WO2001034814A1

WO2001034814A1 - Use of a class of enzymes and their encoding genes to increase the oil content in transgenic organisms

Info

Publication number: WO2001034814A1
Application number: PCT/SE2000/002216
Authority: WO
Inventors: Antoni Banas; Line Sandager; Ulf STÅHL; Anders Dahlqvist; Marit Lenman; Hans Ronne; Sten Stymne
Original assignee: Scandinavian Biotechnology Research Ab (Scanbi Ab)
Priority date: 1999-11-12
Filing date: 2000-11-10
Publication date: 2001-05-17
Also published as: EP1230373A1; SI1230373T1; AU784181B2; BR0015493A; CA2389391A1; EP1230373B1; ATE353360T1; AU1428501A; CN1399682A; CN1294265C; DE60033311T2; CA2389391C; DE60033311D1; PT1230373E; DK1230373T3; ES2280261T3

Abstract

The present invention relates to the use of a novel enzyme and its encoding gene for transformation. More specifically, the invention relates to the use of a gene encoding an enzyme with acyl-CoA: diacylglycerol acyltransferase activity. This gene expressed alone in transgenic organisms will increase the total amount of oil i.e. triacylglycerols that is produced.

Description

Use of a class of enzymes and their encoding genes to increase the oil content in transgenic organisms

FIELD OF THE INVENTION

The present invention relates to the use of a novel enzyme and its encoding gene for transformation. More specifically, the invention relates to the use of a gene encoding an enzyme with acyl-CoA : diacylglycerol acyltransferase activity. This gene expressed alone in transgenic organisms will increase the total amount of oil (i.e. triacylglycerols) that is produced.

BACKGROUND OF THE INVENTION

In oil crops like rape, sunflower, oilpalm etc., the oil (i.e. triacylglycerols) is the most valuable product of the seeds or fruits and other compounds such as starch, protein and fiber is regarded as by-products with less value. Enhancing the quantity of oil per weight basis at the expense of other compounds in oil crops would therefore increase the value of the crop. If enzymes regulating the allocation of reduced carbon into the production of oil can be upregulated by overexpression, the cells will accumulate more oil at the expense of other products. This approach could not only be used to increase the oil content in already high oil producing organisms such as oil crops, they could also lead to significant oil production in moderate or low oil containing crops such as soy, oat, maize, potato, sugar beats, and turnips as well as in microorganisms.

Development in genetic engineering technologies combined with greater understanding of the biosynthesis of triacylglycerols now makes it possible to transfer genes coding for key enzymes involved in the synthesis of triacylglycerols from a wild plant species or organisms of other kingdoms into domesticated oilseed crops. In this way, triacylglycerols can be produced in high purity and quantities at moderate costs.

It is known that the biosynthesis of triacylglycerols (TAG) in fat-accumulating tissues in animals (Bell & Coleman, 1983) and plants (Cao & Huang, 1986, Martin & Wilson 1983) as well as the accumulation of oil in microbial organisms such as bacteria (Ekundayo & Packter, 1994), yeast and other fungi (Ratledge 1989) can be catalyzed by acyl-CoA : diacylglycerol acyltransferases (DAGATs), enzymes that transfer an acyl-group from acyl-CoA to diacylglycerol, thus forming TAG.

During the past few years genes coding for DAGATs, have been identified in animals (Cases et al, 1998), plants (Hobbs et al., 1999; Lardizabal et al., 2000) and in microbes (Lardizabal et al., 1999). These DAGATs belong to two unrelated protein families. The first type of DAGAT that was characterized, DAGAT A, has so far been found only in animals (Cases et al., 1998) and plants (Hobbs et al., 1999). These genes show sequence similarities to genes encoding acyl-CoA : cholesterol acyltransferase (ACAT). The mouse DAGAT A has 20 % amino acid sequence identity to the mouse ACAT (Cases et al., 1998). However, DAGATs A from plants and animals are more similar to each other than to ACAT. Thus, the mouse DAGAT A has 38 % amino acid sequence identity to the Arabidopsis thaliana DAGAT A (Hobbs et al., 1999). It is also approximately 80% identical to the human ACAT like protein ARGP1, which was suggested to be involved in TAG synthesis (Oelkers et al., 1998), indicating that ARGP1 is a DAGAT A.

The yeast S. cerevisiae contain 2 genes with sequence similarity to ACAT, ARE1 and ARE2 (Yang et al, 1996). The encoded proteins have approximately 24 % overall amino acid sequence identity to the mouse ACAT and 15% identity to the DAGAT A from mouse. It should be noted that they are both more similar to each other (45% amino acid sequence identity) than to either ACATs or DAGATs from higher eukaryotes. It is not possible to classify them as putative ACATs or DAGATs based on sequence similarities alone, since their evolutionary distances from both groups of higher eukaryotic enzymes are similar. However, experiments have shown that both Arel and Are2 are ACATs, which together are responsible for all of the sterol ester synthesis that occurs in yeast (Yang et al., 1996; Yu et al., 1996). The possible involvement of Arel and Are2 in the synthesis of TAG has also been studied (Yang et al., 1996; Yu et al., 1996). From these studies, it was concluded that Arel and Are2 are not involved in TAG synthesis. Thus, there is no prior art to show that Arel is a TAG synthesizing enzyme, nor can it be concluded, on the basis of homologies to ACAT like sequences already published, that Arel is a DAGAT (Lassner and Ruezinsky, 1999).

The second family of DAGAT enzymes, the DAGAT B family, is unrelated to any other known proteins. These enzymes show no sequence homology to the mouse and plant ACAT like DAGAT A proteins (Lardizabal et al., 2000) or to any other known proteins.

DAGAT A and B are not the only enzymes that contribute to TAG biosynthesis. TAG can also be synthesized by an acyl-CoA independent reaction. Thus, the newly discovered enzyme phospholipid : diacylglycerol acyltransferase (PDAT) catalyses the formation of TAG by transferring an acyl group from the sn-2 position of a phospholipid to DAG (Dahlqvist et al., 1999; Stahl, 1999). SUMMARY OF INVENTION

This invention describes the identification of a gene encoding an enzyme that is partly responsible for TAG accumulation in yeast.

In a first embodiment, this invention is directed to the TAG synthesising enzyme comprising an amino acid sequence as set forth in SEQ ID NO 2 or a functional fragment, derivative, variant, ortologue or isoenzyme thereof.

The present invention further includes the nucleotide sequence as set forth in SEQ ID NO 1 , as well as portions of the genomic sequence, the cDNA sequence, allelic variants, synthetic variants and mutants thereof. This includes sequences that codes for variants of the polypeptide set forth in the sequence listing including biologically active triacylglycerol synthesising enzymes as well as sequences that are to be used as probes, vectors for transformation or cloning intermediates.

Another aspect of the present invention relates to those polypeptides, which have at least 60% identity to SEQ ID NO 2. Preferred embodiments are polynucleotides that encode polypeptides with diacylglycerol acyltransferase activity.

In a different aspect, this invention relates to the use of these nucleotide sequences in recombinant DNA constructs to direct the transcription and translation of the diacylglycerol acyltransferase sequence of the present invention in a host organism or progeny thereof, including oil seeds, yeast and other fungi, as well as other oil accumulating organisms. Cells and organisms containing the diacylglycerol acyltransferase as a result of the production of the acyltransferase encoding sequence are also included within the scope of the invention.

Of particular interest is the expression of the nucleotide sequences of the present invention from transcription initiation regions that are preferentially expressed in plant seed tissues. It is contemplated that the gene sequence may be synthesized, especially when there is interest to provide plant-preferred codons.

In a different embodiment, this invention also relates to methods of using a DNA sequence encoding a said protein of the present invention for increasing the oil-content within the cells of different organisms. Further, the invention makes possible a process for the production of triacylglycerol, which comprises growing transgenic cells or organisms under conditions whereby any of the nucleotide sequences discussed above are expressed in order to produce an enzyme in these cells with the ability to transfer a fatty acid from acyl-CoA to diacylglycerol, thus forming triacylglycerol.

Moreover, triacylglycerols produced by the aforementioned process are included in the scope of the present invention.

The present invention can be essentially characterized by the following aspects:

1. Use of a nucleic acid sequence encoding an enzyme catalysing the transfer of a fatty acid from acyl-CoA to diacylglycerol for the production of triacylglycerol (TAG) by genetic transformation of an oil-producing organism with said sequence in order to be expressed in this organism and result in an active enzyme in order to increase the oil content of the organism.

The nucleic acid sequence is derived from the sequence shown in SEQ ID NO. 1, from the Saccharomyces cerevisiae ARE1 gene (genomic clone or cDNA), or from a nucleic acid sequence or cDNA that contain nucleotide sequences coding for a protein with an amino acid sequence that is 60% or more identical to the amino acid sequence as presented in SEQ. ID. NO. 2.

2. Transgenic organisms comprising, in their genome or on a plasmid, a nucleic acid sequence according to the above, transferred by recombinant DNA technology. The transgenic organisms are selected from the group consisting of fungi, plants and animals. Preferably the transgenic organisms agricultural plants and preferably said nucleotide sequence is expressed under the control of a storage organ specific promoter. Alternatively, the nucleotide sequence is expressed under the control of a seed-specific promoter.

3. Oils from organisms according to aspect 2.

4. A protein encoded by a DNA molecule according to SEQ ID NO. 1 or a functional (enzymatically active) fragment thereof. Alternatively, the protein produced in an organism as specified in aspect 2, which has the amino acid sequence set forth in SEQ ID NO. 2 or an amino acid sequence with at least 60 % homology to said amino acid sequence. Preferably the protein is isolated from Saccharomyces cerevisiae.

5. Use of a protein as specified in aspect 4 in the production of triacylglycerols.

6. Triacylglycerols according aspect 5.

DETAILED DESCRIPTION OF THE INVENTION

The invention now having been generally described will be more readily understood by reference to the following drawings and examples, which are included for the purpose of illustration only, and are not intended to limit scope of the present invention.

Description of the figures:

Figure 1. In vitro DAGAT activity in a yeast strain (SCY62) that overexpresses the AREl gene. Aliquots of microsomal membranes prepared from the control strain (lane A) or the AREl overexpressing strain (lane B) were assayed for DAGAT activity according to Method A described in Material and Methods. The radioactive triacylglycerol synthesised was visualised and quantified as cpm (figures in brackets) on the TLC plate by electronic autoradiography (Instant Imager, Packard, US). Abbreviations used in the figure: triacylglycerol (TAG) and unesterified fatty acids (FA).

Figure 2. In vitro DAGAT activity in a PDAT DAGAT B double mutant, a PDAT DAGAT B AREl triple mutant, and in the same triple mutant containing a plasmid that overexpresses the AREl gene.

The radioactive triacylglycerols (TAG) synthesised in microsomes from the double mutant, H1226 (lane A), the triple mutant, H1236 (lane B) and the same triple mutant containing a plasmid that overexpresses the AREl gene (lane C) were visualised on a TLC plate by electronic autoradiography (Instant Imager, Packard, US).

BRIEF DESCRIPTION OF THE SEQ ID:

SEQ ID NO. 1 : Genomic DNA sequence of the Saccharomyces cerevisiae AREl gene , ORF YCR048W. SEQ ID NO. 2: The amino acid sequence of the open reading frame YCR048W from Saccharomyces cerevisiae.

EXAMPLES

EXAMPLE 1 - Triacylglycerol accumulation is reduced in yeast cells that lack the AREl gene

Materials and Methods

Yeast strains. Yeast strains used in this study were congenic to the W303-1 A (Thomas & Rothstein, 1989) background. An arel mutant strain, HI 111, with the genotype MATa arel- Δ::HIS3 ADE2 can 1-100 leu2-3,112 trpl-1 uraS-1, was generated by crossing the two strains SCY60 (MATa are 1-Δ::HIS3 ade2-l can 1-100 leu2-3,112 trpl-1 ura3-l) and SCY61 f 4_Ta are2-Δ::LEU2 ADE2 can 1-100 his3-ll,15 trpl-1 ura3-l) (Yang et al., 1996) and dissecting tetrads. As a wild type control, we used SCY62 (MATa ADE2 can 1-100 his3- 11,15 leu2-3 trpl-1 ura3-l) (Yang et al., 1996). Yeast mutant strains disrupted in YNR008w and YOR245c encoding yeast DAGAT B and PDAT, respectively, and the AREl gene were constructed through a series of yeast transformations using the lithium acetate method. Linear DNA fragments used for the disruption of the YOR245c and YNR008w genes were created as follows. Primers specific for YOR245c (300 bases upstream,

CAGCATTGACGTAATGGGAA, and downstream, AAAGCCAAAAAGAGAAGGACA, of the gene) were constructed and the gene was synthesised using PCR from SCY62 genomic DNA. The PCR-fragment was blunt-ended and ligated into pUCl 19 previously cleaved with the restriction enzyme Smal. The resulting plasmid, YOR245c-pUCl 19, was then digested with ClaVStul and dephosphorylated to prevent religation. The marker KanMX4 was obtained by digestion of the plasmid pFA6a by Smal/Sacl. The blunted KanMX4 fragment was then ligated into the YOR245c-pUCl 19 vector between the Clal and Stwl sites within the YOR245c open reading frame. A linear fragment containing the resulting YOR245c::KanMX4 disruption cassette was finally obtained through cleavage by BamHVNdel. The linear fragment used to disrupt the YNR008w gene was constructed in a similar manner as the YOR245c::KanMX4 fragment. The YNR008w gene was amplified from SCY62 genomic DNA, cloned into the pBluescript vector (Dahlqvist et al., 2000) and digested with restriction enzyme BbsVMunl. The TRP1 marker was then ligated between the Bbsl and Muni sites in the YNR008w-pBluescript plasmid, and a linear fragment containing the disruption cassette was obtained by BamRVPstl digestion. The single PDAT mutant, H1079, with the genotype MATa pdat-Δ::TRPl ADE2 leu2-3,112 urα3-l his3-ll,15 trpl-1, was generated by transforming the wild type strain SCY62 with the linear YNR008w::TRPl fragment. The PDAT DAGAT B double mutant, HI 226, with the genotype MATa pdat- Δ::TRP1 dagat B-Δ::KanMX4 ADE2 leu2-3,112 ura3-l his3-ll,15 trpl-1, was constructed in an identical manner by transforming HI 079 with the linear YOR245c::KanMX4 fragment. An AREl PDAT double mutant, H1224, with the genotype MATα arel-Δ::HIS3 pdat-Δr. TRPl ADE2 can 1-100 leu2-3,112 ura3-l trpl-1, was generated by transforming HI 111 with the linear YNR008w::TRPl fragment. The triple mutant strain, H1236, with the genotype MATα arel-Δ::HIS3pdat-Δ::TRPl dagat B-Δ: :KanMX4 ADE2 leu2-3,112 ura3-l trpl-1, was constructed by transforming H1224 with the linear YOR245c::KanMX4 fragment.

Yeast Cultivations. Yeast cells were cultivated at 28 or 30°C on a rotary shaker in liquid YPD medium (1% yeast extract, 2% peptone, 2% glucose). Transformed cells were grown in synthetic medium (Sherman et al., 1986) lacking uracil and supplemented with 2 % (vol/vol) glycerol and 2% (vol/vol) ethanol.

Lipid Analysis. The lipid content of the yeast cells was determined as described by Dahlqvist et al. (2000) and is presented as nmol of fatty acid (FA) per mg dry weight yeast.

Results

The lipid content of a mutant yeast strain (SCY60), in which the AREl gene was disrupted, was analyzed and compared to wild type yeast cells (SCY62) at different stages of growth. In arel mutant cells, harvested in exponential phase after 10 hours of cultivation, the total amount of lipid, measured as nmol FA per dry weight yeast, was not significantly different from the wild type yeast (table 1), nor did the amount of fatty acids accumulated into TAG differ strongly between the wild-type and the arel mutant. The effect of the arel disruption on oil accumulation in stationary phase cells was analysed in an experiment were the yeast cells were pre-cultivated for 24 h in liquid YPD medium. The cells were then harvested and re-suspended in minimal medium (Meesters et al, 1996), supplemented with 16 g/1 glycerol, to the original volume of the growth culture. In this glycerol supplemented minimal medium the yeast cells will enter stationary phase under conditions suitable for TAG accumulation. After further cultivation for 24 h, the cells were harvested and their lipid composition was determined. The total lipid content in the arel mutant was 15% less than in the wild type. The TAG amount in the arel mutant was almost 40 % lower than in the wild type, whereas the polar lipid content did not differ significantly between the arel mutant and the wild type yeast (table 1). Two other genes, YNROOδw and YOR254c (Stahl, 1999; Dahlqvist, et al., 2000; Lardizabal et al., 2000) have recently been shown to be involved in TAG synthesis in yeast. These genes encode a PDAT and a DAGAT B protein, respectively. A yeast strain disrupted in all three genes (AREl, YNROOδw and YOR254c) and a yeast strain with disruptions in only the PDAT and DAGAT B genes were made and they are here named the triple and double mutant, respectively. The TAG content of the double mutant was 48 % of the wild type (table 2), whereas the amount of TAG accumulated in the triple mutant was only 4% of the level in the wild type yeast. By comparing the amounts of TAG accumulated in the double and triple mutants it is clear that Arel protein contributes to TAG synthesis in yeast.

In summary, these experiment clearly show that the product of the AREl gene contributes to TAG accumulation in yeast.

Table 1. Lipid content in AREl mutant (SCY60) and wild type (SCY62) yeast cells. The lipid accumulation in yeast disrupted in the AREl gene (are 1 mutant) was analysed at different stages of growth and compared to the control wild type yeast. The lipid composition of cells in exponential growth was analysed after 10 hours of cultivation in YPD medium at 28 °C. Yeast cells in stationary phase was prepared by pre-cultivating the cells on liquid YPD medium for 24 hours at 28 °C, after which the cells were harvested, re-suspended in minimal medium (Meesters et al, 1996) supplemented with 16 g/1 glycerol, and cultivated for an additional 24 hours at 28 °C. The content of sterol esters, TAG, other neutral lipids, and polar lipids was determined as nmol fatty acids (FA) per mg of dry yeast weight.

SCY62 SCY60

(nmol FA / mg) (nmol FA / mg) lOh 48h lOh 48h

Sterol esters 15 24 12 19

Triacylglycerol 6 44 8 28

Other neutral lipids 4 6 4 5

Polar lipids 65 74 63 74

Total lipids 90 148 87 126 Table 2. Lipid content in the PDATDAGATB double mutant strain (HI 226), in the PDAT DAGATB AREl triple mutant strain (HI 236) and in wild type yeast cells (SCY62). The different yeast strains, all of which contained the empty expression plasmid pJN92 (Ronne et al., 1991), were cultivated in YNB medium to which 2 % (v/v) of galactose was added at an A₆oo of 4. The cells were harvested after an additional 22 hours growth and the content of sterol esters, TAG, other neutral lipids, and polar lipids was determined as nmol fatty acids (FA) per mg of dry yeast weight.

SCY62 H1226 H1236

(nmol FA / mg) (nmol FA / 1 ng) (nmol FA / mg)

Sterol esters 13 10 1

Triacylglycerol 163 78 7

Other neutral lipids 17 16 41

Polar lipids 58 66 44

Total lipids 251 170 87

EXAMPLE 2 - Triacylglycerol accumulation is increased in yeast cells that overexpress the AREl gene.

Material and Methods

For induced overexpression of the AREl gene, a 2001 bp Ehel/Ecl\36ll fragment from the plasmid YEP 3-16 (Yang et al., 1996) was cloned into the BamHl site of the GALl expression vector pJN92 (Ronne et al., 1991), thus generating pUS5. The wild type yeast strain SCY62 (MATa ADE2 can 1-100 his3-ll,15 leu2-3 trpl-1 ura3-l) (Yang et al., 1996), was transformed with the pUS5 and cultivated at 28 °C on a rotary shaker in synthetic medium (Sherman et al, 1986) lacking uracil and supplemented with 2 % (vol/vol) glycerol and 2 % (vol/vol) ethanol. The GALl promoter was induced after 43 h of growth by the addition of 2 % (wt/vol) final concentration of galactose. Cells were harvested after an additional 24 hours of growth. Wild type (SCY62) cells transformed with the empty vector, pJN92, and cultivated under identical conditions were used as a control. The lipid content of the yeast cells was determined as described by Dahlqvist et al. (2000) and is presented as nmol of fatty acid (FA) per mg dry weight yeast. Results

The effect of overexpression of the AREl gene on lipid accumulation was studied by transforming the wild-type yeast (strain SCY62) with a plasmid containing the AREl gene under control of the galactose-induced GALl promotor (Table 3). Overexpression of the AREl gene from this promoter had no strong effect on the growth rate as determined by optical density measurements. However, the total lipid content in yeast cells that overexpressed AREl was 1.4 fold higher than in the control yeast transformed with an empty expression vector (Table 3). The elevated lipid content in yeast cells overexpressing AREl is mostly due to a 50% increase in the TAG content, but the amount of sterol esters also increased significantly in these cells, as compared to the control. These results clearly demonstrate that the gene product of AREl, in addition to its earlier reported involvement in the synthesis of sterol esters (Yang et al, 1996), also is involved in TAG synthesis. The elevated levels of TAG achieved in the AREl overexpressing cells also clearly demonstrate the potential use of the AREl gene in increasing the oil content in transgenic organisms.

Table 3. Lipid content in yeast cells that overexpress the AREl gene. Yeast cells (SCY 62) transformed with the AREl gene under the control of the GALl promotor in the pJN92 vector were cultivated as described in the Material and Method section. Yeast cells (SCY62), transformed with an empty vector, cultivated under identical conditions were used as control. The cells were harvested and the content of sterol esters, triacylglycerols, other neutral lipids and polar lipids was determined as nmol fatty acids (FA) per mg dry yeast weight.

SCY62 SCY62 overexpressing AREl

(nmol FA / mg) (nmol FA / mg)

Sterol esters 19 27

Triacylglycerol 160 239

Other neutral lipids 30 32

Polar lipids 48 56

Total lipids 257 354 EXAMPLE 3 - The AREl gene product has diacylglycerol acyltransferase activity.

Materials and Methods

In vitro diacylglycerol acyltransferase (DAGAT) activity was analyzed, in microsomal fractions prepared from yeast cells, by using one of the following methods.

Method A: A wild type yeast (strain SCY62) was transformed with a plasmid (pUS5) containing the AREl gene under the control of a GALl promotor (described in Material and Methods in Example 2). The transformed yeast was cultivated at 28°C in defined YNB medium lacking uracil. The expression of the AREl gene was induced by the addition of 2 % (v/v) galactose after 8 hours growth and the cells were harvested after an additional 17 hours. Microsomal membranes were prepared from the transformed yeast by resuspending lg of yeast (fresh weight) in 8 ml of ice-cold buffer (20 mM Tris-Cl, pH 7.9, 10 mM MgCl , 1 mM EDTA, 5 % (v/v) glycerol, 1 mM DTT, 0.3 M ammonium sulphate) in a 12 ml glass tube to which 4 ml of glass beads (diameter 0.45 - 0.5 mm) were added. The glass tube was heavily shaken (3 x 60 s) with a MSK cell homogenizer (B. Braun Melsungen AG, Germany). The suspension was centrifuged at 20 000 g for 15 min at 6 °C and the resulting supernatant was centrifuged at 100 OOOg for 2 h at 6 °C. The resulting pellet, containing microsomal membranes, was resuspended in 0.1 M K-phosphate (pH 7.2) buffer and stored at -80 °C. DAGAT activity was analyzed in aliquots of microsomal membranes (50 μl), corresponding to 10 nmol phosphatidylcholine, to which 1 μmol of dioleoyl-PG and 0.25 μmol of dioleoyl- DAG emulsified in 50 μl of buffer containing 190 mM HEPES-NaOH, pH 7.5, 125 mM MgCl₂, 30 mM CHAPS, 2.5 mg/ml BSA and 2 nmol [¹⁴C]-palmitoyl-CoA (2775 dpm/nmol), were added. The reaction mixture was incubated at 30°C for 30 min. The lipids were then extracted in chloroform and separated using thin layer chromatography on silica gel 60 plates in hexane / diethyl ether / acetic acid (80:20:1). The radioactive lipids were visualized and quantified on the plates by electronic autoradiography (Instant Imager, Packard, US).

Method B: The PDAT DAGAT B double mutant (H1226) and the PDAT DAGAT B AREl triple mutant (HI 236), described in Material and Methods in Example 1, were transformed with the empty expression plasmid (pJN92). A transformant expressing the AREl gene under the control of the GALl promotor was generated by transforming the triple mutant HI 236 with the plasmid pUS5 (described in Material and Methods in Example 2). All yeast transformants were cultivated in YNB medium to which 2 % (v/v) of galactose was added at an A₆₀₀ of 4. The cells were harvested after an additional 6 hours growth and microsomes were prepared using a modification of the procedure of Dahlqvist et al. (2000). Yeast cells (0.2 g) were resuspended in 1.5 ml of ice-cold buffer (20 mM Tris-Cl pH 7.9, 10 mM MgCl₂, 1 mM EDTA, 5 % (vol/vol) glycerol, 1 mM DTT, 0.3 M ammonium sulfate) in a 2 ml Eppendorf tube containing 0.2 ml glass beads (0.45-0.5 mm in diameter). The tube was heavily shaken (3 x 60 s) in a cell homogenizer (Mini Bead Beater). The homogenized yeast was centrifuged at 1350 x g for 20 min at 4 °C, and the resulting supernatant was subsequently centrifuged at 150 000 x g for 1 h at 4 °C. The pellet was re-suspended in 0.1 M potassium phosphate (pH 7.2), and stored at -80 °C. Dihexanoyl-DAG (5 nmol) dissolved in chloroform was added to micro tubes and the chloroform was evaporated under a stream of N₂. Aliquots (90 μl) of microsomal fractions corresponding to 150 μg protein, in a buffer consisting of 50 mM HEPES (pH 7.2), 5 mM MgCl₂, and 1 mg/ml BSA were added to the tubes and the suspension was thoroughly mixed. Finally, 10 μl of [¹⁴C]-palmitoyl-CoA (20 nmol, 5000 dpm/nmol) was added, and the mixtures were incubated at 30 °C for 15 min. Lipids were extracted from the reaction mixture into chloroform (Bligh & Dyer, 1959) and separated by TLC on silica gel 60 plates (Merck). The TLC plate was first developed in chloroform / methanol / acetic acid / water (85:15:10:3.5) for 80 mm. The dried plate was then developed in hexane / diethyl ether / acetic acid (80:20:1.5) for 180 mm. The radioactive lipids were visualized and quantified on the plates by electronic autoradiography (Instant Imager, Packard).

Results

Microsomal membranes prepared from the transformed yeast overexpressing the AREl gene and from control yeast transformed with an empty plasmid (pJN92) were assayed for DAGAT activity according to Method A in Materials and Methods. The amount of radiolabelled TAG synthesized from [ C]palmitoyl-CoA in microsomal membranes prepared from the AREl overexpressor was increased with 66 % as compared to the control yeast (Fig 1). DAGAT activity was also assayed in microsomal membranes prepared from the PDAT DAGAT B double mutant strain (H1226) and the PDAT DAGAT B AREl triple mutant strain (H1236) cells (Method B). In the double mutant, with a functional AREl gene, TAG with two hexanoyl and one [¹⁴C]palmitoyl chain, was synthesized from added dihexanoyl-DAG and [¹⁴C]palmitoyl-CoA. This synthesis was barely detectable in the triple mutant (figure 2) where the AREl gene was disrupted. However, the in vitro synthesis of TAG was restored in triple mutant cells transformed with a plasmid expressing the AREl gene. This clearly shows that the in vitro synthesis of TAG in these yeast mutants correlates with the presence of a functional AREl gene and that the protein encoded by the AREl gene possesses DAGAT activity.

EXAMPLE 4 -Triacylglycerol accumulation is increased in the seeds of Arabidopsis thaliana that express the AREl gene.

Material and methods

The AREl gene was amplified from the yeast genome using the proofreading enzyme polymerase pfu (Promega). An EcoRl andXbal restriction enzyme site was introduced respectively into the 5' and 3' ends of this fragment to allow directional cloning of the fragment. The PCR fragment was cloned into the vector pBluescript (Stratagene). The insert derived from this plasmid was then cloned downstream of a napin promoter fragment (Stalberg et al., 1993) in the vector pPGTV-KAN (Becker et al., 1993). This plasmid was transformed into Agrobacterium strain GV3301. Transformed Agrobacterium cells were then used to transform root explants from Arabidopsis thaliana (Valvekens et ai, 1992). The lipid content in Arabidopsis seeds was determined by methylation of fatty acids. Fatty acids in the oil of proximately 2-3 mg of seeds were methylated in 2 ml 2 % (vol/vol) H SO₄ in dry methanol for 90 min at 90 °C. The fatty acid methyl esters were extracted with hexane and analyzed by GLC through a 50 m x 0.32 mm CP-Wax58-CB fused-silica column (chrompack), methylheptadecanoic acid was used as internal standard.

Results

A. thaliana was transformed with the AREl gene under the control of a napin promoter, which is seed specific and active during the major phase of oil accumulation. The oil content was analyzed in seeds from single T2 plants derived from four independent transformation events (Table 4). The results showed that in three lines between 50 % and 100 % of the T2 plants generated seeds with statistically significant elevated oil content as compared to the oil content in the seeds from the control plants. The oil content was elevated with up to 18 % in the seeds expressing AREl. One line (28-1) had the same oil content as the seeds from the control plants. Table 4. Accumulation of oil in seeds from Arabidopsis thaliana transformed with the AREl gene.

T2 plants transformed with the AREl gene under the control of the napin promotor and control plants transformed with an empty vector were cultivated in a growth chamber under controlled conditions. The oil content in mature seeds of these plants was determined by GLC analyses and is presented as nmol fatty acids (FA) per mg seed.

Transformants

^* Calculated with the mean difference two-sided test at α = 5 and based on the average oil content of 4 control plants.

SEQUENCE LISTING

1 GENERAL INFORMATION

I) APPLICANT: Scandinavian Biotechnology Research AB

n) TITLE OF INVENTION: Use of a class of enzymes and their encoding genes to increase oil content in transgenic organisms

m) Number of sequences: 2

2) INFORMATION FOR SEQ ID NO : 1 :

l) SEQUENCE CHARACTERISTICS:

A) LENGTH: 1833 bases

B) TYPE: nucleic acid c) STRANDEDNESS: single D) TOPOLOGY: linear

ii) MOLECULE TYPE: DNA

iii) SEQUENCE DESCRIPTION:: SEQ ID NO : 1:

ATGACGGAGA CTAAGGATTT GTTGCAAGAC GAAGAGTTTC TTAAGATCCG 50

CAGACTCAAT TCCGCAGAAG CCAACAAACG GCATTCGGTC ACGTACGATA 100

ACGTGATCCT GCCACAGGAG TCCATGGAGG TTTCGCCACG GTCGTCTACC 150

ACGTCGCTGG TGGAGCCAGT GGAGTCGACT GAAGGAGTGG AGTCGACTGA 200

GGCGGAACGT GTGGCAGGGA AGCAGGAGCA GGAGGAGGAG TACCCTGTGG 250 ACGCCCACAT GCAAAAGTAC CTTTCACACC TGAAGAGCAA GTCTCGGTCG 300

AGGTTCCACC GAAAGGATGC TAGCAAGTAT GTGTCGTTTT TTGGGGACGT 350

GAGTTTTGAT CCTCGCCCCA CGCTCCTGGA CAGCGCCATC AACGTGCCCT 400

TCCAGACGAC TTTCAAAGGT CCGGTGCTGG AGAAACAGCT CAAAAATTTA 450

CAGTTGACAA AGACCAAGAC CAAGGCCACG GTGAAGACTA CGGTGAAGAC 500

TACGGAGAAA ACGGACAAGG CAGATGCCCC CCCAGGAGAA AAACTGGAGT 550

CGAACTTTTC AGGGATCTAC GTGTTCGCAT GGATGTTCTT GGGCTGGATA 600

GCCATCAGGT GCTGCACAGA TTACTATGCG TCGTACGGCA GTGCATGGAA 650

TAAGCTGGAA ATCGTGCAGT ACATGACAAC GGACTTGTTC ACGATCGCAA 700

TGTTGGACTT GGCAATGTTC CTGTGCACTT TCTTCGTGGT TTTCGTGCAC 750

TGGCTGGTGA AAAAGCGGAT CATCAACTGG AAGTGGACTG GGTTCGTTGC 800

AGTGAGCATC TTCGAGTTGG CTTTCATCCC CGTGACGTTC CCCATTTACG 850

TCTACTACTT TGATTTCAAC TGGGTCACGA GAATCTTCCT GTTCCTGCAC 900

TCCGTGGTGT TTGTTATGAA GAGCCACTCG TTTGCCTTTT ACAACGGGTA 950

TCTTTGGGAC ATAAAGCAGG AACTCGAGTA CTCTTCCAAA CAGTTGCAAA 1000

AATACAAGGA ATCTTTGTCC CCAGAGACCC GCGAGATTCT GCAAAAAAGT 1050

TGCGACTTTT GCCTTTTCGA ATTGAACTAC CAGACCAAGG ATAACGACTT 1100 CCCCAACAAC ATCAGTTGCA GCAATTTCTT CATGTTCTGT TTGTTCCCCG 1150

TCCTCGTGTA CCAGATCAAC TACCCAAGAA CGTCGCGCAT CAGATGGAGG 1200

TATGTGTTGG AGAAGGTGTG CGCCATCATT GGCACCATCT TCCTCATGAT 1250

GGTCACGGCA CAGTTCTTCA TGCACCCGGT GGCCATGCGC TGTATCCAGT 1300

TCCACAACAC GCCCACCTTC GGCGGCTGGA TCCCCGCCAC GCAAGAGTGG 1350

TTCCACCTGC TCTTCGACAT GATTCCGGGC TTCACTGTTC TGTACATGCT 1400

CACGTTTTAC ATGATATGGG ACGCTTTATT GAATTGCGTG GCGGAGTTGA 1450

CCAGGTTTGC GGACAGATAT TTCTACGGCG ACTGGTGGAA TTGCGTTTCG 1500

TTTGAAGAGT TTAGCAGAAT CTGGAACGTC CCCGTTCACA AATTTTTACT 1550

AAGACACGTG TACCACAGCT CCATGGGCGC ATTGCATTTG AGCAAGAGCC 1600

AAGCTACATT ATTTACTTTT TTCTTGAGTG CCGTGTTCCA CGAAATGGCC 1650

ATGTTCGCCA TTTTCAGAAG GGTTAGAGGA TATCTGTTCA TGTTCCAACT 1700

GTCGCAGTTT GTGTGGACTG CTTTGAGCAA CACCAAGTTT CTACGGGCAA 1750

GACCGCAGTT GTCCAACGTT GTCTTTTCGT TTGGTGTCTG TTCAGGGCCC 1800

AGTATCATTA TGACGTTGTA CCTGACCTTA TGA 1833 2 ) INFORMATION FOR SEQ I D NO : 2 :

i ) SEQUENCE CHARACTERI STICS :

A) LENGTH : 610 amino acids

B ) TYPE : amino acid D ) TOPOLOGY : linear

ii ) MOLECULE TYPE : protein

iii ) SEQUENCE DESCRIPTION : SEQ ID NO : 2 :

Met Thr Glu Thr Lys Asp Leu Leu Gin Asp Glu Glu Phe Leu Lys lie 1 5 10 15

Arg Arg Leu Asn Ser Ala Glu Ala Asn Lys Arg His Ser Val Thr Tyr 20 25 30

Asp Asn Val lie Leu Pro Gin Glu Ser Met Glu Val Ser Pro Arg Ser 35 40 45

Ser Thr Thr Ser Leu Val Glu Pro Val Glu Ser Thr Glu Gly Val Glu 50 55 60

Ser Thr Glu Ala Glu Arg Val Ala Gly Lys Gin Glu Gin Glu Glu Glu 65 70 75 80

Tyr Pro Val Asp Ala His Met Gin Lys Tyr Leu Ser His Leu Lys Ser 85 90 95

Lys Ser Arg Ser Arg Phe His Arg Lys Asp Ala Ser Lys Tyr Val Ser 100 105 110

Phe Phe Gly Asp Val Ser Phe Asp Pro Arg Pro Thr Leu Leu Asp Ser 115 120 125

Ala lie Asn Val Pro Phe Gin Thr Thr Phe Lys Gly Pro Val Leu Glu 130 135 140

Lys Gin Leu Lys Asn Leu Gin Leu Thr Lys Thr Lys Thr Lys Ala Thr 145 150 155 160

Val Lys Thr Thr Val Lys Thr Thr Glu Lys Thr Asp Lys Ala Asp Ala 165 170 175

Pro Pro Gly Glu Lys Leu Glu Ser Asn Phe Ser Gly lie Tyr Val Phe 180 185 190

Ala Trp Met Phe Leu Gly Trp lie Ala lie Arg Cys Cys Thr Asp Tyr 195 200 205 Tyr Ala Ser Tyr Gly Ser Ala Trp Asn Lys Leu Glu lie Val Gin Tyr 210 215 220

Met Thr Thr Asp Leu Phe Thr He Ala Met Leu Asp Leu Ala Met Phe 225 230 235 240

Leu Cys Thr Phe Phe Val Val Phe Val His Trp Leu Val Lys Lys Arg 245 250 255

He He Asn Trp Lys Trp Thr Gly Phe Val Ala Val Ser He Phe Glu 260 265 270

Leu Ala Phe He Pro Val Thr Phe Pro He Tyr Val Tyr Tyr Phe Asp 275 280 285

Phe Asn Trp Val Thr Arg He Phe Leu Phe Leu His Ser Val Val Phe 290 295 300

Val Met Lys Ser His Ser Phe Ala Phe Tyr Asn Gly Tyr Leu Trp Asp 305 310 315 320

He Lys Gin Glu Leu Glu Tyr Ser Ser Lys Gin Leu Gin Lys Tyr Lys 325 330 335

Glu Ser Leu Ser Pro Glu Thr Arg Glu He Leu Gin Lys Ser Cys Asp 340 345 350

Phe Cys Leu Phe Glu Leu Asn Tyr Gin Thr Lys Asp Asn Asp Phe Pro 355 360 365

Asn Asn He Ser Cys Ser Asn Phe Phe Met Phe Cys Leu Phe Pro Val 370 375 380

Leu Val Tyr Gin He Asn Tyr Pro Arg Thr Ser Arg He Arg Trp Arg 385 390 395 400

Tyr Val Leu Glu Lys Val Cys Ala He He Gly Thr He Phe Leu Met 405 410 415

Met Val Thr Ala Gin Phe Phe Met His Pro Val Ala Met Arg Cys He 420 425 430

Gin Phe His Asn Thr Pro Thr Phe Gly Gly Trp He Pro Ala Thr Gin 435 440 445

Glu Trp Phe His Leu Leu Phe Asp Met He Pro Gly Phe Thr Val Leu 450 455 460

Tyr Met Leu Thr Phe Tyr Met He Trp Asp Ala Leu Leu Asn Cys Val 465 470 475 480

Ala Glu Leu Thr Arg Phe Ala Asp Arg Tyr Phe Tyr Gly Asp Trp Trp 485 490 495

Asn Cys Val Ser Phe Glu Glu Phe Ser Arg He Trp Asn Val Pro Val 500 505 510

His Lys Phe Leu Leu Arg His Val Tyr His Ser Ser Met Gly Ala Leu 515 520 525 His Leu Ser Lys Ser Gin Ala Thr Leu Phe Thr Phe Phe Leu Ser Ala 530 535 540

Val Phe His Glu Met Ala Met Phe Ala He Phe Arg Arg Val Arg Gly 545 550 555 560

Tyr Leu Phe Met Phe Gin Leu Ser Gin Phe Val Trp Thr Ala Leu Ser 565 570 575

Asn Thr Lys Phe Leu Arg Ala Arg Pro Gin Leu Ser Asn Val Val Phe 580 585 590

Ser Phe Gly Val Cys Ser Gly Pro Ser He He Met Thr Leu Tyr Leu 595 600 605

Thr Leu 610

REFERENCES

Becker, D., Kemper, E., Schell, J., and Masterson, R. (1993) Plant Mol Biol. 20, 1195-7

Bell, R.M., and Coleman, R.A. (1983) in The Enzymes (Boyer, P.D., ed.) Vol. 16, pp. 87-111,

Academic Press, Orlando

Blig , E.G. and Dyer, W.J. (1959J Can. J. Biochem. Physiol. 37, 911-917

Cao, Y.-Z., and Huang, A.H.C. (1986) Plant. Physiol. 82, 813-820

Cases, S., Smith, S.J., Zheng, Y.-W., Myers, H.M., Lear, S.R., Sande, E., Novak, S., Collins,

C, Welch, C.B., Lusis, A.J., Erickson, S.K., and Farese, R.V. (1998) Proc. Natl. Acad. Sci.

95, 13018-13023

Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Ronne, H., and Stymne, S. (1999) Enzymes catalysing a transacylation reaction involved in triacylglycerol synthesis. Presented at

Biochem, Mol. Biol. Plant Fatty Acids Glycerolipids Symp., South Lake Tahoe, Calif., USA

Dahlqvist, A., Stahl, U., Lenman, M., Banas, A., Lee, M., Sandager, L., Ronne, H., and

Stymne, S. (2000) Proc. Natl. Acad. Sci. USA. 97, 6487-6492

Ekundayo, R.O. and Packter, N.M. (1994) Microbiology 140, 931-943

Hobbs, D.H., Lu, C, and Hills, M.J. (1999) FEBS Letters 452, 145-149

Lardizabal KD, Hawkins D, Thompson GA. (2000) International Patent No. WO 00/01713

Lardizabal, K., Hawkins, D., Mai, J., and Wagner, N. (1999) Identification of a new diacylglycerol acyltransferase gene family. Presented at Biochem, Mol. Biol. Plant Fatty

Acids Glycerolipids Symp., South Lake Tahoe, Calif., USA

Lassner, M.W., Ruezinsky, D.M. (1999) International patent No. WO 99/63096

Martin, B.A. and Wilson, R.F. (1983) Lipids 18, 1-6

Meesters, P.A.E.P., Huijberts, G.N.M., and Eggink, G. (1996) Appl. Microbiol. Biotechnol.

45, 575-579

Oelkers, P., Behari, A., Cromley, D., BiUheimer, J.T., and Sturley, S.L. (1998) J. Biol. Chem.

273, 26765-26771

Ratledge, C. (1989) in Microbial Lipids (Ratledge, C. and Wilkinson, S.G., eds.) 2, 567-668,

Academic Press, London

Ronne, H., Carlberg, M., Hu, G.-Z., and Nehlin, J.O. (1991) Mol. Cell. Biol. 11, 4876-4884

Sherman, F., Fink, G.R., and Hicks, J.B. (1986) Laboratory Course Manual for Methods in

Yeast Genetics, Cold Spring Harbor Lab. Press, Plainview, NY

Stalberg, K., Ellerstrδm, M., Josefsson, L.G., and Rask, L. (1993) Plant Mol Biol. 23, 671-83 Stahl, U. (1999) Phospholipases and transacylases involved in triacylglycerol synthesis.

Presented at 23 ^rd World Congress and Exhibition of the International Society for Fat Research

(ISF), Brighton, UK

Thomas, B.J. and Rothstein, R. (1989) Cell 56, 619-630

Valvekens, D., van Lijsebettens, M., and van Montagu, M. (1992) in Plant Tissue Culture.

(Lindsey K.), Kluwer Academic Publishers. NL

Yang, H., Bard, M., Bruner, D.A., Gleeson, A., Deckelbaum, R.J., Aljinovic, G., Pohl, T.M.,

Rothstein, R. and Sturley, S.L. (1996) Science 272, 1353-1356

Yu, C, Kennedy, N.J., Chang, C.Y.G., and Rothblatt, J.A. (1996) J. Biol. Chem. 271, 24157-

24163

Claims

2. Use according to claim 1, wherein said nucleic acid sequence is derived from the sequence shown in SEQ ID NO. 1.

3. Use according to claims 1 or 2, wherein said sequence is derived from the Saccharomyces cerevisiae AREl gene (genomic clone or cDNA).

4. Use according to claims 1, 2 or 3, wherein a nucleic acid sequence or cDNA is used that contain nucleotide sequences coding for a protein with an amino acid sequence that is 60% or more identical to the amino acid sequence as presented in SEQ. ID. NO. 2.

5. Transgenic organisms comprising, in their genome or on a plasmid, a nucleic acid sequence according to claim 1, 2, 3 or 4, transferred by recombinant DNA technology.

6. Transgenic organisms according to claim 5, which are selected from the group consisting of fungi, plants and animals.

7. Transgenic organisms according to claim 6, which are selected from the group of agricultural plants.

8. Transgenic organisms according to claim 7 which are selected from the group of agricultural plants and where said nucleotide sequence is expressed under the control of a storage organ specific promoter.

9. Transgenic organisms according to claim 8 which are selected from the group of agricultural plants and where said nucleotide sequence is expressed under the control of a seed-specific promoter.

10. Oils from organisms according to claims 5-9.

11. A protein encoded by a DNA molecule according to SEQ ID NO. 1 or a functional (enzymatically active) fragment thereof.

12. A protein produced in an organism as specified in any of the claims 5-9, which has the amino acid sequence set forth in SEQ ID NO. 2 or an amino acid sequence with at least 60 % homology to said amino acid sequence.

13. A protein as specified in claims 11 or 12 that is isolated from Saccharomyces cerevisiae.

14. Use of a protein as specified in claim 11, 12 or 13 in the production of triacylglycerols.

15. Triacylglycerols according to claim 14.