MXPA00002972A - Plant phosphatidicacid phosphatases - Google Patents

Abstract

By this invention, novel nucleic acid sequences encoding for phosphatidic acid phosphatase (PAP) proteins are provided, wherein said PAP protein is active in the formation of diacylglycerol from phosphatidic acid. Also considered are amino acid and nucleic acid sequences obtainable from PAP nucleic acid sequences and the use of such sequences to provide transgenic host cells capable of producing altered lipid compositions and total lipid levels.

Description

PHOSPHATASE OF PHOSPHATETIC PLANT ACID INTRODUCTION This application is a continuation in part of the Application with Serial No. 09 / 122,315, filed on July 24, 1998.

Technical Field The present invention is directed to amino acid and nucleic acid constructs and sequences and methods related thereto.

BACKGROUND Through the development of plant genetic design techniques, it is possible to produce a transgenic variety of plant species to provide plants that have novel and desirable characteristics. For example, it is now possible to design plants genetically for their tolerance to environmental stresses, such as resistance to pathogens and tolerance to herbicides. Another important example for such plant genetic design techniques is the production of valuable products in plant tissues, such as improved fatty acid compositions. There is a need for improved means to obtain or manipulate the content and compositions of fatty acid, from natural or biosynthetic plant sources. For example, novel oil products, improved sources of synthetic triacylglycerols (triglycerides), alternative sources of commercial oils, such as tropical oils (ie, palm kernel and coconut oils) and plant oils found in residual amounts of natural sources, for a variety of food and industrial uses. For this purpose, the triacylglycerol biosynthesis system (TAG) has been studied in mammalian, yeast and plant tissues. In the cytoplasmic membranes of plant seed tissues that accumulate storage triglycerides ("oil"), fatty acyl groups are sequentially added by specific acetyltransferase enzymes to the sn-1, sn-2 and sn-3 glycerol positions -3-phosphate (G3P) to form TAG. This trajectory is commonly referred to as the Kennedy or G3P trajectory (figure 9). The first step in the formation of TAG is the acylation of the sn-1 position of glycerol-3-phosphate (G-3P), catalyzed by glycerophosphate acyltransferase (GPAT), to form lysophosphatidic acid (LA). Lysophosphatidic acid is subsequently acylated at the sn-2 position by lysophosphatidic acid acyltransferase (LPAAT) to create phosphatidic acid. A key step in the formation of TAG is the dephosphorylation of the sn-3 position of the phosphatidic acid (PA) to form s /? -1,2-di-acylglycerol (DAG) and inorganic phosphate catalyzed by the phosphatidic acid phosphatase of enzyme (PAP, EC 3.1.3.4). Sn-1, 2-diacylglycerol is acylated at the sp-3 position by diacylglycerol acyltransferase, finally forming triacylglycerol (TAG).

The characterization of phosphatidic acid phosphatase (also known as PAP) of plants is useful for the subsequent study of the fatty acid synthesis systems of plants and for the development of novel and / or alternative oil sources. Studies of the mechanism of plants can provide means to improve, control, modify or otherwise further alter the total fatty acyl composition of triglycerides and oils. In addition, the elucidation of the critical factor (s) for the natural production of triglycerides in plants is desired, including the purification of such factors and the characterization of the element (s) and / or cofactor (s). ) that improve the efficiency of the system. Of particular interest are the nucleic acid sequences of genes encoding the proteins that may be useful for applications in genetic design.

SUMMARY OF THE INVENTION The present invention provides nucleic acid sequences for proteins, which catalyze the dephosphorylation of phosphatidic acid (PA) to form sn-1,2-diacylglycerol (DAG). Such proteins are referred to herein as phosphatidic acid phosphatase (EC 3.1.3.4) or PAP. By this invention, the nucleic acid sequences encoding the plant PAP can now be characterized with respect to the activity of the enzyme. In particular, isolation of the nucleic acid sequences encoding the PAP of Arabidopsis, Brassica, soybean and corn is provided. Thus, this invention includes the PAP nucleic acid sequences and the corresponding amino acid sequences, and the use of these nucleic acid sequences in the preparation of oligonucleotides containing the PAP coding sequences for analysis and recovery of the sequences of the plant PAP gene. The coding sequence of plant PAP can encode a complete or partial sequence depending on the proposed use. All or a portion of the genomic sequence, or cDNA sequence, is proposed. Of particular interest are recombinant DNA constructs, which provide transcription or transcription and translation (expression) of the PAP sequences of plants. In particular, constructs that are capable of transcription or transcription and translation in plant host cells are preferred. For some applications a reduction in the PAP of plants can be desired. In this manner, recombinant constructs can be designed by having the PAP sequences of the plant in a reverse orientation for the expression of an anti-detection sequence or use of co-suppression, also known as "transconmutation", the constructions can be useful. Such constructs may contain a variety of regulatory regions that include the transcription initiation regions obtained from the genes expressed preferentially in the plant seed tissue. For some uses, it may be desired to use the transcription and translation initiation regions of the PAP gene, either with the PAP coding sequence or to direct the transcription and translation of a heterologous sequence. In still a different aspect, this invention relates to a method for producing a plant PAP in a host cell or progeny thereof through the expression of a construct in the cell. Also contemplated herein are cells that contain a plant PAP as a result of production of the plant PAP coding sequence. In addition, methods for increasing the oil content in the seed of development are contemplated as well as the methods for producing new oil compositions in development seeds of the plants that produce oil. Modified plants, seeds and oils obtained by the expression of the plant PAP sequences and the proteins of this invention are also considered in this invention.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the alignment of the amino acid sequence of the mouse, rat, human, yeast and related PAP sequences of Arabidopsis. The underlined sequences show the location of the conserved PAP sequences to search the databases for the plant PAP sequences. Figure 2 provides the nucleotide sequence and deduced amino acid sequence for PAP, ATPAP1 of Arabidopsis. Figure 3 provides the nucleotide sequence and deduced amino acid sequence for PAP, ATPAP2 from Arabidopsis. Figure 4 provides the nucleotide sequence and deduced amino acid sequence for the PAP, ATPAP3 of Arabidopsis. Figure 5 provides the nucleotide sequence and deduced amino acid sequence of the PAP PAP from Brassica napus. Figure 6 provides the nucleotide sequence and deduced amino acid sequence of the maize PAP. Figure 7 provides the nucleotide sequence and deduced amino acid sequence of the soybean PAP1 of the soybean seed (Glycine sp.). Figure 8 provides the nucleotide sequence and deduced amino acid sequence of the soybean PAP2 from soybean (Glycine sp.). Figure 9 provides a schematic diagram of the Kennedy trajectory for the production of triacylglycerol (TAG) as well as for phosphatidylcholine (PC). G-3P, Glycerol 3 Phosphate; LA, Lysophosphatidic acid; PA, Phosphatidic acid; DAG, Diacylglycerol; TAG, Triacylglycerol; CDP-DG, CDP Diacylglycerol; Pl, Phosphatidylinositol; PS, Phosphatidylserine; PGP, Phosphatidylglycerophosphate; PIP, Pl 4-phosphate; PI3-P, Pl 3-phosphate; PE: Phosphatidylethanolamine; PG: Phosphatidylglycerol; PIP2, Pl 4,5-bisphosphate; PME, Phosphatidylmonomethylethanolamine; CL, cardiolipin; PDE, Phosphatidyldimethylethanolamine; PC, Phosphatidylcholine; CDP-Etn, CDP Ethanolamine. Figure 10 provides nucleic acid sequences identified from the EST libraries searched with ATPAP1. Figure 11 provides a nucleic acid sequence identified from the Brassica seed EST libraries that is homologous to the ATPAP3 sequence.

DETAILED DESCRIPTION OF THE INVENTION According to the subject invention, nucleotide sequences are provided, which are capable of encoding amino acid sequences, such as, a protein, polypeptide, or peptide, encoding phosphatidic acid phosphatase (also referred to in the present as PAP). The novel nucleic acid sequences find use in the preparation of constructs to direct their expression in a host cell. In addition, novel nucleic acid sequences find use in the preparation of plant expression constructs to modify the fatty acid composition as well as the fatty acid content of a host plant cell. In one embodiment of the present invention, nucleic acid sequences are provided, which are encoded for plant phosphatidic acid phosphatase. A PAP nucleic acid sequence from Arabidopsis thaliana is identified from the database using oligonucleotide sequences derived from conserved mouse, rat, human sequences and amino acid sequences of phosphatidic acid phosphatase from yeast. The nucleic acid sequence of PAP from Arabidopsis is used to transform the yeast, E. coli and the plants (Arabidopsis and Brassica napus) to confirm the identity of the clone. In order to identify the related amino acid and nucleic acid sequences of plant phosphatidic acid phosphatase, a known PAP nucleic acid sequence from a mammalian source was used to identify additional PAP nucleic acid sequences from other mammalian sources. or yeast. As described in more detail in the following examples, the nucleic acid and amino acid sequence of a mouse plasmalemma form of PAP is used to identify the protein and DNA sequences of public databases. The protein sequences of the related amino acid sequences of PAP are compared using protein alignment software applications, known in the field. Two amino acid sequences, TDIAKXXIGRLRPHFLXXC (SEQ ID NO: 1) and LSRVSDYKHHWSDV (SEQ ID NO: 2) are identified, which are highly conserved between the different sequences. These two peptide sequences are used to search a public EST database to identify the Arabidopsis cDNAs containing the conserved sequences. A cDNA clone is identified from the database, since it contains the sequence LSRVSDYKHHWSDV in two different reading structures. A total length of the Arabidopsis PAP nucleic acid sequence is obtained and used to search for public and proprietary EST databases. The related PAP sequences of Arabidopsis, ATAP2, ATAP3, as well as related PAP sequences of maize, soybean and Brassica are identified. The sequence alignments between the PAP nucleotide sequences demonstrate a high level of identity between the sequences. Of particular interest in the present invention is the use of PAP genes to increase the oil content of the seeds. Dephosphorylation of phosphatidic acid by PAP is considered to be the limiting step of triacylglycerol biosynthesis amount in animal tissues (Brindley, (1978), Int. J. Obes., 2: 7-16). In addition, in microsomal preparations of sunflower and safflower development cotyledons, the inability to form diacylglycerol of phosphatidic acid in glycerol and acyl-CoA phosphate reactions suggests that PAP may also be the plant-limiting step in plants (Stymne, et al. al., (1987), The Biochemistry of Plants, 9: 192-193). Thus, overexpression of a nucleic acid sequence encoding a plant PAP in an oilseed culture may find use in the present invention to increase the levels of fatty acid in plant tissues. To confirm the activity and specificity of the nucleic acid sequences as PAP enzymes, the analyzes in E. Coli, insects and yeast are carried out in vitro. Expression constructs are prepared and transformed for the expression of E. coli, insect and yeast. The separation by thin layer chromatography of the yeast lipid samples showed the presence of diacylglycerol points, indicating PAP activity. All plants use PAP proteins in the production of TAGs and membrane phospholipids, and in this way any given plant species can be considered as a source of additional PAP proteins. The expression of the plant PAP proteins endogenous to the culture species may find use in the present invention as a method for increasing the fatty acid compositions in plant tissues. Alternatively, reduced expression of endogenous PAP proteins, for example, by using anti-detection constructs, may find use in the present invention to reduce membrane lipid levels in plant tissues. In another embodiment of the present invention, methods are provided for isolating additional sequences encoding the phosphatidic acid phosphatase of other plant species. Such PAP enzymes may find use in producing transgenic plants capable of accumulating high levels of unique oil compositions. For example, identification of a PAP of Cuphea species may have preferential activity for medium chain phosphatidic acid species. By preferred middle chain phosphatidic acid species it is understood that the enzyme encoded by the PAP nucleic acid sequence demonstrates a preference for dephosphorylating phosphatidic acid species containing fatty acyl groups of C6, C8, C10, C12 and / or C14 in the s /? - 1 and / or sn-2 positions on PA species containing different fatty acyl groups at positions s / 7-1 and / or sn-2. In addition, the identification of a nucleic acid sequence that is encoded for PAP enzymes from California Bay (Umbellularia califomica), camphor (Cinnamomun camphora), or coconut may also find use in transgenic plants for the increased production of medium chain fatty acids. Also of interest in the present invention are PAP enzymes with preferential activity in the long chain phosphatidic acid species. Such PAP enzymes can be found in plants such as Garcinia mangifera (mangosteen). By preferred long-chain phosphatidic acid species it is understood that the enzyme encoded by the PAP nucleic acid sequence demonstrates a preference for dephosphorylating phosphatidic acid species containing C16, C18 and / or C18: 1 fatty acyl groups in the positions s /? - 1 and / or sn-2 on PA species containing different fatty acyl groups at positions sn-1 and / or sn-2. Alternatively, PAP enzymes with specific activity in very long chain phosphatidic acid species may find use in the present invention. Such PAP enzymes can be identified in plants such as Nasturtium species, which accumulate in excess of 90% of very long chain fatty acids in their seed oil. By very long chain phosphatidic acid species it is understood that the enzyme encoded by the PAP nucleic acid sequence demonstrates a preference for dephosphorylating phosphatidic acid species containing fatty acyl groups of C20, C22 and longer fatty acyl groups at the positions sn-1 and / or sn-2 on PA species that contain different fatty acyl groups at positions sn-1 and / or sn-2. The preferential activity of a plant PAP in relation to fatty acyl-CoA substrates with particular chain length is determined by comparing the amounts of triacylglycerol product obtained by fatty acyl-CoA substrates with different chain length. In some cases, the chain length of an acyl group at position sn-1 or sn-2 may affect the ability of PAP to dephosphorylate phosphatidic acid. Alternatively, plant PAP enzymes that accumulate long-chain fatty acids (C16 and C18 fatty acids) can discriminate against diacylglycerol species containing short chain, long chain or very long chain fatty acyl groups at the sn- positions. 1 and / or sn-2. Thus, PAP enzymes from plants such as Cuphea species, California Bay, or Nasturtium species may have no preferential activity relative to certain diacylglycerol species, but may be less discriminating relative to diacylglycerol species that contain acyl groups Fatty short chain, medium chain or very long chain. One skilled in the art will readily recognize that antibody preparations, nucleic acid tests (DNA or RNA) and the like can be prepared and used to protect and recover "homologous" or "related" phosphatidic acid phosphatase from a variety of sources. of plant. Typically, nucleic acid probes are labeled to allow detection, preferably with radioactivity although enzymes and other methods may be used. For immunological protection methods, the monoclonal or polyclonal antibody preparations can be used. Polyclonal antibodies, although less specific, are typically more useful in isolation of the gene. For detection, the antibody is labeled using radioactivity or any of a variety of antibody / enzyme conjugated secondary systems that are commercially available. Examples of some of the available antibody detection systems are described by Oberfilder (Focus (1989) BRL Life Technol., Inc., 17: 1-5). In order to obtain additional PAP sequences, a suitable genomic or other library prepared from the candidate plant source of interest can be tested with conserved sequences from one or more plant PAP (s) to identify the homologously related sequences. Positive clones can be analyzed by sequencing and / or digestion of the restriction enzyme. When a genomic library is used, one or more sequences can be identified by providing both the coding region as well as the transcriptional regulatory elements of the PAP gene of such a plant source. The probes can also be considerably shorter than the entire sequence. Oligonucleotides may be used, for example, but must be at least about 10, preferably at least about 15, more preferably at least 20 nucleotides in length. When regions of shorter length are used for comparison, a higher degree of sequence identity is required than for longer sequences. Frequently, shorter probes are particularly useful for polymerase chain reactions (PCR), especially when highly conserved sequences can be identified. (See, Gould, et al., PNAS USA (1989) 86: 1934-1938.) When longer nucleic acid fragments are used (>100 bp) as probes, especially when using long or complete cDNA sequences, one can still protect with moderately high severities (for example using 50% formamide at 37 ° C with minimal rinsing) in order to obtain signals from the target sample with 20-50% deviation, that is, homologous sequences. (For additional information regarding protection techniques see Beltz, er al., Meth Enzymology (1983) 00: 266-285). The homologous sequences are found when there is a sequence identity and can be determined by comparing the sequence, nucleic acid or amino acid information, or through hybridization reactions between a known PAP and a candidate source. Conservative changes, such as Glu / Asp, Val / He, Ser / Thr, Arg / Lys and Gln / Asn can also be considered in determining the homology of the sequence. Typically a long nucleic acid sequence can show as little as 50-60% sequence identity and more preferably at least about 70% sequence identity, between the target sequence and the given plant PAP of interest excluding any deletion that can be present, and still be considered related. The amino acid sequences are considered homologous for less than 25% sequence identity between the two complete mature proteins. (See, generally, Doolittle, RF OF URFS and ORFS (University Science Books, CA, 1986) In addition, not only can the sequences provided herein be used to identify homologous phosphatidic acid phosphatases, but the resulting sequences obtained from they can also provide an additional method for obtaining plant phosphatidic acid phosphatases from other plant sources In particular, PCR can be a useful technique for obtaining related plant PAPs from the sequence data provided therein. in the art it will be able to design oligonucleotide probes based on sequence comparisons or typically highly conserved sequence regions Once the nucleic acid sequence is obtained, it is desired that the transcription or transcription and translation (expression) of the plant PAP in a host cell produces a prepared source of the enzyme and / or modi ficar the composition of fatty acids and / or triglycerides found in them. Other useful applications can be found when the host cell is a plant host cell in vitro and in vivo. Accordingly, nucleic acids (genomic DNA, plasmid DNA, cDNA, synthetic DNA, mRNA, etc.) which encode the phosphatidic acid phosphatase or amino acid sequences of the purified enzymes, which allow the design of nucleic acid probes that facilitate the Isolation of DNA coding sequences are known in the art and are available for use in the methods of the present invention. Generally, it is recognized by one of skill in the field to which the present invention pertains that the nucleic acid sequences provided herein and the amino acid sequences derived therefrom, can be used to isolate other potential PAP genes from the Genetic Bank using genetic techniques. search for peptide and DNA generally known in the art. In addition to the sequences described in the present invention, the DNA coding sequences useful in the present invention can be derived from algae, fungi, bacteria, mammalian sources, plants, etc. Searches for homology in existing databases that use tag sequences corresponding to conserved amino acid and nucleotide sequences of PAP can be used to isolate related genes, equivalents from other sources such as plants and microorganisms. Searches in EST databases can also be used. In addition, the use of DNA sequences that encode the enzymes functionally in an enzymatic manner equivalent to those described herein, wherein such DNA sequences are degenerate equivalents of the nucleic acid sequences described herein in accordance with the degeneracy capacity of the genetic code, are also understood by the present invention. The demonstration of the functionality of the coding sequences identified by any of these methods can be carried out by the complementation of mutants of appropriate organisms, such as Synechocystis, Shewanella, yeast, Pseudomonas, Rhodobacteria, etc. that lack specific biochemical reactions or that have mutated. The sequences of the DNA coding regions can be optimized by gene resynthesis, based on the use of codon, for maximum expression in particular hosts. The nucleic acid sequences encoding phosphatases of plant phosphatidic acid can be used in various constructions, for example, as probes to obtain additional sequences. Alternatively, these sequences can be used in conjunction with appropriate regulatory sequences to increase the levels of the respective PAP of interest in a host cell to recover or study the enzyme in vitro or in vivo or to reduce the levels of the respective PAP of interest to some. applications when the host cell is a plant entity, including plant cells, plant parts (including but not limited to seeds, cuts or tissues) and plants. Therefore, depending on the proposed use, the constructs may contain the entire nucleic acid sequence encoding the PAP protein, or a portion thereof. For example, when the inhibition of antidetection of a given PAP protein is desired, the entire PAP sequence is not required. In addition, when the use of PAP constructs is proposed as probes, it may be advantageous to prepare constructs that contain only a particular portion of a PAP coding sequence, for example a sequence that is discovered to encode a highly conserved PAP region. As discussed above, the nucleic acid sequence encoding a plant or other PAP of this invention may include genomic sequences of cDNA or mRNA. By "coding" is meant that the sequence corresponds to a particular amino acid sequence, either in a detection or antidetection orientation. By "extrachromosomal" is meant that the sequence is outside the genome of the plant to which it is naturally associated. By "recombinant" is meant that the sequence contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes and the like. A cDNA sequence may or may not contain pre-processing sequences, such as transit peptide sequences or targeting sequences to facilitate delivery of the PAP protein (such as mitochondrial PAP) to a given organelle or membrane location. The use of any such PAP DNA precursor sequences is preferred for use in cell expression of the plant. A genomic PAP sequence can contain the transcription and translation initiation regions, introns and / or transcription termination regions of the plant PAP, whose sequences can be used in a variety of DNA constructs, with or without the structural gene of PAP. Therefore, the nucleic acid sequences corresponding to the plant PAP of this invention can also provide signal sequences useful in the direction of protein delivery at a membrane or organellar location in particular, upstream coding regulatory regions. 5 '(promoters) having useful tissue and profiling profiles, 3' downstream non-coding regulatory regions useful as transcriptional and translational regulatory regions and can lead to the interior of other gene configurations. Once the desired plant or other PAP nucleic acid sequence is obtained, this can be manipulated in a variety of ways. When the sequence involves distinct regions of non-coding, the distinctive regions may be subject to resection, mutagenesis, etc. Therefore, transitions, transversions, omissions and insertions can be carried out on the naturally occurring sequence. In addition, all or part of the sequence can be synthesized. In the structural gene, one or more codons can be modified to provide a modified amino acid sequence or one or more codon mutations can be introduced to provide a convenient restriction site or other purpose involved with the construct or expression. The structural gene can be further modified by the use of synthetic adapters, linkers to introduce one or more convenient restriction sites or the like. The amino acid or nucleic acid sequences encoding a plant or other PAP of this invention can be combined with other non-native or "heterologous" sequences in a variety of ways. By "heterologous" sequences is meant any sequence that is not naturally bound to native (or wild-type) PAP, including, for example, combinations of nucleic acid sequences from the same plant, which are not naturally linked each. The DNA sequence encoding a plant or other PAP of this invention can be used in conjunction with all or part of the gene sequences normally associated with PAP. In its component parts, a DNA sequence encoding the PAP is combined into a DNA construct having, in the 5 'to 3 * direction of transcription, a transcription initiation control region capable of promoting transcription and translation in a host cell, the DNA sequence encoding the plant PAP and a transcription and translation termination region.

Potential host cells include both prokaryotic and eukaryotic cells. A host cell can be unicellular or found in a differentiated or undifferentiated multicellular organism depending on the proposed use. The cells of this invention can be distinguished by having a PAP foreign to the wild-type cell present therein, for example, by having a recombinant nucleic acid construct encoding a PAP of plant therein, not native to host species . Depending on the host, the regulatory regions will vary, including regions of viral, plasmid or chromosomal genes, or the like. For their expression in prokaryotic or eukaryotic microorganisms, particularly unicellular hosts, a wide variety of constitutive or regulatable promoters can be employed. Expression in a microorganism can provide a prepared source of the plant enzyme. Among the regions of transcription initiation that have been described are the regions of bacterial hosts and yeast, such as E. coli, B. subtilis, Sacchromyces cerevisiae, including genes such as beta-galactosidase, T7 polymerase, tryptophan E and the like . In a preferred embodiment, the constructions will involve functional regulatory regions in plants that provide the modified production of PAP of the plant and, possibly, the modification of the fatty acid composition. The open reading frame encoding the PAP of the plant or the functional fragment thereof will be joined at its 5 'end to a transcription initiation regulatory region. In embodiments wherein the expression of the PAP protein is desired in a host plant, the use of all or part of the full-length PAP gene is desired; that is, all or part of the upstream coding regions 5 '(promoter) can be used together with the sequence of the structural gene and the 3' downstream non-coding regions. If a different promoter is desired, such as a native promoter in the host plant of interest or a modified promoter, i.e., having transcription initiation regions derived from a gene source and translation initiation regions derived from a source of In a different gene, several transcription initiation regions are available that provide a wide variety of constitutive or regulatable, for example inducible, transcripts of structural gene functions. The transcription / translation initiation regions corresponding to such structural genes are immediately upstream of the respective start codons. Among the transcription initiation regions used for plants are such regions associated with the T-DNA structural genes such as for the synthesis of nopaline and mannopine, the 19S and 35S promoters of CaMV and the 5 'upstream regions of other genes. of plants such as napina, ACP, SSU, PG zein, phaseolin E and the like. Enhanced promoters, such as double 35S, are also available for the expression of PAP sequences. For such applications where upstream 5 'non-coding regions of other genes regulated during seed maturation are obtained, those preferentially expressed in plant embryonic tissue, such as transcription initiation control regions derived from ACP, are desired. and napina. Such "seed-specific promoters" may be obtained and used in accordance with the teachings of U.S. Patents issued Nos. 5,608, 152 and 5,530,194, the references of which are incorporated herein by reference. Transcription initiation regions that are preferentially expressed in seed tissue, i.e., which are not detectable in other parts of the plant, are considered desirable for TAG modifications in order to minimize any adverse effect or switch of the gene product. The transcription termination regulatory regions can be provided in DNA constructs of this invention as well. The transcription termination regions can be provided by the DNA sequence encoding the plant PAP or a convenient region of transcription termination derived from a different gene source, for example, the transcription termination region that is naturally associated with the transcription initiation region. When the transcription termination region is from a different gene source, it will contain at least about 0.25 kb, preferably about 1-3 kb of 3 'sequence for the structural gene from which the termination region is derived. Expression or transcription constructs of the plant having a plant PAP as the DNA sequence of interest for increasing or decreasing expression thereof can be employed with a wide variety of plant life, particularly plant life involved in the production of vegetable oils for edible and industrial uses. The most especially preferred are temperate oelaginous seed cultures. Plants of interest include, but are not limited to, rapeseed oil (Highly Erucic and Cañóla Acid varieties), sunflower, safflower, cotton, soybean, peanut, coconut, and oil and corn palm. Depending on the method for introducing the recombinant constructs into the host cell, other DNA sequences may be required. Importantly, this invention is applicable to dicotyledonous and monocotyledonous species equally and will be readily applicable to new and / or improved transformation and regulation techniques. Likewise, expression of any PAP that is capable of dephosphorylating a phosphatidic acid containing a medium chain fatty acyl group at the sn-2 position for applications in crop species designed to contain medium chain fatty acids is also desired. . Additional applications of genetic design in plants for the PAP proteins of this invention include their use in the preparation of structured plant lipids containing TAG molecules having desirable fatty acyl groups, incorporated at particular positions on the TAG molecules.

For example, in the Brassica plants, the sn-2 position of TAG contains mainly unsaturated fatty acyl groups. In certain applications, it may be desirable to have saturated fatty acids in the sn-2 position and therefore, a PAP from a different plant source can be identified as having preferential activity on specific phosphatidic acid substrates, for example, 16: 0 or 18: 0 in position sn-2 and used for the transformation of Brassica. In addition, in Brassica plants that contain high levels of erucic acid (22: 1) in their seed oils (high erucic acid rapeseed oil or HEAR), little or no 22: 1 is in the sn-2 position of the TAG molecules. A "tri-erucic" HEAR plant having 22: 1 in the three sn positions of TAG is desirable. Such seed oil can be obtained by expressing a PAP which is preferably active on phosphatidic acid species containing 22: 1 at position sn-2 in HEAR plants. A gene encoding such PAP can be identified from hay (Limnanthes alba) whose seeds accumulate erucic acid-containing oil (22: 1) at the three positions sn. In order to increase the biosynthesis of TAG and thereby increase the fatty acids in a plant tissue, the co-expression of a plant or other PAP in a plant tissue with a second gene involved in the fatty acid biosynthesis can also find use in the present invention. For example, coexpression of a PAP sequence in the seed tissue of the plant with a DNA sequence encoding another protein involved in the biosynthesis of TAG, such as LPAAT (EU Patent Application 07/458, 109, all of which is incorporated herein by reference), can increase the flow through the Kennedy trajectory and increase the total fatty acids produced in the seed tissue. In addition, other genes involved in TAG biosynthesis, for example DAGAT, can be coexpressed with a PAP coding sequence of the present invention to increase oil levels in the plant tissue. In addition, co-expression of a PAP sequence of the present invention with a sequence encoding an enzyme involved in fatty acid biosynthesis can also find use in the production of increasing levels of plant oils. In particular, coexpression of a PAP sequence with a sequence encoding a medium chain thioesterase may allow the increasing production of medium chain fatty acids in a plant oil. Such medium chain thioesterases are known in the art. Examples of medium chain thioesterases are described in U.S. Patent Nos. 5,455, 167 and 5,667,997, all of which are incorporated herein by reference. Any means for producing a plant comprising a PAP gene or both a PAP gene and a second oil biosynthesis gene is encompassed by the present invention. For example, the second oil biosynthesis gene of interest can be used to transform a plant at the same time that the sequence encodes the PAP either by including both expression constructs in a single transformation vector or by using separate vectors. , each of which expresses desired genes. The second oil biosynthesis gene can be introduced into a plant that has already been transformed to express a PAP coding sequence or, alternatively, transformed plants can be crossed, one that expresses a PAP coding sequence and one that expresses a second gene of oil biosynthesis, to drive the genes together in the same plant. As mentioned above, phosphatidic acid phosphatase also catalyses the first stage committed in the biosynthesis of phosphatidylethanolamine (PE) and phosphatidylcholine (PC) of important membrane phospholipids through CDP ethanolamine (CDP-Etn) and the Kennedy trajectory. based on CDP hill (Kennedy et al (1956) J. Biol. Chem. 222: 193-214). further, in mammalian cells, PAP is thought to be involved with cell signal transduction to control the balance between diacylglycerol and phosphatidic acid, both of which are secondary messengers. Thus, constructs for directing the expression of the PAP sequences of the present invention in a plant host cell can find use in the alteration of cell signal transduction events involving DAG and PA as well as DAG products and PA.

In addition, the PAP sequences of the present invention can find use in expression constructs to generate transgenic plants with altered lipid or membrane phospholipid levels in the host plant. As phospholipids are involved in cell signaling, altered phospholipid levels can produce plants that have an altered cellular metabolism. In addition, for an increasing production of a chain-length fatty acid, for example medium-chain fatty acids, coexpression of a plant or other PAP in a plant tissue with a second sequence can be used in the present invention. DNA that encodes the enzymes involved in the production of medium chain or other chain length fatty acids. The DNA sequences encoding thioesterases (e.g., U.S. Patent No. 5,298,421, U.S. Patent No. 5,667,997, all of which is incorporated herein by reference) or fatty acid synthesis (Patent Application US Serial Number 08 / 827,828, the entirety of which is incorporated herein by reference) are examples of enzymes involved in the production of fatty acids of various chain lengths. The transformation method in obtaining such transgenic plants is not critical in the present invention and several plant transformation methods are currently available. In addition, as more recent methods are available to transform crops, they can also be applied directly to the above. For example, many plant species naturally susceptible to infection by Agrobacterium can be successfully transformed through tripartite or binary vector transformation methods mediated by Agrobacterium. In many cases, it will be desirable to have the construction bounded on one or both sides by T-DNA, particularly having the left and right boundaries, more particularly the right boundary. This is particularly useful when the construction uses A. tumefaciens or A. rhizogenes as a mode of transformation, although T-DNA limits may find use with other modes of transformation. In addition, microinjection techniques, bombardment of DNA particles and electroporation have been developed that allow the transformation of various species of monocot and dicot plants. Normally, the DNA construct will include a structural gene that has the regulatory regions necessary for its expression in a host and that provide for the selection of transforming cells. The gene can provide resistance to a cytotoxic agent, for example, antibiotic, heavy metal, toxin, etc., by providing prototrophy supplementation to an auxotrophic host, viral immunity or the like. Depending on the number of different host species, the construction of the expression or the components thereof that are introduced, one or more markers may be employed when different conditions are used for the selection of the different hosts.

When Agrobacterium is used for the cell transformation of the plant, a vector that can be introduced into the Agrobacterium host for its homologous recombination with T-DNA or the Ti or Ri plasmid present in the Agrobacterium host can be used. The Ti or Ri plasmid containing the T-DNA for recombination can be armed (capable of causing defect formation) or disarmed (unable to cause defect formation), the latter being permissible as long as the vir genes are present in the transformed Agrobacterium host. The armed plasmid can give a mixture of normal plant and defect cells. In some cases where Agrobacterium is used as the vehicle to transform host plant cells, the expression or transcription construct limited by the T-DNA border region (s) will be inserted into a wide range vector of host capable of duplicating in E. coli and Agrobacterium, being vectors of a wide host range described in the literature. PRK2 or derivatives thereof are commonly used. See, for example, Ditta, et al., (Proc. Nat. Acad. Sci., E.U.A. (1980) 77: 7347-7351) and EPA 0 120 515, which are incorporated herein by reference. Alternatively, one can insert the sequences to be expressed in the plant cells in a vector containing separate duplication sequences, one of which stabilizes the vector in E. coli and the other in Agrobacterium. See, for example, McBride and Summerfeit (Plant Mol. Biol. (1990) 74: 269-276), where pRiHRI (Jouanin et al., Mol. Gen. Genet. (1985) 201: 370-374) originates the duplication that is used and provides additional stability to the expression vectors of the plant in Agrobacterium host cells. The construction of the expression and the T-DNA include one or more markers that allow the selection of cells from plants transformed and transformed by Agrobacterium. Several markers have been developed for use with plant cells, such as resistance to chloramphenicol, kanamycin, aminoglycoside G418, hygromycin or the like. The particular marker employed is not essential for this invention, one or the other marker being preferred depending on the particular host and the manner of construction. For the transformation of plant cells by the use of Agrobacterium, the explants can be combined and incubated with the transformed Agrobacterium for a sufficient time for their transformation, the elimination of the bacteria and the cultivation of plant cells in an appropriate selective medium. Once the callus is formed, the shoot formation can be promoted by the use of appropriate plant hormones according to known methods and the shoots can be transferred to a rooting medium for the regeneration of the plants. The plants can then develop up to the seed and the seed used to establish repetitive generations and for the isolation of vegetable oils.

Having now generally described the invention, it will be more readily understood in relation to the following examples, which are included for purposes of illustration only and are not intended to limit the present invention.

EXAMPLES Example 1: Identification of PAP Sequences 1A Identification of a PAP sequence of Arabidopsis The gene encoding a mouse plasmalemma form of phosphatidic acid phosphatase has been previously cloned and sequenced (Kai, et al. (1996), J. Biol. Chem., 271: 18931-18938). The protein sequence was obtained from the gene bank and used to search for protein and DNA databases to identify related sequences. The rat, human, C. elegans and yeast sequences were identified in relation to the mouse PAP sequence. The PAP sequences from mouse, rat, human and yeast were aligned (Figure 1) by using the Macvector (Oxford Molecular, Inc.) and two conserved peptide sequences were identified; TDIAKXXIGRLRPHFLXXC (SEQ ID NO: 1) and LSRVSDYKHHWSDV (SEQ ID NO: 2). These two protein sequences were used to search the EST Arabidopsis database and a cDNA clone, 158J20XP, containing a 71% amino acid sequence motif similar to the motif LSRVSDYKHHWSDV was identified.

The 158J20XP cDNA clone (also referred to as ATPAP1) was obtained from the Arabidopsis Biological Resource Center (Columbus, OH). A full-length DNA sequence was determined by the use of an automated ABI sequencer and is shown in Figure 2 (SEQ ID NO: 3). DNA sequence analysis using the MacVector indicated an open reading frame of 870 bases containing the motif related to the PAP LSRVSDYKHHWSDV. The cDNA sequence of the PAP was amplified from ATPAP1 by the use of the Polymer Chain Reaction (PCR) and cloned into a vector for subsequent manipulations. The cDNA was amplified by using the following charges: 5'CCAGATCTGCATGCTCAACGTACGCTCTCTAGCTC 3 '(SEQ ID NO: 4) and 5J CCAGATCTCTCGAGACAATGCCCTGAAATTCATTTGGGT 3 * (SEQ ID NO: 5) by using the reaction conditions of 25 cycles of the following : 94 ° C for 15 seconds, 47 ° C for 30 seconds, 72 ° C for 2 minutes by using pfu polymerase (Stratagene, La Jolla, CA) following the manufacturers' instructions. The nucféotide sequences of the charges were designed according to the sequence obtained from ATAP1 of the Arabidopsis EST clone. The forward primer containing the coding sequence of the PAP gene from the 5 'end of the cDNA, including the ATG start codon (above underlined) and restriction cloning sites. The reverse primer contains a complementary sequence for the sequences in the 3 'untranslated region and the restriction cloning sites. Following the PCR using Advance and Reverse primers and the RNA prepared as described above, the resulting fragment was cloned into pZERO2 assimilated by assimilated EcoRV (Invitrogen, Carlsbad, CA) to create plasmid pCGN 8521. The nucleotide sequence of the PAP or cloned Arabidopsis cDNA was determined to ensure that no error was introduced in the PCR process. 1 B. Identification of the Sequences Related to the PAP of the Plant. The sequence of ATPAP1 was used to search the EST database and a Brassica EST was identified (figure 5, access to gene bank H74464, clone RRM1112 SEQ ID NO: 6). The identified Brassica EST was aligned with the ATPAP1 DNA sequence by using the MacVector. The alignment of these two sequences showed that over the 257 nucleotides aligned between the Brassica and Arabidopsis sequences, 172 nucleotides were identical (67% identity). The PAP sequence of Arabidopsis was also used to search for a patented database containing EST sequences of corn, soybean and Arabidopsis. Two additional PAP sequences of Arabidopsis, ATPAP2 were identified (Figure 3; SEQ ID NO: 7) and ATPAP3 (Figure 4; SEQ ID NO: 8). Several ESTs of maize and two ESTs of soybean were identified and the largest clone was obtained for later cloning and analysis. The DNA sequence of the soybean and corn seed ESTs of PAP from Arabidopsis was determined and full-length sequences were obtained by using RACE-PCR and the sequence obtained for the maize PAP fr sequence is shown in figure 6 (SEQ ID: 9) and the two PAP sequences of soybean are shown in Figures 7 and 8 (SEQ ID NO: 10 and SEQ ID NO: 11). In addition, EST sequences similar to the ATPAP1 sequence were identified from maize EST databases. The search results are provided in Figure 10. In addition, a sequence was identified with the ATPAP3 sequence of a Brassica seed EST library (Figure 11).

Example 2: Yeast Expression of an Arabidopsis PAP The constructs were prepared to express the PAP protein in the yeast. The pCGN8521 vector was assimilated with Bgl ll and Sphl and the PAP coding fragment was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA), assimilated with BamHI and Sphl to produce the plasmid pCGN8523. The plasmids pCGN8523 and pYES2 were transformed into the yeast strain InvSCI (Invitrogen) by the use of a standard lithium acetate method (Ausubel et al., Current Protocols in Molecular Biology pp13.0.1-13.13.9 (1997)). The manipulations and the standard yeast medium are described in Ausubel et al. (Ausubel et al. Current Protocols in Molecular Biology pp 13.0.1-13.13.9 (1997)) and are summarized here. 50 milliliters of culture of the recombinant yeast was developed to a static phase in a medium of SC (lacking uracil) with glucose. Twenty units of OD 600 cells were centrifuged and rinsed with a sugar-free SC (lacking uracil) medium. The cells were subsequently resuspended in 100 ml of SC medium (lacking uracil) with galactose. This galactose induces the expression of cloned genes under the control of the gal promoter in pYES2. The yeast was developed for 2 days. They were shaped into pellets of 50 milliliters of yeast cells by centrifugation and the lipids were extracted in 5 ml of chloroform: methanol: 0.025MHCI (5: 10: 4). The phase separation was carried out by adding 1.2 ml of Chloroform and 1.2 ml of water. The lower chloroform phase was removed and dried under a stream of nitrogen gas. The lipid samples were resuspended in 50 ul of Hexane and loaded onto a silica TLC plate. The TLC plate was developed in Hexane: Diethyl ether: Acetic acid (50: 50: 2) and the lipids were visualized by dyeing with iodide. Two of the three lipid samples of the yeast transformed with pCGN8523 showed visible diacylglycerol stains, while none of the 4 samples extracted from the untransformed yeast or the yeast transformed with pYES2 showed diacylglycerol stains. These data confirm that the clonal Arabidopsis cDNA encodes PAP.

Example 3: Arabidopsis PAP Baculovirus Expression Constructs are prepared to direct the expression of the ATPAP1 sequences. ATPAP2 and ATPAP3 in cultured insect cells. The entire coding region of ATPAP2 is amplified from EST clone LIB24-018-Q1 -E1-A8 by the use of oligonucleotide primers 5'-GGATCCGCGGCCGCAGAAATGCAGGAGATAGATCTTAG-3 'and 5 * -CCTGCAGGAAGCTTTCATCTGGGAGCGGTGGAAG-3' in a reaction in polymerase chain (PCR). The PCR product was subcloned into pCR2.1Topo (Invitrogen). A double-stranded DNA sequence was obtained to verify that no error was introduced by the amplification of the PCR. The resulting plasmid was designated PCGN8645. The entire coding region of ATPAP3 was amplified from the EST clone LIB25-028-Q1-E1 -E1 1 by the use of oligonucleotide primers 5'-GAGCTCCTGCAGGAAGCTTTCAGCCTCTACCAGTTTCTACATCC-3 'and 5'-GGATCCGCGGCCGCACAGGATGAGAGAGGACAGCTAGG-3' in a reaction in polymerase chain (PCR). The PCR product was subcloned into pCR2.1Topo (Invitrogen). A double-stranded DNA sequence was obtained to verify that no error was introduced by the amplification of the PCR. The resulting plasmid was designated pCGN8646. The construction of pCGN8521 was assimilated with BamHI and EcoRi and a fragment containing the coding region of ATPAP1 was purified by gel electrophoresis. The fragment containing the entire coding region of ATPAP1 was subcloned into the baculovirus expression vector pFastBad (Gibco-BRL, Gaithersburg, MD) which has been assimilated with BamHI and EcoRI. The resulting plasmid was designated pCGN8662. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. The construction of pCGN8645 was assimilated with Notl and Sse8387l and a fragment containing the coding region of ATPAP2 was purified by gel electrophoresis. The fragment containing the entire coding region of ATPAP2 was subcloned into the baculovirus expression vector pFastBad (Gibco-BRL, Gaithersburg, MD) that has been assimilated with Notl and Pstl. The resulting plasmid was designated pCGN8663. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. The construction of pCGN8646 was assimilated with Notl and Sse8387l and a fragment containing the coding region of ATPAP3 was purified by gel electrophoresis. The fragment containing the entire coding region of ATPAP3 was subcloned into the baculovirus expression vector pFastBad (Gibco-BRL, Gaithersburg, MD) which has been assimilated with Notl and PstI. The resulting plasmid was designated pCGN8664. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. The baculovirus expression constructs pCGN8662, pCGN8663 and pCGN8664 were transformed and expressed by using the BAC-a-BAC Baculovirus Expression System (Gibco-BRL, Gaithersburg, MD) according to manufacturers' instructions, except for that the harvest of the recombinant viruses was done 5 days after the transfection. The supernatant of the transfection mixture was used to generate a virus deposit which in turn was used to infect Sf9 cells for use in the assay. The transformed insect cells can be assayed for phosphatidic acid phosphatase activity by using the methods described herein.

Example 4: Expression of Arabidopsis PAP Plant The vectors for PAP expression in plants were constructed in both detection and antidetection orientations. The constructs were prepared for the constitutive and specific expression of PAP seed. A plasmid containing the napkin cassette derived from pCGN3223 (described in U.S. Patent No. 5,639,790, all of which is incorporated herein by reference) was modified to make it more useful in order to clone large DNA fragments containing multiple restriction sites, and to allow the cloning of multiple napina fusion genes into plant binary transformation vectors. A compressed adapter of the sequence self-hardening oligonucleotide CGCGATTTAAATGGCGCGCCCTGCAGGCGGCCGCCTGCAGGGCGCG CCATTTAAAT was ligated to the cloning vector pBC SK + (Stratagene) after assimilation with the restriction endonuclease BssHIl to construct the vector pCGN7765. Plasmids pCGN3223 and pCGN7765 were assimilated with Notl and ligated together. The resulting vector, pCGN7770, contains the main structure pCGN7765 with the napkin seed-specific expression cassette of PCGN3223. The cloning cassette, pCGN7787, essentially the same regulatory elements as pCGN7770, with the exception of the napin regulatory regions of pCGN7770, have been replaced with the double CAMV 35S promoter and the transcription termination region and tml polyadenylation. A binary vector for plant transformation, pCGN5139, was constructed from pCGN1558 (McBride and Summerfeit, (1990) Plant Molecular Biology, 14: 269-276). The polylinker of pCGN1558 was replaced as a Hindlll / Asp718 fragment with a polylinker containing unique restriction endonuclease sites, Ascl, PacI, Xbal, Swal, BamHI and NotI. The restriction endonuclease sites Hindlll and Asp718 are maintained in pCGN5139. A series of turbo binary vectors are constructed to allow rapid cloning of DNA sequences into binary vectors containing transcription initiation regions (promoters) and transcription termination regions. The plasmid pCGN8618 was constructed by ligating the oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3 'and 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3' in the assimilated pCGN7770 by Sall / Xhol. A fragment containing the napin promoter, the polylinker and the 3 'napin region of pCGN8618 was excised by assimilation with Asp718l; the end was removed from the fragment by filling in the 5 'overhangs with the Klenow fragment then it was ligated to pCGN5139 which had been assimilated with Asp718l and Hindlll and the end was removed by filling the 5' overhangs with the Klenow fragment. A plasmid containing the oriented insert so that the napin promoter was closer to the Asp 7181 site removed from pCGN5139 and the 3 'napin was closer to the removed Hindlll site was subjected to sequence analysis in order to confirm both the orientation of insertion as the integrity of cloning unions. The resulting plasmid was designated pCGN8622. The plasmid pCGN8619 was constructed by ligating the oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCC-3 'and 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGG-3' in the assimilated pCGN7770 by Sall / Xhol. A fragment containing the napin promoter, the polylinker and the 3 'napin region of pCGN8619 was removed by assimilation with Asp718l; the end was removed from the fragment by filling the 5 'overhangs with the Klenow fragment, then it was ligated to pCGN5139 which had been assimilated with Asp718l and Hindlll and the end was removed by filling in the 5' overhangs with the Klenow fragment. A plasmid containing the oriented insert so that the napin promoter was closer to the Asp 7181 site removed from pCGN5139 and the 3 'napin was closer to the removed Hindlll site was subjected to sequence analysis in order to confirm both the orientation of insertion as the integrity of cloning unions. The resulting plasmid was designated pCGN8623. Plasmid pCGN8620 was constructed by ligating the oligonucleotides 5'-TCGAGGATCCGCGGCCGCAAGCTTCCTGCAGGAGCT-3 'and 5'-CCTGCAGGAAGCTTGCGGCCGCGGATCC-3' in the assimilated pCGN7787 by Sall / Sacl. A fragment containing the d35S promoter, the polylinker and the 3 'tml region of pCGN8620 was removed by total assimilation with Asp718l; and partial assimilation with Notl. The end was removed from the fragment by filling the 5 'overhangs with the Klenow fragment, then it was ligated to pCGN5139 which had been assimilated with Asp718l and Hindlll and the end was removed by filling in the 5' overhangs with the Klenow fragment. A plasmid containing the targeted insertion so that the d35S promoter was closer to the Asp 7181 site removed from pCGN5139 and the 3 'tml was closer to the removed Hindlll site was subjected to sequence analysis in order to confirm both orientation of insertion as the integrity of cloning unions. The resulting plasmid was designated pCGN8624. Plasmid pCGN8621 was constructed by ligating the oligonucleotides 5'-TCGACCTGCAGGAAGCTTGCGGCCGCGGATCCAGCT-3 'and 5'-GGATCCGCGGCCGCAAGCTTCCTGCAGG-3' in the assimilated pCGN7787 by Sall / Sacl. A fragment containing the d35S promoter, the polylinker and the 3 'tml region of pCGN8621 was removed by total assimilation with Asp718l; and partial assimilation with Notl. The end was removed from the fragment by filling the 5 'overhangs with the Klenow fragment, then it was ligated to pCGN5139 which had been assimilated with Asp718l and Hindlll and the end was removed by filling in the 5' overhangs with the Klenow fragment. A plasmid containing the targeted insertion so that the d35S promoter was closer to the Asp 7181 site removed from pCGN5139 and the 3 'tml was closer to the removed Hindlll site was subjected to sequence analysis in order to confirm both orientation of insertion as the integrity of cloning unions. The resulting plasmid was designated pCGN8625. The construction of plasmid pCGN8640 is a modification of pCGN8624 described above. A fragment of 938bp Pstl isolated from transposition Tn7 which encodes bacterial spectinomycin and resistance to streptomycin (Fling et al (1985), Nucleic Acids Research 13 (19): 7095-7106), a determinant for the selection of E Coli and Agrobacterium, the end was removed with Pfu polymerase. The removed end fragment was ligated to pCGN8624 which had been assimilated with Spel and to which the end was removed with Pfu polymerase. The region containing the PstI fragment was sequenced to confirm both the insertion orientation and the integrity of the cloning junctions. The spectinomycin resistance marker was introduced into pCGN8622 and pCGN8623 as follows. A 7.7 Kbp fragment of AvrlI-SnaBI from pCGN8640 was ligated to the 10.9 Kbp AvrlI-SnaBI fragment from pCGN8623 or pCGN8622, described above. The resulting plasmids were pCGN8641 and pCGN8643, respectively. Plasmid pCGN8644 was constructed by ligating the oligonucleotides 5'-GATCACCTGCAGGAAGCTTGCGGCCGCGGATCCAATGCA-3 'and 5'-TTGGATCCGCGGCCGCAAGCTTCCTGCAGGT-3' in the assimilated pCGN8640 by BamHI-Pstl. Plasmid pCGN8521 was assimilated with BglII and the fragment coding for PAP was cloned into the napin cassette of? CGN7770 after assimilation with BglII. The resulting plasmids are pCGN8607 which contains the PAP gene in the detection orientation and pCGN8608 which contains the PAP gene in the anti-sense orientation. The two plasmids were assimilated with Asp718 and the napin / PAP gene fusions were cloned into the assimilated binary vector by Asp718 pCGN5139. The plasmid pCGN8611 contains the naptin gene / detection of pCGN8607, and the plasmid pCGN8612 contains the napine PAP / antidetection gene of the PCGN8608. Plasmid pCGN8521 was assimilated with BglII and the fragment coding for PAP was cloned into the CAMV35S cassette of pCGN7787 after assimilation with BamHI. The resulting plasmids were pCGN8609 which contains the PAP gene in the detection orientation and pCGN8610 which contains the PAP gene in the anti-sense orientation. The two plasmids were assimilated with Asp718 and the CAMV35S / PAP gene fusions were cloned into the assimilated binary vector by Asp718 pCGN5139. The plasmid pCGN8613 contains the PAP gene CAMV35S / detection of pCGN8609, and the plasmid pCGN8614 contains the PAP gene CAMV35S / antidetection of pCGN8610. A fragment containing the coding region ATPAP2 was removed from pCGN8645 by assimilation with Notl and Sse8387l. The fragment was ligated to pCGN8643 assimilated by PstI-Notl. The resulting plasmid was designated pCGN8647. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP2 was removed from pCGN8645 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8641 assimilated by PstI-NotI. The resulting plasmid was designated pCGN8648. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP2 was removed from pCGN8645 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8640 assimilated by PstI-NotI. The resulting plasmid was designated pCGN8649. Analysis of the DNA sequence confirmed the integrity of the cloning linkages.

A fragment containing the coding region ATPAP2 was removed from pCGN8645 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8644 assimilated by PstI-Notl. The resulting plasmid was designated pCGN8650. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP3 was removed from pCGN8646 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8643 assimilated by PstI-Notl. The resulting plasmid was designated pCGN8651. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP3 was removed from pCGN8646 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8641 assimilated by PstI-NotI. The resulting plasmid was designated pCGN8652. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP3 was removed from pCGN8646 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8640 assimilated by PstI-Notl. The resulting plasmid was designated pCGN8653. Analysis of the DNA sequence confirmed the integrity of the cloning linkages. A fragment containing the coding region ATPAP3 was removed from pCGN8646 by assimilation with Notl and Sse8387l.

The fragment was ligated to pCGN8644 assimilated by PstI-Notl. The resulting plasmid was designated pCGN8654. Analysis of the DNA sequence confirmed the integrity of the cloning linkages.

Example 5: Plant transformation. A variety of methods have been developed to insert a DNA sequence of interest into the genome of a plant host to obtain transcription or transcription and translation of the sequence of phenotypic changes of effect. Transgenic Brassica plants are obtained by Agrobacterium-mediated transformation as described by Radke et al. (Theor. Appl. Genet. (1998) 75: 685-694; Plant Cell Reports (1992) 11: 499-505). Transgenic Arabidopsis thaliana plants can be obtained by Agrobacterium-mediated transformation as described by Valverkens et al. , (Proc. Nat. Acad. Sci. (1988) 85: 5536-5540), or as described by Bent et al. ((1994), Science 265: 1856-1860), or Betchold et al. ( (1993), CR Acad. Sci, Life Sciences 316: 1 194-1199) or Clough, et al. (1998) Plant J., 16: 735-43. Other plant species can be transformed in a similar way using related techniques. Alternatively, microprojectile bombardment methods, such as those described by Klein et al., (Bio / Technology 10: 286-291) can also be used to obtain nuclear transformed plants.

Example 6: Analysis of Transgenic Plant Transgenic plants expressing phosphatidic acid phosphatase are analyzed using techniques known in the art.

Enzyme assays are used to determine the activity of PAP in the leaves of control plants, plants transformed with pCGN8613, and plants transformed with pCGN8614. The leaf lipids are analyzed by thin layer chromatography to determine the glycerolipid composition of the leaf lipids. The seed lipids of the control plants, plants transformed with pCGN8611, and plants transformed with pCGN8612 are analyzed for alterations in the levels of diacylglycerol, triacylglycerol or phospholipids. Fatty acid compositions of different kinds of lipid extracted from mature seeds can be examined by the following method. Analyzes of the acyl compositions of the sn-2 and sn-1 +3 positions of TAG were conducted using the pancreatic lipase protocol (Brockerhoff (1975), supra). Ideally with this protocol, lipase divides fatty acids from positions sn-1 and sn-3, and not from position sn-2. Accordingly, it is presumed that the fatty acids in the resulting mono-glyceride are those in the sn-2 position. However, it is observed that those previously trying to study the TAG that has shorter chain fatty acids by this method (Entressangles et al. (1964) Biochim Biophys. Acta 84: 140-148), reported that the chain fatty acids The shorter ones located at the sn-2 position were rapidly hydrolyzed during such digestion, which the authors reported to be the result of a spontaneous migration of short inner chain fatty acids into outward positions in diglycerides and monoglycerides. Oil distilled from mature seeds may be subject to a modified pancreatic lipase assimilation protocol of Brockerhoff et al., Supra, to minimize acyl migration. This distinguishes acyl compositions from the combined positions sn-2 and sn-1 +3. The modifications are as follows: the pH is decreased to neutrality, the reaction time is reduced from 15 to 3 minutes, the samples are kept at acidic pH, after that and the assimilation products are chromatographed on TLC plants impregnated with borate. The chromatographed products are then eluted and analyzed as methyl esters of fatty acid as before. The enzymatic activity of PAP is analyzed using a modified method described by Lin and Carman ((1989), J. Biol. Chem., 264, 8641-8645). The modifications involve the use of 1 C [U] -glycerol dipalmitoyl-PA and the monitoring of the production of 14C-dipalmitoyl DAG. In a test volume of 100 ul containing a 20 ul sample, the following test components were added: 500 uM of 1 C-PA (71.64 Ci / mol), 2 mM of MgCl, 10 mM of beta-mercaptoethanol, 50 mM NaCl and 0.3% Triton X-100 in 50 mM HEPES pH 7.5. The tests are allowed to last 30 minutes at 30 ° C and then stop at 1.5 my heptane: isopropanol: 0.5M sulfuric acid (20: 80: 2). The products are extracted by adding 0.1 ml of 1 M sodium bicarbonate and 1 ml of heptane. The organic phase was transferred to a new flask and washed with 1 ml of 1 M NaCl. A portion of the organic phase was counted by a liquid scintillation counter and the remaining sample was evaporated under nitrogen gas, resuspended in heptane, and stained on a thin gel chromatographic silica gel plate. The TLC plate was migrated in hexane: diethyl ether: acetic acid (70: 30: 2) then scanned with a radio-image analyzer. The radioactivity incorporated in the DAG was quantified. All publications and patent applications mentioned in this specification are indicative of the level of experience of those skilled in the art to which this invention pertains. All publications and patent applications are incorporated herein by reference to the same extent as if each individual publication or patent application was specifically or individually indicated to be incorporated for reference. Although the above invention has been described in some detail by way of illustration and examples for purposes of clarity of understanding, it will be obvious that some changes and modifications may be practiced within the scope of the appended claims. 1-u.a.kMi

Claims (21)

1. An isolated DNA sequence, characterized in that it encodes a phosphatase protein of plant phosphatidic acid.

2. The DNA coding sequence according to claim 1, characterized in that said phosphatidic acid phosphatase protein is derived from Arabidopsis thaliana.

3. The DNA coding sequence according to claim 2, characterized in that said phosphatidic acid phosphatase protein is encoded by the sequence of Figure 2.

4. The DNA coding sequence according to claim 2, characterized in that said phosphatase protein of Phosphatidic acid is encoded by the sequence of Figure 3. The DNA coding sequence according to claim 2, characterized in that said phosphatidic acid phosphatase protein is encoded by the sequence of Figure 4. 6. The DNA coding sequence according to claim 1, characterized in that said phosphatidic acid phosphatase protein is derived from Brasica sp. 7. The DNA coding sequence according to claim 6, characterized in that said phosphatidic acid phosphatase protein is encoded by a sequence including the EST of Figure

5. The DNA coding sequence according to claim 1, characterized in that said protein Phosphatidic acid phosphatase is derived from corn. 9. The DNA coding sequence according to claim 8, characterized in that said phosphatidic acid phosphatase protein is encoded by a sequence of Figure

6. 10. The DNA coding sequence according to claim 1, characterized in that said phosphatase protein of Phosphatidic acid is derived from soybean seed. 11. The DNA coding sequence according to claim 10, characterized in that said phosphatidic acid phosphatase protein is encoded by the sequence of Figure 7 12. The DNA coding sequence according to claim 10, characterized in that said acid phosphatase protein phosphatidic is encoded by the sequence of Figure 8. 13. A recombinant DNA construct, characterized in that it comprises any of the DNA coding sequences of Claims 1-12. A DNA construct comprising, operably linked in the 5 'to 3' transcription direction, a functional transcription initiation region in plant cells, a DNA structural gene sequence encoding a phosphatidic acid phosphatase plant, and a transcription termination sequence capable of terminating transcription in a plant cell. 15. A plant cell characterized in that it comprises a DNA construct of 14. 16. A plant characterized in that it comprises a cell according to claim 15. 1

7. A method for modifying the lipid composition in a plant cell, said method comprising: transformation of a plant cell with DNA comprising as operably linked in the 5 'to 3' transcription direction, a functional transcription initiation region in plant cells, a DNA structural gene sequence encoding a phosphatase of plant phosphatidic acid, and a transcription termination sequence, capable of terminating transcription in a plant cell, and the growth of said plant cell under conditions wherein the transcription of said plant phosphatidic acid phosphatase is initiated, by means of which said lipid composition is modified. 1

8. A method according to claim 17, characterized in that said coding sequence comprises at least a portion of a plant phosphatidic acid phosphatase in an antidetection orientation, by means of which the transcribed mRNA of said coding sequence is complementary to the equivalent mRNA. transcribed from the endogenous gene, whereby the activity of said phosphatidic acid phosphatase protein in said plant cell is suppressed. 1

9. A method according to claim 18, characterized in that the triglyceride synthesis is suppressed in said plant cell. 20. A method according to claim 17, characterized in that said coding sequence for phosphatidic acid phosphatase protein is in a detection orientation. 21. A method according to claim 20, characterized in that said lipid composition is increased.