WO2001040251A1 - Facteur alpha hiii de transformation cellulaire - Google Patents

Facteur alpha hiii de transformation cellulaire Download PDF

Info

Publication number
WO2001040251A1
WO2001040251A1 PCT/US2000/032745 US0032745W WO0140251A1 WO 2001040251 A1 WO2001040251 A1 WO 2001040251A1 US 0032745 W US0032745 W US 0032745W WO 0140251 A1 WO0140251 A1 WO 0140251A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
replaced
seq
sequence
antibody
Prior art date
Application number
PCT/US2000/032745
Other languages
English (en)
Inventor
Ying-Fei Wei
Original Assignee
Human Genome Sciences, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences, Inc. filed Critical Human Genome Sciences, Inc.
Priority to CA002390839A priority Critical patent/CA2390839A1/fr
Priority to JP2001541006A priority patent/JP2003515326A/ja
Priority to AU20568/01A priority patent/AU2056801A/en
Priority to EP00983862A priority patent/EP1244686A4/fr
Publication of WO2001040251A1 publication Critical patent/WO2001040251A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/495—Transforming growth factor [TGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy

Definitions

  • the present invention relates to a novel human gene encoding a polypeptide which is a member of the Transforming Growth Factor family. More specifically, the present invention relates to a polynucleotide encoding a novel human polypeptide named Transforming Growth Factor Alpha HI, or "TGF alpha HILL"
  • TGF alpha HILL Transforming Growth Factor Alpha HI
  • This invention also relates to TGF alpha HHi polypeptides, as well as vectors, host cells, antibodies directed to TGF alpha HHI polypeptides, and the recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to TGF alpha HHI, and therapeutic methods for treating such disorders.
  • the invention further relates to screening methods for identifying agonists and antagonists of TGF alpha HHI activity.
  • Cellular growth and differentiation appear to be initiated, promoted, maintained and regulated by a multiplicity of stimulatory, inhibitory and synergistic factors and hormones.
  • the alteration and/or breakdown of the cellular homeostasis mechanism seems to be a fundamental cause of growth related diseases, including neoplasia.
  • Growth modular factors are implicated in a wide variety of pathological and physiological processes including signal transduction, cell communication, growth and development, embryogenesis, immune response, hematopoiesis cell survival and differentiation, inflammation, tissue repair and remodeling, atherosclerosis and cancer.
  • Epidermal growth factor (EGF), transforming growth factor alpha (TGFa,) betacellulin, amphiregulin, and vaccinia growth factor among other factors are growth and differentiation modulatory proteins produced by a variety of cell types either under normal physiological conditions or in response to exogenous stimuli and are members of the EGF family.
  • peptide growth factors influence wound cells through autocrine and paracrine mechanisms. They also play important roles in normal wound healing in tissues such as skin, cornea and gastrointestinal tract and all share substantial amino acid sequence homology including the conserved placement of three intra-chain disulfide bonds. In addition, all the factors of this family bind to a 170,000 molecular weight transmembrane glycoprotein receptor and activate the tyrosine kinase activity in the receptor's cytoplasmic domain (Buhrow, S.A. et al., J. Bio. Chem.. 258:7824-7826 (1983)).
  • the receptors are expressed by many types of cells including skin keratinocytes, fibroblasts, vascular endothelial cells, and epithelial cells of the GI tract. These peptide growth factors are synthesized by several cells involved in wound healing including platelets, keratinocytes, and activated macrophages. These growth factors have also been implicated in both the stimulation of growth and differentiation of certain cells, for example, neoplasia, and the inhibition of other types of cells. Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. The carboxyl-terminal domain of betacellulin has 50% sequence similarity with that of rat transforming growth factor a.
  • Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.
  • Amphiregulin is a bifunctional cell growth regulatory factor which exhibits potent inhibitory activity on DNA synthesis in neoplastic cells, yet promotes the growth of certain normal cells.
  • a wide variety of uses for amphiregulin have been assigned including the treatment of wounds and cancers. For example, amphiregulin has potent anti-proliferative effects in vitro on several human cancer cell lines of epithelial origin. Amphiregulin also induces the proliferation of human foreskin fibroblasts as shown in United States Patent Application No. 5,115,096.
  • TGF alpha has pleiotropic biological effects.
  • the production of certain members of TGF alpha is synthesized by a number of oncogenically transformed fibroblasts (Ciardiello et al., J. Cell Biochem., 42:45-57 (1990)) , as well as by a variety of tumors, including renal, breast and squamous carcinomas, melanomas and glioblastomas (Derynck, R. et al., Cancer Res., 47:707-712 (1987)).
  • TGF alpha expression can be a contributing factor in the conversion of a normal cell to its tumorigenic counterpart by analyzing transgenic mice in which tumor cells express high levels of TGF alpha.
  • TGF alpha transgenic animals display a variety of neoplastic lesions, depending on the strain of mouse and the choice of promotor regulating TGF alpha expression (Sandgren, et al., Cell, 61 :1121-1135 (1990)). TGF alpha also plays a role in normal embryonic development and adult physiology (Derynck, R. Adv. Cancer Res., 58:27-5 (1992)). TGF alpha has been expressed in many tissues including skin, brain, gastrointestinal mucosa and activating macrophages. Accordingly, TGF alpha is an important factor in controlling growth of epithelial cells and has a role in wound healing. TGF alpha has also been found to be angiogenic (Schreiber, et al., Science, 232:1250-1253 (1986)).
  • the present invention relates to novel polynucleotides and the encoded polypeptides of TGF alpha HHI. Moreover, the present invention relates to vectors, host cells, antibodies, and recombinant and synthetic methods for producing the polypeptides and polynucleotides. Also provided are diagnostic methods for detecting disorders and conditions related to the polypeptides and polynucleotides, and therapeutic methods for treating such disorders and conditions. The invention further relates to screening methods for identifying binding partners of TGF alpha HHI.
  • polypeptide of the present invention has been putatively identified as transforming growth factor TGF alphaHHI. This identification has been made as a result of amino acid sequence homology to human TGFa.
  • novel mature polypeptides as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • the polypeptides of the present invention are of human origin.
  • nucleic acid molecules encoding the polypeptides of the present invention, including mRNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.
  • isolated nucleic acid molecule encoding a mature polypeptide expressed by the human cDNA contained in ATCC Deposit No. 97342.
  • processes for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention.
  • polypeptides or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to stimulate wound healing to restore normal neurological functioning after trauma or AIDS dementia, to treat ocular disorders, to target certain cells, to treat kidney and liver disorders and, to promote hair follicular development, to stimulate angiogenesis for the treatment of burns, ulcers and corneal incisions and to stimulate embryogenesis.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences of the present invention.
  • antibodies against such polypeptides there are provided antibodies against such polypeptides.
  • agonists to the polypeptide of the present invention there are provided.
  • antagonists to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of corneal inflammation, neoplasia, for example, tumors and cancers and for psoriasis.
  • diagnostic assays for detecting diseases related to overexpression of the polypeptide of the present invention and mutations in the nucleic acid sequences encoding such polypeptide are provided.
  • Figure 1 depicts the cDNA sequence (SEQ ID NO:l) and corresponding deduced amino acid sequence (SEQ ID NO:2) of TGF alpha HHI.
  • the standard one letter abbreviations for amino acids are used.
  • the putative signal sequence has been underlined.
  • FIG. 2 is an illustration of comparative amino acid sequence homology between TGF alpha HHI (top line) and human TGF alpha -HI (bottom line; SEQ ID NO:3). Darkened amino acids denote the conserved EGF motif domain which is shown to be conserved in the polypeptide of the present invention. By examining the regions of amino acids shaded and/or boxed, the skilled artisan can readily identify conserved domains between the two polypeptides. These conserved domains are preferred embodiments of the present invention.
  • Figure 3 shows an analysis of the TGF alpha HIH amino acid sequence.
  • Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings.
  • the positive peaks indicate locations of the highly antigenic regions of the TGF alpha HIH protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
  • the domains defined by these graphs are contemplated by the present invention.
  • the data presented in Figure 3 are also represented in tabular form in Table I.
  • Figure 4 shows TGF alpha HHI stimulatory activity in AoSMC alamar blue proliferation assay. Lanes 1 and 2 are negative controls and lane 4 is PDGF-BB, a positive protein control.
  • isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
  • an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
  • isolated does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
  • a "secreted" TGF alpha HHI protein refers to a protein capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as a TGF alpha HHI protein released into the extracellular space without necessarily containing a signal sequence. If the TGF alpha HHI secreted protein is released into the extracellular space, the TGF alpha HIH secreted protein can undergo extracellular processing to produce a "mature" TGF alpha HIH protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.
  • a TGF alpha HHI "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ ID NO:l or the cDNA contained within the clone deposited with the ATCC.
  • the TGF alpha HHI polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.
  • a TGF alpha HIH "polypeptide” refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
  • the polynucleotides of the invention are at least 15, at least 30, at least 50, at least 100, at least 125, at least 500, or at least 1000 continuous nucleotides but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, 7.5kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length.
  • polynucleotides of the invention comprise a portion of the coding sequences, as disclosed herein, but do not comprise all or a portion of any intron.
  • the polynucleotides comprising coding sequences do not contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the TGF alpha HO gene of interest in the genome). In other embodiments, the polynucleotides of the invention do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
  • the full length TGF alpha HIH sequence identified as SEQ ID NO: 1 was generated by overlapping sequences of the deposited clone (contig analysis).
  • a representative clone containing all or most of the sequence for SEQ ID NO: 1 was deposited with the American Type Culture Collection ("ATCC") on November 20, 1995, and was given the ATCC Deposit Number 97342.
  • the ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA.
  • the ATCC deposit was made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for purposes of patent procedure.
  • a TGF alpha HHI "polynucleotide” also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ JD NO:l, the complement thereof, or the cDNA within the deposited clone.
  • “Stringent hybridization conditions” refers to an overnight incubation at 42 degree C in a solution comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65 degree C.
  • nucleic acid molecules that hybridize to the TGF alpha HIH polynucleotides lower stringency hybridization conditions Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
  • blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • a polynucleotide which hybridizes only to polyA+ sequences such as any
  • polynucleotide 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using digo dT as a primer).
  • the TGF alpha HHI polynucleotide can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • TGF alpha HIH polynucleotides can be composed of single- and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • TGF alpha HHI polynucleotides can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • TGF alpha HIH polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
  • TGF alpha HIH polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids.
  • the TGF alpha HIH polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in the TGF alpha HHI polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • TGF alpha HIH polypeptides may be branched , for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic TGF alpha HIII polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidyhnositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • SEQ ID NO:l refers to a TGF alpha HIH polynucleotide sequence while "SEQ JD
  • NO:2 refers to a TGF alpha HIH polypeptide sequence.
  • a TGF alpha HHI polypeptide "having biological activity” refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of a TGF alpha HIH polypeptide, including mature forms, as measured in a particular biological assay, with or without dose dependency.
  • the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity, and most preferably, not more than about three-fold less activity relative to the TGF alpha HIH polypeptide.
  • nucleic acid which encodes for the mature polypeptide having the deduced amino acid sequence of Figure 1 (SEQ JD NO: 2).
  • the polynucleotide of this invention was discovered in a human testes cDNA library. It is structurally related to the TGF alpha gene family. It contains an open reading frame encoding a polypeptide of 229 amino acids, which exhibits significant homology to a number of members of the TGF alpha gene family; these members include TGF alpha itself as well as other members such as amphiregulin and cripto. Furthermore, the six cysteine residues occurring in all members in a characteristic motif are conserved in TGF alpha HIH.
  • amino acid 1 through amino acid 25 of Figure 1 (SEQ ID NO:2) has a putative signal sequence which comprises amino acid 1 through amino acid 25 of Figure 1 (SEQ ID NO:2) which aids in secretion of the polypeptide from the cell.
  • Amino acid 126 through amino acid 177 of SEQ ID NO:2 represent the active site of the protein of the present invention.
  • amino acid 178 through amino acid 204 represents a putative transmembrane portion which is thought to be necessary to direct the polypeptide to particular target locations for the carrying out of biological functions as hereinafter described.
  • the transmembrane portion may also be cleaved from the polypeptide such that the putative soluble portion of the polypeptide of the present invention comprises amiino acid 1 through amino acid 177 of SEQ ID NO:2.
  • the protein exhibits the highest degree of homology to TGF alpha.
  • isolated polynucleotides encoding a mature polypeptide expressed by the DNA contained in ATCC Deposit No. 97342, deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Maryland 20852, USA, on November 20, 1995.
  • the deposited material is a bluescript plasmid (Stratagene, La Jolla, CA) that contains the full-length TGF alpha HHI cDNA.
  • the deposit has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for purposes of Patent Procedure. The strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent.
  • the polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID NO:l) or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of Figure 1 (SEQ ID NO: 1).
  • the polynucleotide which encodes for the mature polypeptide of Figure 1 may include, but is not limited to: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 51 and/or 31 of the coding sequence for the mature polypeptide.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figure 1 (SEQ ID NO:2).
  • the variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.
  • the present invention includes polynucleotides encoding the same mature polypeptide as shown in Figure 1 (SEQ ID NO:2) as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of Figure 1
  • nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figure 1 (SEQ ID NO:l).
  • allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell.
  • the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
  • the polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues.
  • a mature protein having a prosequence is a proprotein and is an inactive form of the protein.
  • the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention.
  • the marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I, et al., Cell, 37:767 (1984)).
  • gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
  • TGF alpha HIH nucleotide sequence identified as SEQ JD NO:l was assembled from partially homologous ("overlapping") sequences obtained from the deposited clone. The overlapping sequences were assembled into a single contiguous sequence of high redundancy resulting in a final sequence identified as SEQ ID NO: 1.
  • SEQ ID NO:l and the translated SEQ ID NO:2 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below.
  • SEQ ID NO:l is useful for designing nucleic acid hybridization probes that will detect nucleic acid sequences contained in SEQ JD NO:l or the cDNA contained in the deposited clone. These probes will also hybridize to nucleic acid molecules in biological samples, thereby enabling a variety of forensic and diagnostic methods of the invention.
  • polypeptides identified from SEQ ID NO:2 may be used, for example, to generate antibodies which bind specifically to proteins TGF alpha HIH.
  • DNA sequences generated by sequencing reactions can contain sequencing errors.
  • the errors exist as misidentified nucleotides, or as insertions or deletions of nucleotides in the generated DNA sequence.
  • the erroneously inserted or deleted nucleotides cause frame shifts in the reading frames of the predicted amino acid sequence.
  • the predicted amino acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than 99.9% identical to the actual DNA sequence (for example, one base insertion or deletion in an open reading frame of over 1000 bases).
  • the present invention provides not only the generated nucleotide sequence identified as SEQ ID NO:l and the predicted translated amino acid sequence identified as SEQ JD NO:2, but also a sample of plasmid DNA containing a human cDNA of TGF alpha HHI deposited with the ATCC.
  • the nucleotide sequence of the deposited TGF alpha HHI clone can readily be determined by sequencing the deposited clone in accordance with known methods. The predicted TGF alpha HIH amino acid sequence can then be verified from such deposits.
  • amino acid sequence of the protein encoded by the deposited clone can also be directly determined by peptide sequencing or by expressing the protein in a suitable host cell containing the deposited human TGF alpha HIH cDNA, collecting the protein, and determining its sequence.
  • the present invention also relates to the TGF alpha HIH gene corresponding to SEQ ID NO:l, SEQ JD NO:2, or the deposited clone.
  • the TGF alpha HHI gene can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include preparing probes or primers from the disclosed sequence and identifying or amplifying the TGF alpha HIH gene from appropriate sources of genomic material.
  • allelic variants, orthologs, and/or species homologs are also provided in the present invention. Procedures known in the art can be used to obtain full-length genes, allelic variants, splice variants, full-length coding portions, orthologs, and/or species homologs of genes corresponding to SEQ ID NO:l, SEQ JD NO:2, or a the deposited clone, using information from the sequences disclosed herein or the clones deposited with the ATCC. For example, allelic variants and/or species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for allelic variants and/or the desired homologue.
  • TGF alpha HHI polypeptides can be prepared in any suitable manner.
  • Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
  • the TGF alpha HHI polypeptides may be in the form of the secreted protein, including the mature form, or may be a part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification, such as multiple histidine residues, or an additional sequence for stability during recombinant production.
  • TGF alpha HHI polypeptides are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of a TGF alpha HIH polypeptide, including the secreted polypeptide can be substantially purified using techniques described herein or otherwise known in the art, such as, for example, by the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
  • TGF alpha HHI polypeptides also can be purified from natural, synthetic or recombinant sources using techniques described herein or otherwise known in the art, such as, for example, antibodies of the invention raised against the TGF alpha HHI protein.
  • the present invention provides a polynucleotide comprising, or alternatively consisting of, the nucleic acid sequence of SEQ ID NO:l, and/or a cDNA contained in ATCC deposit 97342.
  • the present invention also provides a polypeptide comprising, or alternatively, consisting of, the polypeptide sequence of SEQ JD NO:2 and/or a polypeptide encoded by the cDNA contained in ATCC deposit 97342.
  • Polynucleotides encoding a polypeptide comprising, or alternatively consisting of the polypeptide sequence of SEQ ID NO:2 and/or a polypeptide sequence encoded by the cDNA contained in ATCC deposit 97342 are also encompassed by the invention.
  • the present invention also encompasses mature forms of the polypeptide having the polypeptide sequence of SEQ ID NO:2 and/or the polypeptide sequence encoded by the cDNA in a deposited clone.
  • Polynucleotides encoding the mature forms are also encompassed by the invention.
  • proteins secreted by mammalian cells have a signal or secretary leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein. Further, it has long been known that cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
  • the deduced amino acid sequence of the secreted polypeptide was analyzed by a computer program called SignalP (Henrik Nielsen et al., Protein Engineering 10:1-6 (1997)), which predicts the cellular location of a protein based on the amino acid sequence.
  • SignalP Harik Nielsen et al., Protein Engineering 10:1-6 (1997)
  • the present invention provides secreted polypeptides having a sequence shown in SEQ ID NO:2 which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • SEQ ID NO:2 which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • cleavage of the signal sequence from a secreted protein is not entirely uniform, resulting in more than one secreted species.
  • These polypeptides, and the polynucleotides encoding such polypeptides are contemplated by the present invention.
  • the signal sequence identified by the above analysis may not necessarily predict the naturally occurring signal sequence.
  • the naturally occurring signal sequence may be further upstream from the predicted signal sequence.
  • the predicted signal sequence will be capable of directing the secreted protein to the ER.
  • the present invention provides the mature protein produced by expression of the polynucleotide sequence of SEQ ID NO: 1 and/or the polynucleotide sequence contained in the cDNA of a deposited clone, in a mammalian cell (e.g., COS cells, as desribed below).
  • a mammalian cell e.g., COS cells, as desribed below.
  • the present invention is directed to variants of the polynucleotide sequence disclosed in SEQ JD NO:l, the complementary strand thereto, and/or the cDNA sequence contained in a deposited clone.
  • the present invention also encompasses variants of the polypeptide sequence disclosed in SEQ JD NO:2 and/or encoded by a deposited clone.
  • Variant refers to a polynucleotide or polypeptide differing from the TGF alpha HHI polynucleotide or polypeptide, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the TGF alpha HHI polynucleotide or polypeptide.
  • the present invention is also directed to nucleic acid molecules which comprise, or alternatively consist of, a nucleotide sequence which is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%o, 98% or 99% identical to, for example, the nucleotide coding sequence in SEQ ID NO:l or the complementary strand thereto, the nucleotide coding sequence contained in a deposited cDNA clone or the complementary strand thereto, a nucleotide sequence encoding the polypeptide of SEQ ID NO:2, a nucleotide sequence encoding the polypeptide encoded by the cDNA contained in a deposited clone, and/or polynucleotide fragments of any of these nucleic acid molecules (e.g., those fragments described herein).
  • a nucleotide sequence which is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%o, 98% or 99% identical to, for example, the nu
  • Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.
  • the present invention is also directed to polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%,
  • polypeptide sequence shown in SEQ ID NO:2 the polypeptide sequence encoded by the cDNA contained in a deposited clone, and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).
  • nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the TGF alpha HIH polypeptide.
  • nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • the query sequence may be an entire sequence shown of SEQ ID NO:l, the ORF (open reading frame), or any fragment specified as described herein.
  • nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.)
  • a sequence alignment the query and subject sequences are both DNA sequences.
  • An RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the amino acid sequence of the subject polypeptide may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences of SEQ JD NO:2 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs.
  • a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C- terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.
  • a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
  • the deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence.
  • deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • the TGF alpha HIH variants may contain alterations in the coding regions, non- coding regions, or both.
  • polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide.
  • Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred.
  • variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred.
  • TGF alpha HIH polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. coli).
  • Naturally occurring TGF alpha HIH variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes H, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention.
  • non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
  • variants may be generated to improve or alter the characteristics of the TGF alpha HIH polypeptides. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the secreted protein without substantial loss of biological function.
  • the authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993) reported variant KGF proteins having heparin binding activity even after deleting 3, 8, or 27 amino-terminal amino acid residues.
  • Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et al., J. Biotechnology 7:199-216 (1988).)
  • the invention further includes TGF alpha HIH polypeptide variants which show substantial biological activity.
  • Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%,
  • nucleic acid sequences disclosed herein e.g., encoding a polypeptide having the amino acid sequence of an N and/or C terminal deletion disclosed below as m-n of SEQ ID NO:2
  • m-n of SEQ ID NO:2 e.g., a polypeptide having the amino acid sequence of an N and/or C terminal deletion disclosed below as m-n of SEQ ID NO:2
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having TGF alpha HIH functional activity include, inter alia, (1) isolating a TGF alpha HIH gene or allelic or splice variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the TGF alpha HIH gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting TGF alpha HIH mRNA expression in specific tissues.
  • a polypeptide having TGF alpha HHI functional activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to a functional activity of the TGF alpha HIH polypeptides of the present invention (e.g., complete (full-length) TGF alpha HHI, mature TGF alpha H ⁇ i and soluble TGF alpha HHI (e.g., having sequences contained in the extracellular domain of TGF alpha HHI) as measured, for example, in a particular immunoassay or biological assay.
  • a TGF alpha HIII functional activity can routinely be measured by determining the ability of a TGF alpha Hi ⁇ polypeptide to bind a TGF alpha HHI ligand.
  • TGF alpha HHI functional activity may also be measured by determining the ability of a polypeptide, such as cognate ligand which is free or expressed on a cell surface, to induce cells expressing the polypeptide.
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA, the nucleic acid sequence shown in Figure 1 (SEQ ID NO:l), or fragments thereof, will encode polypeptides "having TGF alpha HIH functional activity.”
  • degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • the second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.
  • tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Tip, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
  • site directed changes at the amino acid level of TGF alpha HIH can be made by replacing a particular amino acid with a conservative amino acid.
  • Preferred conservative mutations include: Ml replaced with A, G, I, L, S, T, or V; A2 replaced with G, I, L, S, T, M, or V; H4 replaced with K, or R; G5 replaced with A, I, L, S, T, M, or V; G7 replaced with A, I, L, S, T, M, or V; S8 replaced with A, G, I, L, T, M, or V; L9 replaced with A, G, LS, T, M, or V; T10 replaced with A, G, I, L, S, M, or V; TI 1 replaced with A, G, I, L, S, M, or V; L12 replaced with A, G, I, S, T, M, or V; VI 3 replaced with A, G, I, L, S, T, or M; W15 replaced with F, or Y; A16 replaced
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have an increased and/or a decreased TGF alpha HIH activity or function, while the remaining TGF alpha HIH activities or functions are maintained. More preferably, the resulting constructs have more than one increased and/or decreased TGF alpha HIH activity or function, while the remaining TGF alpha HHI activities or functions are maintained.
  • variants of TGF alpha HIH include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
  • Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein.
  • TGF alpha HHI polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity.
  • TGF alpha HHI preferred non-conservative substitutions of TGF alpha HHI include: Ml replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A2 replaced with D, E, H, K, R, N,Q, F, W, Y, P, or C; P3 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; H4 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,W, Y, P, or C; G5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P6 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G7replaced with D, E, H, K
  • V96 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • 197 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • 198 replaced with D, E, H,K, R, N, Q, F, W, Y, P, or C
  • D99 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
  • LI 00 replaced with D, E, H, K, R, N, Q, F, W,Y, P, or C
  • Q101 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C
  • A102 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • N103 replacementd with D, E, E, H,
  • E, H, K, R, N, Q, F, W, Y, P, or C replaced with D, E, H, K, R, A, G, I, L, S, T,M, V, N, Q, F, W, Y, or P; N157 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; N158 replaced with D, E, H, K, R, A, G, I, L, S,T, M, V, F, W, Y, P, or C; T159 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G160 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Dl 61 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D
  • LI 78 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • LI 79 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • Ql 80 replaced with D, E, H, K, R, A, G,I, L, S, T,
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have an increased and/or decreased TGF alpha HHI activity or function, while the remaining TGF alpha HIH activities or functions are maintained.
  • the resulting constructs have more than one increased and/or decreased TGF alpha HIH activity or function, while the remaining TGF alpha HHI activities or functions are maintained.
  • more than one amino acid e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10 can be replaced with the substituted amino acids as described above (either conservative or nonconservative).
  • a further embodiment of the invention relates to a polypeptide which comprises the amino acid sequence of a TGF alpha HHI polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions.
  • a polypeptide in order of ever-increasing preference, it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a TGF alpha HHI polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions.
  • the number of additions, substitutions, and/or deletions in the amino acid sequence of Figure 1 or fragments thereof is 1-5, 5-10, 5-25, 5- 50, 10-50 or 50-150, conservative amino acid substitutions are preferable.
  • polynucleotide fragment refers to a short polynucleotide having a nucleic acid sequence which: is a portion of that contained in a deposited clone, or encoding the polypeptide encoded by the cDNA in a deposited clone; is a portion of that shown in SEQ JD NO:l or the complementary strand thereto, or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2.
  • the nucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length.
  • a fragment "at least 20 nt in length,” for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ ID NO:l.
  • “about” includes the particularly recited value, a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini.
  • These nucleotide fragments have uses that include, but are not limited to, as diagnostic probes and primers as discussed herein. Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred
  • polynucleotide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, a sequence from about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351- 400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800-850, 851-900, 901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 1201-1250, 1251-1300, 1301-1350, 1351-1400, 1401-1450, 1451-1500, 1501-1550, 1551-1600, 1601-1650, 1651- 1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, or 2001 to the end of SEQ ID NO:l, or the complementary strand thereto, or the c
  • polypeptide fragments refers to an amino acid sequence which is a portion of that contained in SEQ ID NO:2 or encoded by the cDNA contained in the deposited clone. Protein (polypeptide) fragments may be "free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
  • polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-20, 21- 40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, or 161 to the end of the coding region.
  • polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids in length.
  • “about” includes the particularly recited ranges or values, and ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • TGF alpha HIH mutein with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activities.
  • peptides composed of as few as six TGF alpha HHI amino acid residues may often evoke an immune response.
  • Preferred polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids,
  • polypeptide fragments include the secreted TGF alpha HIH protein as well as the mature form.
  • Further preferred polypeptide fragments include the secreted TGF alpha HHI protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both.
  • any number of amino acids ranging from 1-60, can be deleted from the amino terminus of either the secreted TGF alpha HHI polypeptide or the mature form.
  • any number of amino acids, ranging from 1-30 can be deleted from the carboxy terminus of the secreted TGF alpha HIH protein or mature form.
  • any combination of the above amino and carboxy terminus deletions are preferred.
  • polynucleotides encoding these polypeptide fragments are also preferred.
  • N-terminal deletions of the TGF alpha HIH polypeptide can be described by the general formula m-229, where m is an integer from 2 to 223, where m corresponds to the position of the amino acid residue identified in SEQ DD NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: A-2 to S-229; P-3 to S-229; H-4 to S- 229; G-5 to S-229; P-6 to S-229; G-7 to S-229; S-8 to S-229; L-9 to S-229; T-10 to S-229; T- 11 to S-229; L-12 to S-229; V-13to S-229; P-14 to S-229; W-15 to S-229; A-16 to S-229; A- 17 to S-229; A-18 to S-229; L-19 to S-229; L-20 to S-229; L-21 to S-229; A-22 to S-229; L- 23 toS-229; G-24 to S-229; V-25 to S-229; E-26 to S-229; R-27 to S-229; A-28 to S-229; L- 29 to S-229; A-30 to S-229; L-31 to
  • the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the TGF alpha H ⁇ i polypeptide shown in Figure 1 (SEQ ID NO:2), as described by the general formula 1-n, where n is an integer from 6 to 229, where n corresponds to the position of amino acid residue identified in SEQ ID NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: E-26 to T-228; E-26 to K-227; E-26 to A-226; E-26 to K-225; E-26 to R-224; E-26 to R-223; E-26 to Q-222; E-26 to T-221; E-26 to A-220; E-26 to W- 219; E-26 to L-218; E-26 to L-217; E-26 to 1-216; E-26 to S-215; E-26 to V-214; E-26 to S- 213; E-26 to L-212; E-26 to T-211; E-26 to T-210; E-26 toA-209; E-26 to G-208; E-26 to L- 207; E-26 to 1-206; E-26 to G-205; E-26 to F-204; E-26 to F-203; E-26 to M
  • a signal sequence may be added to these C-terminal constructs.
  • any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted TGF alpha HIH polypeptide.
  • the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues m-n of SEQ ID NO:2, where n and m are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • nucleotide sequence encoding a polypeptide consisting of a portion of the complete TGF alpha HHI amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97342, where this portion excludes any integer of amino acid residues from 1 to about 228 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97342, or any integer of amino acid residues from 1 to about 228 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97342.
  • Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided.
  • the present application is also directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the TGF alpha HIH polypeptide sequence set forth herein m-n.
  • the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific TGF alpha HIH N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • Additional preferred polypeptide fragments comprise, or alternatively consist of, the amino acid sequence of residues: M-l to W-15; A-2 to A-16; P-3 to A-17; H-4 to A-18; G-5 toL-19; P-6 to L-20; G-7 to L-21; S-8 to A-22; L-9 to L-23; T-10 to G-24; T-l 1 to V-25; L-12 to E-26; V-13 to R-27; P-14 to A-28; W-15 to L-29; A-16 to A-30;A-17 to L-31; A-18 to P- 32; L-19 to E-33; L-20 to 1-34; L-21 to C-35; A-22 to T-36; L-23 to Q-37; G-24 to C-38; V- 25 to P-39; E-26 to G-40; R-27 to S-41 ;A-28 to V-42; L-29 to Q-43; A-30 to N-44; L-31 to L-45; P-32 to S-46; E-33 to K-47;
  • polypeptide fragments may retain the biological activity of TGF alpha HIH polypeptides of the invention and/or may be useful to generate or screen for antibodies, as described further below.
  • Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
  • the polynucleotide fragments of the invention encode a polypeptide which demonstrates a TGF alpha HIH functional activity.
  • a polypeptide demonstrating a TGF alpha HIII "functional activity” is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) TGF alpha HIII protein.
  • Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a TGF alpha HHI polypeptide for binding) to an anti-TGF alpha HIH antibody], immunogenicity (ability to generate antibody which binds to a TGF alpha HHI polypeptide), ability to form multimers with TGF alpha HIH polypeptides of the invention, and ability to bind to a receptor or ligand for a TGF alpha H ⁇ i polypeptide.
  • TGF alpha H ⁇ i polypeptides and fragments, variants derivatives, and analogs thereof, can be assayed by various methods.
  • various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation as
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention.
  • binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting.
  • physiological co ⁇ elates of TGF alpha HIH binding to its substrates can be assayed.
  • assays described herein may routinely be applied to measure the ability of TGF alpha HHI polypeptides and fragments, variants derivatives and analogs thereof to elicit TGF alpha HIH related biological activity (either in vitro or in vivo).
  • Other methods will be known to the skilled artisan and are within the scope of the invention.
  • Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions”), beta-sheet and beta-sheet-forming regions (“beta-regions”), turn and turn- forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson- Wolf program) of complete (i.e., full-length) TGF alpha HIH (SEQ ID NO:2).
  • Certain preferred regions are those set out in Figure 3 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figure 1 (SEQ ID NO:2), such preferred regions include; Garnier- Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface- forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • the polynucleotides of the invention encode functional attributes of TGF alpha HIH.
  • Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of TGF alpha HHI.
  • TGF alpha HIH set forth in Figure 1 and/or Table I, as described above, was generated using the various modules and algorithms of the DNA*STAR set on default parameters.
  • the data presented in columns VHI, IX, XHI, and XIV of Table I can be used to determine regions of TGF alpha HHI which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIH, IX, XHI, and/or IV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
  • such prefe ⁇ ed regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson- Wolf regions of high antigenic index.
  • fragments in this regard are those that comprise regions of TGF alpha HHI that combine several structural features, such as several of the features set out above.
  • Other preferred polypeptide fragments are biologically active TGF alpha HIII fragments.
  • Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the TGF alpha HITI polypeptide.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
  • polynucleotide sequences such as EST sequences
  • SEQ JD NO:l amino acid sequences
  • amino acid sequences are publicly available and accessible through sequence databases. Some of these sequences are related to SEQ JD NO:l and may have been publicly available prior to conception of the present invention. Preferably, such related polynucleotides are specifically excluded from the scope of the present invention. To list every related sequence would be cumbersome.
  • polynucleotides comprising a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 to 909 of SEQ JD NO:l, b is an integer of 15 to 923, where both a and b correspond to the positions of nucleotide residues shown in SEQ ID NO:l, and where the b is greater than or equal to a + 14.
  • the present invention encompasses polypeptides comprising, or alternatively consisting of, an epitope of the polypeptide having an amino acid sequence of SEQ ID NO:2, or an epitope of the polypeptide sequence encoded by a polynucleotide sequence contained in ATCC Deposit No: 97342 or encoded by a polynucleotide that hybridizes to the complement of the sequence of SEQ ID NO:l or contained in ATCC Deposit No: 97342 under stringent hybridization conditions or lower stringency hybridization conditions as defined supra.
  • the present invention further encompasses polynucleotide sequences encoding an epitope of a polypeptide sequence of the invention (such as, for example, the sequence disclosed in SEQ ID NO:l), polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope of the invention, and polynucleotide sequences which hybridize to the complementary strand under stringent hybridization conditions or lower stringency hybridization conditions defined supra.
  • epitopes refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human.
  • the present invention encompasses a polypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide.
  • An "immunogenic epitope,” as used herein, is defined as a portion of a protein that elicits an antibody response in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described infra. (See, for example, Geysen et al., Proc. Natl. Acad. Sci.
  • antigenic epitope is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art, for example, by the immunoassays described herein. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross- reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic.
  • antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 15 to about 30 amino acids.
  • Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof. Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these antigenic epitopes. Antigenic epitopes can be used as the target molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al., Science 219:660-666 (1983)).
  • immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985).
  • Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes.
  • the polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids), the polypeptide may be presented without a carrier.
  • a carrier protein such as an albumin
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting).
  • Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol., 66:2347-2354 (1985).
  • animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine residues may be coupled to a carrier using a linker such as maleimidobenzoyl- N- hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier- coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ g of peptide or carrier protein and Freund's adjuvant or any other adjuvant known for stimulating an immune response.
  • booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
  • polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to other polypeptide sequences.
  • the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, or any combination thereof and portions thereof) resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3, or any combination thereof and portions thereof resulting in chimeric polypeptides.
  • Such fusion proteins may facilitate purification and may increase half-life in vivo. This has been shown for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins.
  • IgG Fusion proteins that have a disulfide- linked dimeric structure due to the IgG portion desulfide bonds have also been found to be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone.
  • Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag (e.g., the hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of the expressed polypeptide.
  • an epitope tag e.g., the hemagglutinin ("HA") tag or flag tag
  • HA hemagglutinin
  • a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972- 897).
  • the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues.
  • the tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged proteins can be selectively eluted with imidazole-containing buffers.
  • DNA shuffling may be employed to modulate the activities of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721 ; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol.
  • alteration of polynucleotides corresponding to SEQ ID NO:l and the polypeptides encoded by these polynucleotides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence.
  • polynucleotides of the invention may be altered by being subjected to random mutagenesis by error- prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • polypeptides of the invention relate to antibodies and T-cell antigen receptors (TCR) which immunospecifically bind a polypeptide, polypeptide fragment, or variant of SEQ ID NO:2, and/or an epitope, of the present invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding).
  • TCR T-cell antigen receptors
  • Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen.
  • the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of immunoglobulin molecule.
  • the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain.
  • Antigen-binding antibody fragments, including single-chain antibodies may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, and CH3 domains.
  • the antibodies of the invention may be from any animal origin including birds and mammals.
  • the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken.
  • "human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Patent No. 5,939,598 by Kucherlapati et al.
  • the antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
  • Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind.
  • the epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures.
  • Preferred epitopes of the invention include: C38- N44; K53-L60; C65-I72; L77-F89; Q101-L109; I144-G177; A184-F198; and or T221-S229 of SEQ ID NO:2, as well as polynucleotides that encode these epitopes.
  • Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
  • Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. j ntibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof.
  • Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention.
  • the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein.
  • antibodies which bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions are also included in the present invention.
  • Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10 "2 M, 10 "2 M, 5 X 10 "3 M, 10 “3 M, 5 X 10 "4 M, 10 “4 M, 5 X 10 "5 M, 10 ⁇ 5 M, 5 X 10 "6 M, 10 “6 M, 5 X 10 "7 M, 10 7 M, 5 X 10 "8 M, 10 “8 M, 5 X 10 "9 M, 10 “9 M, 5 X 10 "10 M, 10 “10 M, 5 X 10 "11 M, 10 " " “ M, 5 X 1 0 -i2 M; 10-12 M 5 ⁇ 10 -i3 Mj 10 -i3 M> 5 ⁇ J Q-M M> J Q-14 M? 5 X 1 0 15 M, or 10" 15 M.
  • the invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herein.
  • the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
  • Antibodies of the present invention may act as agonists or antagonists of the polypeptides of the present invention.
  • the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully.
  • antibodies of the present invention bind an antigenic epitope disclosed herein, or a portion thereof.
  • the invention features both receptor-specific antibodies and ligand-specific antibodies.
  • the invention also features receptor-specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art.
  • receptor activation can be determined by detecting the phosphorylation (e.g., tyrosine or serine/threonine) of the receptor or its substrate by immunoprecipitation followed by western blot analysis (for example, as described supra).
  • phosphorylation e.g., tyrosine or serine/threonine
  • antibodies are provided that inhibit ligand activity or receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% of the activity in absence of the antibody.
  • the invention also features receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand.
  • receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand.
  • neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor.
  • antibodies which activate the receptor are also act as receptor agonists, i.e., potentiate or activate either all or a subset of the biological activities of the ligand-mediated receptor activation, for example, by inducing dimerization of the receptor.
  • the antibodies may be specified as agonists, antagonists or inverse agonists for biological activities comprising the specific biological activities of the peptides of the invention disclosed herein.
  • the above antibody agonists can be made using methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng et al., Blood 92(6):1981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J.
  • Antibodies of the present invention may be used, for example, but not limited to, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods.
  • the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference herein in its entirety).
  • the antibodies of the present invention may be used either alone or in combination with other compositions.
  • the antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions.
  • antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.
  • the antibodies of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from generating an anti-idiotypic response.
  • the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.
  • the antibodies of the present invention may be generated by any suitable method known in the art.
  • Polyclonal antibodies to an antigen-of- interest can be produced by various procedures well known in the art.
  • a polypeptide of the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen.
  • adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art.
  • Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof.
  • monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references incorporated by reference in their entireties).
  • mice can be immunized with a polypeptide of the invention or a cell expressing such peptide.
  • the mouse spleen is harvested and splenocytes isolated.
  • the splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC.
  • Hybridomas are selected and cloned by limited dilution.
  • the hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
  • the present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind a polypeptide of the invention.
  • Antibody fragments which recognize specific epitopes may be generated by known techniques.
  • Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain.
  • the antibodies of the present invention can also be generated using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
  • phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine).
  • Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIU protein.
  • Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
  • chimeric, humanized, or human antibodies For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies.
  • a chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art.
  • Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and a framework regions from a human immunoglobulin molecule.
  • CDRs complementarity determining regions
  • framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
  • These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No.
  • Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Patent No. 5,565,332).
  • Human antibodies are particularly desirable for therapeutic treatment of human patients.
  • Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.
  • Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes.
  • the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
  • the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
  • the mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production.
  • the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice.
  • the chimeric mice are then bred to produce homozygous offspring which express human antibodies.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
  • Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
  • Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection.”
  • a selected non-human monoclonal antibody e.g., a mouse antibody
  • antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)).
  • antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that "mimic" the polypeptide multimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and/or its ligand.
  • anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand.
  • anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
  • Antibodies specific to TGF alpha HHI may be used for cancer diagnosis and therapy, since many types of cancer cells up-regulate various members of the TGF alpha family during the process of neoplasia or hyperplasia. These antibodies bind to and inactivate TGF alpha HIII. Monoclonal antibodies against TGF alpha HIII (and/or its family members) are in clinical use for both the diagnosis and therapy of certain disorders including (but not limited to) hyperplastic and neoplastic growth abnormalities. Upregulation of growth factor expression by neoplastic tissues forms the basis for a variety of serum assays which detect increases in growth factor in the blood of affected patients. These assays are typically applied not only in diagnostic settings, but are applied in prognostic settings as well (to detect the presence of occult tumor cells following surgery,chemotherapy, etc)
  • TGF alpha HIII receptor may be detected by using labeled TGF alpha HIH in a receptor binding assay, or by the use of antibodies to the TGF alpha HIH receptor itself.
  • Cells may be distinguished in accordance with the presence and density of receptors for TGF alpha HIII, thereby providing a means for predicting the susceptibility of such cells to the biological activities of TGF alpha HIII.
  • the invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof.
  • the invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a polypeptide having the amino acid sequence of SEQ ID NO:2.
  • the polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art.
  • a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al.,
  • a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody.
  • a suitable source e.g., an antibody cDNA
  • Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
  • the nucleotide sequence and corresponding amino acid sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
  • the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well know in the art, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability.
  • CDRs complementarity determining regions
  • one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody, as described supra.
  • the framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol.
  • the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds a polypeptide of the invention.
  • one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds.
  • Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • Techniques for the assembly of functional Fv fragments in E. coli may also be used (Skerra et al., Science 242:1038- 1041 (1988)).
  • the antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.
  • Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention
  • an expression vector containing a polynucleotide that encodes the antibody requires construction of an expression vector containing a polynucleotide that encodes the antibody.
  • the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art.
  • Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.
  • the expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention.
  • the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter.
  • vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
  • host-expression vector systems may be utilized to express the antibody molecules of the invention.
  • Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ.
  • These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B.
  • subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mamm
  • bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule.
  • mammalian cells such as Chinese hamster ovary cells (CHO)
  • CHO Chinese hamster ovary cells
  • a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
  • a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed.
  • vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
  • Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
  • GST glutathione S-transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
  • Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • the antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter
  • a number of viral-based expression systems may be utilized.
  • the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non- essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts, (e.g., see Logan & Shenk, Proc. Natl. Acad.
  • Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.
  • cell lines which stably express the antibody molecule may be engineered.
  • host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines which express the antibody molecule.
  • Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.
  • a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., Cell 11 :223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes can be employed in tk-, hgprt- or aprt- cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci.
  • the expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
  • vector amplification for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
  • a marker in the vector system expressing antibody is amplifiable
  • increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al, Mol. Cell. Biol. 3:257 (1983)).
  • the host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide.
  • the two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides.
  • a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980)).
  • the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
  • an antibody molecule of the invention may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
  • centrifugation e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
  • differential solubility e.g., differential solubility, or by any other standard technique for the purification of proteins.
  • the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
  • the present invention encompasses antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • the antibodies may be specific for antigens other than polypeptides (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention.
  • antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors.
  • Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett.
  • the present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions.
  • the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof.
  • the antibody portion fused to a polypeptide of the present invention may comprise the constant region, hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof.
  • the polypeptides may also be fused or conjugated to the above antibody portions to form multimers.
  • Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions.
  • polypeptides corresponding to a polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2 may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art. Further, the polypeptides corresponding to SEQ ID NO:2 may be fused or conjugated to the above antibody portions to facilitate purification.
  • One reported example describes chimeric proteins consisting of the first two domains of the human CD4- polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature 331 :84-86 (1988).
  • polypeptides of the present invention fused or conjugated to an antibody having disulfide- linked dimeric structures may also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone.
  • the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
  • EP A 232,262 Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired.
  • the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
  • human proteins such as hIL-5
  • Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5.
  • the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide to facilitate purification.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • peptide tags useful for purification include, but are not limited to, the "HA” tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
  • the present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent.
  • the antibodies can be used diagnostically to, for example, monitor the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance.
  • detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions.
  • the detectable substance may be coupled or conjugated either directly to the antibody (or fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • examples of bioluminescent materials include luciferase, luciferin, and aequorin;
  • suitable radioactive material include 1251, 1311, l l lln or 99Tc.
  • an antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213Bi.
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to cells.
  • Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydro testosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6- thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis- dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.
  • the conjugates of the invention can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See, International Publication No.
  • a thrombotic agent or an anti- angiogenic agent e.g., angiostatin or endostatin
  • biological response modifiers such as, for example, lymphokines, interleukin- 1 ("IL-1"), interleukin-2 (“IL-2”), interleukin-6 (“IL-6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.
  • Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen.
  • Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is incorporated herein by reference in its entirety.
  • An antibody, with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.
  • the antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples.
  • the translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types.
  • Monoclonal antibodies directed against a specific epitope, or combination of epitopes will allow for the screening of cellular populations expressing the marker.
  • Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, "panning" with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Patent 5,985,660; and Morrison et al, Cell, 96:131-49 (1999)).
  • hematological malignancies i.e. minimal residual disease (MRD) in acute leukemic patients
  • GVHD Graft-versus-Host Disease
  • these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
  • the antibodies of the invention may be assayed for immunospecific binding by any method known in the art.
  • the immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few.
  • Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIP A buffer (1% NP-40 or Triton X- 100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4° C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer.
  • a lysis buffer such as RIP A buffer (1% NP-40 or Triton X- 100, 1% sodium de
  • the ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis.
  • One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre- clearing the cell lysate with sepharose beads).
  • immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
  • Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti- human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 1251) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen.
  • ELISAs comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen.
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well.
  • ELISAs see, e.g., Ausubel et al, eds, 1994, Cunent Protocols in Molecular Biology, Vol. 1 , John Wiley & Sons, Inc., New York at 11.2.1.
  • the binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction can be determined by competitive binding assays.
  • a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3H or 1251) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen.
  • the affinity of the antibody of interest for a particular antigen and the binding off-rates can be determined from the data by scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassays.
  • the antigen is incubated with antibody of interest conjugated to a labeled compound (e.g., 3H or 1251) in the presence of increasing amounts of an unlabeled second antibody.
  • the present invention is further directed to antibody-based therapies which involve administering antibodies of the invention to an animal, preferably a mammal, and most preferably a human, patient for treating one or more of the disclosed diseases, disorders, or conditions.
  • Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein).
  • the antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with abenant expression and/or activity of a polypeptide of the invention, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein.
  • the treatment and/or prevention of diseases, disorders, or conditions associated with abenant expression and/or activity of a polypeptide of the invention includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions.
  • Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • a summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below.
  • the antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
  • lymphokines or hematopoietic growth factors such as, e.g., IL-2, IL-3 and IL-7
  • the antibodies of the invention may be administered alone or in combination with other types of treatments (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents).
  • treatments e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents.
  • administration of products of a species origin or species reactivity in the case of antibodies
  • human antibodies, fragments derivatives, analogs, or nucleic acids are administered to a human patient for therapy or prophylaxis.
  • Prefened binding affinities include those with a dissociation constant or Kd less than 5 X 10 "2 M, 10 "2 M, 5 X 10 "3 M, 10 “3 M, 5 X 10 "4 M, 10 “4 M, 5 X 10 "5 M, 10 “5 M, 5 X 10 "6 M, 10 “6 M, 5 X 10 "7 M, 10 “7 M, 5 X 10 “8 M, 10 “8 M, 5 X 10 "9 M, 10 “9 M, 5 X 10 "10 M, 10 “10 M, 5 X 10 " “ M, 10 “ “ M, 5 X 10 "12 M, 10 “12 M, 5 X 10 "13 M, 10 " 13 M, 5 X 10 "14 M, 10 “14 M, 5 X 10 "15 M, and 10 "15 M.
  • nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to treat, inhibit or prevent a disease or disorder associated with abenant expression and/or activity of a polypeptide of the invention, by way of gene therapy.
  • Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid.
  • the nucleic acids produce their encoded protein that mediates a therapeutic effect.
  • the compound comprises nucleic acid sequences encoding an antibody, said nucleic acid sequences being part of expression vectors that express the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host.
  • nucleic acid sequences have promoters operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue- specific.
  • nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989).
  • the expressed antibody molecule is a single chain antibody; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments thereof, of the antibody.
  • Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid- carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
  • the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product.
  • This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retro virals or other viral vectors (see U.S. Patent No.
  • microparticle bombardment e.g., a gene gun; Biolistic, Dupont
  • coating lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc.
  • nucleic acid- ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
  • the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
  • the nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989)).
  • viral vectors that contains nucleic acid sequences encoding an antibody of the invention are used.
  • a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the conect packaging of the viral genome and integration into the host cell DNA.
  • the nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient.
  • retroviral vectors More detail about retroviral vectors can be found in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
  • Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al, Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Cun. Opin. in Genetics and Devel. 3:110-114 (1993).
  • Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Cunent Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy.
  • Adeno-associated virus has also been proposed for use in gene therapy (Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No. 5,436,146).
  • Another approach to gene therapy involves transfening a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection.
  • the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transfened gene. Those cells are then delivered to a patient.
  • the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
  • introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc.
  • Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen et al., Meth. Enzymol.
  • the technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
  • Recombinant blood cells e.g., hematopoietic stem or progenitor cells
  • Recombinant blood cells are preferably administered intravenously.
  • the amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
  • Cells into which a nucleic acid can be introduced for purposes of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone manow, umbilical cord blood, peripheral blood, fetal liver, etc.
  • the cell used for gene therapy is autologous to the patient.
  • nucleic acid sequences encoding an antibody are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect.
  • stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g. PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61 :771 (1986)).
  • the nucleic acid to be introduced for purposes of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription. Demonstration of Therapeutic or Prophylactic Activity
  • the compounds or pharmaceutical compositions of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans.
  • in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include, the effect of a compound on a cell line or a patient tissue sample.
  • the effect of the compound or composition on the cell line and/or tissue sample can be determined utilizing techniques known to those of skill in the art including, but not limited to, rosette formation assays and cell lysis assays.
  • in vitro assays which can be used to determine whether administration of a specific compound is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered a compound, and the effect of such compound upon the tissue sample is observed.
  • the invention provides methods of treatment, inhibition and prophylaxis by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention.
  • the compound is substantially purified (e.g., substantially free from substances that limit its effect or produce undesired side-effects).
  • the subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably human.
  • Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below.
  • a compound of the invention e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc.
  • Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the compounds or compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • a protein, including an antibody, of the invention care must be taken to use materials to which the protein does not absorb.
  • the compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)
  • the compound or composition can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J.Neurosurg. 71 :105 (1989)).
  • a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
  • Other controlled release systems are discussed in the review by Langer (Science
  • the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see U.S. Patent No.
  • a nucleic acid can be introduced intracellularly and incorporated within host cell DNA for expression, by homologous recombination.
  • the present invention also provides pharmaceutical compositions.
  • compositions comprise a therapeutically effective amount of a compound, and a pharmaceutically acceptable canier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical earners can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a prefened canier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E.W. Martin.
  • Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile iso tonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the compounds of the invention can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • the amount of the compound of the invention which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with abenant expression and/or activity of a polypeptide of the invention can be determined by standard clinical techniques.
  • in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the dosage administered to a patient is typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
  • the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to 10 mg/kg of the patient's body weight.
  • human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible.
  • the dosage and frequency of administration of antibodies of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • Labeled antibodies, and derivatives and analogs thereof, which specifically bind to a polypeptide of interest can be used for diagnostic purposes to detect, diagnose, or monitor diseases and/or disorders associated with the abenant expression and/or activity of a polypeptide of the invention.
  • the invention provides for the detection of abenant expression of a polypeptide of interest, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of abenant expression.
  • the invention provides a diagnostic assay for diagnosing a disorder, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder.
  • a diagnostic assay for diagnosing a disorder comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder.
  • the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior
  • Antibodies of the invention can be used to assay protein levels in a biological sample using classical immunohistological methods known to those of skill in the art (e.g., see Jalkanen, et al., J. Cell. Biol. 101 :976-985 (1985); Jalkanen, et al., J. Cell . Biol. 105:3087- 3096 (1987)).
  • Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Suitable antibody assay labels include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as, glucose oxidase
  • radioisotopes such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc)
  • luminescent labels such as luminol
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled molecule which specifically binds to the polypeptide of interest; b) waiting for a time interval following the administering for permitting the labeled molecule to preferentially concentrate at sites in the subject where the polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with abenant expression of the polypeptide of interest.
  • Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.
  • the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images.
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
  • the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
  • monitoring of the disease or disorder is canied out by repeating the method for diagnosing the disease or disease, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.
  • Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
  • CT computed tomography
  • PET position emission tomography
  • MRI magnetic resonance imaging
  • sonography sonography
  • the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050).
  • the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument.
  • the molecule is labeled with a positron emitting metal and is detected in the patent using positron emission-tomography.
  • the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
  • MRI magnetic resonance imaging
  • kits that can be used in the above methods.
  • a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers.
  • the kits of the present invention contain a substantially isolated polypeptide comprising an epitope which is specifically immunoreactive with an antibody included in the kit.
  • the kits of the present invention further comprise a control antibody which does not react with the polypeptide of interest.
  • kits of the present invention contain a means for detecting the binding of an antibody to a polypeptide of interest (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate).
  • a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate.
  • the kit is a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides.
  • a kit may include a control antibody that does not react with the polypeptide of interest.
  • a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti-polypeptide antigen antibody.
  • a kit includes means for detecting the binding of said antibody to the antigen (e.g., the antibody may be conjugated to a fluorescent compound such as fluorescein or rhodamine which can be detected by flow cytometry).
  • the kit may include a recombinantly produced or chemically synthesized polypeptide antigen.
  • the polypeptide antigen of the kit may also be attached to a solid support.
  • the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached.
  • a kit may also include a non-attached reporter-labeled anti-human antibody.
  • binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labeled antibody.
  • the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention.
  • the diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody.
  • the antibody is attached to a solid support.
  • the antibody may be a monoclonal antibody.
  • the detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen.
  • test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention.
  • the reagent After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support.
  • the reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
  • the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96- well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
  • the invention provides an assay system or kit for carrying out this diagnostic method.
  • the kit generally includes a support with surface- bound recombinant antigens, and a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.
  • any TGF alpha HIII polypeptide can be used to generate fusion proteins.
  • the TGF alpha HDI polypeptide when fused to a second protein, can be used as an antigenic tag.
  • Antibodies raised against the TGF alpha HDI polypeptide can be used to indirectly detect the second protein by binding to the TGF alpha HHI.
  • secreted proteins target cellular locations based on trafficking signals, the TGF alpha HIII polypeptides can be used as targeting molecules once fused to other proteins.
  • domains that can be fused to TGF alpha HHI polypeptides include not only heterologous signal sequences, but also other heterologous functional regions.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • TGF alpha HIII proteins of the invention comprise fusion proteins wherein the TGF alpha HIII polypeptides are those described above as m-n.
  • the application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences encoding polypeptides having the amino acid sequence of the specific N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • fusion proteins may also be engineered to improve characteristics of the TGF alpha HIII polypeptide.
  • a region of additional amino acids may be added to the N-terminus of the TGF alpha HIII polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage.
  • peptide moieties may be added to the TGF alpha Hm polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the TGF alpha HIII polypeptide.
  • the addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.
  • polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with heterologous polypeptide sequences.
  • the polypeptides of the present invention may be fused with heterologous polypeptide sequences, for example, the polypeptides of the present invention may be fused with parts of the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CHI, CH2, CH3, and any combination thereof, including both entire domains and portions thereof), resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3 any combination thereof, including both entire domains and portions thereof
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
  • EP-A 0232 262. Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
  • human proteins such as hIL-5
  • Fc portions for the purpose of high-throughput screening assays to identify antagonists of hIL-5.
  • the TGF alpha HDI polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of TGF alpha HIII.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • Another peptide tag useful for purification, the "HA" tag conesponds to an epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).)
  • any of these above fusions can be engineered using the TGF alpha HHI polynucleotides or the polypeptides.
  • the present invention also relates to vectors containing the TGF alpha HHI polynucleotide, host cells, and the production of polypeptides by recombinant techniques.
  • the vector may be, for example, a phage, plasmid, viral, or retroviral vector.
  • Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or tip, the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses.
  • the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin - resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • bacterial cells such as E. coli, Streptomyces, Salmonella typhimuriaum, fungal cells, such as yeast
  • insect cells such as Drosophila S2 and Spodoptera SF9
  • animal cells such as CHO, COS or Bowes melanoma
  • adenoviruses plant cells, etc.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 (Qiagen), pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, PNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, ⁇ KK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and tip.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relatesto host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), alpha factor acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017).
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). These PBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • TGF alpha HIII polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid.
  • a virus If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the TGF alpha HIH polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors prefened for use in bacteria include pQE70, pQE60 and ⁇ QE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a, pKK223- 3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc.
  • prefened eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • TGF alpha HIII polypeptides may in fact be expressed by a host cell lacking a recombinant vector. Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • appropriate means e.g., temperature shift or chemical induction
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freezethaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.
  • Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
  • DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • TGF alpha HIII polypeptides can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be nonglycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.
  • TGF alpha HDI polypeptides and preferably the secreted form, can also be recovered from: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
  • a prokaryotic or eukaryotic host including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
  • the TGF alpha HIH polypeptides may be glycosylated or may be non-glycosylated.
  • TGF alpha HIII polypeptides may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
  • the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., TGF alpha HIII coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with TGF alpha HIII polynucleotides of the invention, and which activates, alters, and or amplifies endogenous TGF alpha HIII polynucleotides.
  • endogenous genetic material e.g., TGF alpha HIII coding sequence
  • genetic material e.g., heterologous polynucleotide sequences
  • heterologous control regions e.g., promoter and or enhancer
  • endogenous TGF alpha HIH polynucleotide sequences via homologous recombination, resulting in the formation of a new transcription unit
  • heterologous control regions e.g., promoter and or enhancer
  • endogenous TGF alpha HIH polynucleotide sequences via homologous recombination, resulting in the formation of a new transcription unit
  • polypeptides of the invention can be chemically synthesized using techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-111 (1984)).
  • a polypeptide conesponding to a fragment of a TGF alpha HIII polypeptide can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into the TGF alpha HIII polypeptide sequence.
  • Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t- butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid
  • the invention encompasses TGF alpha HIII polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 ; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
  • the polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
  • the polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the prefened molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • polyethylene glycol molecules should be attached to the protein with consideration of effects on functional or antigenic domains of the protein.
  • attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Prefened for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • the TGF alpha HIII polypeptides of the invention may be in monomers or multimers (i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the TGF alpha HIII polypeptides of the invention, their preparation, and compositions (preferably, Therapeutics) containing them.
  • the polypeptides of the invention are monomers, dimers, trimers or tetramers.
  • the multimers of the invention are at least dimers, at least trimers, or at least tetramers.
  • Multimers encompassed by the invention may be homomers or heteromers.
  • the term homomer refers to a multimer containing only polypeptides conesponding to the amino acid sequence of SEQ ID NO:2 or encoded by the cDNA contained in the deposited clone (including fragments, variants, splice variants, and fusion proteins, conesponding to these as described herein). These homomers may contain TGF alpha HIII polypeptides having identical or different amino acid sequences.
  • a homomer of the invention is a multimer containing only TGF alpha HHI polypeptides having an identical amino acid sequence.
  • a homomer of the invention is a multimer containing TGF alpha Hi ⁇ polypeptides having different amino acid sequences.
  • the multimer of the invention is a homodimer (e.g., containing TGF alpha HEH polypeptides having identical or different amino acid sequences) or a homotrimer (e.g., containing TGF alpha HHI polypeptides having identical and/or different amino acid sequences).
  • the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.
  • heteromer refers to a multimer containing one or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the TGF alpha HIII polypeptides of the invention.
  • the multimer of the invention is a heterodimer, a heterotrimer, or a heterotetramer.
  • the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.
  • Multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and/or covalent associations and/or may be indirectly linked, by for example, liposome formation.
  • multimers of the invention such as, for example, homodimers or homotrimers, are formed when polypeptides of the invention contact one another in solution.
  • heteromultimers of the invention such as, for example, heterotrimers or heterotetramers, are formed when polypeptides of the invention contact antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in a fusion protein of the invention) in solution.
  • multimers of the invention are formed by covalent associations with and/or between the TGF alpha HIII polypeptides of the invention.
  • covalent associations may involve one or more amino acid residues contained in the polypeptide sequence (e.g., that recited in SEQ ID NO:2, or contained in the polypeptide encoded by the clone HTECD31).
  • the covalent associations are cross-linking between cysteine residues located within the polypeptide sequences which interact in the native (i.e., naturally occurring) polypeptide.
  • the covalent associations are the consequence of chemical or recombinant manipulation.
  • covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a TGF alpha HIII fusion protein.
  • covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, e.g., US Patent Number 5,478,925).
  • the covalent associations are between the heterologous sequence contained in a TGF alpha HIH-Fc fusion protein of the invention (as described herein).
  • covalent associations of fusion proteins of the invention are between heterologous polypeptide sequence from another protein that is capable of forming covalently associated multimers, such as for example, oseteoprotegerin (see, e.g., International Publication NO: WO 98/49305, the contents of which are herein inco ⁇ orated by reference in its entirety).
  • two or more polypeptides of the invention are joined through peptide linkers. Examples include those peptide linkers described in U.S. Pat. No. 5,073,627 (hereby inco ⁇ orated by reference). Proteins comprising multiple polypeptides of the invention separated by peptide linkers may be produced using conventional recombinant DNA technology.
  • Leucine zipper and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found.
  • Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al., Science 240:1759, (1988)), and have since been found in a variety of different proteins.
  • Leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize.
  • leucine zipper domains suitable for producing soluble multimeric proteins of the invention are those described in PCT application WO 94/10308, hereby inco ⁇ orated by reference.
  • Recombinant fusion proteins comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimerizes in solution are expressed in suitable host cells, and the resulting soluble multimeric fusion protein is recovered from the culture supernatant using techniques known in the art.
  • Trimeric polypeptides of the invention may offer the advantage of enhanced biological activity.
  • Prefened leucine zipper moieties and isoleucine moieties are those that preferentially form trimers.
  • a leucine zipper derived from lung surfactant protein D SPD
  • SPD lung surfactant protein D
  • Other peptides derived from naturally occurring trimeric proteins may be employed in preparing trimeric polypeptides of the invention.
  • proteins of the invention are associated by interactions between Flag® polypeptide sequence contained in fusion proteins of the invention containing Flag® polypeptide seuqence.
  • associations proteins of the invention are associated by interactions between heterologous polypeptide sequence contained in Flag® fusion proteins of the invention and anti-Flag® antibody.
  • the multimers of the invention may be generated using chemical techniques known in the art.
  • polypeptides desired to be contained in the multimers of the invention may be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • multimers of the invention may be generated using techniques known in the art to form one or more inter-molecule cross-links between the cysteine residues located within the sequence of the polypeptides desired to be contained in the multimer (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • polypeptides of the invention may be routinely modified by the addition of cysteine or biotin to the C terminus or N-terminus of the polypeptide and techniques known in the art may be applied to generate multimers containing one or more of these modified polypeptides (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety). Additionally, techniques known in the art may be applied to generate liposomes containing the polypeptide components desired to be contained in the multimer of the invention (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • multimers of the invention may be generated using genetic engineering techniques known in the art.
  • polypeptides contained in multimers of the invention are produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • polynucleotides coding for a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a linker polypeptide and then further to a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • recombinant techniques described herein or otherwise known in the art are applied to generate recombinant polypeptides of the invention which contain a transmembrane domain (or hyrophobic or signal peptide) and which can be inco ⁇ orated by membrane reconstitution techniques into liposomes (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • TGF alpha HIII Polynucleotides can be used in numerous ways as reagents. The following description should be considered exemplary and utilizes known techniques.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the sequences shown in SEQ ID NO:l. Primers can be selected using computer analysis so that primers do not span more than one predicted exon in the genomic DNA. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human TGF alpha HIII gene conesponding to the SEQ ID NO:l will yield an amplified fragment. Similarly, somatic hybrids provide a rapid method of PCR mapping the polynucleotides to particular chromosomes. Three or more clones can be assigned per day using a single thermal cycler.
  • sublocalization of the TGF alpha HIH polynucleotides can be achieved with panels of specific chromosome fragments.
  • Other gene mapping strategies that can be used include in situ hybridization, prescreening with labeled flow-sorted chromosomes, and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • TGF alpha HIH polynucleotides Precise chromosomal location of the TGF alpha HIH polynucleotides can also be achieved using fluorescence in situ hybridization (FISH) of a metaphase chromosomal spread.
  • FISH fluorescence in situ hybridization
  • This technique uses polynucleotides as short as 500 or 600 bases; however, polynucleotides 2,000-4,000 bp are prefened.
  • Verma et al. "Human Chromosomes: a Manual of Basic Techniques," Pergamon Press, New York (1988).
  • the TGF alpha HIH polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes). Prefened polynucleotides conespond to the noncoding regions of the cDNAs because the coding sequences are more likely conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping. Once a polynucleotide has been mapped to a precise chromosomal location, the physical position of the polynucleotide can be used in linkage analysis.
  • Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease.
  • Disease mapping data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library) .
  • a cDNA precisely localized to a chromosomal region associated with the disease could be one of 50- 500 potential causative genes.
  • TGF alpha HHI polynucleotide and the conesponding gene between affected and unaffected individuals can be examined.
  • visible structural alterations in the chromosomes such as deletions or translocations, are examined in chromosome spreads or by PCR. If no structural alterations exist, the presence of point mutations are ascertained. Mutations observed in some or all affected individuals, but not in normal individuals, indicates that the mutation may cause the disease.
  • complete sequencing of the TGF alpha HIII polypeptide and the conesponding gene from several normal individuals is required to distinguish the mutation from a polymo ⁇ hism. If a new polymo ⁇ hism is identified, this polymo ⁇ hic polypeptide can be used for further linkage analysis.
  • TGF alpha HIII polynucleotides can be assessed using TGF alpha HIII polynucleotides. Any of these alterations (altered expression, chromosomal reanangement, or mutation) can be used as a diagnostic or prognostic marker.
  • this invention is also related to the use of the gene of the present invention as a diagnostic. Detection of a mutated form of the gene of the present invention will allow a diagnosis of a disease or a susceptibility to a disease which results from underexpression of the polypeptide of the present invention, for example, improper wound healing, improper neurological functioning, ocular disorders, kidney and liver disorders, hair follicular development, angiogenesis and embryogenesis.
  • the invention also provides a diagnostic method useful during diagnosis of a disorder, involving measuring the expression level of polynucleotides of the present invention in cells or body fluid from an individual and comparing the measured gene expression level with a standard level of polynucleotide expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a disorder.
  • the invention includes a kit for analyzing samples for the presence of proliferative and/or cancerous polynucleotides derived from a test subject.
  • the kit includes at least one polynucleotide probe containing a nucleotide sequence that will specifically hybridize with a polynucleotide of the present invention and a suitable container.
  • the kit includes two polynucleotide probes defining an internal region of the polynucleotide of the present invention, where each probe has one strand containing a 31 'mer-end internal to the region.
  • the probes may be useful as primers for polymerase chain reaction amplification.
  • the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or depressed polynucleotide of the present invention expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.
  • measuring the expression level of polynucleotide of the present invention is intended qualitatively or quantitatively measuring or estimating the level of the polypeptide of the present invention or the level of the mRNA encoding the polypeptide in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the polypeptide level or mRNA level in a second biological sample).
  • the polypeptide level or mRNA level in the first biological sample is measured or estimated and compared to a standard polypeptide level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder.
  • a standard polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains the polypeptide of the present invention or mRNA.
  • biological samples include body fluids (such as semen, lymph, sera, plasma, urine, synovial fluid and spinal fluid) which contain the polypeptide of the present invention, and other tissue sources found to express the polypeptide of the present invention. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the prefened source.
  • the method(s) provided above may prefenably be applied in a diagnostic method and/or kits in which polynucleotides and/or polypeptides are attached to a solid support.
  • the support may be a "gene chip” or a "biological chip” as described in US Patents 5,837,832, 5,874,219, and 5,856,174.
  • a gene chip with polynucleotides of the present invention attached may be used to identify polymo ⁇ hisms between the polynucleotide sequences, with polynucleotides isolated from a test subject. The knowledge of such polymo ⁇ hisms (i.e.
  • the present invention encompasses polynucleotides of the present invention that are chemically synthesized, or reproduced as peptide nucleic acids (PNA), or according to other methods known in the art.
  • PNA peptide nucleic acids
  • a peptide nucleic acid is a polyamide type of DNA analog and the monomeric units for adenine, guanine, thymine and cytosine are available commercially (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxides, or deoxyribose derivatives, are not present in PNAs.
  • PNA peptide nucleic acid
  • PNAs bind specifically and tightly to complementary DNA strands and are not degraded by nucleases. In fact, PNA binds more strongly to DNA than DNA itself does. This is probably because there is no electrostatic repulsion between the two strands, and also the polyamide backbone is more flexible. Because of this, PNA/DNA duplexes bind under a wider range of stringency conditions than DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller probes can be used than with DNA due to the strong binding.
  • the present invention is useful for detecting cancer in mammals.
  • the invention is useful during diagnosis of pathological cell proliferative neoplasias which include, but are not limited to: acute myelogenous leukemias including acute monocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute undifferentiated leukemia, etc.; and chronic myelogenous leukemias including chronic myelomonocytic leukemia, chronic granulocytic leukemia, etc.
  • Prefened mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly prefened are humans.
  • Neoplasias are now believed to result from the qualitative alteration of a normal cellular gene product, or from the quantitative modification of gene expression by insertion into the chromosome of a viral sequence, by chromosomal translocation of a gene to a more actively transcribed region, or by some other mechanism.
  • c-myc expression is highly amplified in the non-lymphocytic leukemia cell line HL-60.
  • HL-60 cells When HL-60 cells are chemically induced to stop proliferation, the level of c-myc is found to be downregulated.
  • International Publication Number WO 91/15580 it has been shown that exposure of HL-60 cells to a DNA construct that is complementary to the 5' end of c-myc or c-myb blocks translation of the conesponding mRNAs which downregulates expression of the c-myc or c-myb proteins and causes anest of cell proliferation and differentiation of the treated cells.
  • a TGF alpha HIII polynucleotide can be used to control gene expression through triple helix formation or antisense DNA or RNA.
  • Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241 : 456 (1988); and Dervan et al., Science 251 : 1360 (1991).
  • prefened polynucleotides are usually oligonucleotides 20 to 40 bases in length and complementary to either the region of the gene involved in transcription (triple helix - see Lee et al., Nucl. Acids Res. 3:173 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991) ) or to the mRNA itself (antisense - Okano, J. Neurochem.
  • TGF alpha HIH polynucleotides are also useful in gene therapy.
  • One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to conect the genetic defect.
  • TGF alpha HHI offers a means of targeting such genetic defects in a highly accurate manner.
  • Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.
  • the TGF alpha HIII polynucleotides are also useful for identifying individuals from minute biological samples.
  • the United States military, for example, is considering the use of restriction fragment length polymo ⁇ hism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymo ⁇ hism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel. This method does not suffer from the cunent limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the TGF alpha HIH polynucleotides can be used as additional DNA markers for RFLP.
  • the TGF alpha HIII polynucleotides can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ID database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples.
  • DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc.
  • body fluids e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc.
  • gene sequences amplified from polymo ⁇ hic loci such as DQa class II HLA gene, are used in forensic biology to identify individuals.
  • TGF alpha HIH polynucleotides can be used as polymo ⁇ hic markers for forensic pu ⁇ oses.
  • reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin.
  • Appropriate reagents can comprise, for example, DNA probes or primers specific to particular tissue prepared from TGF alpha HIII sequences. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination.
  • TGF alpha HIII polynucleotides are useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample.
  • polypeptides and antibodies directed to TGF alpha HIII polypeptides are useful to provide immuno logical probes for differential identification of the tissue(s) or cell type(s).
  • significantly higher or lower levels of TGF alpha HIII gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" TGF alpha HIII gene expression level, i.e., the TGF alpha HIH expression level in healthy tissue from an individual not having the disorder.
  • the invention provides a diagnostic method of a disorder, which involves: (a) assaying TGF alpha HHI gene expression level in cells or body fluid of an individual; (b) comparing the TGF alpha HIH gene expression level with a standard TGF alpha HHI gene expression level, whereby an increase or decrease in the assayed TGF alpha HIH gene expression level compared to the standard expression level is indicative of disorder.
  • the present invention also relates to diagnostic assays for detecting altered levels of the polypeptide of the present invention in various tissues since an overexpression of the proteins compared to normal control tissue samples can detect the presence of certain disease conditions such as neoplasia, skin disorders, ocular disorders and inflammation.
  • Assays used to detect levels of the polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis and preferably an ELISA assay.
  • An ELISA assay initially comprises preparing an antibody specific to an antigen of the polypeptide of the present invention, preferably a monoclonal antibody.
  • a reporter antibody is prepared against the monoclonal antibody.
  • a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme.
  • a sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides of the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to polypeptides of the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of protein present in a given volume of patient sample when compared against a standard curve.
  • a competition assay may also be employed to determine levels of the polypeptide of the present invention in a sample derived from the hosts.
  • Such an assay comprises isolating plasma membranes which over-express the receptor for the polypeptide of the present invention.
  • a test sample containing the polypeptides of the present invention which have been labeled are then added to the plasma membranes and then incubated for a set period of time.
  • Also added to the reaction mixture is a sample derived from a host which is suspected of containing the polypeptide of the present invention.
  • the reaction mixtures are then passed through a filter which is rapidly washed and the bound radioactivity is then measured to determine the amount of competition for the receptors and therefore the amount of the polypeptides of the present invention in the sample.
  • the TGF alpha HIH polynucleotides can be used as molecular weight markers on Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, as a probe to "subtract-out" known sequences in the process of discovering novel polynucleotides, for selecting and making oligomers for attachment to a "gene chip” or other support, to raise anti-DNA antibodies using DNA immunization techniques, and as an antigen to elicit an immune response.
  • TGF alpha HHI polypeptides can be used in numerous ways. The following description should be considered exemplary and utilizes known techniques.
  • TGF alpha HIH polypeptides can be used to assay protein levels in a biological sample using antibody-based techniques.
  • protein expression in tissues can be studied with classical immunohistological methods.
  • Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Suitable antibody assay labels include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • proteins can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be inco ⁇ orated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example, 1311, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously, or intraperitoneally) into the mammal.
  • a radioisotope for example, 1311, 112In, 99mTc
  • a radio-opaque substance for example, parenterally, subcutaneously, or intraperitoneally
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).)
  • the invention provides a diagnostic method of a disorder, which involves (a) assaying the expression of TGF alpha HHI polypeptide in cells or body fluid of an individual; (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed TGF alpha HHI polypeptide gene expression level compared to the standard expression level is indicative of a disorder.
  • a diagnostic method of a disorder involves (a) assaying the expression of TGF alpha HHI polypeptide in cells or body fluid of an individual; (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed TGF alpha HHI polypeptide gene expression level compared to the standard expression level is indicative of a disorder.
  • the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms.
  • TGF alpha HIH polypeptides can be used to treat disease.
  • patients can be administered TGF alpha HIH polypeptides in an effort to replace absent or decreased levels of the TGF alpha HHI polypeptide (e.g., insulin), to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the activity of a polypeptide (e.g., an oncogene or tumor supressor), to activate the activity of a polypeptide (e.g., by binding to a receptor), to reduce the activity of a membrane bound receptor by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation), or to bring about a desired response (e.g., blood vessel growth inhibition, enhancement of the immune response to proliferative cells or tissues).
  • TGF alpha HHI polypeptide e.g., insulin
  • a different polypeptide e.g.
  • antibodies directed to TGF alpha HHI polypeptides can also be used to treat disease.
  • administration of an antibody directed to a TGF alpha HHI polypeptide can bind and reduce ove ⁇ roduction of the polypeptide.
  • administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).
  • the TGF alpha HHI polypeptides can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • TGF alpha HIH polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell.
  • TGF alpha HIH polypeptides can be used to test the following biological activities.
  • the polypeptide of the present invention may also be employed for characterization of receptors.
  • the EGF family receptors cunently includes four EGF receptors, denoted as EGFR1, EGFR2, EGFR3 and EGFR4.
  • the EGFR2 receptor may also be refened to as Erb-2 and this molecule is useful for a variety of diagnostic and therapeutic indications (Prigent, S.A., and Lemoine, N.R., Prog. Growth Factor Res.. 4:1-24 (1992)).
  • the TGF alpha HHI polypeptide is likely a ligand for one or more of these receptors as well as for a new EGF type receptor. Use of the TGF alpha HHI can assist with the identification, characterization and cloning of such receptors.
  • the EGF receptor gene represents the cellular homolog of the v-erb-B oncogene of avian erythroblastosis virus.
  • Overexpression of the EGF receptor or deletion of kinase regulatory segments of the protein can bring about tumorigenic transformation of cells (Manjusri, D. et al., Human Cvokines, 364 and 381 (1991)) .
  • the polypeptides of the present invention may also be employed for restoration or enhancement of neurological functions diminished as a result of trauma or other damaging pathologies (such as AIDS dementia, senile dementia, etc) .
  • TGF alpha and its homologs have been found to be the most abundant ligand for the EGF/TGF alpha receptor in most parts of the brain (Kaser, et al., Mol. Brain Res., 16:316-322, (1992)) .
  • TGF alpha There appears to be a widespread distribution of TGF alpha in various regions of the brain in contrast to EGF which is only present in smaller, more discrete areas, suggesting that TGF-alpha might play a physiological role in brain tissues.
  • TGF alpha has an important utility in promoting normal brain cell differentiation and function. Accordingly, in instances where neurological functioning is diminished, an administration of the polypeptide of the present invention may stimulate the brain and enhance proper physiological functions.
  • TGF alpha HIH or soluble form thereof may also, be employed to treat ocular disorders, for example, corneal inflammation.
  • ocular disorders for example, corneal inflammation.
  • a variety of experiments have implicated members of the TGF alpha gene family in such pathologies. A recent paper summarizes some of the data related to the role these growth factors play in eye disease (Mann, et al Cell 73:249-261 (1993)). Recent experiments have shown that a number of mice lacking the TGF alpha gene displayed corneal inflammation due to an infiltration of leukocytes and other cells to the substantia intestinal of the eyes. In addition, the specificity of the TGF alpha growth factors for their target cells can be exploited as a mechanism to destroy the target cell.
  • TGF alpha HIH or soluble forms thereof can be coupled (by a wide variety of methods) to toxic molecules: for example, a radiopharmaceutical which inactivates target cells. These growth factor-toxin fusions kill the target cell (and in certain cases neighboring cells by a variety of "bystander” effects).
  • toxic molecules for example, a radiopharmaceutical which inactivates target cells.
  • TGF alpha HHI and related molecules may also be encapsulated in liposomes and may be conjugated to antibodies which recognize and bind to tumor or cell specific antigens, thereby provided a means for "targeting" cells.
  • TGF alpha HHI can be employed as an anti-neoplastic compound, since members of the EGF family show anti-proliferative effects on transformed cells.
  • the subject polypeptide may be administered in a variety of ways, including but not limited to, injection, infusion, topically, parenterally, etc. Administration may be in any physiologically acceptable carrier, including phosphate buffered saline, saline, sterilized water, etc.
  • the TGF alpha HHI polypeptide fragment may also be employed to treat certain kidney disorders, since it has been found that there has been expression of these growth factors in the kidney. Thus, these factors may be necessary for the proper physiological maintenance of this organ.
  • Treatments may also be related to liver regeneration or liver dysfunction, since TGF alpha and its homologs and hepatocyte growth factor trigger hepatocyte regeneration after partial hepatectomy and after acute liver cell necrosis (Masuhara, M. et al, Hepatology 16:1241-1249 (1992)).
  • a significant treatment involving TGF alpha HIH relates to wound healing.
  • the compositions of the present invention may be employed for treating a wide variety of wounds including substantially all cutaneous wounds, corneal wounds, and injuries to the epithelial-lined hollow organs of the body.
  • Wounds suitable for treatment include those resulting from trauma such as burns, abrasions and cuts, as well as from surgical procedures such as surgical incisions and skin grafting
  • Other conditions suitable for treatment with the polypeptide of the present invention include chronic conditions, such as chronic ulcers, diabetic ulcers, and other non-healing (trophic) conditions.
  • TGF alpha HIH or soluble fragment thereof may be inco ⁇ orated in physiologically-acceptable carriers for application to the affected area.
  • a cream or ointment base is usually prefened; suitable bases include lanolin, Silvadene (Marion) (particularly for the treatment of burns), Aquaphor (Duke Laboratories, South Norwalk, Conn.), and the like. If desired, it will be possible to inco ⁇ orate TGF alpha HIH containing compositions in bandages and other wound dressings to provide for continuous exposure of the wound to the peptide. Aerosol applications may also find use.
  • the concentration of TGF alpha HIH in the treatment composition is not critical but should be enough to induce epithelial cell proliferation.
  • the compositions may be applied topically to the affected area, typically as eye drops to the eye or as creams, ointments or lotions to the skin. In the case of the eyes, frequent treatment is desirable, usually being applied at intervals of 4 hours or less. On the skin, it is desirable to continually maintain the treatment composition on the affected area during the healing, with applications of the treatment composition from two to four times a day or more frequently.
  • the amount employed of the subject polypeptide will vary with the manner of administration, the employment of other active compounds, and the like, generally being in the range of about lug to 100 ug.
  • the subject polypeptide may be employed with a physiologically acceptable carrier, such as saline, phosphate-buffered saline, or the like.
  • a physiologically acceptable carrier such as saline, phosphate-buffered saline, or the like.
  • the amount of compound employed will be determined empirically, based on the response of cells in vitro and response of experimental animals to the subject polypeptides or formulations containing the subject polypeptides.
  • TGF alpha HIH or soluble fragment thereof may be employed in the modulation of angiogenesis, bone reso ⁇ tion, immune response, and synaptic and neuronal effector functions.
  • TGF alpha HHI may also be used in the modulation of the arachidonic acid cascade.
  • TGF alpha HIH or soluble fragment thereof may also be employed for applications related to terminal differentiation.
  • Many TGF alpha factors, and their homologs induce terminal differentiation in their target cells. This property can be exploited in vivo by administering the factor and inducing target cell death.
  • This regimen is under consideration for disorders related to the hype ⁇ roliferation of medically undesirable cell types such as cancers and other proliferative disorders (eg inflammation, psoriasis, etc)
  • in vitro administration there are a variety of situations where in vitro administration may be wananted. For example, bone manow can be purged of undesirable cell populations in vitro by treating the cells with growth factors and/or derivatives thereof.
  • TGF alpha Hi ⁇ growth factor Certain disease pathologies may be partially or completely ameliorated by the systemic clinical administration of the TGF alpha Hi ⁇ growth factor.
  • This administration can be in the form of gene therapy (see below) or through the administration of peptides or proteins synthesized from recombinant constructs of TGF alphaHIII DNA or from peptide chemical synthesis (Woo, et al., Protein Engineering 3:29-37 (1989).
  • the gene therapy methods relate to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal to achieve expression of the TGF alpha HIII polypeptide of the present invention.
  • This method requires a polynucleotide which codes for a TGF alpha HIII polypeptide operatively linked to a promoter and any other genetic elements necessary for the expression of the polypeptide by the target tissue.
  • Such gene therapy and delivery techniques are known in the art, see, for example, WO90/1 1092, which is herein inco ⁇ orated by reference.
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) comprising a promoter operably linked to a TGF alpha HIII polynucleotide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • Such methods are well-known in the art. For example, see Belldegrun, A., et al., J. Natl. Cancer Inst. 85: 207-216 (1993); Fenantini, M. et al., Cancer Research 53: 1107- 1 112 (1993); Fenantini, M. et al., J.
  • the cells which are engineered are arterial cells.
  • the arterial cells may be reintroduced into the patient through direct injection to the artery, the tissues sunounding the artery, or through catheter injection.
  • the polypeptides, and agonists and antagonists which are polypeptides, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often refened to as "gene therapy.”
  • cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • a polynucleotide DNA or RNA
  • Such methods are well-known in the art and are apparent from the teachings herein.
  • cells may be engineered by the use of a retroviral plasmid vector containing
  • RNA encoding a polypeptide of the present invention RNA encoding a polypeptide of the present invention.
  • cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art.
  • a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest.
  • These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo.
  • Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency vims, adenovirus, Myeloproliferative
  • the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.
  • the vector includes one or more promoters.
  • Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques Vol. 7,
  • any other promoter e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol HI, and beta-actin promoters.
  • cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol HI, and beta-actin promoters.
  • viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.
  • Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the He ⁇ es Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the beta-actin promoter; and human growth hormone promoters.
  • adenoviral promoters such as the adenoviral major late promoter
  • heterologous promoters such as the cytomegalovirus (CMV) promoter; the respiratory s
  • the promoter also may be the native promoter which controls the gene encoding the polypeptide.
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, psi-2, psi-AM, PA12, T19-14X, VT-19-17-H2, psi-CRE, psi-CREP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is inco ⁇ orated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence (s) encoding the polypeptides.
  • retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo.
  • the transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide.
  • Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.
  • the TGF alpha HIII polynucleotide constructs can be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, and the like).
  • the TGF alpha HHI polynucleotide constructs may be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
  • the TGF alpha HIH polynucleotide is delivered as a naked polynucleotide.
  • naked polynucleotide, DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like.
  • the TGF alpha HHI polynucleotides can also be delivered in liposome formulations and lipofectin formulations and the like can be prepared by methods well known to those skilled in the art. Such methods are described, for example, in U.S. Patent Nos.
  • TGF alpha HIHpolynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication.
  • Appropriate vectors include pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia; and pEFl/V5, pcDNA3.1, and pRc/CMV2 available from Invitrogen.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Suitable promoters include adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the He ⁇ es Simplex thymidine kinase promoter; retroviral LTRs; the b-actin promoter; and human growth hormone promoters.
  • CMV cytomegalovirus
  • RSV respiratory syncytial virus
  • inducible promoters such as the MMT promoter, the metallothionein promoter
  • heat shock promoters such as the albumin promoter
  • the ApoAI promoter the ApoAI promoter
  • the promoter also may be the native promoter for TGF alpha HIH.
  • TGF alpha HIH the native promoter for TGF alpha HIH.
  • one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
  • the TGF alpha HIH polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone manow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue.
  • Interstitial space of the tissues comprises the intercellular, fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone.
  • the interstitial space of muscle tissue is prefened for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.
  • an effective dosage amount of DNA or RNA will be in the range of from about 0.05 mg/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection.
  • the appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration.
  • the prefened route of administration is by the parenteral route of injection into the interstitial space of tissues.
  • naked TGF alpha HIH DNA constructs can be delivered to arteries during angioplasty by the catheter used in the procedure.
  • the naked polynucleotides are delivered by any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, and so-called "gene guns". These delivery methods are known in the art.
  • constructs may also be delivered with delivery vehicles such as viral sequences, viral particles, liposome formulations, lipofectin, precipitating agents, etc. Such methods of delivery are known in the art.
  • the TGF alpha HIH polynucleotide constructs are complexed in a liposome preparation.
  • Liposomal preparations for use in the instant invention include cationic (positively charged), anionic (negatively charged) and neutral preparations.
  • cationic liposomes are particularly prefened because a tight charge complex can be formed between the cationic liposome and the polyanionic nucleic acid.
  • Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al., Proc. Natl. Acad. Sci.
  • Cationic liposomes are readily available. For example,
  • N[l-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are particularly useful and are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Feigner et al., Proc. Natl Acad. Sci. USA (1987) 84:7413-7416, which is herein inco ⁇ orated by reference).
  • Other commercially available liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boehringer).
  • cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g. PCT Publication No. WO 90/11092 (which is herein inco ⁇ orated by reference) for a description of the synthesis of DOTAP (1,2- bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes. Preparation of DOTMA liposomes is explained in the literature, see, e.g., P. Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, which is herein inco ⁇ orated by reference. Similar methods can be used to prepare liposomes from other cationic lipid materials.
  • anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials.
  • Such materials include phosphatidyl, choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others.
  • DOPC dioleoylphosphatidyl choline
  • DOPG dioleoylphosphatidyl glycerol
  • DOPE dioleoylphoshatidyl ethanolamine
  • DOPC dioleoylphosphatidyl choline
  • DOPG dioleoylphosphatidyl glycerol
  • DOPE dioleoylphosphatidyl ethanolamine
  • DOPG/DOPC vesicles can be prepared by drying 50 mg each of DOPG and DOPC under a stream of nitrogen gas into a sonication vial. The sample is placed under a vacuum pump overnight and is hydrated the following day with deionized water.
  • the sample is then sonicated for 2 hours in a capped vial, using a Heat Systems model 350 sonicator equipped with an inverted cup (bath type) probe at the maximum setting while the bath is circulated at 15EC.
  • negatively charged vesicles can be prepared without sonication to produce multilamellar vesicles or by extrusion through nucleopore membranes to produce unilamellar vesicles of discrete size.
  • Other methods are known and available to those of skill in the art.
  • the liposomes can comprise multilamellar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs), with SUVs being prefened.
  • MLVs multilamellar vesicles
  • SUVs small unilamellar vesicles
  • LUVs large unilamellar vesicles
  • the various liposome-nucleic acid complexes are prepared using methods well known in the art. See, e.g., Straubinger et al., Methods of Immunology (1983), 101 :512-527, which is herein inco ⁇ orated by reference.
  • MLVs containing nucleic acid can be prepared by depositing a thin film of phospholipid on the walls of a glass tube and subsequently hydrating with a solution of the material to be encapsulated.
  • SUVs are prepared by extended sonication of MLVs to produce a homogeneous population of unilamellar liposomes.
  • the material to be entrapped is added to a suspension of preformed MLVs and then sonicated.
  • liposomes containing cationic lipids the dried lipid film is resuspended in an appropriate solution such as sterile water or an isotonic buffer solution such as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are mixed directly with the DNA.
  • the liposome and DNA form a very stable complex due to binding of the positively charged liposomes to the cationic DNA.
  • SUVs find use with small nucleic acid fragments.
  • LUVs are prepared by a number of methods, well known in the art. Commonly used methods include Ca 2+ -EDTA chelation (Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483; Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D. and Bangham, A., Biochim. Biophys. Acta (1976) 443:629; Ostro et al., Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc. Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H.
  • the ratio of DNA to liposomes will be from about 10:1 to about 1 :10.
  • the ration will be from about 5:1 to about 1 :5. More preferably, the ration will be about 3:1 to about 1 :3. Still more preferably, the ratio will be about 1:1.
  • U.S. Patent No. 5,676,954 (which is herein inco ⁇ orated by reference) reports on the injection of genetic material, complexed with cationic liposomes caniers, into mice.
  • WO 94/9469 (which are herein inco ⁇ orated by reference) provide cationic lipids for use in transfecting DNA into cells and mammals.
  • WO 94/9469 (which are herein inco ⁇ orated by reference) provide methods for delivering DNA-cationic lipid complexes to mammals.
  • cells are engineered, ex vivo or in vivo, using a retroviral particle containing RNA which comprises a sequence encoding TGF alpha HHI.
  • Retroviruses from which the retroviral plasmid vectors may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, Rous sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X, VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy 1 :5-14 (1990), which is inco ⁇ orated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include polynucleotide encoding TGF alpha HHI. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express TGF alpha HIH. In certain other embodiments, cells are engineered, ex vivo or in vivo, with TGF alpha HIH polynucleotide contained in an adenovirus vector. Adenovirus can be manipulated such that it encodes and expresses TGF alpha HIH, and at the same time is inactivated in terms of its ability to replicate in a normal lytic viral life cycle.
  • Adenovirus expression is achieved without integration of the viral DNA into the host cell chromosome, thereby alleviating concerns about insertional mutagenesis.
  • adenoviruses have been used as live enteric vaccines for many years with an excellent safety profile (Schwartz, A. R. et al. (1974) Am. Rev. Respir. Dis.l09:233-238).
  • adenovirus mediated gene transfer has been demonstrated in a number of instances including transfer of alpha- 1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld et al., (1992) Cell 68:143-155).
  • extensive studies to attempt to establish adenovirus as a causative agent in human cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl. Acad. Sci. USA 76:6606).
  • Suitable adenoviral vectors useful in the present invention are described, for example, in Kozarsky and Wilson, Cun. Opin. Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155 (1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993); Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature 365:691-692 (1993); and U.S. Patent No. 5,652,224, which are herein inco ⁇ orated by reference.
  • the adenovirus vector Ad2 is useful and can be grown in human 293 cells.
  • These cells contain the El region of adenovirus and constitutively express Ela and Elb, which complement the defective adenoviruses by providing the products of the genes deleted from the vector.
  • Ad2 other varieties of adenovirus (e.g., Ad3, Ad5, and Ad7) are also useful in the present invention.
  • the adenoviruses used in the present invention are replication deficient.
  • Replication deficient adenoviruses require the aid of a helper virus and/or packaging cell line to form infectious particles.
  • the resulting virus is capable of infecting cells and can express a polynucleotide of interest which is operably linked to a promoter, but cannot replicate in most cells.
  • Replication deficient adenoviruses may be deleted in one or more of all or a portion of the following genes: Ela, Elb, E3, E4, E2a, or LI through L5.
  • the cells are engineered, ex vivo or in vivo, using an adeno-associated virus (AAV).
  • AAV adeno-associated virus
  • AAVs are naturally occuning defective viruses that require helper viruses to produce infectious particles (Muzyczka, N., Cun. Topics in Microbiol. Immunol. 158:97 (1992)). It is also one of the few viruses that may integrate its DNA into non-dividing cells. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods for producing and using such AAVs are known in the art. See, for example, U.S. Patent Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and 5,589,377.
  • an appropriate AAV vector for use in the present invention will include all the sequences necessary for DNA replication, encapsidation, and host-cell integration.
  • the TGF alpha HIH polynucleotide construct is inserted into the AAV vector using standard cloning methods, such as those found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989).
  • the recombinant AAV vector is then transfected into packaging cells which are infected with a helper virus, using any standard technique, including lipofection, electroporation, calcium phosphate precipitation, etc.
  • helper viruses include adenoviruses, cytomegaloviruses, vaccinia viruses, or he ⁇ es viruses.
  • packaging cells Once the packaging cells are transfected and infected, they will produce infectious AAV viral particles which contain the TGF alpha HHI polynucleotide construct. These viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo. The transduced cells will contain the TGF alpha HIH polynucleotide construct integrated into its genome, and will express TGF alpha HIH.
  • Another method of gene therapy involves operably associating heterologous control regions and endogenous polynucleotide sequences (e.g.
  • Polynucleotide constructs are made, using standard techniques known in the art, which contain the promoter with targeting sequences flanking the promoter. Suitable promoters are described herein.
  • the targeting sequence is sufficiently complementary to an endogenous sequence to permit homologous recombination of the promoter-targeting sequence with the endogenous sequence.
  • the targeting sequence will be sufficiently near the 5' end of the TGF alpha HHI desired endogenous polynucleotide sequence so the promoter will be operably linked to the endogenous sequence upon homologous recombination.
  • the promoter and the targeting sequences can be amplified using PCR.
  • the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends.
  • the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter.
  • the amplified promoter and targeting sequences are digested and ligated together.
  • the promoter-targeting sequence construct is delivered to the cells, either as naked polynucleotide, or in conjunction with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitating agents, etc., described in more detail above.
  • the P promoter-targeting sequence can be delivered by any method, included direct needle injection, intravenous injection, topical administration, catheter infusion, particle accelerators, etc. The methods are described in more detail below.
  • the promoter-targeting sequence construct is taken up by cells. Homologous recombination between the construct and the endogenous sequence takes place, such that an endogenous TGF alpha HIH sequence is placed under the control of the promoter. The promoter then drives the expression of the endogenous TGF alpha HHI sequence.
  • the polynucleotides encoding TGF alpha HHI may be administered along with other polynucleotides encoding an angiogenic protein.
  • angiogenic proteins include, but are not limited to, acidic and basic fibroblast growth factors, VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and beta, platelet-derived endothelial cell growth factor, platelet-derived growth factor, tumor necrosis factor alpha, hepatocyte growth factor, insulin like growth factor, colony stimulating factor, macrophage colony stimulating factor, granulocyte/macrophage colony stimulating factor, and nitric oxide synthase.
  • the polynucleotide encoding TGF alpha HHI contains a secretory signal sequence that facilitates secretion of the protein.
  • the signal sequence is positioned in the coding region of the polynucleotide to be expressed towards or at the 5' end of the coding region.
  • the signal sequence may be homologous or heterologous to the polynucleotide of interest and may be homologous or heterologous to the cells to be transfected. Additionally, the signal sequence may be chemically synthesized using methods known in the art.
  • any mode of administration of any of the above-described polynucleotides constructs can be used so long as the mode results in the expression of one or more molecules in an amount sufficient to provide a therapeutic effect.
  • This includes direct needle injection, systemic injection, catheter infusion, biolistic injectors, particle accelerators (i.e., "gene guns"), gelfoam sponge depots, other commercially available depot materials, osmotic pumps
  • a preferred method of local administration is by direct injection.
  • a recombinant molecule of the present invention complexed with a delivery vehicle is administered by direct injection into or locally within the area of arteries.
  • Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries.
  • Another method of local administration is to contact a polynucleotide construct of the present invention in or around a surgical wound.
  • a patient can undergo surgery and the polynucleotide construct can be coated on the surface of tissue inside the wound or the construct can be injected into areas of tissue inside the wound.
  • compositions useful in systemic administration include recombinant molecules of the present invention complexed to a targeted delivery vehicle of the present invention.
  • Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site.
  • Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using methods standard in the art (see, for example, Stribling et al., Proc. Natl. Acad. Sci. USA 189:11277-11281, 1992, which is inco ⁇ orated herein by reference).
  • Oral delivery can be performed by complexing a polynucleotide construct of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such caniers, include plastic capsules or tablets, such as those known in the art.
  • Topical delivery can be performed by mixing a polynucleotide construct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
  • a lipophilic reagent e.g., DMSO
  • Determining an effective amount of substance to be delivered can depend upon a number of factors including, for example, the chemical structure and biological activity of the substance, the age and weight of the animal, the precise condition requiring treatment and its severity, and the route of administration.
  • the frequency of treatments depends upon a number of factors, such as the amount of polynucleotide constructs administered per dose, as well as the health and history of the subject. The precise amount, number of doses, and timing of doses will be determined by the attending physician or veterinarian.
  • compositions of the present invention can be administered to any animal, preferably to mammals and birds.
  • Prefened mammals include humans, dogs, cats, mice, rats, rabbits sheep, cattle, horses and pigs, with humans being particularly prefened.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI can be used in assays to test for one or more biological activities. If TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, do exhibit activity in a particular assay, it is likely that TGF alpha HHI may be involved in the diseases associated with the biological activity. Therefore, TGF alpha HIH could be used to treat the associated disease.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
  • Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
  • the etiology of these immune deficiencies or disorders may be genetic, somatic, such as cancer or some autoimmune disorders, acquired (e.g., by chemotherapy or toxins), or infectious.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI can be used as a marker or detector of a particular immune system disease or disorder.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may be useful in treating or detecting deficiencies or disorders of hematopoietic cells.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells.
  • immunologic deficiency syndromes include, but are not limited to: blood protein disorders (e.g.
  • agammaglobulinemia agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
  • SIDs severe combined immunodeficiency
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation).
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment of heart attacks (infarction), strokes, or scarring.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may also be useful in treating or detecting autoimmune disorders.
  • Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destruction of the host tissue. Therefore, the administration of TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune disorders.
  • autoimmune disorders examples include, but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Pu ⁇ ura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Bane Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
  • allergic reactions and conditions such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated by TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI.
  • these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may also be used to treat and/or prevent organ rejection or graft- versus-host disease (GVHD).
  • Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response.
  • an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
  • the administration of TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells may be an effective therapy in preventing organ rejection or GVHD.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI may also be used to modulate inflammation.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
  • These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
  • cytokines e.g., TNF or IL-1.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI can be used to treat or detect hype ⁇ roliferative disorders, including neoplasms.
  • HIH may inhibit the proliferation of the disorder through direct or indirect interactions.
  • TGF alpha HIII may proliferate other cells which can inhibit the hype ⁇ roliferative disorder.
  • hype ⁇ roliferative disorders can be treated.
  • This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • decreasing an immune response may also be a method of treating hype ⁇ roliferative disorders, such as a chemotherapeutic agent. Examples of hype ⁇ roliferative disorders that can be treated or detected by TGF alpha
  • HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH include, but are not limited to neoplasms located in thexolon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
  • neoplasms located in thexolon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thora
  • TGF alpha HHI polynucleotides or polypeptides can also be treated or detected by TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI.
  • hype ⁇ roliferative disorders include, but are not limited to: hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias, pu ⁇ ura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hype ⁇ roliferative disease, besides neoplasia, located in an organ system listed above.
  • One prefened embodiment utilizes polynucleotides of the present invention to inhibit abenant cellular division, by gene therapy using the present invention, and/or protein fusions or fragments thereof.
  • the present invention provides a method for treating cell proliferative disorders by inserting into an abnormally proliferating cell a polynucleotide of the present invention, wherein said polynucleotide represses said expression.
  • polynucleotides of the present invention is a DNA construct comprising a recombinant expression vector effective in expressing a DNA sequence encoding said polynucleotides.
  • the DNA construct encoding the poynucleotides of the present invention is inserted into cells to be treated utilizing a retrovirus, or more prefenably an adenoviral vector (See G J. Nabel, et.
  • the viral vector is defective and will not transform non-proliferating cells, only proliferating cells.
  • the polynucleotides of the present invention inserted into proliferating cells either alone, or in combination with or fused to other polynucleotides can then be modulated via an external stimulus (i.e. magnetic, specific small molecule, chemical, or drug administration, etc.), which acts upon the promoter upstream of said polynucleotides to induce expression of the encoded protein product.
  • an external stimulus i.e. magnetic, specific small molecule, chemical, or drug administration, etc.
  • the beneficial therapeutic affect of the present invention may be expressly modulated (i.e. to increase, decrease, or inhibit expression of the present invention) based upon said external stimulus.
  • Polynucleotides of the present invention may be useful in repressing expression of oncogenic genes or antigens.
  • repressing expression of the oncogenic genes is intended the suppression of the transcription of the gene, the degradation of the gene transcript (pre- message RNA), the inhibition of splicing, the destruction of the messenger RNA, the prevention of the post-translational modifications of the protein, the destruction of the protein, or the inhibition of the normal function of the protein.
  • polynucleotides of the present invention may be administered by any method known to those of skill in the art including, but not limited to transfection, electroporation, microinjection of cells, or in vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any other method described throughout the specification.
  • the polynucleotide of the present invention may be delivered by known gene delivery systems such as, but not limited to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci. U.S.A.
  • vaccinia virus system Chokrabarty et al., Mol. Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812 (1985)) known to those skilled in the art.
  • vaccinia virus system Chokrabarty et al., Mol. Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812 (1985)) known to those skilled in the art.
  • retrovirus or adenoviral (as described in the art and elsewhere herein) delivery system known to those of skill in the art. Since host DNA replication is required for retroviral DNA to integrate and the retrovirus will be unable to self replicate due to the lack of the retrovirus genes needed for its life cycle. Utilizing such a retroviral delivery system for polynucleotides of the present invention will target said gene and constructs to abnormally proliferating cells and will spare the non- dividing normal cells.
  • the polynucleotides of the present invention may be delivered directly to cell proliferative disorder/disease sites in internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the disease site.
  • the polynucleotides of the present invention may also be administered to disease sites at the time of surgical intervention.
  • cell proliferative disease any human or animal disease or disorder, affecting any one or any combination of organs, cavities, or body parts, which is characterized by single or multiple local abnormal proliferations of cells, groups of cells, or tissues, whether benign or malignant. Any amount of the polynucleotides of the present invention may be administered as long as it has a biologically inhibiting effect on the proliferation of the treated cells. Moreover, it is possible to administer more than one of the polynucleotide of the present invention simultaneously to the same site.
  • biologically inhibiting is meant partial or total growth inhibition as well as decreases in the rate of proliferation or growth of the cells.
  • the biologically inhibitory dose may be determined by assessing the effects of the polynucleotides of the present invention on target malignant or abnormally proliferating cell growth in tissue culture, tumor growth in animals and cell cultures, or any other method known to one of ordinary skill in the art.
  • the present invention is further directed to antibody-based therapies which involve administering of anti-polypeptides and anti-polynucleotide antibodies to a mammalian, preferably human, patient for treating one or more of the described disorders.
  • antibody-based therapies involve administering of anti-polypeptides and anti-polynucleotide antibodies to a mammalian, preferably human, patient for treating one or more of the described disorders.
  • Methods for producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and monoclonal antibodies are described in detail elsewhere herein. Such antibodies may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • a summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below.
  • the antibodies, fragments and derivatives of the present invention are useful for treating a subject having or developing cell proliferative and/or differentiation disorders as described herein.
  • Such treatment comprises administering a single or multiple doses of the antibody, or a fragment, derivative, or a conjugate thereof.
  • the antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors, for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
  • Prefened binding affinities include those with a dissociation constant or Kd less than 5X10 "6 M, 10 "6 M, 5X10 “7 M, 10 “7 M, 5X10 “8 M, 10 “8 M, 5X10 "9 M, 10 "9 M, 5X10 "I0 M, 10 "10 M, 5X10 " ⁇ M, 10 "n M, 5X10 "12 M, 10 “12 M, 5X10 "13 M, 10 " 13 M, 5X10 "14 M, 10 "14 M, 5X10 "15 M, and 10 "15 M.
  • polypeptides of the present invention are useful in inhibiting the angiogenesis of proliferative cells or tissues, either alone, as a protein fusion, or in combination with other polypeptides directly or indirectly, as described elsewhere herein.
  • said anti-angiogenesis effect may be achieved indirectly, for example, through the inhibition of hematopoietic, tumor-specific cells, such as tumor- associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90(21):1648-53 (1998), which is hereby inco ⁇ orated by reference).
  • Antibodies directed to polypeptides or polynucleotides of the present invention may also result in inhibition of angiogenesis directly, or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17(2): 155-61 (1998), which is hereby inco ⁇ orated by reference)).
  • Polypeptides including protein fusions, of the present invention, or fragments thereof may be useful in inhibiting proliferative cells or tissues through the induction of apoptosis.
  • Said polypeptides may act either directly, or indirectly to induce apoptosis of proliferative cells and tissues, for example in the activation of a death-domain receptor, such as tumor necrosis factor (TNF) receptor- 1, CD95 (Fas/APO-1), TNF-recep tor-related apoptosis- mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL) receptor- 1 and -2 (See Schulze-Osthoff K, etal., Eur J Biochem 254(3):439-59 (1998), which is hereby inco ⁇ orated by reference).
  • TNF tumor necrosis factor
  • TRAMP TNF-recep tor-related apoptosis- mediated protein
  • TRAIL TNF-related
  • said polypeptides may induce apoptosis through other mechanisms, such as in the activation of other proteins which will activate apoptosis, or through stimulating the expression of said proteins, either alone or in combination with small molecule drugs or adjuviants, such as apoptonin, galectins, thioredoxins, antiinflammatory proteins (See for example, Mutat Res 400(1 -2):447-55 (1998), Med Hypotheses.50(5):423-33 (1998), Chem Biol Interact.
  • Polypeptides, including protein fusions to, or fragments thereof, of the present invention are useful in inhibiting the metastasis of proliferative cells or tissues.
  • Inhibition may occur as a direct result of administering polypeptides, or antibodies directed to said polypeptides as described elsewere herein, or indirectly, such as activating the expression of proteins known to inhibit metastasis, for example alpha 4 integrins, (See, e.g., Cun Top Microbiol Immunol 1998;231 :125-41, which is hereby inco ⁇ orated by reference).
  • Such thereapeutic affects of the present invention may be achieved either alone, or in combination with small molecule drugs or adjuvants.
  • the invention provides a method of delivering compositions containing the polypeptides of the invention (e.g., compositions containing polypeptides or polypeptide antibodes associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs) to targeted cells expressing the polypeptide of the present invention.
  • compositions containing the polypeptides of the invention e.g., compositions containing polypeptides or polypeptide antibodes associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs
  • Polypeptides or polypeptide antibodes of the invention may be associated with with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
  • Polypeptides, protein fusions to, or fragments thereof, of the present invention are useful in enhancing the immunogenicity and/or antigenicity of proliferating cells or tissues, either directly, such as would occur if the polypeptides of the present invention 'vaccinated' the immune response to respond to proliferative antigens and immunogens, or indirectly, such as in activating the expression of proteins known to enhance the immune response (e.g. chemokines), to said antigens and immunogens.
  • proteins known to enhance the immune response e.g. chemokines
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, encoding TGF alpha HHI may be used to treat cardiovascular disorders, including peripheral artery disease, such as limb ischemia.
  • Cardiovascular disorders include cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome.
  • Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dexfrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal defects.
  • Cardiovascular disorders also include heart disease, such as anhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac anest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart rupture, ventricular septal rupture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
  • heart disease such as anhythmias, carcinoid heart disease
  • Arrhythmias include sinus anhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation.
  • Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
  • Heart valve disease include aortic valve insufficiency, aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
  • Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
  • Myocardial ischemias include coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
  • Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel- Trenaunay- Weber Syndrome, Sturge- Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemonhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal vein
  • Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
  • Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstruction, retinal artery occlusion, and thromboangiitis obliterans.
  • Cerebrovascular disorders include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemonhage, epidural hematoma, subdural hematoma, subaraxhnoid hemonhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
  • Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms.
  • Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.
  • Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia.
  • Vasculitis includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch pu ⁇ ura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH are especially effective for the treatment of critical limb ischemia and coronary disease.
  • TGF alpha HIH polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art.
  • TGF alpha HHI polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering TGF alpha HHI polynucleotides are described in more detail herein.
  • angiogenesis is stringently regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as that characterizing solid tumor growth, these regulatory controls fail. Unregulated angiogenesis becomes pathologic and sustains progression of many neoplastic and non- neoplastic diseases.
  • a number of serious diseases are dominated by abnormal neovascularization including solid tumor growth and metastases, arthritis, some types of eye disorders, and psoriasis. See, e.g., reviews by Moses et al, Biotech. 9:630-634 (1991); Folkman et al, N. Engl. J. Med., 333:1151-1763 (1995); Auerbach et al, J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol 94:115-143 (1982); and Folkman et al, Science 221:719-125 (1983).
  • the present invention provides for treatment of diseases or disorders associated with neovascularization by administration of the polynucleotides and/or polypeptides of the invention, as well as agonists or antagonists of the present invention.
  • Malignant and metastatic conditions which can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention include, but are not limited to, malignancies, solid tumors, and cancers described herein and otherwise known in the art (for a review of such disorders, see Fishman et al, Medicine, 2d Ed., J. B.
  • the present invention provides a method of treating an angiogenesis-related disease and/or disorder, comprising administering to an individual in need thereof a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist of the invention.
  • a polynucleotide, polypeptide, antagonists and/or agonist of the invention may be utilized in a variety of additional methods in order to therapeutically treat a cancer or tumor.
  • Cancers which may be treated with polynucleotides, polypeptides, antagonists and/or agonists include, but are not limited to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, uterus, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non- small cell lung cancer; colorectal cancer; advanced malignancies; and blood bom tumors such as leukemias.
  • polynucleotides, polypeptides, antagonists and/or agonists may be delivered topically, in order to treat cancers such as skin cancer, head and neck tumors, breast tumors, and Kaposi's sarcoma.
  • polynucleotides, polypeptides, antagonists and/or agonists may be utilized to treat superficial forms of bladder cancer by, for example, intravesical administration.
  • Polynucleotides, polypeptides, antagonists and/or agonists may be delivered directly into the tumor, or near the tumor site, via injection or a catheter.
  • the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.
  • Polynucleotides, polypeptides, antagonists and/or agonists may be useful in treating other disorders, besides cancers, which involve angiogenesis.
  • disorders include, but are not limited to: benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids); nonunion fractures;
  • methods for treating hypertrophic scars and keloids comprising the step of administering a polynucleotide, polypeptide, antagonist and/or agonist of the invention to a hypertrophic scar or keloid.
  • polynucleotides, polypeptides, antagonists and/or agonists are directly injected into a hypertrophic scar or keloid, in order to prevent the progression of these lesions.
  • This therapy is of particular value in the prophylactic treatment of conditions which are known to result in the development of hypertrophic scars and keloids (e.g., bums), and is preferably initiated after the proliferative phase has had time to progress (approximately 14 days after the initial injury), but before hypertrophic scar or keloid development.
  • the present invention also provides methods for treating neovascular diseases of the eye, including for example, corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
  • neovascular diseases of the eye including for example, corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
  • Ocular disorders associated with neovascularization which can be treated with the polynucleotides and polypeptides of the present invention (including agonists and/or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity macular degeneration, comeal graft neovascularization, as well as other eye inflammatory diseases, ocular tumors and diseases associated with choroidal or iris neovascularization. See, e.g., reviews by Waltman et al, Am. J. Ophthal 55:704-710 (1978) and Gartner et al, Surv. Ophthal 22:291-312 (1978).
  • neovascular diseases of the eye such as comeal neovascularization (including comeal graft neovascularization)
  • a therapeutically effective amount of a compound (as described above) to the cornea such that the formation of blood vessels is inhibited.
  • the cornea is a tissue which normally lacks blood vessels.
  • capillaries may extend into the cornea from the pericomeal vascular plexus of the limbus.
  • the cornea becomes vascularized, it also becomes clouded, resulting in a decline in the patient's visual acuity. Visual loss may become complete if the cornea completely opacitates.
  • a wide variety of disorders can result in comeal neovascularization, including for example, corneal infections (e.g., trachoma, he ⁇ es simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (e.g., graft rejection and Stevens- Johnson's syndrome), alkali bums, trauma, inflammation (of any cause), toxic and nutritional deficiency states, and as a complication of wearing contact lenses.
  • corneal infections e.g., trachoma, he ⁇ es simplex keratitis, leishmaniasis and onchocerciasis
  • immunological processes e.g., graft rejection and Stevens- Johnson's syndrome
  • alkali bums e.g., trauma, inflammation (of any cause), toxic and nutritional deficiency states, and as a complication of wearing contact lenses.
  • prefened embodiments of the invention may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations), and administered in eyedrop form.
  • the solution or suspension may be prepared in its pure form and administered several times daily.
  • anti-angiogenic compositions prepared as described above, may also be administered directly to the cornea.
  • the anti-angiogenic composition is prepared with a muco-adhesive polymer which binds to cornea.
  • the anti-angiogenic factors or anti-angiogenic compositions may be utilized as an adjunct to conventional steroid therapy.
  • Topical therapy may also be useful prophylactically in comeal lesions which are known to have a high probability of inducing an angiogenic response (such as chemical bums). In these instances the treatment, likely in combination with steroids, may be instituted immediately to help prevent subsequent complications.
  • the compounds described above may be injected directly into the comeal stroma by an ophthalmologist under microscopic guidance.
  • the prefened site of injection may vary with the mo ⁇ hology of the individual lesion, but the goal of the administration would be to place the composition at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal cornea). In most cases this would involve perilimbic comeal injection to "protect" the cornea from the advancing blood vessels.
  • This method may also be utilized shortly after a comeal insult in order to prophylactically prevent comeal neovascularization. In this situation the material could be injected in the perilimbic cornea interspersed between the comeal lesion and its undesired potential limbic blood supply.
  • Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted corneas.
  • sustained-release form injections might only be required 2-3 times per year.
  • a steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.
  • methods for treating neovascular glaucoma, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited.
  • the compound may be administered topically to the eye in order to treat early forms of neovascular glaucoma.
  • the compound may be implanted by injection into the region of the anterior chamber angle.
  • the compound may also be placed in any location such that the compound is continuously released into the aqueous humor.
  • methods for treating proliferative diabetic retinopathy, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eyes, such that the formation of blood vessels is inhibited.
  • proliferative diabetic retinopathy may be treated by injection into the aqueous humor or the vitreous, in order to increase the local concentration of the polynucleotide, polypeptide, antagonist and/or agonist in the retina.
  • this treatment should be initiated prior to the acquisition of severe disease requiring photocoagulation.
  • methods for treating retrolental fibroplasia comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited.
  • the compound may be administered topically, via intravitreous injection and/or via intraocular implants.
  • disorders which can be treated with the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osier- Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.
  • disorders and/or states, which can be treated with be treated with the the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, solid tumors, blood bom tumors such as leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, comeal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vascluogenesis, granulations, hypertrophic scars (keloids), nonunion
  • an amount of the compound sufficient to block embryo implantation is administered before or after intercourse and fertilization have occuned, thus providing an effective method of birth control, possibly a "morning after" method.
  • Polynucleotides, polypeptides, agonists and/or agonists may also be used in controlling menstruation or administered as either a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis.
  • Polynucleotides, polypeptides, agonists and/or agonists of the present invention may be inco ⁇ orated into surgical sutures in order to prevent stitch granulomas.
  • compositions in the form of, for example, a spray or film
  • a compositions may be utilized to coat or spray an area prior to removal of a tumor, in order to isolate normal sunounding tissues from malignant tissue, and/or to prevent the spread of disease to sunounding tissues.
  • compositions e.g., in the form of a spray
  • surgical meshes which have been coated with anti- angiogenic compositions of the present invention may be utilized in any procedure wherein a surgical mesh might be utilized.
  • a surgical mesh laden with an anti-angiogenic composition may be utilized during abdominal cancer resection surgery (e.g., subsequent to colon resection) in order to provide support to the structure, and to release an amount of the anti-angiogenic factor.
  • methods for treating tumor excision sites, comprising administering a polynucleotide, polypeptide, agonist and/or agonist to the resection margins of a tumor subsequent to excision, such that the local recunence of cancer and the formation of new blood vessels at the site is inhibited.
  • the anti-angiogenic compound is administered directly to the tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic compound).
  • the anti-angiogenic compounds may be inco ⁇ orated into known surgical pastes prior to administration.
  • the anti-angiogenic compounds are applied after hepatic resections for malignancy, and after neurosurgical operations.
  • polynucleotides, polypeptides, agonists and/or agonists may be administered to the resection margin of a wide variety of tumors, including for example, breast, colon, brain and hepatic tumors.
  • anti-angiogenic compounds may be administered to the site of a neurological tumor subsequent to excision, such that the formation of new blood vessels at the site are inhibited.
  • polynucleotides, polypeptides, agonists and/or agonists of the present invention may also be administered along with other anti-angiogenic factors.
  • anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, Plasminogen Activator Inhibitor- 1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals.
  • Lighter "d group” transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes.
  • vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes.
  • Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate.
  • Suitable vanadyl complexes include, for example, vanadyl acetyl acetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates.
  • Representative examples of tungsten and molybdenum complexes also include oxo complexes.
  • Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes.
  • Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid.
  • Suitable tungsten oxides include tungsten (IV) oxide and tungsten (VI) oxide.
  • Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes.
  • Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates.
  • Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid.
  • Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate.
  • Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.
  • a wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res.
  • SP- PG Sulphated Polysaccharide Peptidoglycan Complex
  • the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-2(3H)- oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J.
  • TGF alpha HIH polynucleotides or polypeptides include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, and others).
  • cancers such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited
  • TGF alpha HIII polynucleotides, polypeptides, and/or antagonists of the invention are used to inhibit growth, progression, and/or metasis of cancers, in particular those listed above.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but
  • TGF alpha HIH polynucleotides or polypeptides as well as agonists or antagonists of TGF alpha
  • HIH include ADDS; neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease); autoimmune disorders (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cinhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia), graft v.
  • ADDS neurodegenerative disorders
  • Parkinson's disease Amyotrophic lateral sclerosis
  • Retinitis pigmentosa Cerebellar degeneration and brain tumor or prior associated disease
  • autoimmune disorders such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, bili
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • liver injury e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer
  • toxin-induced liver disease such as that caused by alcohol
  • septic shock cachexia and anorexia.
  • TGF alpha HIH polynucleotides or polypeptides as well as agonists or antagonists of TGF alpha HIH, for therapeutic pu ⁇ oses, for example, to stimulate epithelial cell proliferation and basal keratinocytes for the pu ⁇ ose of wound healing, and to stimulate hair follicle production and healing of dermal wounds.
  • TGF alpha HIH polynucleotides or polypeptides may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, bums resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associted with systemic treatment with steroids, radiation therapy and antineoplastic drugs and antimetabolites.
  • TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH could be used to promote dermal reestablishment subsequent to dermal loss
  • TGF alpha HHI polynucleotides or polypeptides could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
  • TGF alpha HIII polynucleotides or polypeptides, agonists or antagonists of TGF alpha HIH could be used to increase adherence to a wound bed: autografts, artificial skin, allografts, autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts, bone graft, brephoplastic grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia graft, full thickness graft, heterologous graft, xenograft, homologous graft, hype ⁇ lastic graft, lamellar graft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft, penetrating graft, split skin graft, thick split graft
  • TGF alpha HIII polynucleotides or polypeptides can be used to promote skin strength and to improve the appearance of aged skin. It is believed that TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH, will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in the lung, breast, pancreas, stomach, small intesting, and large intestine.
  • TGF alpha HHI polynucleotides or polypeptides could promote proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type H pneumocytes, mucin-producing goblet cells, and other epithelial cells and their progenitors contained within the skin, lung, liver, and gastrointestinal tract.
  • TGF alpha HIH polynucleotides or polypeptides, agonists or antagonists of TGF alpha HHI may promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.
  • TGF alpha HHI polynucleotides or polypeptides could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections.
  • TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH may have a cytoprotective effect on the small intestine mucosa.
  • TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HHI may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections.
  • TGF alpha HIH polynucleotides or polypeptides could further be used in full regeneration of skin in full and partial thickness skin defects, including bums, (i.e., repopulation of hair follicles, sweat glands, and sebaceous glands), treatment of other skin defects such as psoriasis.
  • TGF alpha HIH polynucleotides or polypeptides could be used to treat epidermo lysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating reepithelialization of these lesions.
  • TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH could also be used to treat gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly.
  • TGF alpha HHI polynucleotides or polypeptides as well as agonists or antagonists of TGF alpha HIII, could be used to promote the resurfacing of the mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease.
  • TGF alpha HHI polynucleotides or polypeptides, agonists or antagonists of TGF alpha HIH is expected to have a significant effect on the production of mucus throughout the gastrointestinal tract and could be used to protect the intestinal mucosa from injurious substances that are ingested or following surgery.
  • TGF alpha H ⁇ i polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HHI could be used to treat diseases associate with the under expression of TGF alpha HHI.
  • TGF alpha HHI polynucleotides or polypeptides could be used to prevent and heal damage to the lungs due to various pathological states.
  • a growth factor such as TGF alpha HHI polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH, which could stimulate proliferation and differentiation and promote the repair of alveoli and brochiolar epithelium to prevent or treat acute or chronic lung damage.
  • emphysema which results in the progressive loss of aveoli, and inhalation injuries, i.e., resulting from smoke inhalation and bums, that cause necrosis of the bronchiolar epithelium and alveoli could be effectively treated using TGF alpha HIH polynucleotides or polypeptides, agonists or antagonists of TGF alpha HIH.
  • TGF alpha HHI polynucleotides or polypeptides could be used to stimulate the proliferation of and differentiation of type ⁇ pneumocytes, which may help treat or prevent disease such as hyaline membrane diseases, such as infant respiratory distress syndrome and bronchopulmonary displasia, in premature infants.
  • TGF alpha HIII could stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat liver diseases and pathologies such as fulminant liver failure caused by cinhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
  • TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH could be used treat or prevent the onset of diabetes mellitus.
  • TGF alpha HIH polynucleotides or polypeptides in patients with newly diagnosed Types I and H diabetes, where some islet cell function remains, TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HIH, could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease. Also, TGF alpha HIH polynucleotides or polypeptides, as well as agonists or antagonists of TGF alpha HHI, could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
  • Nervous system disorders which can be treated with the TGF alpha HHI compositions of the invention (e.g., TGF alpha HHI polypeptides, polynucleotides, and/or agonists or antagonists), include, but are not limited to, nervous system injuries, and diseases or disorders which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination.
  • TGF alpha HHI compositions of the invention include, but are not limited to, nervous system injuries, and diseases or disorders which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination.
  • Nervous system lesions which may be treated in a patient (including human and non-human mammalian patients) according to the invention, include but are not limited to, the following lesions of either the central (including spinal cord, brain) or peripheral nervous systems: (1) ischemic lesions, in which a lack of oxygen in a portion of the nervous system results in neuronal injury or death, including cerebral infarction or ischemia, or spinal cord infarction or ischemia; (2) traumatic lesions, including lesions caused by physical injury or associated with surgery, for example, lesions which sever a portion of the nervous system, or compression injuries; (3) malignant lesions, in which a portion of the nervous system is destroyed or injured by malignant tissue which is either a nervous system associated malignancy or a malignancy derived from non-nervous system tissue; (4) infectious lesions, in which a portion of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency vims, he ⁇ es
  • the TGF alpha HHI polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neural cells from the damaging effects of cerebral hypoxia.
  • the TGF alpha HIH compositions of the invention are used to treat or prevent neural cell injury associated with cerebral hypoxia.
  • the TGF alpha HHI polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with cerebral ischemia.
  • the TGF alpha Hi ⁇ polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with cerebral infarction.
  • the TGF alpha HHI polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with a stroke.
  • the TGF alpha HIH polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat or prevent neural cell injury associated with a heart attack.
  • compositions of the invention which are useful for treating or preventing a nervous system disorder may be selected by testing for biological activity in promoting the survival or differentiation of neurons.
  • TGF alpha HIH compositions of the invention which elicit any of the following effects may be useful according to the invention: (1) increased survival time of neurons in culture; (2) increased sprouting of neurons in culture or in vivo; (3) increased production of a neuron-associated molecule in culture or in vivo, e.g., choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or (4) decreased symptoms of neuron dysfunction in vivo.
  • Such effects may be measured by any method known in the art.
  • increased survival of neurons may routinely be measured using a method set forth herein or otherwise known in the art, such as, for example, the method set forth in Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased sprouting of neurons may be detected by methods known in the art, such as, for example, the methods set forth in Pestronk et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci.
  • neuron-associated molecules may be measured by bioassay, enzymatic assay, antibody binding, Northern blot assay, etc., using techniques known in the art and depending on the molecule to be measured; and motor neuron dysfunction may be measured by assessing the physical manifestation of motor neuron disorder, e.g., weakness, motor neuron conduction velocity, or functional disability.
  • motor neuron disorders that may be treated according to the invention include, but are not limited to, disorders such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as disorders that selectively affect neurons such as amyotrophic lateral sclerosis, and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio- Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary Motorsensory Neuropathy (Charcot-Marie-Tooth Disease).
  • disorders such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as disorders that selectively affect neurons such as amyotrophic lateral sclerosis, and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar
  • epilepsy such as generalized epilepsy which includes infantile spasms, absence epilepsy, myoclonic epilepsy which includes MERRF Syndrome, tonic-clonic epilepsy, partial epilepsy such as complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, status epilepticus such as Epilepsia Partialis Continua, Hallervorden-Spatz Syndrome, hydrocephalus such as Dandy-Walker Syndrome and normal pressure hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms, cerebral malaria, n
  • Bacterial meningtitis which includes Haemophilus Meningtitis, Listeria Meningtitis, Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis and meningeal tuberculosis, fungal meningitis such as Cryptococcal Meningtitis, subdural effusion, meningoencephalitis such as uvemeningoencephalitic syndrome, myelitis such as transverse myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which includes bulbar poliomyelitis and postpoliomyelitis syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome, Ku , Scrapie) cerebral toxoplasmosis, central nervous system neoplasms such as brain neoplasms that include cerebellear neoplasms such
  • Postpoliomyelitis Syndrome Muscular Dystrophy, Myasthenia Gravis, Myotonia Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial Periodic Paralysis, Multiplex Paramyloclonus, Tropical Spastic Paraparesis and Stiff-Man Syndrome, peripheral nervous system diseases such as acrodynia, amyloid neuropathies, autonomic nervous system diseases such as Adie's Syndrome, Bane-Lieou Syndrome, Familial Dysautonomia, Homer's Syndrome, Reflex Sympathetic Dystrophy and Shy-Drager Syndrome, Cranial Nerve Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma which includes Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia,Melkersson-Rosenthal Syndrome, ocular motility disorders which includes amblyopia, nystagmus, oculomotor nerve paralysis, ophthalmoplegia such as Duane's Syndrome
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • Vimses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention.
  • viruses include, but are not limited to Examples of vimses, include, but are not limited to the following DNA and RNA vimses and viral families: Arbovims, Adenoviridae, Arenaviridae, Arteri virus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), He ⁇ esviridae (such as, Cytomegalovirus, He ⁇ es Simplex, He ⁇ es Zoster), Mononegavims (e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A,
  • Vimses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial vims, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemonhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
  • arthritis bronchiollitis, respiratory syncytial vims, encephalitis, eye infections (e.g.,
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B).
  • hepatitis e.g., hepatitis B
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat ADDS.
  • Actinomycetales e.g., Corynebacterium, Mycobacterium, Norcardia
  • Enterobacteriaceae Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Senatia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gononhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp., Sta
  • bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gononhea, meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted
  • Polynucleotides or polypeptides, agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • Ppolynucleotides, polypeptides, agonists or antagonists of the invention are, used to treat: tetanus, Diptheria, botulism, and/or meningitis type B.
  • parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium ovale).
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat malaria.
  • treatment using a polypeptide or polynucleotide and/or agonist or antagonist of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy).
  • the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues.
  • the regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, bums, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or systemic cytokine damage.
  • Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and lymphatics), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue.
  • organs e.g., pancreas, liver, intestine, kidney, skin, endothelium
  • muscle smooth, skeletal or cardiac
  • vasculature including vascular and lymphatics
  • nervous hematopoietic
  • skeletal bone, cartilage, tendon, and ligament
  • regeneration occurs without or decreased scarring.
  • Regeneration also may include angiogenesis.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIII may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI, of the present invention could also be used prophylactically in an effort to avoid damage.
  • Specific diseases that could be treated include of tendinitis, ca ⁇ al tunnel syndrome, and other tendon or ligament defects.
  • tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds.
  • nerve and brain tissue could also be regenerated by using TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH, to proliferate and differentiate nerve cells.
  • Diseases that could be treated using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic disorders (e.g., spinal cord disorders, head trauma, cerebrovascular disease, and stoke).
  • diseases associated with peripheral nerve injuries could all be treated using the TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI.
  • Chemotaxis TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may have chemotaxis activity.
  • a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hype ⁇ roliferation.
  • the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
  • TGF alpha HIH polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH may increase chemotaxic activity of particular cells.
  • These chemotactic molecules can then be used to treat inflammation, infection, hype ⁇ roliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body.
  • chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location.
  • Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat wounds.
  • TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HHI may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, TGF alpha HHI polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIH, could be used as an inhibitor of chemotaxis.
  • TGF alpha HIH polypeptides may be used to screen for molecules that bind to TGF alpha HHI or for molecules to which TGF alpha HHI binds.
  • the binding of TGF alpha HHI and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the TGF alpha HIII or the molecule bound.
  • examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors),or small molecules.
  • the molecule is closely related to the natural ligand of TGF alpha HHI, e.g., a fragment of the ligand, or a natural substrate, a ligand, a stmctural or functional mimetic.
  • the molecule can be closely related to the natural receptor to which TGF alpha HIH binds, or at least, a fragment of the receptor capable of being bound by TGF alpha HHI (e.g., active site). In either case, the molecule can be rationally designed using known techniques.
  • the screening for these molecules involves producing appropriate cells which express TGF alpha HHI, either as a secreted protein or on the cell membrane.
  • Prefened cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing
  • TGF alpha HIII(or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either TGF alpha HHI or the molecule.
  • the assay may simply test binding of a candidate compound toTGF alpha HIH, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to TGF alpha HIH.
  • the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
  • the assay may also simply comprise the steps of mixing a candidate compound with a solution containing TGF alpha HHI, measuring TGF alpha HHI/molecule activity or binding, and comparing the TGF alpha HHI/molecule activity or binding to a standard.
  • an ELISA assay can measure TGF alpha HIH level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
  • the antibody can measure TGF alpha HIII level or activity by either binding, directly or indirectly, to TGF alpha HIH or by competing with TGF alpha HIII for a substrate.
  • the receptor to which TGF alpha HIH binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Cunent Protocols in Immun., 1(2), Chapter 5, (1991)).
  • polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NTH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides.
  • Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labelled.
  • the polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase.
  • the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
  • DNA shuffling may be employed to modulate the activities of TGF alpha HIH thereby effectively generating agonists and antagonists of TGF alpha HIH.
  • DNA shuffling may be employed to modulate the activities of TGF alpha HIH thereby effectively generating agonists and antagonists of TGF alpha HIH.
  • alteration of TGF alpha HHI polynucleotides and conesponding polypeptides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments into a desired TGF alpha HHI molecule by homologous, or site-specific, recombination.
  • TGF alpha HIH polynucleotides and conesponding polypeptides may be altened by being subjected to random mutagenesis by enor-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of TGF alpha H ⁇ i may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • the heterologous molecules are Transforming Growth Factor family members.
  • the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone mo ⁇ hogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF-betal, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
  • PDGF platelet-derived growth factor
  • IGF-I insulin-like growth factor
  • TGF transforming growth factor
  • EGF epidermal growth factor
  • FGF fibroblast growth factor
  • TGF-beta bone
  • TGF alpha HIH fragments are biologically active TGF alpha HIH fragments.
  • Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the TGF alpha HHI polypeptide.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention.
  • An example of such an assay comprises combining a mammalian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and ->[H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate.
  • a control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3[H] thymidine in each case.
  • the amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the inco ⁇ oration of 3[H] thymidine.
  • Both agonist and antagonist compounds may be identified by this procedure.
  • a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured.
  • the response of a known second messenger system following interaction of a compound to be screened and the TGF alpha HIH receptor is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to determine if the compound is a potential agonist or antagonist.
  • second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • the invention includes a method of identifying compounds which bind to TGF alpha HIH comprising the steps of: (a) incubating a candidate binding compound with TGF alpha HHI; and (b) determining if binding has occuned.
  • the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with TGF alpha HHI, (b) assaying a biological activity , and (b) determining if a biological activity of TGF alpha HIH has been altered. Also, one could identify molecules bind TGF alpha HIH experimentally by using the beta-pleated sheet regions disclosed in Figure 3 and Table 1. Accordingly, specific embodiments of the invention are directed to polynucleotides encoding polypeptides which comprise, or alternatively consist of, the amino acid sequence of each beta pleated sheet regions disclosed in Figure 3/Table 1.
  • the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention.
  • polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodmgs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
  • the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids.
  • the invention provides a method for delivering a therapeutic protein into the targeted cell.
  • the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.
  • a single stranded nucleic acid e.g., antisense or ribozymes
  • double stranded nucleic acid e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed
  • the invention provides a method for the specific destmction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodmgs.
  • polypeptides of the invention e.g., polypeptides of the invention or antibodies of the invention
  • toxin compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death.
  • Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
  • radioisotopes known in the art
  • compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseu
  • cytotoxic prodrug is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound.
  • Cytotoxic prodmgs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunombisin, and phenoxyacetamide derivatives of doxombicin.
  • polypeptides of the present invention or the polynucleotides encoding these polypeptides, to screen for molecules which modify the activities of the polypeptides of the present invention.
  • a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding.
  • This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of dmg screening techniques.
  • the polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly.
  • One method of dmg screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Dmgs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.
  • the present invention provides methods of screening for dmgs or any other agents which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art.
  • the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.
  • Another technique for dmg screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on September 13, 1984, which is inco ⁇ orated herein by reference herein.
  • large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
  • the peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art.
  • Purified polypeptides are coated directly onto plates for use in the aforementioned dmg screening techniques.
  • non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.
  • This invention also contemplates the use of competitive dmg screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.
  • antagonists according to the present invention are nucleic acids conesponding to the sequences contained in SEQ ID NO:l, or the complementary strand thereof, and/or to nucleotide sequences contained in the deposited clone 97342.
  • antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
  • Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation.
  • Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 10-1573 (1979); Cooney et al., Science 241 :456 (1988); and Dervan et al., Science 251 :1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines was previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with the oligoribonucleotide. A similar procedure for in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRI site on the 5 end and a HindHI site on the 3 end.
  • the pair of oligonucleotides is heated at 90°C for one minute and then annealed in 2X ligation buffer (20mM TRIS HCl pH 7.5, lOmM MgC12, 10MM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoRI /Hind m site of the retroviral vector PMV7 (WO 91/15580).
  • 2X ligation buffer 20mM TRIS HCl pH 7.5, lOmM MgC12, 10MM dithiothreitol (DTT) and 0.2 mM ATP
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the TGF alpha HIII antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence.
  • a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
  • RNA antisense nucleic acid
  • Such a vector would contain a sequence encoding the TGF alpha HIH antisense nucleic acid.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constmcted by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells.
  • TGF alpha HIH can be by any promoter known in the art to act in vertebrate, preferably human cells.
  • Such promoters can be inducible or constitutive.
  • Such promoters include, but are not limited to, the SV40 early promoter region (Bemoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma vims (Yamamoto et al., Cell 22:787- 797 (1980), the he ⁇ es thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
  • the antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a TGF alpha HIH gene.
  • absolute complementarity although prefened, is not required.
  • a sequence "complementary to at least a portion of an RNA,” refened to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded TGF alpha HIH antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid.
  • the larger the hybridizing nucleic acid the more base mismatches with a TGF alpha HIH RNA it may contain and still form a stable duplex (or triplex as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
  • sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
  • oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of TGF alpha HIH shown in Figures 1A-B could be used in an antisense approach to inhibit translation of endogenous TGF alpha HIH mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
  • antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
  • the polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A.
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fiuorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
  • the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an a-anomeric oligonucleotide.
  • An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands mn parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0- methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res.
  • RNA-DNA analogue a chimeric RNA-DNA analogue
  • Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res.
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. While antisense nucleotides complementary to the TGF alpha HIII coding region sequence could be used, those complementary to the transcribed untranslated region are most prefened.
  • Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy TGF alpha HIII mRNAs, the use of hammerhead ribozymes is prefened. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
  • hammerhead ribozymes The constmction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988).
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the TGF alpha HHI mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non- functional mRNA transcripts.
  • the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express TGF alpha HHI in vivo.
  • DNA constmcts encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA.
  • a prefened method of delivery involves using a DNA constmct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol HI or pol ⁇ promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous TGF alpha HIH messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.
  • the antagonist/agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery.
  • Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
  • the antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing.
  • the antagonist/agonist may also be employed to treat the diseases described herein.
  • the invention provides a method of treating disorders or diseases, including but not limited to the disorders or diseases listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention.
  • this invention provides a method of screening compounds to identify agonist or antagonist compounds to the polypeptide of the present invention.
  • a mammalian cell or membrane preparation expressing a TGF alphaHIII receptor is incubated with a potential compound and the ability of the compound to generate a second signal from the receptor is measured to determine if it is an effective agonist.
  • second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • Effective antagonists are determined by the method above wherein an antagonist compound is detected which binds to the receptor but does not elicit a second messenger response to thereby block the receptor from TGF alpha HIH.
  • Another assay for identifying potential antagonists specific to the receptors to the polypeptide of the present invention is a competition assay which comprises isolating plasma membranes which overexpress a receptor to the polypeptide of the present invention, for example, human A431 carcinoma cells.
  • Serially diluted test sample in a medium (volume is approximately 10 microliters) containing 10 nM 125I-TGF alpha HIH is added to five micrograms of the plasma membrane in the presence of the potential antagonist compound and incubated for 4 hours at 40 degree C.
  • the reaction mixtures are diluted and immediately passed through a millipore filter.
  • the filters are then rapidly washed and the bound radioactivity is measured in a gamma counter.
  • the amount of bound TGF alpha HIH is then measured.
  • a control assay is also performed in the absence of the compound to determine if the antagonists reduce the amount of bound TGF alpha HHI.
  • Potential antagonist compounds include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide.
  • a potential antagonist may be a closely related protein which binds to the receptor which is an inactive forms of the polypeptide and thereby prevent the action of the polypeptide of the present invention.
  • Another antagonist compound is an antisense constmct prepared using antisense technology.
  • Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA.
  • the 5' coding portion of the polynucleotide sequence which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix -see Lee et al., Nucl.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide of the present invention (Antisense - Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)) .
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide of the present invention.
  • Antagonist compounds include a small molecule which binds to the polypeptide of the present invention and blocks its action at the receptor such that normal biological activity is prevented.
  • the small molecules may also bind the receptor to the polypeptide to prevent binding. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.
  • the antagonists may be employed to treat neoplasia, for example, cancers and tumors. It is known that inhibition of secretion or production of members of the EGF family by tumor cells in mice causes regression of tumors.
  • the antagonists to the polypeptides of the present invention may also be used therapeutically for the treatment of certain skin disorders, for example, psoriasis. Elevated levels of expression of members of this family of growth factors in skin biopsies taken from diseases such as psoriatic lesions have been found to be elevated (Cook, et al., Cancer Research, 52:3224-3227 (1992)).
  • the antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be employed in treatment for stimulating re-vascularization of ischemic tissues due to various disease conditions such as thrombosis, arteriosclerosis, and other cardiovascular conditions.
  • the polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to stimulate angiogenesis and limb regeneration, as discussed above.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for treating wounds due to injuries, bums, post-operative tissue repair, and ulcers since they are mitogenic to various cells of different origins, such as fibroblast cells and skeletal muscle cells, and therefore, facilitate the repair or replacement of damaged or diseased tissue.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed stimulate neuronal growth and to treat and prevent neuronal damage which occurs in certain neuronal disorders or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease, and AIDS-related complex.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may have the ability to stimulate chondrocyte growth, therefore, they may be employed to enhance bone and periodontal regeneration and aid in tissue transplants or bone grafts.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be also be employed to prevent skin aging due to sunburn by stimulating keratinocyte growth.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for preventing hair loss, since FGF family members activate hair-forming cells and promotes melanocyte growth.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be employed to stimulate growth and differentiation of hematopoietic cells and bone manow cells when used in combination with other cytokines.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to maintain organs before transplantation or for supporting cell culture of primary tissues.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for inducing tissue of mesodermal origin to differentiate in early embryos.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also increase or decrease the differentiation or proliferation of embryonic stem cells, besides, as discussed above, hematopoietic lineage.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used to modulate mammalian characteristics, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, and shape (e.g., cosmetic surgery).
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to modulate mammalian metabolism affecting catabolism, anabolism, processing, utilization, and storage of energy.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to change a mammal's mental state or physical state by influencing biorhythms, caricadic rhythms, depression (including depressive disorders), tendency for violence, tolerance for pain, reproductive capabilities (preferably by Activin or Inhibin-like activity), hormonal or endocrine levels, appetite, libido, memory, stress, or other cognitive qualities.
  • a polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used as a food additive or preservative, such as to increase or decrease storage capabilities, fat content, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other nutritional components.
  • hosts include, but are not limited to, human, murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, non-human primate, and human.
  • the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat.
  • the host is a mammal. In most prefened embodiments, the host is a human.
  • TGF alpha HIH Two approaches can be used to isolate TGF alpha HIH from the deposited sample.
  • a suitable host such as XL-1 Blue (Stratagene)
  • the transformants are plated on 1.5% agar plates (containing the appropriate selection agent, e.g., ampicillin) to a density of about 150 transformants (colonies) per plate.
  • a single colony is then used to generate DNA using nucleic acid isolation techniques well known to those skilled in the art. (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edit., (1989), Cold Spring Harbor Laboratory Press.)
  • two primers of 17-20 nucleotides derived from both ends of the SEQ ID NO:l are synthesized and used to amplify the TGF alpha HIH cDNA using the deposited cDNA plasmid as a template.
  • the polymerase chain reaction is carried out under routine conditions, for instance, in 25 ul of reaction mixture with 0.5 ug of the above cDNA template.
  • a convenient reaction mixture is 1.5-5 mM MgCl 2 , 0.01% (w/v) gelatin, 20 uM each of dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq polymerase.
  • Thirty five cycles of PCR (denaturation at 94 degree C for 1 min; annealing at 55 degree C for 1 min; elongation at 72 degree C for 1 min) are performed with a Perkin-Elmer Cetus automated thermal cycler.
  • the amplified product is analyzed by agarose gel electrophoresis and the DNA band with expected molecular weight is excised and purified.
  • the PCR product is verified to be the selected sequence by subcloning and sequencing the DNA product.
  • RNA presumably containing full-length gene RNA transcripts A primer set containing a primer specific to the ligated RNA oligonucleotide and a primer specific to a known sequence of the TGF alpha HHI gene of interest is used to PCR amplify the 5' portion of the TGF alpha HHI full-length gene. This amplified product may then be sequenced and used to generate the full length gene.
  • RNA isolation can then be treated with phosphatase if necessary to eliminate 5' phosphate groups on degraded or damaged RNA which may interfere with the later RNA ligase step.
  • the phosphatase should then be inactivated and the RNA treated with tobacco acid pyrophosphatase in order to remove the cap stmcture present at the 5' ends of messenger RNAs. This reaction leaves a 5' phosphate group at the 5' end of the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using T4 RNA ligase.
  • This modified RNA preparation is used as a template for first strand cDNA synthesis using a gene specific oligonucleotide.
  • the first strand synthesis reaction is used as a template for PCR amplification of the desired 5' end using a primer specific to the ligated RNA oligonucleotide and a primer specific to the known sequence of the gene of interest.
  • the resultant product is then sequenced and analyzed to confirm that the 5' end sequence belongs to the TGF alpha HHI gene.
  • Example 2 Isolation of TGF alpha HIII Genomic Clones
  • a human genomic PI library (Genomic Systems, Inc.) is screened by PCR using primers selected for the cDNA sequence conesponding to SEQ ID NO:l., according to the method described in Example 1. (See also, Sambrook.)
  • Tissue distribution of mRNA expression of TGF alpha HIH is determined using protocols for Northern blot analysis, described by, among others, Sambrook et al.
  • a TGF alpha HHI probe produced by the method described in Example 1 is labeled with P 32 using the rediprimeTM DNA labeling system (Amersham Life Science), according to manufacturer's instmctions. After labeling, the probe is purified using CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT1200-1. The purified labeled probe is then used to examine various human tissues for mRNA expression.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • ExpressHybTM hybridization solution (Clontech) according to manufacturer's protocol number PTl 190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70 degree C overnight, and the films developed according to standard procedures.
  • An oligonucleotide primer set is designed according to the sequence at the 5' end of
  • This primer preferably spans about 100 nucleotides.
  • This primer set is then used in a polymerase chain reaction under the following set of conditions : 30 seconds, 95 degree C; 1 minute, 56 degree C; 1 minute, 70 degree C. This cycle is repeated 32 times followed by one 5 minute cycle at 70 degree C.
  • Human, mouse, and hamster DNA is used as template in addition to a somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc). The reactions is analyzed on either 8% polyacrylamide gels or 3.5 % agarose gels. Chromosome mapping is determined by the presence of an approximately 100 bp PCR fragment in the particular somatic cell hybrid.
  • the DNA sequence encoding TGF alpha HIH was initially amplified using PCR oligonucleotide primers conesponding to the 51 sequences of the processed TGF alpha HIH protein (minus the signal peptide sequence) and the vector sequences 3' to the
  • TGF alpha HIH gene Additional nucleotides conesponding to TGF alpha HHI were added to the 5' and 3' sequences respectively.
  • the 5' oligonucleotide primer has the sequence 5'
  • CGCGGATCCGGGCAAAAGAACCTTTGC 3' contains a BamHI restriction enzyme site (in bold) followed by 18 nucleotides of TGF alpha HHI coding sequence starting from the presumed terminal amino acid of the processed protein.
  • the 3' sequence 5' GCGTCTAGACTAAAGCAGTGAGAACGAGCC 3' contains complementary sequences to a Xbal site and is followed by 21 nucleotides of TGF alpha HIH
  • the restriction enzyme sites conespond to the restriction enzyme sites on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91311).
  • pQE-9 encodes antibiotic resistance (Amp') a bacterial origin of replication (ori) , an IPTG-regulatable promoter operator (P/0), a ribosome binding site (RBS) , a 6-His tag and restriction enzyme sites.
  • pQE-9 was then digested with BamHI and Xbal. The amplified sequences were ligated into pQE-9 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J.
  • M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kan'). Transf ormants were identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.
  • Clones containing the desired constmcts were grown overnight (OIN) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml)
  • the O/N culture was used to inoculate a large culture at a ratio of 1 :100 to 1 :250.
  • the cells were grown to an optical density 600 (O.D. ⁇ w) of between 0.4 and 0.6 IPTG (“Isopropyl-B-D-thiogalacto pyranoside”) was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours.
  • TGF alpha HHI (85 % pure) was eluted from the column in 6 molar guanidine HCl pH 5.0 and for the pu ⁇ ose of renaturation adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione (oxidized). After incubation in this solution for 12 hours the protein was dialyzed to 10 molar sodium phosphate.
  • the present invention further includes an expression vector comprising phage operator and promoter elements operatively linked to a TGF alpha HHI polynucleotide, called pHE4a.
  • This vector contains: 1) a neomycinphosphotransferase gene as a selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter sequence, 4) two lac operator sequences, 5) a Shine-Delgarno sequence, and 6) the lactose operon repressor gene (laclq).
  • the origin of replication (oriC) is derived from pUC19 (LTI, Gaithersburg, MD). The promoter sequence and operator sequences are made synthetically.
  • DNA can be inserted into the pHEa by restricting the vector with Ndel and Xbal, BamHI, Xhol, or Asp718, running the restricted product on a gel, and isolating the larger fragment (the stuffer fragment should be about 310 base pairs).
  • the DNA insert is generated according to the PCR protocol described in Example 1, using PCR primers having restriction sites for Ndel (5' primer) and Xbal, BamHI, Xhol, or Asp718 (3' primer).
  • the PCR insert is gel purified and restricted with compatible enzymes.
  • the insert and vector are ligated according to standard protocols.
  • the following alternative method can be used to purify TGF alpha HHI polypeptide expressed in E coli when it is present in the form of inclusion bodies. Unless otherwise specified, all of the following steps are conducted at 4-10 degree C.
  • the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10 degree C and the cells harvested by continuous centrifugation at 15,000 ⁇ m (Heraeus Sepatech). On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.
  • the cells are then lysed by passing the solution through a microfluidizer
  • the resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 xg centrifugation for 15 min., the pellet is discarded and the polypeptide containing supernatant is incubated at 4 degree C overnight to allow further GuHCl extraction.
  • guanidine hydrochloride (GuHCl)
  • GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCI, 2 mM EDTA by vigorous stirring.
  • the refolded diluted protein solution is kept at 4 degree C without mixing for 12 hours prior to further purification steps.
  • a previously prepared tangential filtration unit equipped with 0.16 um membrane filter with appropriate surface area e.g., Filtron
  • 40 mM sodium acetate, pH 6.0 is employed.
  • the filtered sample is loaded onto a cation exchange resin (e.g., Poros HS-50, Perseptive Biosystems).
  • the column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCI in the same buffer, in a stepwise manner.
  • the absorbance at 280 nm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS- PAGE.
  • Fractions containing the TGF alpha HIH polypeptide are then pooled and mixed with 4 volumes of water.
  • the diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins.
  • the columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCI.
  • CM-20 column is then eluted using a 10 column volume linear gradient ranging from 0.2 M NaCI, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCI, 50 mM sodium acetate, pH 6.5. Fractions are collected under constant A 80 monitoring of the effluent. Fractions containing the polypeptide (determined, for instance, by 16% SDS- PAGE) are then pooled.
  • the resultant TGF alpha HIH polypeptide should exhibit greater than 95% purity after the above refolding and purification steps. No major contaminant bands should be observed from Commassie blue stained 16% SDS-PAGE gel when 5 ug of purified protein is loaded.
  • the purified TGF alpha HHI protein can also be tested for endotoxin/LPS contamination, and typically the LPS content is less than 0.1 ng/ml according to LAL assays.
  • Example 7 Cloning and Expression of TGF alpha HIII in a Baculovirus Expression System
  • the first set of primers are:
  • the second set of primers are:
  • All 5' primers have a BamHI restriction enzyme site (in bold).
  • the 3' primer sequences contain the cleavage site for the restriction endonuclease Xbal and have nucleotides complementary to the 3' extracellular and active domain, respectively of the TGF alpha HHI gene.
  • the amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.) . The fragment was then digested with the endonucleases BamHI and Xbal and then purified again on a 1% agarose gel. This fragment was designated F2.
  • the vectors pA2 and pA2GP were used (modification of PVL941 vector, discussed below) for the expression of the TGF alpha HHI protein using the baculovims expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovims vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555).
  • This expression vector contains the strong polyhedrin promoter of the Autographa califomica nuclear polyhedrosis vims (AcMNPV) followed by the recognition sites for the restriction endonucleases.
  • the polyadenylation site of the simian vims SV40 was used for efficient polyadenylation.
  • the beta-galactosidase gene from E.coli was inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene.
  • the polyhedrin sequences were flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA.
  • Many other baculovims vectors could be used such as pAc373, pRGl, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
  • the plasmid was digested with the restriction enzymes BamHI and Xbal and then dephosphorylated using calf intestinal phosphatase by procedures known in the art.
  • the DNA was then isolated from a 1% agarose gel using the commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA was designated V2.
  • Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase.
  • E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid (pBacTGF alpha HIH) with the TGF alpha HHI gene using the restriction enzymes BamHI and Xbal.
  • the sequence of the cloned fragment was confirmed by DNA sequencing. 5 ug of the plasmid pBacTGF alpha HHI was co-transfected with 1.0 ug of a commercially available linearized baculovims ("BaculoGold baculovims DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc.
  • the plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27 degree C. After 5 hours the transfection solution was removed from the plate and 2 ml of Grace's insect medium supplemented with 10% fetal calf semm was added. The plate was put back into an incubator and cultivation continued at 27 degree C for four days. After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra) . As a modification an agarose gel with "Blue Gall' (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
  • the vims was added to the cells and blue stained plaques were picked with the tip of an Eppendorf pipette.
  • the agar containing the recombinant vimses was then resuspended in an Eppendorf tube containing 200 ul of Grace's medium.
  • the agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovims was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4 degree C.
  • Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V-TGF alpha HHI at a multiplicity of infection (MOI) of 2.
  • MOI multiplicity of infection
  • the medium was removed and replaced with SF900 H medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg).
  • 5 uCi of 35S methionine and 5 uCi 35S cysteine (Amersham) were added.
  • the cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
  • Microsequencing of the amino acid sequence of the amino terminus of purified protein may be used to determine the amino terminal sequence of the produced TGF alpha H ⁇ i protein.
  • TGF alpha HHI polypeptide can be expressed in a mammalian cell.
  • a typical mammalian expression vector contains a promoter element, which mediates the initiation of transcription of mRNA, a protein coding sequence, and signals required for the termination of transcription and polyadenylation of the transcript. Additional elements include enhancers,
  • RNA splicing Kozak sequences and intervening sequences flanked by donor and acceptor sites for RNA splicing. Highly efficient transcription is achieved with the early and late promoters from SV40, the long terminal repeats (LTRs) from Retrovimses, e.g., RSV, HTLVI, HIVI and the early promoter of the cytomegalovirus (CMV).
  • LTRs long terminal repeats
  • Retrovimses e.g., RSV, HTLVI, HIVI
  • CMV cytomegalovirus
  • cellular elements can also be used
  • the human actin promoter (e.g., the human actin promoter).
  • Suitable expression vectors for use in practicing the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport 3.0.
  • vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109), pCMVSport 2.0, and pCMVSport 3.0.
  • Mammalian host cells that could be used include, human Hela, 293, H9 and
  • TGF alpha HIH polypeptide can be expressed in stable cell lines containing the TGF alpha HIH polynucleotide integrated into a chromosome.
  • the co- transfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin allows the identification and isolation of the transfected cells.
  • the transfected TGF alpha HIH gene can also be amplified to express large amounts of the encoded protein.
  • the DHFR (dihydrofolate reductase) marker is useful in developing cell lines that carry several hundred or even several thousand copies of the gene of interest.
  • the mammalian cells are grown in selective medium and the cells with the highest resistance are selected.
  • These cell lines contain the amplified gene(s) integrated into a chromosome.
  • Chinese hamster ovary (CHO) and NSO cells are often used for the production of proteins.
  • Derivatives of the plasmid pSV2-DHFR (ATCC Accession No. 37146), the expression vectors pC4 (ATCC Accession No. 209646) and pC6 (ATCC Accession No.209647) contain the strong promoter (LTR) of the Rous Sarcoma Vims (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the CMV- enhancer (Boshart et al., Cell 41 :521-530 (1985).) Multiple cloning sites, e.g., with the restriction enzyme cleavage sites BamHI, Xbal and Asp718, facilitate the cloning of TGF alpha HIH.
  • the vectors also contain the 3' intron, the polyadenylation and termination signal of the rat preproinsulin gene, and the mouse DHFR gene under control of the S V40 early promoter.
  • the vector does not need a second signal peptide.
  • the vector can be modified to include a heterologous signal sequence in an effort to secrete the protein from the cell. (See, e.g., WO 96/34891.)
  • the amplified fragment is then digested and purified on a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.).
  • the isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase.
  • E. coli HB101 or XL- 1 Blue cells are then transformed and bacteria are identified that contain the fragment inserted into plasmid pC6 or pC4 using, for instance, restriction enzyme analysis.
  • Chinese hamster ovary cells lacking an active DHFR gene is used for transfection.
  • Five ⁇ g of the expression plasmid pC6 or pC4 is cotransfected with 0.5 ug of the plasmid pSVneo using lipofectin (Feigner et al., supra).
  • the plasmid pSV2-neo contains a dominant selectable marker, the neo gene from Tn5 encoding an enzyme that confers resistance to a group of antibiotics including G418.
  • the cells are seeded in alpha minus MEM supplemented with 1 mg/ml G418.
  • the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or 50 ng/ml of metothrexate plus 1 mg/ml G418. After about 10-14 days single clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM).
  • methotrexate 50 nM, 100 nM, 200 nM, 400 nM, 800 nM.
  • TGF alpha HHI is analyzed, for instance, by SDS-PAGE and Western blot or by reversed phase HPLC analysis.
  • the expression of plasmid, TGF alpha HIH HA is derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.
  • the DNA sequence encoding TGF alpha HHI, ATCC 97342, is constmcted by PCR using two primers: the 5' primer 5'
  • CGCGGATCCGTCCATCATGGCGCCTCACGGCCCG 3' contains a BamHI site (in bold) followed by 18 nucleotides of TGF alpha HIH coding sequence starting from the initiation codon; the 3' sequence
  • 5' GCGCTCAGACATAAGCAGTGAGAACGAGCC 3' contains complementary sequences to an Xhol site, the last 21 nucleotides of the TGF alpha HIH domain and an Xhol site.
  • pcDNA3/Amp vector contains BamHI/XhoI cloning sites which bring the PCR insert in frame with the 3' HA tag followed by a stop codon. Therefore, the PCR product contains a BamHI site, 606 base pair coding sequence and an Xhol site.
  • the PCR amplified DNA fragment and the vector, ⁇ cDNA3/Amp are digested with BamHI and Xhol restriction enzyme and ligated. The ligation mixture is transformed into E.
  • TGF alpha HHI bacterial strain SURE (available from Stratagene Cloning Systems, La Jolla, CA 92037) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the conect fragment.
  • COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)).
  • the expression of the TGF alpha HHI HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D.
  • TGF alpha HHI deletion mutant a N-terminal or C-terminal deletion TGF alpha HHI deletion mutant.
  • two oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO:l. The 5' and 3' positions of the primers are determined based on the desired TGF alpha HHI polynucleotide fragment.
  • An initiation and stop codon are added to the 5' and 3' primers respectively, if necessary, to express the TGF alpha HIH polypeptide fragment encoded by the polynucleotide fragment.
  • Prefened TGF alpha HIII polynucleotide fragments are those encoding the N-terminal and C-terminal deletion mutants disclosed above in the "Polynucleotide and Polypeptide Fragments" section of the Specification.
  • TGF alpha HHI polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art.
  • TGF alpha HHI polypeptide fragments encoded by the TGF alpha HHI polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.
  • the polynucleotide encoding the TGF alpha HIH polypeptide fragment C-35 to S-215 is amplified and cloned as follows: A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with C-35. A complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the TGF alpha HIH polypeptide fragment ending with S-215.
  • the amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers.
  • the digested polynucleotides are then ligated together.
  • the TGF alpha HHI polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the TGF alpha HHI polypeptide fragment coding region downstream from the promoter.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • TGF alpha HHI polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of TGF alpha HIH polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 5; see also EP A 394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo.
  • Nuclear localization signals fused to TGF alpha HIH polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non- fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Example
  • the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.
  • the human Fc portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed.
  • the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and TGF alpha HIH polynucleotide, isolated by the PCR protocol described in
  • Example 1 is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
  • pC4 does not need a second signal peptide.
  • the vector can be modified to include a heterologous signal sequence.
  • TGF alpha Hiii cells expressing TGF alpha Hiii are administered to an animal to induce the production of sera containing polyclonal antibodies.
  • a preparation of TGF alpha HIII protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • Monoclonal antibodies specific for TGF alpha HIII protein are prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
  • an animal preferably a mouse
  • TGF alpha HIII polypeptide or, more preferably, with a secreted TGF alpha HII I polypeptide-expressing cell are cultured in any suitable tissue culture medium, preferably in Earle's modified Eagle's medium supplemented with 10% fetal bovine semm (inactivated at about 56°C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ⁇ g/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • a suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC.
  • SP2O parent myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)).
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the TGF alpha HIH polypeptide.
  • additional antibodies capable of binding to TGF alpha HHI polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies.
  • a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody.
  • protein specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the TGF alpha HIH protein-specific antibody can be blocked by TGF alpha HHI.
  • Such antibodies comprise anti-idiotypic antibodies to the TGF alpha HIII protein-specific antibody and are used to immunize an animal to induce formation of further TGF alpha HIH protein-specific antibodies.
  • an antibody is "humanized". Such antibodies can be produced using genetic constmcts derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed herein. (See, for review, Morrison, Science 229:1202 (1985); Oi et al, BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Dermatology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Neurosurgery (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne une nouvelle protéine humaine appelée TGF (Transforming Growth Factor) Alpha III, ainsi que des polynucléotides isolés codant pour cette protéine. L'invention concerne également des vecteurs, des cellules hôtes, des anticorps et des techniques de recombinaison permettant de produire cette protéine humaine. L'invention concerne enfin des techniques de diagnostique et des thérapies utiles dans le diagnostic et le traitement des troubles liés à cette nouvelle protéine humaine.
PCT/US2000/032745 1999-12-02 2000-12-01 Facteur alpha hiii de transformation cellulaire WO2001040251A1 (fr)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002390839A CA2390839A1 (fr) 1999-12-02 2000-12-01 Facteur alpha hiii de transformation cellulaire
JP2001541006A JP2003515326A (ja) 1999-12-02 2000-12-01 トランスフォーミング増殖因子αＨＩＩＩ
AU20568/01A AU2056801A (en) 1999-12-02 2000-12-01 Transforming growth factor alpha hiii
EP00983862A EP1244686A4 (fr) 1999-12-02 2000-12-01 Facteur alpha hiii de transformation cellulaire

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16838799P 1999-12-02 1999-12-02
US60/168,387 1999-12-02

Publications (1)

Publication Number Publication Date
WO2001040251A1 true WO2001040251A1 (fr) 2001-06-07

Family

ID=22611307

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/032745 WO2001040251A1 (fr) 1999-12-02 2000-12-01 Facteur alpha hiii de transformation cellulaire

Country Status (5)

Country Link
EP (1) EP1244686A4 (fr)
JP (1) JP2003515326A (fr)
AU (1) AU2056801A (fr)
CA (1) CA2390839A1 (fr)
WO (1) WO2001040251A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3041514A4 (fr) * 2013-09-03 2017-07-05 Mayo Foundation for Medical Education and Research Réduction du risque d'événements cardiaques négatifs majeurs

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997025349A1 (fr) * 1996-01-04 1997-07-17 Human Genome Sciences, Inc. Facteur transformant de croissance alpha hiii

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2305886A1 (fr) * 1997-10-08 1999-04-15 Sagami Chemical Research Center Proteines humaines comportant des domaines transmembranaires et adn codant ces proteines

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997025349A1 (fr) * 1996-01-04 1997-07-17 Human Genome Sciences, Inc. Facteur transformant de croissance alpha hiii

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See also references of EP1244686A4 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3041514A4 (fr) * 2013-09-03 2017-07-05 Mayo Foundation for Medical Education and Research Réduction du risque d'événements cardiaques négatifs majeurs
US9884090B2 (en) 2013-09-03 2018-02-06 Mayo Foundation For Medical Education And Research Using nucleic acids encoding NAP-2 and TGF-alpha polypeptides to improve cardiac function
EP3639860A1 (fr) * 2013-09-03 2020-04-22 Mayo Foundation for Medical Education and Research Réduction du risque de problèmes cardiaques majeurs
US10682394B2 (en) 2013-09-03 2020-06-16 Mayo Foundation For Medical Education And Research NAP-2 polypeptides and methods for modulating immune system activity in heart tissue
US11413330B2 (en) 2013-09-03 2022-08-16 Mayo Foundation For Medical Education And Research Using nucleic acids encoding NAP-2 polypeptides to improve cardiac function

Also Published As

Publication number Publication date
JP2003515326A (ja) 2003-05-07
CA2390839A1 (fr) 2001-06-07
EP1244686A4 (fr) 2003-04-23
AU2056801A (en) 2001-06-12
EP1244686A1 (fr) 2002-10-02

Similar Documents

Publication Publication Date Title
US6593112B1 (en) Polynucleotides encoding fibroblast growth factor 15
US6953667B2 (en) Antibodies against human protein HUVDJ43
US20060039905A1 (en) Galectin 11
US20080146505A1 (en) 47 Human Secreted Proteins
US20050221376A1 (en) Metalloproteinase ADAM 22
US20060036089A1 (en) 33 human secreted proteins
WO2001012776A2 (fr) 18 proteines secretees humaines
US6605441B1 (en) Antibodies against fibroblast growth factor 11
US20050064458A1 (en) 143 human secreted proteins
EP1208191A1 (fr) 13 proteines associees au cancer du colon et au colon humain
US20070190612A1 (en) 31 Human Secreted Proteins
US20050019824A1 (en) Fibroblast Growth Factor-10
WO2001007476A1 (fr) Prostate humaine 26 et cancer de la prostate associe aux proteines
EP1192168A1 (fr) Galectine 11
US20020025553A1 (en) Transforming growth factor alpha HIII
EP1223946A1 (fr) Recepteur humain du neuropeptide
WO2000071152A9 (fr) Facteur 10 de croissance des fibroblastes
US20050026838A1 (en) Fibroblast Growth Factor-13
WO2001053343A1 (fr) Polynucleotides, polypeptides et anticorps humains
US20030175778A1 (en) Interferon Receptor HKAEF92
WO2000067775A1 (fr) Facteur de croissance des fibroblastes (fgf) 15
WO2001007608A1 (fr) Interferon derive du keratinocyte
WO2000071715A1 (fr) Facteur 11 de croissance des fibroblastes
WO2000071582A1 (fr) Facteur 14 de croissance du fibroblaste
WO2001040251A1 (fr) Facteur alpha hiii de transformation cellulaire

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2390839

Country of ref document: CA

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2001 541006

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: 2000983862

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000983862

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWW Wipo information: withdrawn in national office

Ref document number: 2000983862

Country of ref document: EP