ ddoi + +1 a +++ d g ++ a 1 a + a i +

d si¾DSAHw-eAWddoiiGnvHdanidw— edcnviaiiasiSHd¾ ---

 C 9 mil dD I a¾0 ni¾Ai) -3VA) IAVVVIV1 VVlNH31N¾A0VHHA> ia I Al¾AWV3d I Dl ζίζ nofqs

 + 1+ ¾ D eVAiAV n + VI ¾ + 1 + HA0V3MA ¥ 1+ + dI0 + 081 D0HH3IAGS¾ai¾Va¾HD03VA) lAVAV¾3IV0inaiSHA0V3MAHlIiaiIIADdlDl ΪΠ + Zi + H + I +++ 0 + 0 + 0 + 0 + A + Sia

on D dnoH ai0 ((i ΠΗ¾Η v I a 1 ¾Hai) iAOdA011 awwnvvd IIVIIN viv idiAOsia 19 ^^ 0 ddANiAHGMdV) iNDHdaiAenvsvdao¾AasooGiaanwAdNSASA ioaniodw §: ioiqdaoan + Λ + Λ + ¾odw

 09 dVAN1AHaiJNHN0HdaiAanVVVciaOi) 1S) [01) iaAHandAc [NMAOAInOMinOciW ΐ ^ sni)

() Ui / OU = support '(% PS) / Lil = units

Z / l

Z.OSOO / OON3 / X3 <[98t-0Wl0 OAV 2/2

Query: 415 FDGGFTVKTRPGL 427

 F + G +++ R L

 Sbjct: 873 FEGRCPLRSRSKL 885

Query: human ATP-dependent serine protease 48 Sbjct: LONl protease in Zea Mays

 figure 1

figure 2 (1) General information:

(i i) Name of the invention: Human ATP-dependent serine protease 48 and its coding sequence

(i i i) Number of sequences: 9

(2) Information of SEQ ID NO: 1:

 (i) Sequence characteristics:

 (A) Length: 2295bp

 (B) Type: Nucleic acid

 (C) Chain: double strand

 (D) Topological structure: linear

 (Π) Molecular type: cDNA

 (x i) Sequence description: SEQ ID NO: 1:

GTTTTTATTTCATGCCACACTCTACATCTGTCATAATTATGTGGGTGATTCTTGTCCAAA TACAATAAAGCAGGCTCTCACATTTTAACGTTCAACAAAATACCTGGCTGGCTGAACGTG GTTATTGCCAATTAGTGCATATGGGATGAATACAGTTTTGTTCAAAAGGACAGAATAATG CTCTG A AAATAAAAGAG ATTGGAGTTTTTCTTTTTTTGTTGTTGTTTTTGGTCTGCATTC TGAGTGGCTGTTTGAACTGATTTTAATTTCCTTCATGAAGATGATGATGTTTTAGCTGGC CCAGGGGCAGCCATTTCAGTGTGCATAAAGGTGGTTGCGTTGGGTAGGGGGATGCTCAGA A AA ATCATGG AA AGCATGGGA ATTCATAGGGTACTTTGG ACATTTTGGA ATCTTGA AG AG TAAGAACCGTAACTGGTGACTTAAGTGTCGTGTTTCTTCATTTCACCAAATGGCAAAATG TG ATACAGTTCTTCCA ATATCATGGGCA ACTTGTAGCCAGA ATTAAGTAG AAGATA AG AT

GAATGGCGTCGCTCCTGCCTCCTGACATCTCACACTGTGAATGTGCTACTTGCTTTCTCT AGGCGCACCTATGTTGGCAGCATGCCTGGTCGCATCATCAACGGCTTGA AGACTGTGGGA 2

 901 GATCCAGCAGCAGCTCTGCTTGAGGTGTTGGATCCTGAACAAAACCATAACTTCACAGAT 961 CATTATCTAAATGTGGCCTTTGACCTTTCTCAAGTTCTTTTTATAGCTACTGCCAACACC 1021 ACTGCTACCATTCCAGCTGCCTTGTTGGACAGAATGGAGATCATTCAGGTTCCAGGTTAT 1081 ACACAGGAGGAGAAGATAGAGATTGCCCATAGGCACTTGATCCCCAAGCAGCTGGAACAA 1141 CATGGGCTGACTCCACAGCAGATTCAGATACCCCAGGTCACCACTCTTGACATCATCACC 1201 AGGTATACCAGAGAGGCAGGGGTTCGTTCTCTGGATAGAAAACTTGGGGCCATTTGCCGA 1261 GCTGTGGCCGTGAAGGTGGCAGAAGGACAGCATAAGGAAGCCAAGTTGGACCGTTCTGAT 1321 GTGACTGAGAGAGAAGGTTGCAGAGAACACATCTTAGAAGATGAAAAACCTGAATCTATC 1381 AGTGACACTACTGACTTGGCTCTACCACCTGAAATGCCGATTTTGATTGATTTCCATGCT 1441 CTGAAAGACATCCTTGGGCCCCCGATGTATGAAATGGAGGTATCTCAGCGTTTGAGTCAG 1501 CCAGGAGTAGCAATAGGTTTGGCTTGG ACTCCCTTAGGTGGAG AAATCATGTTCGTGGAG 1561 GCGAGTCGAATGGATGGCGAGGGCCAGTTAACTCTGACCGGCCAGCTCGGGGACGTGATG 1621 AAGGAGTCCGCCCACCTCGCTATCAGCTGGCTCCGCAGCAACGCAAAGAAGTACCAGCTG 1681 ACCAATGCTTTTGGAAGTTTTGATCTTCTTGACA ACACAGACATCCATCTGCACTTCCCA 1741 GCTGGAGCTGTCACAAAAGATGGACCATCTGCTGGAGTTACCATAGTAACCTGTCTCGCC 1801 TCAC TTTTTAGTGGGCGGCTGGTACGTTCAGATGTAGCCATGACTGGAGAAATTACACTG 1861 AGAGGTCTTGTTCTTCCAGTGGGTGGAATTAAAGACAAAGTGCTGGCGGCACACAGAGCG 1921 GGACTGAAGCAAGTCATTATTCCTCGGAGAAAATGAACAGTTTTGAGAGATCCCGCAGAGCTCTAGAGAC

2221 ACAGTA ATAA ACCTCA AGTAGTGGCTAGTGTTTAGTAT AGA AATATA AG ATGTTGATTTA 2281 GTAAACTGATAAAAA

(3) Information of SEQ ID NO: 2:

 (i) Sequence characteristics:

 (A) Length: 432 amino acids

 (B) Type: Amino acid

(D) Topological structure: linear (ii) Molecular type: peptide

 (xi) Sequence description: SEQ ID NO: 2:

 Met Pro Gly Arg He lie Asn Gly Leu Lys Thr Val Gly Val Asn

Asn Pro Val Phe Leu Leu Asp Glu Val Asp Lys Leu Gly Lys Ser

Leu Gin Gly Asp Pro Ala Ala Ala Leu Leu Glu Val Leu Asp Pro

Glu Gin Asn His Asn Phe Thr Asp His Tyr Leu Asn Val Ala Phe

Asp Leu Ser Gin Val Leu Phe lie Ala Thr Ala Asn Thr Thr Ala

Thr lie Pro Ala Ala Leu Leu Asp Arg Met Glu lie lie Gin Val

Pro Gly Tyr Thr Gin Glu Glu Lys lie Glu lie Ala His Arg His

Leu lie Pro Lys Gin Leu Glu Gin His Gly Leu Thr Pro Gin Gin lie Gin lie Pro Gin Val Thr Thr Leu Asp lie He Thr Arg Tyr

Thr Arg Glu Ala Gly Val Arg Ser Leu Asp Arg Lys Leu Gly Ala lie Cys Arg Ala Val Ala Val Lys Val Ala Glu Gly Gin His Lys

Glu Ala Lys Leu Asp Arg Ser Asp Val Thr Glu Arg Glu Gly Cys

Arg Glu His lie Leu Glu Asp Glu Lys Pro Glu Ser lie Ser Asp

Thr Thr Asp Leu Ala Leu Pro Pro Glu Met Pro lie Leu lie Asp

Phe His Ala Leu Lys Asp lie Leu Gly Pro Pro Met Tyr Glu Met

Glu Val Ser Gin Arg Leu Ser Gin Pro Gly Val Ala lie Gly Leu

Ala Trp Thr Pro Leu Gly Gly Glu lie Met Phe Val Glu Ala Ser

Arg Met Asp Gly Glu Gly Gin Leu Thr Leu Thr Gly Gin Leu Gly

Asp Val Met Lys Glu Ser Ala His Leu Ala lie Ser Trp Leu Arg

Ser Asn Ala Lys Lys Tyr Gin Leu Thr Asn Ala Phe Gly Ser Phe

Asp Leu Leu Asp Asn Thr Asp lie His Leu His Phe Pro Ala Gly

Ala Val Thr Lys Asp Gly Pro Ser Ala Gly Val Thr lie Val Thr

Cys Leu Ala Ser Leu Phe Ser Gly Arg Leu Val Arg Ser Asp Val

Ala Met Thr Gly Glu lie Thr Leu Arg Gly Leu Val Leu Pro Val

Gly Gly lie Lys Asp Lys Val Leu Ala Ala His Arg Ala Gly Leu

Lys Gin Val lie lie Pro Arg Arg Asn Glu Lys Asp Leu Glu Gly lie Pro Gly Asn Val Arg Gin Asp Leu Ser Phe Val Thr Ala Ser Cys Leu Asp Glu Val Leu Asn Ala Ala Phe Asp Gly Gly Phe Thr 421 Val Lys Thr Arg Pro Gly Leu Leu Asn Ser Lys Leu

(4) Information of SEQ ID NO: 3

 (i) Sequence characteristics

 (A) Length: 25 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 3:

 GTTTTTATTTCATGCCACACTCTAC

(5) Information of SEQ ID NO: 4

 (i) Sequence characteristics

 (A) Length: 24 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 () Molecular type: Oligonucleotide

 (x i) Sequence description: SEQ ID NO: 4:

 TTTTTATCAGTTTACTAAATCAAC

(6) Information of SEQ ID NO: 5

 (i) Sequence characteristics

 (A) Length: 32 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

(Π) Molecular type: Oligonucleotide (xi) Sequence description: SEQ ID NO: 5:

 CAGCCATGGCGGGGAAGAAGAATGTTCTGTCG

(7) Information of SEQ ID NO: 6

 (i) Sequence characteristics

 (A) Length: 29 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (i i) Molecular type: Oligonucleotide

 (xi) Sequence description: SEQ ID NO: 6:

 CCCGGATCCCGCTGCTTGGCCTTCTTCAC

(8) Information of SEQ ID NO: 7:

 (i) Sequence characteristics:

 (A) Length: 15 amino acids

 (B) Type: Amino acid

 (W topology: linear

 (i i) molecular type: peptide

 (xi) Sequence description: SEQ ID NO: 7:

 Met-Ala-Gl -Lys-Lys-Asn-Val-Leu-Ser-Ser-Leu-Ala-Val-Tyr-Ala

(9) Information of SEQ ID NO: 8

 (i) Sequence characteristics

 (A) Length: 41 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (i i) Molecular type: Oligonucleotide

(x U sequence description: SEQ ID NO: 8: 6

 CCCGGATCCCGCTGCTTGGCCTTCTTCAC 41

(10) Information of SEQ ID NO: 9

 (i) Sequence characteristics

 (A) Length: 41 bases

 (B) Type: Nucleic acid

 (C) Chain: single chain

 (D) Topological structure: linear

 (Π) Molecular type: Oligonucleotide

 (x i) Sequence description: SEQ ID NO: 9

CCCGGATCCCGCTGCTTGGCCTTCTTCAC 41