WO2001034770A2 - Expression genetique modulee par l'activation de microglies ou de macrophages - Google Patents

Expression genetique modulee par l'activation de microglies ou de macrophages Download PDF

Info

Publication number
WO2001034770A2
WO2001034770A2 PCT/US2000/030585 US0030585W WO0134770A2 WO 2001034770 A2 WO2001034770 A2 WO 2001034770A2 US 0030585 W US0030585 W US 0030585W WO 0134770 A2 WO0134770 A2 WO 0134770A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
polynucleotide
microglia
marker
Prior art date
Application number
PCT/US2000/030585
Other languages
English (en)
Other versions
WO2001034770A3 (fr
Inventor
Monica J. Carson
J. Gregor Sutcliffe
Melissa T. Almazan
Gabriela M. Tobal
Original Assignee
Digital Gene Technologies, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/026824 external-priority patent/WO2000028013A2/fr
Application filed by Digital Gene Technologies, Inc. filed Critical Digital Gene Technologies, Inc.
Priority to AU15867/01A priority Critical patent/AU1586701A/en
Publication of WO2001034770A2 publication Critical patent/WO2001034770A2/fr
Publication of WO2001034770A3 publication Critical patent/WO2001034770A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/521—Chemokines

Definitions

  • Microglia have been implicated as key players in the inflammatory responses associated with numerous degenerative brain pathologies. For example, it has been shown that microglia activation is involved in such degenerative brain conditions as trauma, abscess, focal ischemia, experimental allergic encephalitis (EAE), Wallerian degeneration, Down's syndrome and Alzheimer's disease (Griffen et al., In: Biology and Pathology of Astrocyte-Neuron Interactions, pp. 359-381 (Fedoroff et al., eds., (1993)).
  • microglial cells Present information related to the characterization of microglial cells in their quiescent and various activated forms is incomplete.
  • One hypothesis is that while the various microglial subtypes may arise from the differentiation of cells from a common precursor pool that is possibly indistinguishable from that giving rise to macrophage and dendritic cells, the roles played by differentiated microglia in normal neural physiology and neuropathology are determined in part by the ensembles of proteins that are expressed after their differentiation. Also, there may be overlapping ensembles expressed during different types of inflammation.
  • HIV infection of microglia is thought to lead to their activation and result in the production of factors that initiate a cascade of neuropathological events, leading to a progressive dementia correlated with astrogliosis and neuronal loss (Wiley et al., Ann. Neurol., 29:651-657 (1991); Everall et al., J. Neuropathol. Exp. Neurol. 52:561-566; Lipton, Mol. Neurobiol. 8:181 (1994); Merrill et al., FASEB J., 5:2391-2397 (1991)).
  • the neurophysiology associated with HIV infection shares similarities with the neurodegenerative features observed in humans and experimental animal models of other neuropathological conditions, such as brain trauma, experimental allergic encephalitis (EAE), Wallerian degeneration after nerve transection, brain abscess, focal ischemia, Down's syndrome and Alzheimer's disease.
  • EAE experimental allergic encephalitis
  • Wallerian degeneration after nerve transection brain abscess
  • focal ischemia focal ischemia
  • Alzheimer's disease Alzheimer's disease.
  • IL-1 interleukin-1
  • transgenic expression of the HIV envelope glycoprotein gpl20 or transgenic expression of LL-6 by astrocytes has been shown to mimic HIV-induced neuropathologies (Toggas et al., Nature, 367:188-193 (1994); Campbell et al., Proc. Natl. Acad. Sci., 90:10061-10065 (1993)).
  • nitric oxide produced by nitric oxide synthase (iNOS), an enzyme induced in activated microglia
  • iNOS nitric oxide synthase
  • nitric oxide mediates the neurotoxicity associated with human immunodeficiency virus type-1 coat protein (Dawson et al., Proc. Natl. Acad. Sci., 90:3256-3259 (1993); Wallas et al., Neuroreport, 5:245-248 (1993)).
  • microglia are bone marrow-derived cells of monocyte lineage that, like peripheral macrophages, demonstrate remarkable phenotypic plasticity dependent upon their environment. Dawson et al., (1993); Wallas et al., (1993); Lipton et al, (1993)). While the exact relationship of microglia to macrophages has not been definitively determined, it is known that in addition to NO and IL-1, microglia produce an array of cytokines. In addition, several studies indicate that microglia may also serve as antigen- presenting cells during an inflammatory response (Frei et al., Eur. J. Immunol. 17:1271- 1278 (1987); Carson et al., Glia 22:72-85 (1998)).
  • CNS macrophages At least five forms of CNS macrophages have been described based on their morphologies and reactivity with reagents that recognize various macrophage cell surface antigens. These forms include amoeboid, ramified, activated, reactive, and perivascular microglia (Flaris et al., Glia 7:34-40 (1993)). Cumulatively, these forms account for 10- 20% of the cells of the CNS, a percentage far greater than the concentration of macrophages found in peripheral tissues, which is fewer than 1% of the cells (Lawson et al., Neurosci., 39:151-170 (1990)).
  • Parenchymal microglia display many of the same expression markers as macrophage and dendritic cells (Carson et al., (1998)). Consequently, in past, they have been presumed to share many of the same functions as these cells. However, recent studies have demonstrated that while microglia do share some functional similarities with these cells, they have a distinctly different repertoire of responses (Carson et al., (1998); Sedgewick et al., (1998)). Two features specific to microglia may represent CNS specializations. First, microglia possess ATP-stimulated inward rectifying potassium channels, whereas peritoneal macrophages have an outward rectifying potassium channel (Kettenmann et al., Glia, 7:93-101 (1993)).
  • microglia are especially sensitive to depolarizing events and the release of ATP from injured cells.
  • peripheral macrophages microglia are weak antigen- presenting cells (Perry et al, J. Leuk. Biol., 56:399-406 (1994); Carson et al., (1998); Sedgewick et al., (1998); Flaris et al., Glia, 7:34-40 (1993)).
  • microglia in healthy CNS tissue express costimulatory molecules necessary to activate T lymphocytes during antigen presentation, but do not express the MHC class ⁇ necessary to present the antigen.
  • microglia In response to pathology, microglia do express MHC class II, but are very slow to acquire the ability to present antigen. Indeed, some studies have suggested that they may induce T cell apoptosis rather than T cell proliferation (Sedgewick et al., (1998)). Other studies show that microglia acquisition of antigen- presenting function is coupled with their production of soluble factors (prostaglandins) which suppress T lymphocyte proliferation and activation. These soluble factors may also act to suppress the ability of infiltrating macrophage to activate T cells in the CNS. It is thought that these features of microglia may represent CNS specializations that prevent autoimmune attack of nonregenerating neurons under normal conditions, and a controlled response under pathological conditions.
  • microglia and macrophages are highly related cell types that adopt a particular phenotype depending upon environmental conditions.
  • the MAbs detected phenotypic markers that were induced on microglia in different patterns under different inflammatory conditions, suggesting that different microglia forms may contribute selectively to the pathophysiologies associated with different inflammatory responses.
  • both microglia and macrophages show phenotypic heterogeneity even within a single pathology, illustrating their sensitivity to environmental activators (Perry et al., (1994); Flaris et al., (1993); Williamson et al., J. Neuroimmunol., 32:199-207 (1991)).
  • macrophage effector function is dependent upon the type of activation, and may include an array of partially characterized responses, including the production of cytokines, proteases, and reactive oxygen and/or nitrogen intermediates.
  • LPS stimulation of macrophages results in the production of TNF ⁇ , IL-1 and IL- 6, but not nitric oxide.
  • studies aimed at identifying the cascade of activation events have concentrated on only a few readily followed molecules (iNOS, IFN) and have yielded conflicting data, in part due to the phenotypic plasticity of macrophages (Levin et al, J. Immunol., 151:6742-6750 (1993)).
  • the identification and characterization of molecules that are selectively expressed in subsets of microglia would greatly illuminate the physiology of this system.
  • the identification of proteins induced by activation may contribute to the understanding of the neuropathology responsible for dementia and other neurological diseases.
  • the proteins induced in active microglia may lead to the identification of neural-specific proteins, which would distinguish microglia functionally from other macrophages.
  • Unfortunately at present, only a few already-identified species have been candidates for study. As a result of such limited studies, present understanding of the neuropathology associated with neurodegenerative conditions is incomplete.
  • microglia i.e. the resident myeloid cell of the CNS
  • macrophages that infiltrate the CNS during inflammation.
  • Such a systematic characterization of microglial - specific versus macrophage-specific proteins would allow: 1) the nature of the relationship between microglia and other monocyte-derived cell types to be precisely determined, and 2) the separation of the relative contributions of microglia and macrophage toward neuroprotection versus neurodegeneration.
  • determining patterns of gene expression that distinguish microglia from macrophages would identify molecules that would be useful to distinguish these two cell types in histological sections of CNS pathology.
  • the PCR-based Total Gene Expression Analysis (TOGA) differential display system has been used in studies to examine the differential gene expression in microglia and macrophage cells in both the unstimulated and stimulated (activated) states. Specifically, the TOGA system has been used to analyze and compare the expression patterns of molecules corresponding to genes that are regulated in four cellular conditions: (1) unstimulated microglia; (2) activated microglia; (3) unstimulated macrophage; and (4) activated macrophage.
  • Such molecules are useful in therapeutic and diagnostic applications in the treatment of neuroinflammatory pathologies. Additionally, the provided polynucleotides and polypeptides are useful for detecting and treating processes mediated by the activation of microglia. The provided polynucleotides and polypeptides also are useful for detecting and treating processes mediated by the activation of macrophages. The provided polynucleotides and polypeptides also are useful for detecting and treating neurodegenerative processes. The provided polynucleotides and polypeptides also are useful for detecting and treating infections of the nervous system. The present invention provides novel polynucleotides and the encoded polypeptides.
  • the present invention relates to vectors, host cells, antibodies, and recombinant methods for producing the polynucleotides and the polypeptides.
  • One embodiment of the invention provides an isolated nucleic acid molecule comprising a polynucleotide chosen from the group consisting of SEQ ID NO: 1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l l, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO
  • an isolated nucleic acid molecule comprising a polynucleotide at least 95% identical to any one of these isolated nucleic acid molecules and an isolated nucleic acid molecule at least ten bases in length that is hybridizable to any one of these isolated nucleic acid molecules under stringent conditions. Any one of these isolated nucleic acid molecules can comprise sequential nucleotide deletions from either the 5 '-terminus or the 3 '-terminus. Further provided is a recombinant vector comprising any one of these isolated nucleic acid molecules and a recombinant host cell comprising any one of these isolated nucleic acid molecules. Also provided is the gene corresponding to the cDNA sequence of any one of these isolated nucleic acids.
  • Another embodiment of the invention provides an isolated polypeptide encoded by a polynucleotide chosen from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO: 10, SEQ ID NO:l l, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ XT) NO: 17, SEQ ID NO:18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ XD NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ XO NO:25, SEQ XO NO:26, SEQ ID NO:27, SEQ XD NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31 , SEQ ID
  • an isolated nucleic acid molecule encoding any of these polypeptides, an isolated nucleic acid molecule encoding a fragment of any of these polypeptides, an isolated nucleic acid molecule encoding a polypeptide epitope of any of these polypeptides, and an isolated nucleic acid encoding a species homologue of any of these polypeptides.
  • any one of these polypeptides has biological activity.
  • any one of the isolated polypeptides comprises sequential amino acid deletions from either the C-terminus or the N-terminus.
  • a recombinant host cell that expresses any one of these isolated polypeptides.
  • Yet another embodiment of the invention comprises an isolated antibody that binds specifically to an isolated polypeptide encoded by a polynucleotide chosen from the group consisting of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ XD NO:5, SEQ XD NO:6, SEQ XD NO:7, SEQ XD NO:8, SEQ XD NO:9, SEQ XD NO: 10, SEQ ID NO:l l, SEQ ID NO:12, SEQ XD NO:13, SEQ XD NO:14, SEQ ID NO: 15, SEQ XD NO:16, SEQ ED NO: 17, SEQ XD NO: 18, SEQ XD NO: 19, SEQ XD NO:20, SEQ ID NO.21, SEQ ID NO:22, SEQ XD NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ XD NO:27, SEQ ID NO:
  • Another embodiment of the invention provides a method for preventing, treating, modulating, or ameliorating a medical condition, such as a neuroinflammatory pathology or a neurodegenerative condition, comprising administering to a mammalian subject a therapeutically effective amount of a polypeptide of the invention or a polynucleotide of the invention.
  • a medical condition such as a neuroinflammatory pathology or a neurodegenerative condition
  • a further embodiment of the invention provides an isolated antibody that binds specifically to the isolated polypeptide of the invention.
  • a preferred embodiment of the invention provides a method for preventing, treating, modulating, or ameliorating a medical condition, such as a neuroinflammatory pathology or a neurodegenerative condition, comprising administering to a mammalian subject a therapeutically effective amount of the antibody.
  • An additional embodiment of the invention provides a method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject.
  • the method comprises determining the presence or absence of a mutation in a polynucleotide of the invention.
  • a pathological condition or a susceptibility to a pathological condition such as a neuroinflammatory pathology or a neurodegenerative condition, is diagnosed based on the presence or absence of the mutation.
  • Even another embodiment of the invention provides a method of diagnosing a pathological condition or a susceptibility to a pathological condition, such as neuroinflammatory pathology or a neurodegenerative condition, in a subject.
  • the method comprises detecting an alteration in expression of a polypeptide encoded by the polynucleotide of the invention, wherein the presence of an alteration in expression of the polypeptide is indicative of the pathological condition or susceptibility to the pathological condition.
  • the alteration in expression can be an increase in the amount of expression or a decrease in the amount of expression.
  • a first biological sample is obtained from a patient suspected of having a neuroinflammatory pathology or a neurodegenerative condition, and a second sample from a suitable comparable control source is obtained.
  • the amount of at least one polypeptide encoded by a polynucleotide of the invention is determined in the first and second sample.
  • the amount of the polypeptide in the first and second samples is determined.
  • a patient is diagnosed as having a neuroinflammatory pathology or a neurodegenrative condition if the amount of the polypeptide in the first sample is greater than or less than the amount of the polypeptide in the second sample.
  • Another embodiment of the invention provides a method for identifying a binding partner to a polypeptide of the invention.
  • a polypeptide of the invention is contacted with a binding partner and it is determined whether the binding partner effects an activity of the polypeptide.
  • Yet another embodiment of the invention is a method of identifying an activity of an expressed polypeptide in a biological assay.
  • a polypeptide of the invention is expressed in a cell and isolated.
  • the expressed polypeptide is tested for an activity in a biological assay and the activity of the expressed polypeptide is identified based on the test results.
  • DNA molecule suitable for use as a probe for genes regulated in neuroinflammatory pathology or neurodegenerative conditions chosen from the group consisting of the DNA molecules shown in SEQ XD NO:l, SEQ ID NO:2, SEQ XD NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ED NO:6, SEQ XD NO:7, SEQ XD NO:8, SEQ ID NO:9, SEQ XD NO: 10, SEQ XD NO:l l, SEQ XD NO:12, SEQ XD NO:13, SEQ XD NO:14, SEQ XD NO: 15, SEQ XD
  • SEQ ID NO: 16 SEQ XD NO: 17, SEQ XD NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ XD NO:21, SEQ XD NO:22, SEQ ID NO:23, SEQ XD NO:24, SEQ XD NO:25, SEQ XD NO:26, SEQ XD NO:27, SEQ ID NO:28, SEQ XD NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ XD NO:33, SEQ XD NO:34, SEQ XD NO:35, SEQ ED NO:36, SEQ XD NO:37, SEQ XD NO:38, SEQ ED NO:39, SEQ ID NO:40, SEQ XD NO:41, SEQ XD NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ XD NO:45, SEQ ID NO:46, SEQ ID NO:
  • kits for detecting the presence of a polypeptide of the invention in a mammalian tissue sample comprises a first antibody which immunoreacts with a mammalian protein encoded by a gene corresponding to the polynucleotide of the invention or with a polypeptide encoded by the polynucleotide in an amount sufficient for at least one assay and suitable packaging material.
  • the kit can further comprise a second antibody that binds to the first antibody.
  • the second antibody can be labeled with enzymes, radioisotopes, fluorescent compounds, colloidal metals, chemiluminescent compounds, phosphorescent compounds, or bioluminescent compounds.
  • Another embodiment of the invention provides a kit for detecting the presence of genes encoding a protein comprising a polynucleotide of the invention, or fragment thereof having at least 10 contiguous bases, in an amount sufficient for at least one assay, and suitable packaging material.
  • Yet another embodiment of the invention provides a method for detecting the presence of a nucleic acid encoding a protein in a mammalian tissue sample.
  • a polynucleotide of the invention or fragment thereof having at least 10 contiguous bases is hybridized with the nucleic acid of the sample. The presence of the hybridization product is detected.
  • Figure 1A-D is a graphical representation of the results of TOGA analysis using a 5' PCR primer with parsing bases GTTC, showing PCR products produced from mRNA extracted from (A) untreated microglia (control), (B) microglia treated with LPS/IFN ⁇ (100 ng/ml LPS; 100 U/ml IFN ⁇ ) for 22 hours, (C) untreated macrophages (control) and (D) macrophages treated with LPS/IFN ⁇ (100 ng/ml LPS; 100 U/ml IFN ⁇ ) for 22 hours, where the vertical index line indicates a PCR product of about 426 b.p. that is present in microglia, but not macrophage cells;
  • Figure 2A-C is a graphical representation of a more detailed analysis of the 426 b.p. PCR product indicated in Figure 1, using the extended TOGA primer G-A-T-C-G-A- A-T-C-C-G-G-G-T-T-C-A-A-C-C-G-C-G-T-G-A-A-G-G-T (SEQ XD NO: 94);
  • Figure 3 shows northern blot analyses of clone MM_27 (GTTC 426), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from embryonic (day 14, 16, 18), and post-natal (day 1, 5, 10, 15, 20, 25, 30) brain tissue and mRNA from embryonic (day 16) and adult liver tissue was blotted after electrophoresis and probed with radiolabeled
  • Figure 4A-D is a graphical representation of the results of TOGA analysis using a
  • PCR primer with parsing bases GTTG showing PCR products produced from of mRNA extracted from (A) untreated microglia (control), (B) microglia treated with LPS/EFN ⁇ (lOOng/ml LPS; lOOU/ml IFN ⁇ ) for 22 hours, (C) untreated macrophages (control) and (D) macrophages treated with LPS/EFN ⁇ (lOOng/ml LPS; lOOU/ml IFN ⁇ ) for 22 hours, where the vertical index line indicates a PCR product of about 244 b.p.
  • Figure 5A-C is a graphical representation of more detailed analysis of the 244 b.p. PCR product indicated in Figure 3, using the extended TOGA primer G-A-T-C-G-A-A-T- C-C-G-G-G-T-T-G-C-A-C-C-T-A-T-T-G-C-A-T-G-C-A-T-G-C-A-T-G-T-G-T (SEQ JD NO: 93).
  • Figure 6A-C shows northern blot analyses of clone MM_3 (AAGT 366), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from various murine tissue and cells was blotted after electrophoresis and probed with radiolabeled MM_3.
  • Cells from mixed glial cultures, whole brain tissue, peritoneal macrophage cultures, kidney fibroblast cultures, and bone marrow-derived dendritic cell cultures were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/IFN- ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) prior to mRNA isolation.
  • Figure 7A-F is an in situ hybridization analysis using an antisense cRNA probe directed against the 3' end of clone MM_3, showing the pattern of clone MM 3 mRNA expression in vivo 24 hours after an intracranial injection of LPS/EFN ⁇ , where Figures 7(A- C) show coronal sections through anterior (7 A) and posterior (B) regions of the cerebrum and 7(C) shows a coronal section of the cerebellum of a control C57B1/6J mouse.
  • Figures 7(D-F) show coronal sections through anterior (7D) and posterior (E) regions of the cerebrum and 7(F) shows a coronal section of the cerebellum of a C57B1/6J mouse sacrificed 24 hours after an intracerebral injection of LPS/EFN ⁇ .
  • Figure 8 shows Northern blot analyses of clone MM_11 (AGGT 315), where an agarose gel containing lO ⁇ g of total cytoplasmic RNA from various murine cells was blotted after electrophoresis and probed with radiolabeled MM_11.
  • Microglial, macrophage, and dendritic cells were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/IFN- ⁇ (50 ng/ml LPS; 10 U/ml EFN- ⁇ ) prior to RNA isolation.
  • Figure 9A-B shows northern blot analyses of clone MM_12 (ACCA 381), where an agarose gel containing lO ⁇ g of total RNA from microglial, macrophage, and dendritic cells (Figure 9 A) or 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues ( Figure 9B) was blotted after electrophoresis and probed with radiolabeled MM_12.
  • Cells from mixed glial cultures, peritoneal macrophage cultures, and bone marrow-derived dendritic cultures were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml EFN- ⁇ ) for 22 hours prior to RNA isolation.
  • Figure 10 shows northern blot analyses of clone MM_12 (ACAA 381) where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from spleen and brain of post-natal day 1 and adult mice as well as microglia cells from mixed glial cultures and peritoneal macrophage cells was blotted after electrophoresis and probed with radiolabeled MM_12.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 22 hours prior to RNA isolation.
  • Figure 11 A-B shows northern blot analyses of clone MM 18 (TTGG 262), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from microglial and macrophage cells ( Figure 11 A) or 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues (Figure 1 IB) was blotted after electrophoresis and probed with radiolabeled MM_18.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 22 hours prior to RNA isolation.
  • Figure 12 shows a northern blot similar to the one shown in Figure 11 A, except that the blot is probed with a 32 P-labled probe comprising GOLLI-MBP exon 5a.
  • the Figure identifies transcripts 1-4 of Figure 11 A-B as follows: transcript 1 as MBP 1-56, transcript 2 as MBP 1 -102 - MBP 155-168, transcript 3 as MBP 1-56, and transcript 4 as MBP 1-102 - MBP 155-168.
  • Figure 13 shows northern blot analyses of clone MM_18 (TTGG 262), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from brain of embryonic (day 14, 16, 18), post-natal (day 1, 5, 10, 15, 20, 25, 30), and adult and mRNA from liver of embryonic (day 16) and adult was blotted after electrophoresis and probed with radiolabeled MM 18.
  • Figure 14A-E shows a schematic diagram of the GOLLI-MBP exons (A) and the results of an immunocytochemical analysis using an anti-GOLLI/MBP antibody on pancreas (B), thymus (C), liver (D) and lymph node (E) sections.
  • Figure 15 is a schematic drawing of the known GOLLI molecules and clone
  • Figure 16 demonstrates that in cells isolated from the adult mouse CNS, GOLLI- MBP (MM_18) expression stimulated by LPS/IFN ⁇ (as detected using RT-PCR) is higher in CD45 hlgh macrophages (lane 3, right) than in CD45 low/,ntermed ⁇ ate microglia (lane 2, center) or untreated controls (lane 1, left).
  • Figure 17 shows northern blot analyses of clone MM_20 (TGTG 411), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from murine spleen, brain, microglial cells and macrophage cells was blotted after electrophoresis and probed with radiolabeled MM_20.
  • Brain and spleen tissues were prepared from neonatal (postnatal day 1, PI) or adult mice.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 22 hours prior to RNA isolation.
  • Figure 18 shows northern blot analyses of clone MM_20 (TGTG 411), where an agarose gel containing 1.1 ⁇ g or 2 ⁇ g of poly A enriched mRNA from microglial cells and macrophage cells was blotted after electrophoresis and probed with radiolabeled MM_20.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 24 hours prior to RNA isolation.
  • Figure 19 A-B shows northern blot analyses of clone MM_21 (TCAT 410), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from murine spleen, brain, microglial cells and macrophage cells (Figure 19A) or 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues (Figure 19B) was blotted after electrophoresis and probed with radiolabeled MM_21. Brain and spleen tissues were prepared from neonatal (postnatal day 1, PI) or adult mice.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 22 hours prior to RNA isolation.
  • Figure 20A-C shows northern blot analyses of clone MM_23 (TCGG 314), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from murine spleen, brain, microglial cells and macrophage cells (Figure 20A, C) or 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues (Figure 20B) was blotted after electrophoresis and probed with radiolabeled MM_23. Brain and spleen tissues were prepared from neonatal (postnatal day 1, PI) or adult mice.
  • Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated (control) or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 1 hour or 22 hours prior to RNA isolation.
  • LPS/IFN ⁇ 50 ng/ml LPS; 10 U/ml IFN- ⁇
  • Figure 21 shows northern blot analyses of clone MM_23 (TCGG 314), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from embryonic (day 14, 16, 18), post-natal (day 1, 5, 10, 15, 20, 25, 30), and adult brain and mRNA from embryonic (day 16) and adult liver was blotted after electrophoresis and probed with radiolabeled MM_23.
  • Figure 22 shows comparisons of the predicted amino acid sequence of DDP with predicted polypeptides from an S. pombe gene (SPAC 13G6.04), a human EST yv59a08.sl, and the MM_23 sequence.
  • Figure 23 shows the sequence and cloning sites of MM 23 used to construct the prokaryote PBAD-TOPO expression vector shown in Figure 24.
  • Figure 24 is a map of the PBAD-TOPO expression vector construct containing the MM_23 translation sequence.
  • Figure 25 shows northern blot analyses of clone MM_37 (CGGG 246), where an agarose gel containing 2 ⁇ g of poly A enriched RNA from microglial, macrophage, and dendritic cells was blotted after electrophoresis and probed with radiolabeled MM_37.
  • Cells from mixed glial cultures, peritoneal macrophage cultures, and bone marrow-derived dendritic cultures were either untreated (control) or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 22 hours prior to RNA isolation.
  • Figure 26A-B shows northern blot analyses of clone MM_22 (TCTT 296), where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from murine fibroblasts, brain, microglial cells and macrophage cells (Figure 26B) or 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues (Figure 26A) was blotted after electrophoresis and probed with radiolabeled MM_22. Brain tissue was prepared from neonatal (postnatal day 1, PI) or adult mice. Microglia cells from mixed glial cultures and peritoneal macrophage cells were either untreated
  • Figure 27A-D shows northern blot analyses of MM_59 (GGCC 255).
  • Figure 27A shows northern blot analyses where an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglial, macrophage, and dendritic cells was blotted after electrophoresis and probed with radiolabeled MM_59.
  • Cells from mixed glial cultures, peritoneal macrophage cultures, and bone marrow-derived dendritic cultures were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml EFN- ⁇ ) for 22 hours prior to RNA isolation.
  • Figure 27B shows northern blot analyses where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from embryonic (day 14, 16, 18), post-natal (day 1, 5, 10, 15, 20, 25, 30), and adult brain and mRNA from embryonic (day 16) and adult liver was blotted after electrophoresis and probed with radiolabeled MM 59.
  • Figure 27C shows northern blot analyses where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from untreated lung, heart, kidney, liver, spleen, lymph node, testis and several brain tissues was blotted after electrophoresis and probed with radiolabeled MM_59.
  • Figure 27D is a longer exposure of the northern blot of Figure 27C.
  • Figure 28 shows a northern blot analyses of MM_59 (GGCC 255), where an agarose gel containing 2 ⁇ g of polyA enriched RNA from brain, kidney, and heart tissue taken from control mice (lanes 1, 3, 5) and from brain, kidney, and heart tissue taken from relb knockout mice (lacking the NF-kB subunit relb gene; lanes 2, 4, 6) was blotted after electrophoresis and probed with radiolabeled MM_59.
  • Figure 29 shows the results of an analysis of in situ hybridization of MM_59 to sections of healthy adult mouse brain. MM_59 expression is detected in intemeurons of the cortex (Figure 29A), islands of calleja (Figure 29B), and the septum (Figure 29C).
  • MM_59 expression is also detected in the cigulate cortex, intemeurons of the cortex, and hippocampus ( Figure 29D). MM_59 expression is further detected in the Purkinje layer of the cerebellar cortex as shown in Figures 29E and 29F and in the inferior colliculus as shown in Figure 29E.
  • Figure 30 shows the level of CXCL14 (MM_59) expression in rat, mouse, and monkey tissue.
  • Lane 1 contained RNA extracted from rat brain tissue
  • lane 2 contained RNA extracted from rat liver tissue
  • lane 3 contained RNA extracted from mouse brain tissue
  • lane 4 contained RNA extracted from mouse liver tissue
  • lane 5 contained RNA extracted from monkey brain tissue
  • lane 6 contained RNA extracted from monkey liver tissue.
  • Figure 31 shows the level of CXCL14 (MM_59) expression in human brain tissue.
  • Lane 1 contained RNA extracted from amygdala
  • lane 2 contained RNA extracted from caudate nucleus
  • lane 3 contained RNA extracted from corpus callosum
  • lane 4 contained RNA extracted from hippocampus
  • lane 5 contained RNA extracted from whole brain
  • lane 6 contained RNA extracted from substantia nigra
  • lane 7 contained RNA extracted from thalamus.
  • Figure 32 shows the level of CXCL14 (MM_59) expression in rat tissue.
  • Lane 1 contained RNA extracted from olfactory bulb
  • lane 2 contained RNA extracted from hippocampus
  • lane 3 contained RNA extracted from thalamus
  • lane 4 contained RNA extracted from cerebellum
  • lane 5 contained RNA extracted from liver
  • lane 6 contained RNA extracted from kidney
  • lane 7 contained RNA extracted from heart
  • lane 8 contained RNA extracted from whole brain
  • lane 9 contained RNA extracted from cortex
  • lane 10 contained RNA extracted from liver
  • lane 11 contained RNA extracted from ovaries
  • lane 12 contained RNA extracted from testes.
  • Figure 33 shows northern blot analyses of MM_6 (ATGG 384), where an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglial, macrophage, and dendritic cells was blotted after electrophoresis and probed with radiolabeled MM_6.
  • Cells from mixed glial cultures, peritoneal macrophage cultures, and bone marrow-derived dendritic cultures were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 22 hours prior to RNA isolation.
  • Figure 34 shows northern blot analyses of apolipoprotein D, where an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglial, macrophage, and dendritic cells was blotted after electrophoresis and probed with radiolabeled apoD.
  • Cells from mixed glial cultures, peritoneal macrophage cultures, and bone marrow-derived dendritic cultures were either untreated (control), treated with LPS (50 ng/ml), or treated with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) for 22 hours prior to RNA isolation.
  • Figure 35 demonstrates the up-regulation of the expression of apoD (MM_66) in the CNS 24 hours after the intracranial injection of LPS/IFN ⁇ , showing the results of in situ hybridization analysis using an antisense cRNA probe directed against the 3' end of clone MM 66, showing the pattern mRNA expression in vivo in coronal sections through anterior (35 A) and posterior (35B) regions of the cerebrum.
  • Figure 36 demonstrates that the expression of MM_115 (CGTG 160) is higher in microglia and dendritic cells compared to macrophages, showing an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglia (untreated, lane 1; treated 24 hours with LPS/IFN ⁇ , lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/IFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_115
  • Figure 37 shows the results of an analysis of in situ hybridization of MM_115 in a coronal section through an anterior level of the cerebrum of an adult mouse.
  • Figure 38 shows northern blot analyses of MM_80 (TTCG 211) and MM_81 (TAAG 387) in various adult mouse tissues, where an agarose gel containing polyA enriched RNA was blotted after electrophoresis and probed with radiolabeled MM_80 and MM_81. Expression of both clones was highest in the CNS (cerebral cortex, lane 1; midbrain, lane 2; brainstem, lane 3; cerebellum, lane 4). MM 80, but not MM_81, was detected in liver (lane 8), testes (lane 11), kidney (lane 7) and heart (lane 6). Neither MM_80, nor MM_81, was detected in lung (lane 5), spleen (lane 9), and lymph node (lane 10).
  • Figure 39 shows the results of an analysis of in situ hybridization of MM_81 in a coronal section of the cerebellum of an adult mouse. MM_81 could be detected only in the cerebellum.
  • Figure 40A-D shows the results of an analysis of in situ hybridization of MM_90 (GAGC 419) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing the pattern of MM_90 mRNA expression in vivo in untreated control (A,B) and in the brain of a mouse 24 hours after an intracranial injection of LPS/IFN ⁇ , showing expression in the hypothalamus (A, C) and thalamus (B, D).
  • Figure 41 shows the results of an analysis of in situ hybridization of MM_100 (ATCG 400) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in the hippocampus and lateral cortex in untreated control (A) and in the brain of a mouse 24 hours after an intracranial injection of LPS/IFN ⁇ (B).
  • Figure 42 shows the results of an analysis of in situ hybridization of MM_101 (ATCG 435) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior (A) and posterior levels (B) of the brain.
  • Figure 43 shows the results of an analysis of in situ hybridization of MM_102 (ATCT 208) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in the cerebrum of an untreated control (A) and in the cerebrum (B) and cerebellum (C) of a mouse 24 hours after an intracranial injection of LPS/IFN ⁇ .
  • Figure 44 demonstrates that the expression of MM_48 (TGCC 268) can be detected in stimulated microglia, showing an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglia (untreated, lane 1 ; treated 24 hours with LPS/TFN ⁇ , lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/EFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_48
  • Figure 45 demonstrates that the expression of MM 51 (GCGC 301) is higher in microglia than in macrophages, showing an agarose gel containing polyA enriched RNA from microglia (untreated, lane 1; treated 24 hours with LPS/IFN ⁇ , lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/IFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_51.
  • Figure 46 shows the results of northern blot analyses of clone MM_75, (GACC
  • Figure 47 shows the results of an analysis of in situ hybridization of MM_106 (CCAC 292) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in posterior levels of the brain.
  • MM_106 expression was detected in hippocampal neurons, in the Purkinje cell layer of the cerebellum, in the amygdala and in glia throughout the CNS.
  • Figure 48 shows the results of an analysis of in situ hybridization of MM_151 (AGTT 435) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior levels of the brain.
  • Figure 49 shows the results of an analysis of in situ hybridization of MM_78 (TTTC 437) in coronal sections of the brain of an adult mouse using an antisense cRNA probe.
  • Figure 50 shows the results of an analysis of in situ hybridization of MM 71 (AAGG 394)/ 92 (AAGG 409) in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior (A) and posterior (B, C) levels of the brain.
  • isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
  • an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
  • a "secreted" protein refers to those proteins capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as those proteins released into the extracellular space without necessarily containing a signal sequence. If the secreted protein is released into the extracellular space, the secreted protein can undergo extracellular processing to produce a "mature" protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.
  • a "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ XD NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the polynucleotide can contain all or part of the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.
  • a "polypeptide” refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
  • a "polynucleotide” of the present invention also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188, or the complement thereof, or the cDNA.
  • “Stringent hybridization conditions” refers to an overnight incubation at 42°C in a solution comprising 50% formamide, 5X SSC (750 mM NaCl, 75 mM sodium citrate), 50 mM sodium phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1 x SSC at about 65°C.
  • nucleic acid molecules that hybridize to the polynucleotides of the present invention at lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
  • blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • polynucleotide which hybridizes only to polyA+ sequences (such as any 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double- stranded cDNA clone).
  • a polynucleotide of the present invention can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • a polynucleotide can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • a polynucleotide may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • a variety of modifications can be made to DNA and RNA; thus, "polynucleotide” embraces chemically, enzymatically, or metabolically modified forms.
  • the polypeptide of the present invention can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids.
  • the polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • polypeptides may be branched, for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formulation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • a polypeptide having biological activity refers to polypeptides exhibiting activity similar, but not necessarily identical to, an activity of a polypeptide of the present invention, including mature forms, as measured in a particular biological assay, with or without dose-dependency. In the case where dose dependency does exist, it need not be identical to that of the polypeptide, but rather substantially similar to the dose-dependence in a given activity as compared to the polypeptide of the present invention (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about ten-fold less activity and, most preferably, not more than about three-fold less activity relative to the polypeptide of the present invention).
  • the translated amino acid sequence beginning with the methionine, is identified although other reading frames can also be easily translated using known molecular biology techniques.
  • the polypeptides produced by the translation of these alternative open reading frames are specifically contemplated by the present invention.
  • SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188 and the translations of SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and described further below.
  • These nucleic acid molecules will also hybridize to nucleic acid molecules in biological samples, thereby enabling a variety of forensic and diagnostic methods of the invention.
  • polypeptides identified from the translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 may be used to generate antibodies which bind specifically to the secreted proteins encoded by the cDNA clones identified.
  • DNA sequences generated by sequencing reactions can contain sequencing errors.
  • the errors exist as misidentified nucleotides, or as insertions or deletions of nucleotides in the generated DNA sequence.
  • the e ⁇ oneously inserted or deleted nucleotides cause frame shifts in the reading frames of the predicted amino acid sequence. In these cases, the predicted amino acid sequence diverges from the actual amino acid sequence, even though the generated DNA sequence may be greater than
  • the present invention also relates to the genes corresponding to SEQ ID NOs: 1- 64, 106, 170-182, 184, and 186-188, and translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the co ⁇ esponding gene can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include preparing probes or primers from the disclosed sequence and identifying or amplifying the corresponding gene from appropriate sources of genomic material.
  • species homologues may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source for the desired homologue.
  • polypeptides of the invention can be prepared in any suitable manner.
  • Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides, or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well understood in the art.
  • polypeptides may be in the form of the secreted protein, including the mature form, or may be a part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence which contains secretory or leader sequences, pro-sequences, sequences which aid in purification (such as multiple histidine residues), or an additional sequence for stability during recombinant production.
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified.
  • a recombinantly produced version of a polypeptide, including the secreted polypeptide can be substantially purified by the one- step method described in Smith & Johnson, Gene, 67:31-40 (1988).
  • Polypeptides of the invention also can be purified from natural or recombinant sources using antibodies of the invention raised against the secreted protein in methods which are well known in the art.
  • the deduced amino acid sequence of the secreted polypeptide was analyzed by a computer program called Signal P (Nielsen et al., Protein Engineering, 10:1-6 (1997), which predicts the cellular location of a protein based on the amino acid sequence.
  • Signal P Naelsen et al., Protein Engineering, 10:1-6 (1997), which predicts the cellular location of a protein based on the amino acid sequence.
  • McGeoch and von Heinje are incorporated.
  • cleavage sites sometimes vary from organism to organism and cannot be predicted with absolute certainty.
  • the present invention provides secreted polypeptides having a sequence corresponding to the translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 which have an N- terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 which have an N- terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • cleavage of the signal sequence from a secreted protein is not entirely uniform, resulting in more than one secreted species.
  • the signal sequence identified by the above analysis may not necessarily predict the naturally occurring signal sequence.
  • the naturally occurring signal sequence may be further upstream from the predicted signal sequence.
  • the predicted signal sequence will be capable of directing the secreted protein to the ER.
  • Variant refers to a polynucleotide or polypeptide differing from the polynucleotide or polypeptide of the present invention, but retaining essential properties thereof. In general, variants have close similarity overall and are identical in many regions to the polynucleotide or polypeptide of the present invention.
  • identity is well known to skilled artisans (Carillo et al., SIAM J Applied Math., 48:1073 (1988)). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in "Guide to Huge Computers,” Martin J. Bishop, Ed., Academic Press, San Diego, (1994) and Carillo et al., (1988), Supra. Methods for aligning polynucleotides or polypeptides are codified in computer programs, including the GCG program package (Devereux et al., Nuc. Acids Res.
  • the parameters are set such that the percentage of identity is calculated over the full length of the reference polynucleotide and that gaps in identity of up to 5% of the total number of nucleotides in the reference polynucleotide are allowed.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Bioscl, 6:237-245 (1990)).
  • sequence includes nucleotide and amino acid sequences, h a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is presented in terms of percent identity.
  • a polynucleotide having a nucleotide sequence of at least 95% "identity" to a sequence contained in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 means that the polynucleotide is identical to a sequence contained in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 or the cDNA except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the total length (not just within a given 100 nucleotide stretch).
  • a polynucleotide having a nucleotide sequence at least 95% identical to SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 up to 5% of the nucleotides in the sequence contained in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 or the cDNA can be deleted, inserted, or substituted with other nucleotides. These changes may occur anywhere throughout the polynucleotide.
  • polynucleotides having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity will encode a polypeptide identical to an amino acid sequence contained in the translations of SEQ ID NOS: 1-64, 106, 170-182, 184, and 186-188.
  • a polypeptide having an amino acid sequence having at least, for example, 95% "identity" to a reference polypeptide is intended that the amino acid sequence of the polypeptide is identical to the reference polypeptide except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the total length of the reference polypeptide.
  • up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
  • alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • Further embodiments of the present invention include polypeptides having at least 80% identity, more preferably at least 85% identity, more preferably at least 90% identity, and most preferably at least 95%, 96%, 97%, 98% or 99% identity to an amino acid sequence contained in translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the above polypeptides should exhibit at least one biological activity of the protein.
  • polypeptides of the present invention include polypeptides having at least 90% similarity, more preferably at least 95% similarity, and still more preferably at least 96%, 97%, 98%, or 99% similarity to an amino acid sequence contained in translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the variants may contain alterations in the coding regions, non-coding regions, or both.
  • polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide are prefened.
  • variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also prefened.
  • Polynucleotide variants can be produced for a variety of reasons. For instance, a polynucleotide variant may be produced to optimize codon expression for a particular host (i.e., codons in the human mRNA may be changed to those prefened by a bacterial host, such as E. coli).
  • Naturally occurring variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism (Lewin, Ed., Genes II, John Wiley & Sons, New York (1985)). These allelic variants can vary at either the polynucleotide and/or polypeptide level. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
  • variants may be generated to improve or alter the characteristics of the polypeptides of the present invention.
  • one or more amino acids can be deleted from the N- terminus or C-terminus of the secreted protein without substantial loss of biological function.
  • Ron et al. reported variant KGF proteins having heparin binding activity even after deleting 3, 8, or 27 amino-terminal amino acid residues (J. Biol. Chem. 268: 2984- 2988 (1993)).
  • interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein (Dobeli et al., J. Biotechnology, 7:199-216 (1988)).
  • the invention further includes polypeptide variants which show substantial biological activity.
  • variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.
  • guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., Science, 247:1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.
  • the first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, the amino acid positions which have been conserved between species can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions in which substitutions have been tolerated by natural selection indicate positions which are not critical for protein function. Thus, positions tolerating amino acid substitution may be modified while still maintaining biological activity of the protein.
  • the second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site-directed mutagenesis or alanine-scanning mutagenesis (the introduction of single alanine mutations at every residue in the molecule) can be used (Cunningham et al., Science, 244:1081-1085 (1989)). The resulting mutant molecules can then be tested for biological activity.
  • tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin; replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Tip; and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
  • variants of the present invention include: (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code; (ii) substitution with one or more of amino acid residues having a substituent group; (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (e.g., polyethylene glycol); (iv) fusion of the polypeptide with additional amino acids, such as an IgG Fc fusion region peptide, a leader or secretory sequence, or a sequence facilitating purification.
  • substitutions with one or more of the non-conserved amino acid residues where the substituted amino acid residues may or may not be one encoded by the genetic code
  • substitution with one or more of amino acid residues having a substituent group such as a compound to increase the stability and/or solubility of the polypeptide (e.g., poly
  • polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as decreased aggregation.
  • aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity (see, e.g., Pinckard et al., Clin. Exp. Immunol. 2:331- 340 (1967); Robbins et al., Diabetes, 36: 838-845 (1987); Cleland et al., Crit. Rev. Therap. Drug Carrier Sys., X0:307-377 (1993)).
  • a "polynucleotide fragment” refers to a short polynucleotide having a nucleic acid sequence contained in that shown in SEQ ID NOs: 1- 64, 106, 170-182, 184, and 186-188.
  • the short nucleotide fragments are preferably at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length.
  • a fragment "at least 20 nt in length,” for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in that shown in SEQ ED NOs: 1-64, 106, 170-182,
  • nucleotide fragments are useful as diagnostic probes and primers as discussed herein.
  • larger fragments e.g., 50, 150, and greater than 150 nucleotides are prefened.
  • polynucleotide fragments of the invention include, for example, fragments having a sequence from about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, to the end of SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188.
  • “about” includes the particularly recited ranges, larger or smaller by several nucleotides (i.e., 5, 4, 3, 2, or 1 nt) at either terminus or at both termini.
  • these fragments encode a polypeptide which has biological activity.
  • polypeptide fragment refers to a short amino acid sequence contained in the translations of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186- 188. Protein fragments may be "free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention include, for example, fragments from about amino acid number 1-20, 21-40, 41-60, or 61 to the end of the coding region. Moreover, polypeptide fragments can be about 20, 30, 40, 50, or 60 amino acids in length. In this context "about” includes the particularly recited ranges, larger or smaller by several amino acids (5, 4, 3, 2, or 1) at either extreme or at both extremes.
  • Prefened polypeptide fragments include the secreted protein as well as the mature form. Further prefened polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids ranging from 1-60, can be deleted from the amino terminus of either the secreted polypeptide or the mature form.
  • any number of amino acids ranging from 1-30 can be deleted from the carboxy terminus of the secreted protein or mature form. Furthermore, any combination of the above amino and carboxy terminus deletions are prefened. Similarly, polynucleotide fragments encoding these polypeptide fragments are also prefened.
  • polypeptide and polynucleotide fragments characterized by structural or functional domains, such as fragments that comprise alpha-helix and alpha- helix-forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-forming regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic index regions.
  • Polypeptide fragments of the translations of SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188 falling within conserved domains are specifically contemplated by the present invention.
  • polynucleotide fragments encoding these domains are also contemplated.
  • Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the polypeptide of the present invention.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • epitopes & Antibodies refer to polypeptide fragments having antigenic or immunogenic activity in an animal, especially in a human.
  • a prefened embodiment of the present invention relates to a polypeptide fragment comprising an epitope, as well as the polynucleotide encoding this fragment.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • an "immunogenic epitope” is defined as a part of a protein that elicits an antibody response. (See, e.g., Geysen et al., Proc. Natl. Acad. Sci. USA, 81:3998-4002 (1983)).
  • Fragments which function as epitopes may be produced by any conventional means. (See, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA, 82:5131-5135 (1985), further described in U.S. Patent No. 4,631,211).
  • antigenic epitopes preferably contain a sequence of at least seven, more preferably at least nine, and most preferably between about 15 to about 30 amino acids.
  • Antigenic epitopes are useful to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. (See, e.g., Wilson et al., Cell, 37:767-778 (1984); Sutcliffe et al., Science, 219:660-666 (1983)).
  • immunogenic epitopes can be used to induce antibodies according to methods well known in the art. (See, e.g., Sutcliffe et al., (1983) Supra; Wilson et al., (1984) Supra; Chow et al., Proc. Natl. Acad. Sci., USA, 82:910-914; and Bittle et al., J. Gen. Virol, 66:2347-2354 (1985)).
  • a prefened immunogenic epitope includes the secreted protein.
  • the immunogenic epitope may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse).
  • the immunogenic epitope may be prescribed without a carrier, if the sequence is of sufficient length (at least about 25 amino acids).
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting.)
  • antibody As used herein, the term "antibody” (Ab) or “monoclonal antibody” (Mab) is meant to include intact molecules as well as antibody fragments (such as, for example, Fab and F(ab') 2 fragments) which are capable of specifically binding to protein. Fab and F(ab') 2 fragments lack the Fc fragment of intact antibody, clear more rapidly from the circulation, and may have less non-specific tissue binding than an intact antibody (Wahl et al., J. Nucl. Med., 24:316-325 (1983)). Thus, these fragments are prefened, as well as the products of a Fab or other immunoglobulin expression library. Moreover, antibodies of the present invention include chimeric, single chain, and human and humanized antibodies.
  • chimeric antibodies e.g., humanized versions of murine monoclonal antibodies.
  • Such humanized antibodies may be prepared by known techniques, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans.
  • a humanized monoclonal antibody comprises the variable region of a murine antibody (or just the antigen binding site thereof) and a constant region derived from a human antibody.
  • a humanized antibody fragment may comprise the antigen binding site of a murine monoclonal antibody and a variable region fragment (lacking the antigen-binding site) derived from a human antibody.
  • Procedures for the production of chimeric and further engineered monoclonal antibodies include those described in Riechmann et al.
  • One method for producing a human antibody comprises immunizing a non-human animal, such as a transgenic mouse, with a polypeptide translated from a nucleotide sequence chosen from SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188, whereby antibodies directed against the polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 are generated in said animal.
  • Procedures have been developed for generating human antibodies in non-human animals.
  • the antibodies may be partially human, or preferably completely human.
  • Non-human animals (such as transgenic mice) into which genetic material encoding one or more human immunoglobulin chains has been introduced may be employed.
  • transgenic mice may be genetically altered in a variety of ways.
  • the genetic manipulation may result in human immunoglobulin polypeptide chains replacing endogenous immunoglobulin chains in at least some (preferably virtually all) antibodies produced by the animal upon immunization.
  • Antibodies produced by immunizing transgenic animals with a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186- 188 are provided herein.
  • mice in which one or more endogenous immunoglobulin genes are inactivated by various means have been prepared.
  • Human immunoglobulin genes have been introduced into the mice to replace the inactivated mouse genes.
  • Antibodies produced in the animals inco ⁇ orate human immunoglobulin polypeptide chains encoded by the human genetic material introduced into the animal. Examples of techniques for production and use of such transgenic animals are described in U.S. Patent Nos.5,814,318, 5,569,825, and 5,545,806, which are inco ⁇ orated by reference herein.
  • Monoclonal antibodies may be produced by conventional procedures, e.g., by immortalizing spleen cells harvested from the transgenic animal after completion of the immunization schedule.
  • the spleen cells may be fused with myeloma cells to produce hybridomas by conventional procedures.
  • a method for producing a hybridoma cell line comprises immunizing such a transgenic animal with an immunogen comprising at least seven contiguous amino acid residues of a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188; harvesting spleen cells from the immunized animal; fusing the harvested spleen cells to a myeloma cell line, thereby generating hybridoma cells; and identifying a hybridoma cell line that produces a monoclonal antibody that binds a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • Such hybridoma cell lines, and monoclonal antibodies produced therefrom, are encompassed by the present invention.
  • Monoclonal antibodies secreted by the hybridoma cell line are purified by conventional techniques.
  • Antibodies may be employed in an in vitro procedure, or administered in vivo to inhibit biological activity induced by a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188. Disorders caused or exacerbated (directly or indirectly) by the interaction of such polypeptides of the present invention with cell surface receptors thus may be treated.
  • a therapeutic method involves in vivo administration of a blocking antibody to a mammal in an amount effective for reducing a biological activity induced by a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • focal inflammation is mediated by chemotaxis of immune cells that can locally produce cytokines leading to the inflammation.
  • Administration of an antibody derived from the identified polynucleotides could be used to modulate these events.
  • conjugates comprising a detectable (e.g., diagnostic) or therapeutic agent, attached to an antibody directed against a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • detectable or therapeutic agent attached to an antibody directed against a polypeptide translated from a nucleotide sequence chosen from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • agents are well known, and include but are not limited to diagnostic radionuclides, therapeutic radionuclides, and cytotoxic drugs.
  • the conjugates find use in in vitro or in vivo procedures.
  • any polypeptide of the present invention can be used to generate fusion proteins.
  • the polypeptide of the present invention when fused to a second protein, can be used as an antigenic tag.
  • Antibodies raised against the polypeptide of the present invention can be used to indirectly detect the second protein by binding to the polypeptide.
  • secreted proteins target cellular locations based on trafficking signals, the polypeptides of the present invention can be used as targeting molecules once fused to other proteins.
  • domains that can be fused to polypeptides of the present invention include not only heterologous signal sequences, but also other heterologous functional regions.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • fusion proteins may also be engineered to improve characteristics of the polypeptide of the present invention. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.
  • polypeptides of the present invention can be combined with parts of the constant domain of immunoglobulin s (IgG), resulting in chimeric polypeptides.
  • IgG immunoglobulin s
  • EP A 0 464 533 (Canadian counte ⁇ art 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties (see, e.g., EP A 0 232 262).
  • deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired.
  • the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
  • human proteins such as hTL-5
  • Fc portions for the pu ⁇ ose of high- throughput screening assays to identify antagonists of hTL-5 (See, Bennett et al., J. Mol. Recognition 8:52-58 (1995); Johanson et al., J. Biol. Chem., 270:9459-9471 (1995)).
  • the polypeptides of the present invention can be fused to marker sequences, such as a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., Chatsworth, CA), among others, many of which are commercially available.
  • hexa- histidine provides for convenient purification of the fusion protein (Proc. Natl. Acad. Sci. USA 86:821-824 (1989)).
  • HA hemagglutinin protein
  • Other fusion proteins may use the ability of the polypeptides of the present invention to target the delivery of a biologically active peptide. This might include focused delivery of a toxin to tumor cells, or a growth factor to stem cells.
  • any of these above fusions can be engineered using the polynucleotides or the polypeptides of the present invention.
  • the present invention also relates to vectors containing the polynucleotide of the present invention, host cells, and the production of polypeptides by recombinant techniques.
  • the vector may be, for example, a phage, plasmid, viral, or retroviral vector.
  • Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the polynucleotide insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, t ⁇ , phoA and tac promoters, the SV40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells, and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors prefened for use in bacteria include pQ ⁇ 70, pQE60 and pQE-9, available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNH8A,
  • prefened eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986). It is specifically contemplated that the polypeptides of the present invention may, in fact, be expressed by a host cell lacking a recombinant vector.
  • a polypeptide of this invention can be recovered and purified from recombinant cell cultures by well-known methods, including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention can also be recovered from products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
  • a prokaryotic or eukaryotic host including, for example, bacterial, yeast, higher plant, insect, and mammalian cells.
  • the polypeptides of the present invention may be glycosylated or may be non-glycosylated.
  • polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
  • the polynucleotides of the present invention are useful for chromosome identification. There exists an ongoing need to identify new chromosome markers, since few chromosome marking reagents based on actual sequence data (repeat polymo ⁇ hisms) are presently available. Each polynucleotide of the present invention can be used as a chromosome marker. Cunently, no specific diagnostic markers exist that can be used to detect or diagnose neuroinflammation. The polynucleotides of the present invention can be used as chromosome markers for detection and diagnosis of neuroinflammation.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the sequences shown in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188. Primers can be selected using computer analysis so that primers do not span more than one predicted exon in the genomic DNA. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene conesponding to the SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 will yield an amplified fragment.
  • somatic hybrids provide a rapid method of PCR mapping the polynucleotides to particular chromosomes. Three or more clones can be assigned per day using a single thermal cycler. Moreover, sublocalization of the polynucleotides can be achieved with panels of specific chromosome fragments.
  • Other gene-mapping strategies that can be used include in situ hybridization, prescreening with labeled flow-sorted chromosomes, and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • FISH fluorescence in situ hybridization
  • the polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes). Prefened polynucleotides conespond to the noncoding regions of the cDNAs because the coding sequences are more likely conserved within gene families, thus increasing the chance of cross-hybridization during chromosomal mapping.
  • the physical position of the polynucleotide can be used in linkage analysis. Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease.
  • polynucleotide and the conesponding gene between affected and unaffected individuals can be examined.
  • the polynucleotides of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 can be used for this analysis of individuals.
  • a polynucleotide can be used to control gene expression through triple helix formation or antisense DNA or RNA. Both methods rely on binding of the polynucleotide to DNA or RNA. For these techniques, prefened polynucleotides are usually 20 to 40 bases in length and complementary to either the region of the gene involved in transcription (see, Lee et al., Nuc. Acids Res., 6:3073 (1979); Cooney et al., Science, 241:456 (1988); and Dervan et al., Science, 251 :1360 (1991) for discussion of triple helix formation) or to the mRNA itself (see, Okano, J.
  • Polynucleotides of the present invention are also useful in gene therapy.
  • One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to conect the genetic defect.
  • the polynucleotides disclosed in the present invention offer a means of targeting such genetic defects in a highly accurate manner.
  • Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.
  • the polynucleotides are also useful for identifying individuals from minute biological samples.
  • the United States military for example, is considering the use of restriction fragment length polymo ⁇ hism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymo ⁇ hism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel.
  • This method does not suffer from the cunent limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the polynucleotides of the present invention can be used as additional DNA markers for RFLP.
  • the polynucleotides of the present invention can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ID database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples.
  • DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, etc.
  • DNA sequences amplified from polymo ⁇ hic loci such as DQa class H HLA gene, are used in forensic biology to identify individuals. (Erlich, Ed., PCR Technology, M. Stockton Press (1989)).
  • polymo ⁇ hic loci are amplified, they are digested with one or more restriction enzymes, yielding an identifying set of bands on a Southern blot probed with DNA conesponding to the DQa class H HLA gene.
  • polynucleotides of the present invention can be used as polymo ⁇ hic markers for forensic pu ⁇ oses.
  • reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin.
  • Appropriate reagents can comprise, for example, DNA probes or primers specific to particular tissue prepared from the sequences of the present invention. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination.
  • the polynucleotides of the present invention can be used as molecular weight markers on Southern gels; as diagnostic probes for the presence of a specific mRNA in a particular cell type; as a probe to "subtract-out" known sequences in the process of discovering novel polynucleotides; for selecting and making oligomers for attachment to a "gene chip” or other support; to raise anti-DNA antibodies using DNA immunization techniques; and as an antigen to elicit an immune response.
  • a polypeptide of the present invention can be used to assay protein levels in a biological sample using antibody-based techniques.
  • protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, et al., J. Cell. Biol, 101:976-985 (1985); Jalkanen, et al., J Cell. Biol, 105:3087-3096 (1987)).
  • Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Suitable antibody assay labels include enzyme labels, such as glucose oxidase; and radioisotopes, such as iodine ( 125 1, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( 112 In), and technetium ( 99m Tc); fluorescent labels, such as fluorescein and rhodamine; and biotin.
  • enzyme labels such as glucose oxidase
  • radioisotopes such as iodine ( 125 1, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( 112 In), and technetium ( 99m Tc)
  • fluorescent labels such as fluorescein and rhodamine
  • biotin such as fluorescein and rhodamine
  • proteins can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, nuclear magnetic resonance (NMR), or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be inco ⁇ orated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (e.g., 131 I, 112 In, 99m Tc), a radio-opaque substance, or a material detectable by NMR, is introduced (e.g., parenterally, subcutaneously, or intraperitoneally) into the mammal.
  • a radioisotope e.g., 131 I, 112 In, 99m Tc
  • a radio-opaque substance e.g., a radio-opaque substance, or a material detectable by NMR
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, Burchiel and Rhodes, Eds., Masson Publishing Inc. (1982)).
  • the invention provides a diagnostic method of a disorder, which involves (a) assaying the expression of a polypeptide of the present invention in cells or body fluid of an individual; and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a disorder.
  • Inflammation associated with infection of the brain or traumatic, degenerative, and ischemic insults to the brain is the result of locally produced cytokines, chemokines, and changes in immune cell physiology involving up- or down-regulation of polynucleotides and polypeptides. These changes can be diagnosed or monitored by assaying changes in polypeptide levels in tissues or fluids, such as CSF, blood, or fecal samples.
  • polypeptides of the present invention can be used to treat disease.
  • patients can be administered a polypeptide of the present invention in an effort to replace absent or decreased levels of the polypeptide (e.g., insulin); to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B); to inhibit the activity of a polypeptide (e.g., an oncogene); to activate the activity of a polypeptide (e.g., by binding to a receptor); to reduce the activity of a membrane bound receptor by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation); or to bring about a desired response (e.g., blood vessel growth).
  • a polypeptide of the present invention in an effort to replace absent or decreased levels of the polypeptide (e.g., insulin); to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B); to inhibit the activity of a polypeptide (
  • antibodies directed to a polypeptide of the present invention can also be used to treat disease.
  • administration of an antibody directed to a polypeptide of the present invention can bind and reduce ove ⁇ roduction of the polypeptide.
  • administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).
  • Polypeptides can be used as antigens to trigger immune responses.
  • Local production of cytokines and chemokines modulate many aspects of immune cell function. In infection of the brain and traumatic, degenerative and ischemic insults to the brain, local production of cytokines activate and promote chemotaxis of microglia and macrophages to areas of injury and/or infection.
  • an antibody to an ove ⁇ roduced polypeptide can be used to modulate microglial and macrophage responses.
  • the polypeptides of the present invention can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well-known to those of skill in the art. Polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell.
  • the polypeptides of the present invention can be used to test the following biological activities.
  • polynucleotides and polypeptides of the present invention can be used in assays to test for one or more biological activities. If these polynucleotides and polypeptides do exhibit activity in a particular assay, it is likely that these molecules may be involved in the diseases associated with the biological activity. Thus, the polynucleotides and polypeptides could be used to treat the associated disease.
  • a polypeptide or polynucleotide of the present invention may be useful in treating deficiencies or disorders of the central nervous system or peripheral nervous system by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of neuroblasts, stem cells, or glial cells. Also, a polypeptide or polynucleotide of the present invention may be useful in treating deficiencies or disorders of the central nervous system or peripheral nervous system by activating or inhibiting the mechanisms of synaptic transmission, synthesis, metabolism and inactivation of neural transmitters, neuromodulators and trophic factors, and by activating or inhibiting the expression and inco ⁇ oration of enzymes, structural proteins, membrane channels, and receptors in neurons and glial cells.
  • the etiology of these deficiencies or disorders may be genetic, somatic (such as cancer or some autoimmune disorder), acquired (e.g., by chemotherapy or toxins), or infectious.
  • a polynucleotide or polypeptide of the present invention can be used as a marker or detector of a particular nervous system disease or disorder.
  • the disorder or disease can be any of Alzheimer's disease, Pick's disease, Binswanger's disease, other senile dementia, Parkinson's disease, parkinsonism, obsessive compulsive disorders, epilepsy, encephaolopathy, ischemia, alcohol addiction, drug addiction, schizophrenia, amyotrophic lateral sclerosis, multiple sclerosis, depression, and bipolar manic-depressive disorder.
  • the polypeptide or polynucleotide of the present invention can be used to study circadian variation, aging, or long-term potentiation, the latter affecting the hippocampus. Additionally, particularly with reference to mRNA species occurring in particular structures within the central nervous system, the polypeptide or polynucleotide of the present invention can be used to study brain regions that are known to be involved in complex behaviors, such as learning and memory, emotion, drug addiction, glutamate neurotoxicity, feeding behavior, olfaction, viral infection, vision, and movement disorders.
  • a polypeptide or polynucleotide of the present invention may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
  • Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
  • the etiology of these immune deficiencies or disorders may be genetic, somatic (such as cancer or some autoimmune disorders) acquired (e.g., by chemotherapy or toxins), or infectious.
  • a polynucleotide or polypeptide of the present invention can be used as a marker or detector of a particular immune system disease or disorder.
  • a polynucleotide or polypeptide of the present invention may be useful in treating or detecting deficiencies or disorders of hematopoietic cells.
  • a polypeptide or polynucleotide of the present invention could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells.
  • immuno logic deficiency syndromes include, but are not limited to: blood protein disorders (e.g.
  • agammaglobulinemia dysgammaglobulinemia
  • ataxia telangiectasia common variable immunodeficiency
  • Di George's Syndrome HIV infection
  • HTLV-BLV infection leukocyte adhesion deficiency syndrome
  • lymphopenia phagocyte bactericidal dysfunction
  • severe combined immunodeficiency SCIDs
  • Wiskott- Aldrich Disorder anemia, thrombocytopenia, or hemoglobinuria.
  • a polypeptide or polynucleotide of the present invention could also be used to modulate hemostatic (bleeding cessation) or thrombolytic activity (clot formation).
  • a polynucleotide or polypeptide of the present invention could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
  • blood coagulation disorders e.g., afibrinogenemia, factor deficiencies
  • blood platelet disorders e.g. thrombocytopenia
  • wounds resulting from trauma, surgery, or other causes e.g., a polynucleotide or polypeptide of the present invention that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment of heart attacks (infarction), strokes, or scarring.
  • a polynucleotide or polypeptide of the present invention may also be useful in the treatment or detection of autoimmune disorders.
  • Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destruction of the host tissue. Therefore, the administration of a polypeptide or polynucleotide of the present invention that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells or in some way results in the induction of tolerance, may be an effective therapy in preventing autoimmune disorders.
  • autoimmune disorders examples include, but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus,
  • allergic reactions and conditions such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated by a polypeptide or polynucleotide of the present invention.
  • these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
  • a polynucleotide or polypeptide of the present invention may also be used to treat and/or prevent organ rejection or graft-versus-host disease (GVHD).
  • Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response.
  • an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
  • the administration of a polypeptide or polynucleotide of the present invention that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD.
  • a polypeptide or polynucleotide of the present invention may also be used to modulate inflammation.
  • the polypeptide or polynucleotide may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
  • These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
  • SIRS systemic inflammatory response syndrome
  • a polypeptide or polynucleotide can be used to treat or detect hype ⁇ roliferative disorders, including neoplasms.
  • a polypeptide or polynucleotide of the present invention may inhibit the proliferation of the disorder through direct or indirect interactions.
  • a polypeptide or polynucleotide of the present invention may proliferate other cells which can inhibit the hype ⁇ roliferative disorder.
  • hype ⁇ roliferative disorders can be treated.
  • This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • decreasing an immune response may also be a method of treating hype ⁇ roliferative disorders, such as by administering the polypeptide or polynucleotide as a chemotherapeutic agent.
  • Examples of hype ⁇ roliferative disorders that can be treated or detected by a polynucleotide or polypeptide of the present invention include, but are not limited to neoplasms located in the abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvic region, skin, soft tissue, spleen, thoracic region, and urogenital system.
  • neoplasms located in the abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous system (central and peripheral), lymphatic system, pelvic region, skin, soft tissue, spleen, thoracic region
  • hype ⁇ roliferative disorders can also be treated or detected by a polynucleotide or polypeptide of the present invention.
  • hype ⁇ roliferative disorders include, but are not limited to hypergammaglobulinemia, lymphoprohferative disorders, paraproteinemias, pu ⁇ ura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hype ⁇ roliferative disease, besides neoplasia, located in an organ system listed above.
  • a polypeptide or polynucleotide of the present invention can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated.
  • the immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • the polypeptide or polynucleotide of the present invention may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • treatment of patients with a polypeptide or polynucleotide of the present invention could act as a vaccine to trigger a more efficient immune response through modulation of microlia, macrophages, and T cells, altering the course of disease.
  • viruses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by a polynucleotide or polypeptide of the present invention.
  • viruses include, but are not limited to, the following DNA and RNA viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Flaviviridae, Hepadnaviridae (Hepatitis), He ⁇ esviridae (such as Cytomegalovirus, He ⁇ es Simplex, He ⁇ es Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbilhvirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza), Papovaviridae, Parvoviridae, Picornaviridae, Poxviridae (such as Smallpox or Vaccin
  • Viruses falling within these families can cause a variety of diseases or symptoms, including, but not limited to, arthritis, bronchiollitis, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), meningitis, opportunistic infections (e.g., AEDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemonhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
  • a polypeptide or polynucleotide of the present invention can be used to treat or detect any of these symptoms or diseases.
  • Pasteurellacea infections e.g., Actinobacillus, Heamophilus, Pasteurella
  • Pseudomonas Rickettsiaceae
  • Chlamydiaceae Chlamydiaceae
  • Syphilis Staphylococcus
  • bacteremia e.g., endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections (such as whooping Cough or empyema), sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gononhea, meningitis, Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually-transmitted diseases, skin diseases (e.g., cellu
  • parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide of the present invention include, but are not limited to, the following families: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas.
  • These parasites can cause a variety of diseases or symptoms, including, but not limited to, Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., AIDS related), Malaria, pregnancy complications, and toxoplasmosis.
  • a polypeptide or polynucleotide of the present invention can be used to treat or detect any of these symptoms or diseases.
  • treatment using a polypeptide or polynucleotide of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy).
  • the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
  • a polynucleotide or polypeptide of the present invention can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues (see, Science, 276:59-87 (1997)).
  • the regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery (including cosmetic plastic surgery), fibrosis, reperfusion injury, or systemic cytokine damage.
  • Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vascular (including vascular endothelium), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, ligament) tissue.
  • organs e.g., pancreas, liver, intestine, kidney, skin, endothelium
  • muscle smooth, skeletal or cardiac
  • vascular including vascular endothelium
  • nervous hematopoietic
  • skeletal bone, cartilage, tendon, ligament
  • Regeneration also may include angiogenesis.
  • angiogenesis In the case of multiple sclerosis, stroke, trauma, and neurodegeneration, the recunent inflammation associated with ongoing cell death triggers chronic degeneration and regeneration of the nervous system that never resolves, leading to the formation of scar tissue as part of the wound healing process.
  • Scar tissue replaces normal cell populations, thus preventing
  • a polynucleotide or polypeptide of the present invention may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage.
  • a polynucleotide or polypeptide of the present invention could also be used prophylactically in an effort to avoid damage.
  • Specific diseases that could be treated include of tendinitis, ca ⁇ al tunnel syndrome, and other tendon or ligament defects.
  • tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds. In multiple sclerosis, stroke, trauma, and neurodegeneration of the brain, ongoing inflammatory responses may reflect defective healing of the tissue.
  • Polynucleotides and polypeptides of the present invention could be used to treat such disorders by boosting the capacity of the epithelium to heal.
  • nerve and brain tissue could also be regenerated by using a polynucleotide or polypeptide of the present invention to proliferate and differentiate nerve cells.
  • Diseases that could be treated using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic disorders (e.g., spinal cord disorders, head trauma, cerebro vascular disease, and stroke).
  • diseases associated with peripheral nerve injuries, peripheral neuropathy (e.g., resulting from chemotherapy or other medical therapies), localized neuropathies, and central nervous system diseases e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome
  • Alzheimer's disease Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome
  • a polynucleotide or polypeptide of the present invention may have chemotaxis activity.
  • a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hype ⁇ roliferation.
  • the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
  • a polynucleotide or polypeptide of the present invention may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hype ⁇ roliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat wounds.
  • a polynucleotide or polypeptide of the present invention may inhibit chemotactic activity. Such molecules could also be used to treat a variety of disorders. Thus, a polynucleotide or polypeptide of the present invention could be used as an inhibitor of chemotaxis. In multiple sclerosis, stroke, trauma, and neurodegeneration of the brain, the most dramatic sign of pathology is the chemotactic recruitment of microglia, macrophages and Tcells. Polynucleotides and polypeptides of the present invention can be used to either inhibit the recruitment of cells driving the pathology or induce the recruitment of cells able to protect the tissue from damage.
  • a polypeptide of the present invention may be used to screen for molecules that bind to the polypeptide or for molecules to which the polypeptide binds.
  • the binding of the polypeptide and the molecule may activate (i.e., an agonist), increase, inhibit (i.e., an antagonist), or decrease activity of the polypeptide or the molecule bound.
  • Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors), or small molecules.
  • the molecule is closely related to the natural ligand of the polypeptide, e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic (see, Coligan et al., Current Protocols in Immunology 1(2), Chapter 5 (1991)).
  • the molecule can be closely related to the natural receptor to which the polypeptide binds or, at least, related to a fragment of the receptor capable of being bound by the polypeptide (e.g., an active site). In either case, the molecule can be rationally designed using known techniques.
  • the screening for these molecules involves producing appropriate cells which express the polypeptide, either as a secreted protein or on the cell membrane.
  • Prefened cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing the polypeptide (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either the polypeptide or the molecule.
  • the assay may simply test binding of a candidate compound to the polypeptide, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to the polypeptide.
  • the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
  • the assay may also simply comprise the steps of mixing a candidate compound with a solution containing a polypeptide, measuring polypeptide/molecule activity or binding, and comparing the polypeptide/molecule activity or binding to a standard.
  • an ⁇ LISA assay can measure polypeptide level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
  • the antibody can measure polypeptide level or activity by either binding, directly or indirectly, to the polypeptide or by competing with the polypeptide for a substrate. All of these above assays can be used as diagnostic or prognostic markers.
  • the molecules discovered using these assays can be used to treat disease or to bring about a particular result in a patient (e.g., blood vessel growth) by activating or inhibiting the polypeptide/molecule.
  • the assays can discover agents which may inhibit or enhance the production of the polypeptide from suitably manipulated cells or tissues. At present, early diagnosis of multiple sclerosis and neurodegenerative diseases of the brain depends upon a number of relatively invasive and expensive clinical tests. Assays for the presence of markers, in easily obtained specimens (blood, urine, or stool) can provide an important diagnostic tool.
  • the invention includes a method of identifying compounds which bind to a polypeptide of the invention comprising the steps of: (a) incubating a candidate binding compound with a polypeptide of the invention; and (b) determining if binding has occuned.
  • the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with a polypeptide of the invention, (b) assaying a biological activity, and (c) determining if a biological activity of the polypeptide has been altered.
  • a polypeptide or polynucleotide of the present invention may also increase or decrease the differentiation or proliferation of embryonic stem cells from a lineage other than the above-described hemopoietic lineage.
  • embryonic stem cells from a lineage other than the above-described hemopoietic lineage.
  • diseases of the brain including but not limited to, multiple sclerosis, stroke, trauma, and neurodegenerative disease, cells of the brain die or are destroyed.
  • the identified molecules can be used to promote the differentiation and proliferation of stem cells to promote healing.
  • a polypeptide or polynucleotide of the present invention may also be used to modulate mammalian characteristics, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, and shape (e.g., cosmetic surgery).
  • a polypeptide or polynucleotide of the present invention may be used to modulate mammalian metabolism affecting catabolism, anabolism, processing, utilization, and storage of energy.
  • a polypeptide or polynucleotide of the present invention may be used to change a mammal's mental state or physical state by influencing biorhythms, circadian rhythms, depression (including depressive disorders), tendency for violence, tolerance for pain, the response to opiates and opioids, tolerance to opiates and opioids, withdrawal from opiates and opioids, reproductive capabilities (preferably by activin or inhibin-like activity), hormonal or endocrine levels, appetite, libido, memory, stress, or other cognitive qualities.
  • a polypeptide or polynucleotide of the present invention may also be used as a food additive or preservative, such as to increase or decrease storage capabilities, fat content, lipid, protein, carbohydrate, vitamins, minerals, cofactors, or other nutritional components.
  • a polynucleotide of the invention is down-regulated and exacerbates a pathological condition, such as a neurodegenerative condition
  • the expression of the polynucleotide can be increased or the level of the intact polypeptide product can be increased in order to treat, prevent, ameliorate, or modulate the pathological condition. This can be accomplished by, for example, administering a polynucleotide or polypeptide of the invention to the mammalian subject.
  • a polynucleotide of the invention can be administered to a mammalian subject by a recombinant expression vector comprising the polynucleotide.
  • a mammalian subject can be a human, baboon, chimpanzee, macaque, cow, horse, sheep, pig, horse, dog, cat, rabbit, guinea pig, rat or mouse.
  • the recombinant vector comprises a polynucleotide shown in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 or a polynucleotide which is at least 98% identical to a nucleic acid sequence shown in SEQ ED NOs: 1-64, 106, 170- 182, 184, and 186-188.
  • the recombinant vector comprises a variant polynucleotide that is at least 80%, 90%, or 95%> identical to a polynucleotide comprising SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • a polynucleotide or recombinant expression vector of the invention can be used to express a polynucleotide in said subject for the treatment of, for example, a neurodegenrative disease.
  • Expression of a polynucleotide in target cells including but not limited to microglia or macrophage cells, would effect greater production of the encoded polypeptide.
  • the regulation of other genes may be secondarily up- or down-regulated.
  • a naked polynucleotide can be administered to target cells.
  • Polynucleotides and recombinant expression vectors of the invention can be administered as a pharmaceutical composition.
  • Such a composition comprises an effective amount of a polynucleotide or recombinant expression vector, and a pharmaceutically acceptable formulation agent selected for suitability with the mode of administration.
  • Suitable formulation materials preferably are non-toxic to recipients at the concentrations employed and can modify, maintain, or preserve, for example, the pH, osmolarity, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adso ⁇ tion, or penetration of the composition. See Remington 's Pharmaceutical Sciences (18 th Ed., A.R. Gennaro, ed., Mack Publishing Company 1990).
  • the pharmaceutically active compounds i.e., a polynucleotide or a vector
  • the pharmaceutical composition comprising a polynucleotide or a recombinant expression vector may be made up in a solid form (including granules, powders or suppositories) or in a liquid form (e.g., solutions, suspensions, or emulsions).
  • the dosage regimen for treating a disease with a composition comprising a polynucleotide or expression vector is based on a variety of factors, including the type or severity of the neurodegenrative condition, the age, weight, sex, medical condition of the patient, the route of administration, and the particular compound employed. Thus, the dosage regimen may vary widely, but can be determined routinely using standard methods. A typical dosage may range from about 0.1 mg/kg to about 100 mg/kg or more, depending on the factors mentioned above. The frequency of dosing will depend upon the pharmacokinetic parameters of the polynucleotide or vector in the formulation being used. Typically, a clinician will administer the composition until a dosage is reached that achieves the desired effect.
  • composition may therefore be administered as a single dose, as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via implantation device or catheter. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. Appropriate dosages may be ascertained through use of appropriate dose-response data.
  • the cells of a mammalian subject may be transfected in vivo, ex vivo, or in vitro.
  • Administration of a polynucleotide or a recombinant vector containing a polynucleotide to a target cell in vivo may be accomplished using any of a variety of techniques well known to those skilled in the art.
  • U.S. Patent No. 5,672,344 describes an in vivo viral-mediated gene transfer system involving a recombinant neuro trophic HSV-1 vector.
  • compositions of polynucleotides and recombinant vectors can be transfected in vivo by oral, buccal, parenteral, rectal, or topical administration as well as by inhalation spray.
  • parenteral as used herein includes, subcutaneous, intravenous, intramuscular, intrastemal, infusion techniques or intraperitoneally.
  • nucleic acids and/or vectors of the invention can be administered as the sole active pharmaceutical agent, they can also be used in combination with one or more vectors of the invention or other agents.
  • the therapeutic agents can be formulated as separate compositions that are given at the same time or different times, or the therapeutic agents can be given as a single composition.
  • Another delivery system for polynucleotides of the invention is a "non- viral" delivery system.
  • Techniques that have been used or proposed for gene therapy include DNA-ligand complexes, adenovirus-ligand-DNA complexes, direct injection of DNA, CaPO 4 precipitation, gene gun techniques, electroporation, lipofection, and colloidal dispersion (Mulligan, R., (1993) Science, 260 (5110):926-32). Any of these methods are widely available to one skilled in the art and would be suitable for use in the present invention. Other suitable methods are available to one skilled in the art, and it is to be understood that the present invention may be accomplished using any of the available methods of transfection. Several such methodologies have been utilized by those skilled in the art with varying success (Mulligan, R., (1993) Science, 260 (5110):926-32).
  • a polynucleotide of the invention is up-regulated and exacerbates a pathological condition in a mammalian subject, such as a neurodegenerative condition
  • the expression of the polynucleotide can be blocked or reduced or the level of the intact polypeptide product can be reduced in order to treat, prevent, ameliorate, or modulate the pathological condition.
  • This can be accomplished by, for example, the use of antisense oligonucleotides or ribozymes.
  • drugs or antibodies that bind to and inactivate the polypeptide product can be used.
  • Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12, 15, 20, 25, 30, 35, 40, 45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of gene products of the invention in the cell.
  • Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5' end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester intemucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters.
  • Modifications of gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of a gene of the invention. Oligonucleotides derived from the transcription initiation site, e.g., between positions -10 and +10 from the start site, are prefened. Similarly, inhibition can be achieved using "triple helix" base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.
  • An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.
  • Antisense oligonucleotides which comprise, for example, 2, 3, 4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to a polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent nucleotides, can provide sufficient targeting specificity for mRNA.
  • each stretch of complementary contiguous nucleotides is at least 4, 5, 6, 7, or 8 or more nucleotides in length.
  • Non-complementary intervening sequences are preferably 1, 2, 3, or 4 nucleotides in length.
  • One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular polynucleotide sequence.
  • Antisense oligonucleotides can be modified without affecting their ability to hybridize to a polynucleotide of the invention. These modifications can be internal or at one or both ends of the antisense molecule.
  • internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose.
  • Modified bases and/or sugars such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3' hydroxyl group or the 5' phosphate group are substituted, also can be employed in a modified antisense oligonucleotide.
  • modified oligonucleotides can be prepared by methods well known in the art. See, e.g., Agrawal et al., (1992) Trends Biotechnol, 10:152-158; Uhlmann et al., (1990) Chem. Rev., 90:543-584; Uhlmann et al., (1987) Tetrahedron. Lett., 215:3539-3542.
  • Ribozymes are RNA molecules with catalytic activity. See, e.g., Cech, (1987) Science, 236:1532-1539; Cech, (1990) Ann. Rev. Biochem., 59:543-568; Cech, (1992) Curr. Opin. Struct.
  • Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e.g., Haseloff et al., U.S. Patent 5,641,673).
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.
  • the coding sequence of a polynucleotide of the invention can be used to generate ribozymes which will specifically bind to mRNA transcribed from the polynucleotide.
  • Methods of designing and constructing ribozymes which can cleave RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. (1988) Nature, 334:585-591).
  • the cleavage activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization" region into the ribozyme.
  • the hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, e.g., Gerlach et al., EP 321,201).
  • Specific ribozyme cleavage sites within a RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides conesponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays.
  • nucleotide sequences shown in SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 and their complements provide sources of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target.
  • the hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.
  • Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease polynucleotide expression. Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art.
  • a ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.
  • ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.
  • Pathological conditions or susceptibility to pathological conditions can be diagnosed using methods of the invention.
  • Testing for expression of a polynucleotide of the invention or for the presence of the polynucleotide product can conelate with the severity of the condition and can also indicate appropriate treatment.
  • the presence or absence of a mutation in a polynucleotide of the invention can be determined and a pathological condition or a susceptibility to a pathological condition is diagnosed based on the presence or absence of the mutation.
  • an alteration in expression of a polypeptide encoded by a polynucleotide of the invention can be detected, where the presence of an alteration in expression of the polypeptide is indicative of the pathological condition or susceptibility to the pathological condition.
  • the alteration in expression can be an increase in the amount of expression or a decrease in the amount of expression.
  • a suitable control source can be obtained from one or more mammalian subjects that do not have the pathological condition.
  • the average concentrations and distribution of a polynucleotide or polypeptide of the invention can be determined from biological samples taken from a representative population of mammalian subjects, wherein the mammalian subjects are the same species as the subject from which the test sample was obtained.
  • the amount of at least one polypeptide encoded by a polynucleotide of the invention is determined in the first and second sample.
  • the amounts of the polypeptide in the first and second samples are compared.
  • a patient is diagnosed as having a pathological condition if the amount of the polypeptide in the first sample is greater than or less than the amount of the polypeptide in the second sample.
  • the amount of polypeptide in the first sample falls in the range of samples taken from a representative group of patients with the pathological condition.
  • nucleic acid molecule comprising a nucleotide sequence which is at least 80%, preferably at least 85%), more preferably at least 90%, most preferably at least 95% identical to a sequence of at least about 50 contiguous nucleotides in the nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • nucleic acid molecule wherein said sequence of contiguous nucleotides is included in the nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 in the range of positions beginning with the nucleotide at about the position of the 5' nucleotide of the clone sequence and ending with the nucleotide at about the position of the 3' nucleotide of the clone sequence.
  • nucleic acid molecule wherein said sequence of contiguous nucleotides is included in the nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188 in the range of positions beginning with the nucleotide at about the position of the 5' nucleotide of the start codon and ending with the nucleotide at about the position of the 3' nucleotide of the clone sequence as defined for SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188.
  • nucleic acid molecule wherein said sequence of contiguous nucleotides is included in the nucleotide sequence of SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188 in the range of positions beginning with the nucleotide at about the position of the 5' nucleotide of the first amino acid of the signal peptide and ending with the nucleotide at about the position of the 3' nucleotide of the clone sequence as defined for SEQ ID NOS: 1-64, 106, 170-182, 184, and 186-188.
  • nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least about 150 contiguous nucleotides in the nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186- 188.
  • nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least about 500 contiguous nucleotides in the nucleotide sequence of SEQ ID NOs: 1 -64, 106, 170-182, 184, and 186- 188.
  • a further prefened embodiment is a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the nucleotide sequence of SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188 beginning with the nucleotide at about the position of the 5' nucleotide of the first amino acid of the signal peptide and ending with the nucleotide at about the position of the 3' nucleotide of the clone sequence as defined for SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • a further prefened embodiment is an isolated nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the complete nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188. Also prefened is an isolated nucleic acid molecule which hybridizes under stringent hybridization conditions to a nucleic acid molecule, wherein said nucleic acid molecule which hybridizes does not hybridize under stringent hybridization conditions to a nucleic acid molecule having a nucleotide sequence consisting of only A residues or of only T residues.
  • a further prefened embodiment is a method for detecting in a biological sample a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of a nucleotide sequence of SEQ XD NOs: 1-64, 106, 170-182, 184, and 186- 188, which method comprises a step of comparing a nucleotide sequence of at least one nucleic acid molecule in said sample with a sequence selected from said group and determining whether the sequence of said nucleic acid molecule in said sample is at least 95% identical to said selected sequence.
  • step of comparing sequences comprises determining the extent of nucleic acid hybridization between nucleic acid molecules in said sample and a nucleic acid molecule comprising said sequence selected from said group.
  • step of comparing sequences is performed by comparing the nucleotide sequence determined from a nucleic acid molecule in said sample with said sequence selected from said group.
  • the nucleic acid molecules can comprise DNA molecules or RNA molecules.
  • a further prefened embodiment is a method for identifying the species, tissue or cell type of a biological sample, which method comprises a step of detecting nucleic acid molecules in said sample, if any, comprising a nucleotide sequence that is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of a nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • Also prefened is a method for diagnosing in a subject a pathological condition associated with abnormal structure or expression of a gene, which method comprises a step of detecting in a biological sample obtained from said subject nucleic acid molecules, if any, comprising a nucleotide sequence that is at least 95%> identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of a nucleotide sequence of SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the method for diagnosing a pathological condition can comprise a step of detecting nucleic acid molecules comprising a nucleotide sequence in a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is at least 95 % identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from said group.
  • composition of matter comprising isolated nucleic acid molecules wherein the nucleotide sequences of said nucleic acid molecules comprise a panel of at least two nucleotide sequences, wherein at least one sequence in said panel is at least 95% identical to a sequence of at least 50 contiguous nucleotides in a sequence selected from the group consisting of a nucleotide sequence of SEQ XD NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the nucleic acid molecules can comprise DNA molecules or RNA molecules.
  • an isolated polypeptide comprising an amino acid sequence at least 90% > identical to a sequence of at least about 10 contiguous amino acids in an amino acid sequence translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • polypeptide wherein said sequence of contiguous amino acids is included in amino acids in an amino acid sequence translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188, in the range of positions beginning with the residue at about the position of the first amino acid of the secreted portion and ending with the residue at about the last amino acid of the open reading frame.
  • an isolated polypeptide comprising an amino acid sequence at least 95%> identical to a sequence of at least about 30 contiguous amino acids in an amino acid sequence translated from SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188.
  • an isolated polypeptide comprising an amino acid sequence at least 95%o identical to a sequence of at least about 100 contiguous amino acids in an amino acid sequence translated from SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188.
  • an isolated polypeptide comprising an amino acid sequence at least 95 %> identical to amino acids in an amino acid sequence translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • a method for detecting in a biological sample a polypeptide comprising an amino acid sequence which is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of amino acid sequences translated from SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188, which method comprises a step of comparing an amino acid sequence of at least one polypeptide molecule in said sample with a sequence selected from said group and determining whether the sequence of said polypeptide molecule in said sample is at least 90% identical to said sequence of at least 10 contiguous amino acids.
  • step of comparing an amino acid sequence of at least one polypeptide molecule in said sample with a sequence selected from said group comprises determining the extent of specific binding of polypeptides in said sample to an antibody which binds specifically to a polypeptide comprising an amino acid sequence that is at least 90%> identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of amino acid sequences translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • step of comparing sequences is performed by comparing the amino acid sequence determined from a polypeptide molecule in said sample with said sequence selected from said group.
  • Also prefened is a method for identifying the species, tissue or cell type of a biological sample which method comprises a step of detecting polypeptide molecules in said sample, if any, comprising an amino acid sequence that is at least 90%> identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of amino acid sequences translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • Also prefened is a method for diagnosing in a subject a pathological condition associated with abnormal structure or expression of a gene, which method comprises a step of detecting in a biological sample obtained from said subject polypeptide molecules comprising an amino acid sequence in a panel of at least two amino acid sequences, wherein at least one sequence in said panel is at least 90% identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of amino acid sequences translated from SEQ ID NOs: 1-64, 106, 170-182, 184, and 186-188.
  • the step of detecting said polypeptide molecules includes using an antibody.
  • nucleic acid molecule comprising a nucleotide sequence which is at least 95%> identical to a nucleotide sequence encoding a polypeptide wherein said polypeptide comprises an amino acid sequence that is at least 90%> identical to a sequence of at least 10 contiguous amino acids in a sequence selected from the group consisting of amino acid sequences translated from SEQ ED NOs: 1-64, 106, 170-182, 184, and 186-188.
  • nucleic acid molecule wherein said nucleotide sequence encoding a polypeptide has been optimized for expression of said polypeptide in a prokaryotic host.
  • nucleic acid molecule encodes a polypeptide comprising an amino acid sequence selected from the group consisting of amino acid sequences translated from SEQ ID NOs: 1-64, 106, 170- 182, 184, and 186-188.
  • prefened is a method of making a recombinant vector comprising inserting any of the above isolated nucleic acid molecule into a vector. Also prefened is the recombinant vector produced by this method. Also prefened is a method of making a recombinant host cell comprising introducing the vector into a host cell, as well as the recombinant host cell produced by this method.
  • Also prefened is a method of making an isolated polypeptide comprising culturing this recombinant host cell under conditions such that said polypeptide is expressed and recovering said polypeptide. Also prefened is this method of making an isolated polypeptide, wherein said recombinant host cell is a eukaryotic cell and said polypeptide is a secreted portion of a human secreted protein comprising an amino acid sequence selected from the group consisting of amino acid sequences translated from SEQ JD NOs: 1-64, 106, 170-182, 184, and 186-188. The isolated polypeptide produced by this method is also prefened.
  • Also prefened is a method of treatment of an individual in need of an increased level of a secreted protein activity, which method comprises administering to such an individual a pharmaceutical composition comprising an amount of an isolated polypeptide, polynucleotide, or antibody of the claimed invention effective to increase the level of said protein activity in said individual.
  • the present invention also includes a diagnostic system, preferably in kit form, for assaying for the presence of the polypeptide of the present invention in a body sample, such as brain tissue, cell suspensions or tissue sections; or a body fluid sample, such as CSF, blood, plasma or serum, where it is desirable to detect the presence, and preferably the amount, of the polypeptide of this invention in the sample according to the diagnostic methods described herein.
  • a body sample such as brain tissue, cell suspensions or tissue sections
  • a body fluid sample such as CSF, blood, plasma or serum
  • a nucleic acid molecule can be used as a probe (i.e., an oligonucleotide) to detect the presence of a polynucleotide of the present invention, a gene conesponding to a polynucleotide of the present invention, or a mRNA in a cell that is diagnostic for the presence or expression of a polypeptide of the present invention in the cell.
  • the nucleic acid molecule probes can be of a variety of lengths from at least about 10, suitably about 10 to about 5000 nucleotides long, although they will typically be about 20 to 500 nucleotides in length. Hybridization methods are extremely well known in the art and will not be described further here.
  • PCR primers are utilized in pairs, as is well known, based on the nucleotide sequence of the gene to be detected.
  • the nucleotide sequence is a portion of the nucleotide sequence of a polynucleotide of the present invention.
  • Particularly prefened PCR primers can be derived from any portion of a DNA sequence encoding a polypeptide of the present invention, but are preferentially from regions which are not conserved in other cellular proteins.
  • PCR primer pairs useful for detecting the genes conesponding to the polynucleotides of the present invention and expression of these genes are described in the Examples, including the conesponding Tables. Nucleotide primers from the conesponding region of the polypeptides of the present invention described herein are readily prepared and used as PCR primers for detection of the presence or expression of the conesponding gene in any of a variety of tissues.
  • the diagnostic system includes, in an amount sufficient to perform at least one assay, a subject polypeptide of the present invention, a subject antibody or monoclonal antibody, and/or a subject nucleic acid molecule probe of the present invention, as a separately packaged reagent.
  • a diagnostic system preferably in kit form, is contemplated for assaying for the presence of the polypeptide of the present invention or an antibody immunoreactive with the polypeptide of the present invention in a body fluid sample.
  • Such diagnostic kit would be useful for monitoring the fate of a therapeutically administered polypeptide of the present invention or an antibody immunoreactive with the polypeptide of the present invention.
  • the system includes, in an amount sufficient for at least one assay, a polypeptide of the present invention and/or a subject antibody as a separately packaged immunochemical reagent.
  • a package refers to a solid matrix or material such as glass, plastic (e.g., polyethylene, polypropylene, or polycarbonate), paper, foil and the like capable of holding within fixed limits a polypeptide, polyclonal antibody, or monoclonal antibody of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated polypeptide or antibody or it can be a microtiter plate well to which microgram quantities of a contemplated polypeptide or antibody have been operatively affixed (i.e., linked) so as to be capable of being immunologically bound by an antibody or antigen, respectively.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/ sample admixtures, temperature, buffer conditions, and the like.
  • a diagnostic system of the present invention preferably also includes a label or indicating means capable of signaling the formation of an immunocomplex containing a polypeptide or antibody molecule of the present invention.
  • complex refers to the product of a specific binding reaction such as an antibody-antigen or receptor-ligand reaction.
  • exemplary complexes are immunoreaction products.
  • label and "indicating means” in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal to indicate the presence of a complex. Any label or indicating means can be linked to or inco ⁇ orated in an expressed protein, polypeptide, or antibody molecule that is part of an antibody or monoclonal antibody composition of the present invention or used separately, and those atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well- known in clinical diagnostic chemistry and constitute a part of this invention only insofar as they are utilized with otherwise novel proteins methods and/or systems.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturing them to form a fluorochrome (dye) that is a useful immuno fluorescent tracer.
  • Suitable fluorescent labeling agents are fluorochromes such as fluorescein isocyanate (FIC), fluorescein isothiocyanate (FITC), 5-dimethylamine- 1-naphthalenesulfonyl chloride (DANSC), tetramethylrhodamine isothiocyanate (TRITC), lissamine, rhodamine 8200 sulphonyl chloride (RB 200 SC) and the like.
  • fluorochromes such as fluorescein isocyanate (FIC), fluorescein isothiocyanate (FITC), 5-dimethylamine- 1-naphthalenesulfonyl chloride (DANSC), tetramethylrhodamine isothiocyanate (TRITC), liss
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP), glucose oxidase, or the like.
  • HRP horseradish peroxidase
  • glucose oxidase or the like.
  • additional reagents are required to visualize the fact that a receptor-ligand complex (immunoreactant) has formed.
  • additional reagents for HRP include hydrogen peroxide and an oxidation dye precursor such as diaminobenzidine.
  • An additional reagent useful with glucose oxidase is 2,2'-amino-di-(3-ethyl-benzthiazoline-G-sulfonic acid) (ABTS).
  • Radioactive elements are also useful labeling agents and are used illustratively herein.
  • An exemplary radiolabeling agent is a radioactive element that produces gamma ray emissions. Elements which themselves emit gamma rays, such as 124 I, 125 I, 128 I, 132 I and 51 Cr represent one class of gamma ray emission-producing radioactive element indicating groups. Particularly prefened is 125 I.
  • Another group of useful labeling means are those elements such as ' 'C, l8 F, 15 O and 13 N which themselves emit positrons. The positrons so emitted produce gamma rays upon encounters with electrons present in the animal's body.
  • beta emitter such ' "indium or 3 H.
  • the linking of labels or labeling of polypeptides and proteins is well known in the art.
  • antibody molecules produced by a hybridoma can be labeled by metabolic inco ⁇ oration of radioisotope-containing amino acids provided as a component in the culture medium (see, e.g., Galfre et al., Meth. Enzymol, 73:3-46 (1981)).
  • the techniques of protein conjugation or coupling through activated functional groups are particularly applicable (see, e.g., Aurameas, et al., Scand. J. Immunol, Vol. 8 Suppl. 7:7- 23 (1978); Rodwell et al., Biotech., 3:889-894 (1984); and U.S. Patent No. 4,493,795).
  • the diagnostic systems can also include, preferably as a separate package, a specific binding agent.
  • a "specific binding agent” is a molecular entity capable of selectively binding a reagent species of the present invention or a complex containing such a species, but is not itself a polypeptide or antibody molecule composition of the present invention.
  • Exemplary specific binding agents are second antibody molecules, complement proteins or fragments thereof, S. aureus protein A, and the like.
  • the specific binding agent binds the reagent species when that species is present as part of a complex.
  • the specific binding agent is labeled.
  • the agent is typically used as an amplifying means or reagent.
  • the labeled specific binding agent is capable of specifically binding the amplifying means when the amplifying means is bound to a reagent species-containing complex.
  • the diagnostic kits of the present invention can be used in an "ELISA" format to detect the quantity of the polypeptide of the present invention in a sample.
  • ELISA refers to an enzyme-linked immunosorbent assay that employs an antibody or antigen bound to a solid phase and an enzyme-antigen or enzyme-antibody conjugate to detect and quantify the amount of an antigen present in a sample.
  • a description of the ELISA technique is found in Sites et al., Basic and Clinical Immunology, 4' Ed., Chap. 22, Lange Medical Publications, Los Altos, CA (1982) and in U.S. Patent No. 3,654,090; U.S. Patent No. 3,850,752; and U.S. Patent No.
  • a polypeptide of the present invention an antibody or a monoclonal antibody of the present invention can be affixed to a solid matrix to form a solid support that comprises a package in the subject diagnostic systems.
  • a reagent is typically affixed to a solid matrix by adso ⁇ tion from an aqueous medium, although other modes of affixation applicable to proteins and polypeptides can be used that are well known to those skilled in the art. Exemplary adso ⁇ tion methods are described herein.
  • Useful solid matrices are also well known in the art. Such materials are water insoluble and include the cross-linked dextran available under the trademark SEPHADEX from Pharmacia Fine Chemicals (Piscataway, NJ), agarose, polystyrene beads of about 1 micron ( ⁇ m) to about 5 millimeters (mm) in diameter available from several suppliers (e.g., Abbott Laboratories, Chicago, IL), polyvinyl chloride, polystyrene, cross-linked polyacrylamide, nitrocellulose- or nylon-based webs (sheets, strips or paddles) or tubes, plates or the wells of a microtiter plate, such as those made from polystyrene or polyvinylchloride.
  • SEPHADEX cross-linked dextran available under the trademark SEPHADEX from Pharmacia Fine Chemicals (Piscataway, NJ)
  • agarose agarose
  • polystyrene beads of about 1 micron ( ⁇ m) to about 5 millimeters (mm) in diameter available
  • the reagent species, labeled specific binding agent, or amplifying reagent of any diagnostic system described herein can be provided in solution, as a liquid dispersion or as a substantially dry power, e.g., in lyophilized form.
  • the indicating means is an enzyme
  • the enzyme's substrate can also be provided in a separate package of a system.
  • a solid support such as the before-described microtiter plate and one or more buffers can also be included as separately packaged elements in this diagnostic assay system.
  • packaging materials discussed herein in relation to diagnostic systems are those customarily utilized in diagnostic systems.
  • microglial subtypes may arise from the differentiation of cells from a common precursor pool that is possibly indistinguishable from that giving rise to the macrophage/dendritic cells
  • the roles played by differentiated microglia in normal neural physiology and neuropathology are determined in part by the ensembles of proteins that are expressed after differentiation.
  • the studies were designed to identify and determine the microglial and macrophage transcripts that are regulated by an inflammatory response.
  • the TOGA (Total Gene Analysis) method was used to identify digital sequence tags (DSTs) conesponding to mRNAs which concentrations differ between macrophage and microglia or that are induced in microglia by lipopolysaccharide (LPS) and gamma- interferon (IFN ⁇ ), two substances that initiate inflammatory responses when introduced into the CNS, and which elicit the induction of markers of inflammation when applied to microglial cells in culture.
  • DSTs digital sequence tags conesponding to mRNAs which concentrations differ between macrophage and microglia or that are induced in microglia by lipopolysaccharide (LPS) and gamma- interferon (IFN ⁇ ), two substances that initiate inflammatory responses when introduced into the CNS, and which elicit the induction of markers of inflammation when applied to microglial cells in culture.
  • LPS lipopolysaccharide
  • IFN ⁇ gamma- interferon
  • Microglia were isolated from mixed glial cultures prepared from the brains of neonatal C57B1/6J mice according to the method described in Raible et al., J.Neurosci. Res., 27:43-46 (1990). Briefly, CNS from newborn mice (postnatal day 1 to postnatal day 3) were stripped of meninges, mechanically dissociated, seeded into T-75 flasks and maintained in OM5 media supplemented with 10%> FBS. After two to four weeks, cultures were trypsinized, resuspended in RPMI media supplemented with 10%> FBS, but lacking phenol red and incubated in suspension for 60 minutes at 37°C to allow for the reexpression of trypsinized surface markers. Microglia were then purified by flow cytometry using PE-conjugated antibodies against FcR CD16/CD32 (Pharmingen, San Diego, CA) as described in Carson et al., Glia, 22:72-85 (1998).
  • microglial responses may be different from those of peripheral macrophages, due at least in part to their interactions with other CNS cell types. Therefore, to study microglial activation, these cells were stimulated in the presence of astrocytes, oligodendrocytes and the other CNS cell types present in the mixed glial cultures for 22 hours with 50-100 ng/ml LPS and 10-100 U/ml IFN ⁇ (Genzyme). Only after stimulation were microglia isolated by flow cytometry. LPS and EFN ⁇ were chosen as global stimulators of microglial and macrophage function.
  • LPS is a potent stimulator of several early events in macrophage activation, including the production and secretion of TNF ⁇ , IL-1 and IL-6, and mimics bacterial sepsis such as that occurring in bacterial meningitis.
  • IFN ⁇ which is produced by activated THl T cells
  • microglia and macrophages express MHC class II, produce nitrogen and oxygen intermediates, and become fully tumoricidal.
  • peritoneal macrophages were prepared by standard methodologies.
  • macrophages were induced to migrate into the peritoneal cavity of C57BL/6 mice by the injection of Brewer's thioglycolate solution into the peritoneal cavity.
  • Peritoneal macrophages were harvested at 3-5 days post-injection, by flushing the peritoneal cavities of halothane-euthanized mice with PBS.
  • Macrophage cells were separated from contaminating nonadherent cells by their adherence to tissue culture plastic. Cells were either allowed to rest for 22 hours in culture or were stimulated with 50-100 ng/ml LPS and 10-100 U/ml EFN ⁇ for 1 hour or 22 hours.
  • RNA from each of four cell samples was prepared: unstimulated microglia, stimulated microglia, unstimulated peritoneal macrophage, stimulated macrophage. Standard methods of RNA isolation and polyA selection were used, according to the method described in Schiber et al., J. Mol. Biol., 142:93-116 (1980).
  • RNA was analyzed using a method of simultaneous sequence-specific identification of mRNAs known as TOGA (TOtal Gene expression Analysis) described in Sutcliffe, J.G., et al Proc Natl Acad Sci USA 2000 Feb 29; 97(5):1976-1981, International published application PCT US99/23655, U.S. Patent No. 5,459,037, U.S. Patent No. 5,807,680, U.S. Patent No. 6,030,784, and U.S. Patent No. 6,110,680, hereby inco ⁇ orated herein by reference.
  • the isolated RNA was enriched to form a starting polyA-containing mRNA population by methods known in the art.
  • the TOGA method further comprised an additional PCR step performed using four 5' PCR primers in four separate reactions and cDNA templates prepared from a population of antisense cRNAs.
  • a final PCR step that used 256 5' PCR primers in separate reactions produced PCR products that were cDNA fragments that conesponded to the 3'-region of the starting mRNA population.
  • the produced PCR products were then identified by a) the initial 5' sequence comprising the sequence of the remainder of the recognition site of the restriction endonuclease used to cut and isolate the 3' region plus the sequence of the preferably four parsing bases immediately 3' to the remainder of the recognition site, preferably the sequence of the entire fragment, and b) the length of the fragment.
  • sequence and fragment length were used to compare the obtained PCR products to a database of known polynucleotide sequences. Since the length of the obtained PCR products includes known vector sequences at the 5' and 3' ends of the insert, the sequence of the insert provided in the sequence listing is shorter than the fragment length that forms part of the digital address.
  • the method yields Digital Sequence Tags (DSTs), that is polynucleotides that are expressed sequence tags of the 3' end of mRNAs. DSTs that showed differential representation were selected for further study as candidates of activation-induced or microglial specific mRNAs. The intensities of the laser-induced fluorescence of the labeled PCR products were compared across sample isolated from treated and untreated microglia and macrophages.
  • DSTs Digital Sequence Tags
  • double stranded cDNA is generated from polyA enriched cytoplasmic RNA extracted using an equimolar mixture of all 48 of a set of 5'-biotinylated anchor primers to initiate reverse transcription.
  • One such suitable set is G-A-A-T-T-C-A-A-C-T- G-G-A-A-G-C-G-G-C-C-G-C-A-G-G-A-A-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-T-V- N-N (SEQ ID NO: 65), where V is A, C or G and N is A, C, G or T.
  • One member of this mixture of 48 anchor primers initiates synthesis at a fixed position at the 3' end of all copies of each mRNA species in the sample, thereby defining a 3' endpoint for each species, resulting in biotinylated double stranded cDNA.
  • Each biotinylated double stranded cDNA sample was cleaved with the restriction endonuclease Mspl, which recognizes the sequence CCGG.
  • the resulting fragments of cDNA conesponding to the 3' region of the starting mRNA were then isolated by capture of the biotinylated cDNA fragments on a streptavidin-coated substrate.
  • Suitable streptavidin-coated substrates include microtitre plates, PCR tubes, polystyrene beads, paramagnetic polymer beads and paramagnetic porous glass particles.
  • a prefened streptavidin-coated substrate is a suspension of paramagnetic polymer beads (Dynal, Inc., Lake Success, NY).
  • the cDNA fragment product was released by digestion with Notl, which cleaves at an 8-nucleotide sequence within the anchor primers but rarely within the mRNA-derived portion of the cDNAs.
  • Plasmid preps (Qiagen) were made from the cDNA library of each sample under study.
  • each library was digested with Mspl, which effects linearization by cleavage at several sites within the parent vector while leaving the 3' cDNA inserts and their flanking sequences, including the T3 promoter, intact.
  • the product was incubated with T3 RNA polymerase (MEGAscript kit, Ambion) to generate antisense cRNA transcripts of the cloned inserts containing known vector sequences abutting the Mspl and Notl sites from the original cDNAs.
  • T3 RNA polymerase MEGAscript kit, Ambion
  • each of the cRNA preparations was processed in a three-step fashion.
  • 250ng of cRNA was converted to first-strand cDNA using the 5' RT primer (A-G-G-T-C-G-A-C-G-G-T-A-T-C-G-G, (SEQ ID NO: 66).
  • step two 400 pg of cDNA product was used as PCR template in four separate reactions with each of the four 5' PCR primers of the form G-G-T-C-G-A-C-G-G-T-A-T-C-G-G-N (SEQ ID NO: 67), each paired with an "universal" 3' PCR primer G-A-G-C-T-C-C-A-C-C-G-C-G-G-G-T (SEQ ID NO: 68), to yield four sets of PCR reaction products ("Nl reaction products").
  • step three the product of each subpool was further divided into 64 subsubpools (2ng in 20 ⁇ l) for the second PCR reaction.
  • This PCR reaction comprised adding 100 ng of the fluoresceinated "universal" 3' PCR primer (SEQ ID NO: 68) conjugated to 6-FAM and 100 ng of the appropriate 5' PCR primer of the form C-G-A-C-G-G-T-A-T-C-G-G-N-N- N-N (SEQ ED NO:69), and using a program that included an annealing step at a temperature X slightly above the T m of each 5' PCR primer to minimize artifactual misprinting and promote high fidelity copying.
  • Each polymerase chain reaction step was performed in the presence of TaqStart antibody (Clonetech).
  • N4 reaction products The products (“N4 reaction products”) from the final polymerase chain reaction step for each of the tissue samples were resolved on a series of denaturing DNA sequencing gels using the automated ABI Prizm 377 sequencer. Data were collected using the GeneScan software package (ABI) and normalized for amplitude and migration. Complete execution of this series of reactions generated 64 product subpools for each of the four pools established by the 5' PCR primers of the first PCR reaction, for a total of 256 product subpools for the entire 5' PCR primer set of the second PCR reaction.
  • ABSI GeneScan software package
  • Table 1 is a summary of the expression levels of 529 mRNAs determined from cDNA. These cDNA molecules are identified by their digital address, that is, a partial 5' terminus nucleotide sequence comprising the remainder of the Mspl site and the four parsing bases for the 5' PCR primer of each subsubpool coupled with the length of the molecule, as well as the relative amount of the molecule produced in untreated microglia, treated microglia, untreated macrophages and treated macrophages.
  • the 5' terminus partial nucleotide sequence is determined by the recognition site for Mspl and the nucleotide sequence of the parsing bases of the 5' PCR primer used in the final PCR step.
  • the length of the fragment was determined by inte ⁇ olation on a standard curve and, as such, may vary plus or minus 1 to 2 base pairs from the actual length as determined by sequencing.
  • the entry in Table 1 that describes a DNA molecule identified by the digital address Mspl GTTC 426 is further characterized as having a 5' terminus partial nucleotide sequence of CGGGTTC and a digital address length of 426 b.p.
  • the DNA molecule identified as Mspl GTTC 426 is further described as being expressed in control (2590) and activated (1650) microglia, but not control (153) or activated (185) macrophage cells (Table 1, Figure 1). Additionally, the DNA molecule identified as Mspl GTTC 426 (clone MM_27) is described by its nucleotide sequence which conesponds with SEQ ID NO: 15.
  • the other DNA molecules identified in Table 1 by their Mspl digital addresses are further characterized by: (1) the level of gene expression in untreated microglia; (2) the level of gene expression in treated microglia; (3) the level of gene expression in untreated macrophages; and (4) the level of gene expression in treated macrophages.
  • isolated clones are further characterized as shown in Tables 2 and 3, and their nucleotide sequences are provided as SEQ ID NOs: 1-64, 106 and 170-181.
  • Several of the isolated clones described in Table 2 were also characterized by the level of gene expression in various tissues including lung, heart, kidney, liver, lymph nodes, spleen, testes and several brain tissues (cortex, midbrain, brainstem, and cerebellum).
  • sequences of SEQ ED NO: 1-23 have had the Mspl site found in the native state of the conesponding mRNA indicated by the addition of a "C" to the 5' end of the sequence.
  • C the ligation of the sequence into the vector does not regenerate the Mspl site; the experimentally determined sequence of the PCR products reported herein has C-G-G as the first bases of the 5' end.
  • FIG. 1 shows the results of TOGA analysis using the above-described 5' PCR primer with parsing bases GTTC (SEQ JD NO: 70)
  • Figure 1 shows the PCR products produced from mRNA extracted from (A) untreated microglia, (B) treated microglia, (C) untreated macrophages and (D) treated macrophages in four panels.
  • the vertical index line indicates a PCR product of about 426 b.p. that is present in microglia, but not macrophage cells.
  • PCR primers were designed based on the determined sequence and PCR was performed using the cDNA produced in the first PCR reaction as substrate. Oligonucleotides were synthesized conesponding to the 5' PCR primer in the second PCR step for each candidate extended at the 3' end with an additional 14 nucleotides from the clone sequence 3' to the parsing bases. For example, for the 426 b.p.
  • the 5' PCR primer was G-A-T-C-G-A-A-T-C-C-G-G-G-T-T-C-A-A-C-C-G-C-G- T-G-A-A-G-G-T (SEQ JD NO: 94).
  • This 5' PCR primer was paired with the fluorescent labeled 3' PCR primer (SEQ ED NO: 68) in PCRs using the cDNA produced in the first PCR reaction as substrate. Primers designed for such studies are shown in Table 3, below.
  • the sequenced products were separated by electrophoresis and the length of the clone was compared to the length of the original PCR product as shown in Figure 2.
  • the upper panel (A) shows the PCR products produced using the original PCR primers, SEQ ID NO: 70 and SEQ ED NO: 68 (compare to the top panel in Figure 1 A).
  • the middle panel shows the length (as peak position) of the PCR product derived from the isolated clone as described above using the PCR primers, SEQ ID NO: 94 and SEQ ID NO: 68.
  • the traces from the top and middle panels are overlaid, demonstrating that the PCR product of the isolated and sequenced novel clone is the same length as the original PCR product.
  • the TOGA PCR product was sequenced using a modification of a direct sequencing methodology (Innis et al., Proc. Nat'l Acad. Sci., 85: 9436-9440 (1988)). PCR products conesponding to DSTs were gel purified and PCR amplified again to inco ⁇ orate sequencing primers at the 5'- and 3'- ends. The sequence addition was accomplished through 5' and 3' ds-primers containing Ml 3 sequencing primer sequences (Ml 3 forward and Ml 3 reverse respectively) at their 5' ends, followed by a linker sequence and a sequence complementary to the DST ends.
  • a master mix containing all components except the gel purified PCR product template was prepared, which contained sterile H O, 1 OX PCR ⁇ buffer, lOmM dNTP, 25 mM MgCl 2 , AmpliTaq/ Antibody mix (1.1 ⁇ g/ ⁇ l Taq antibody, 5 U/ ⁇ l AmpliTaq), 100 ng/ ⁇ l of 5' ds-primer (5' TCC CAG TCA CGA CGT TGT AAA ACG ACG GCT CAT ATG AAT TAG GTG ACC GAC GGT ATC GG 3', SEQ ID NO: 122), and 100 ng/ ⁇ l of 3' ds-primer (5' CAG CGG ATA AC A ATT TCA CAC AGG GAG CTC CAC CGC GGT GGC GGC C 3', SEQ JD NO: 123).
  • PCR product template PCR was performed using the following program: 94°C, 4 minutes and 25 cycles of 94°C, 20 seconds; 65°C, 20 seconds; 72°C, 20 seconds; and 72°C 4 minutes.
  • the resulting amplified PCR product was gel purified.
  • the purified PCR product was sequenced using a standard protocol for ABI 3700 sequencing. Briefly, triplicate reactions in forward and reverse orientation (6 total reactions) were prepared, each reaction containing 5 ⁇ l of gel purified PCR product as template.
  • the 3' sequencing primer was the sequence 5' GGT GGC GGC CGC AGG AAT TTT TTT TTT TTT TT 3', (SEQ ID NO: 126). PCR was performed using the following thermal cycling program: 96°C, 2 minutes and 29 cycles of 96°C, 15 seconds; 50°C, 15 seconds; 60°C, 4 minutes.
  • PCR primers were designed based on the sequences determined by direct sequencing, and PCR reactions were performed using the Nl TOGA PCR reaction products as substrate, as described above for the sequences cloned into the TOPO vector.
  • oligonucleotides were synthesized with the sequence G-A-T-C-G- A-A-T-C extended at the 3' end with a partial Mspl site (C-G-G) and an additional 18 nucleotides adjacent to the partial Mspl site from the sequence determined by direct sequencing.
  • the 5' PCR primers were paired with the fluorescent labeled universal 3' PCR primer (SEQ ID NO: 68) in PCR reactions with the Nl TOGA PCR reaction product as template. The lengths of these PCR products were compared to the length of the PCR products of interest. Table 4 contains the sequences of the primers used in these studies.
  • FIG. 3 The northern blot analysis shown in Figure 3 shows the developmental profile of MM 27 expression.
  • Poly A enriched mRNA was prepared from whole brain isolated from embryonic (day 14, 16, and 18) and post-natal (day 1, 5, 10, 15, 20, 25 and 30) mice as described above.
  • the expression of MM 27 in embryonic (day 16) liver and adult liver was measured.
  • the CNS expression of MM_27 decreases dramatically after birth, in brain tissue, but increases dramatically in liver.
  • Tables 2 and 3 MM_27 conesponds to a gene that encodes the G protein gamma-5 subunit.
  • MM_27 is associated with control and activated microglia cells, but not macrophage cells, suggesting that its expression is specific to microglia.
  • FIGs 4 and 5 Another example is shown in Figures 4 and 5.
  • a peak at about 244 is indicated, identified by digital address Mspl GTTG 244 when a 5' PCR primer (SEQ ED NO: 71) was paired with SEQ ID NO: 68 to produce the panel of PCR products.
  • the PCR product was cloned and sequenced as described in Example 1.
  • SEQ ID NO: 14 oligonucleotides were synthesized conesponding to the 5' PCR primer in the second PCR step for each candidate extended at the 3' end with an additional 14 nucleotides from the clone sequence 3' to the parsing bases (GTTG).
  • the 5' PCR primer was G-A-T-C-G-A-A-T-C-C-G-G-G-T-T- G-C-A-C-C-T-A-T-T-G-C-A-T-G-T-T (SEQ JD NO: 93).
  • This 5' PCR primer were paired with the fluorescently labeled 3' PCR primer (SEQ ID NO: 68) in PCRs using the cDNA produced in the first PCR reaction as substrate.
  • the upper panel ( Figure 5 A) shows the PCR products produced using the original PCR primers, SEQ ID NO:71 and SEQ ID NO: 68 (compare to Figure 4B).
  • the middle panel shows the length (as peak position) of the PCR product derived from the isolated clone as described above.
  • the traces from the top and middle panels are overlaid, demonstrating that the PCR product of the isolated and sequenced novel clone is the same length as the original PCR product.
  • the DNA molecule identified by the digital address Mspl GTTG 244 (clone MM_26), is further characterized as having a 5' terminus partial nucleotide sequence of CGGGTTG and a digital address length of 244 b.p.
  • MM 26 is further described as being expressed at comparable levels in untreated macrophages (6242) and treated macrophages (6175). However, the treatment results in a marked regulation of the expression of MM 26 in microglia, producing a 26-fold increase between untreated microglia (45) and treated microglia (1180).
  • MM_26 is further characterized by its nucleotide sequence which is presented in SEQ ID NO: 14.
  • MM 26 is associated with stimulated microglia cells and macrophage cells, but not with untreated microglia cells, suggesting its expression conelates with an activated phenotype. Based on these results, MM_26 thus has the expected characteristics of a marker of an inflammatory response in the CNS.
  • the clone MM_3 (digital address AAGT 366) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-A-G-T; SEQ ID NO: 72) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM. ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 366 bp PCR product was isolated and characterized as described below.
  • the sequence of the 317 bp insert (the balance being vector sequence) is given in SEQ ED NO: 18.
  • MM_3 is present in microglia, but not macrophage cells. Additionally, MM_3 shows greater expression in microglia cells that have been stimulated with LPS/IFN ⁇ than in unstimulated microglia cells. As shown in Table 2, the MM_3 clone conesponds with GenBank sequence
  • U43086 which is identified as the mouse glucocorticoid-attenuated response gene 49 (GARG/IRG2).
  • GAG/IRG2 mouse glucocorticoid-attenuated response gene 49
  • Poly A enriched mRNA was prepared from whole brain isolated from either neonatal (post-natal day 1. PI) or adult mice, microglia isolated from mixed glial cultures, peritoneal macrophage cells, kidney fibroblasts, and bone ma ⁇ ow-derived dendritic cells. The glial and macrophage cells were prepared according to the previously described methods ( Figures 6A, B). Whole brain was prepared by rapidly sacrificing mice using halothane inhalation, immediately removing the brain from the skull, and homogenizing the whole brain in preparation for RNA extraction.
  • Kidney fibroblast cells were isolated from adult C57BL/6 mice (both wild-type and relB knock out mice) as described in Feng et al., Am. J. Phys., 266:F713-F722 (1994). Briefly, cell suspensions were prepared from kidney immediately after removal from halothane euthanized mice. Adherent cells were cultured for 15 passages, at which time the cultures consisted of only fibroblast cells.
  • Dendritic cells were isolated from bone manow according to the method described in Talmor et al., Ewr. J. Imm., 28:811-817 (1998). Briefly, manow from femurs was eluted in RPMI 1640 tissue culture media. Cells were recovered by centrifugation and plated at one mouse equivalent per 150mm tissue culture plate in RPMI 1640 supplemented with 10% fetal bovine serum, 25mM Hepes, ImM glutamine, 50 ⁇ M 2- mercaptoethanol, 50 U/ml granulocyte/macrophage colony stimulating factor and 100 U/ml interleukin-4. After 2 days, non-adherent cells were transfened to a new 150mm tissue culture plate.
  • dendritic cells were isolated from the non-adherent population in both 150mm plates by flow cytometry. Dendritic cells were identified by size, side scatter and high B7.2 expression using fluorescein isothiocyanate -conjugated antibodies against B7.2.
  • the glial and macrophage cells were either unstimulated, stimulated for 1 hour with LPS/IFN ⁇ (50ng/ml LPS; 10 U/ml IFN ⁇ ), or stimulated for 22 hours with LPS/ ⁇ FN ⁇ (50ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • LPS/IFN ⁇ 50ng/ml LPS; 10 U/ml IFN ⁇
  • LPS/ ⁇ FN ⁇ 50ng/ml LPS
  • 10 U/ml IFN ⁇ LPS/ ⁇ FN ⁇
  • poly A enriched mRNA was prepared from various freshly-isolated murine tissues including lung, heart, kidney, liver, spleen, lymph node, testis, and several regions of the brain (cortex, midbrain, brainstem, and cerebellum).
  • the various tissues were isolated by rapidly sacrificing mice using halothane inhalation, immediately removing the specified tissue and placing it in ice-cold phosphate buffered saline (PBS) prior to homogenation.
  • PBS ice-cold phosphate buffered saline
  • the brain regions were isolated by rapidly removing the brain from the skull, separating the cortex, midbrain, brainstem, and cerebellum regions and placing them in separate tubes of ice cold PBS prior to homogenation.
  • the cytoplasmic RNA and poly A enriched mRNA was prepared from each of these tissues using the method described in Schiber et al., J. Mol. Biol, 142:93-116 (1980).
  • Filters were washed to high stringency (0.2X SSC) (1 X SSC: 0.015 M NaCl and 0.0015 M Na citrate) at 68°C and then exposed to Kodak X-AR film (Eastman Kodak, Rochester, NY) for up to one week.
  • the transcript detected using MM_3 is expressed at a significantly higher level in mixed glial cultures than in whole brain from either neonatal or adult mice. Likewise, the expression is significantly higher in mixed glial cultures than in macrophages and kidney fibroblasts.
  • LPS/IFN ⁇ stimulation 50ng/ml LPS; 10 U/ml IFN ⁇
  • the expression continues to increase in mixed glial cultures exposed to LPS/IFN ⁇ for 22 hours, while its expression in peritoneal macrophages has already begun to decline after 22 hours.
  • the expression of the transcript detected by MM 3 in LPS treated fibroblasts was not affected by the absence of relB in knock out mice.
  • RelB is a subunit of the NF- kappa B transcription factor. LPS-stimulated kidney fibroblasts express numerous chemokines and inflammatory molecules. Given that mice lacking the relB gene can not turn off the expression of these molecules, the use of such mice allows the detection of inflammatory molecules that are normally expressed at levels below the level of detection.
  • Figure 6B shows microglia, macrophage, and dendritic cells that were either untreated, treated with LPS/EFN ⁇ (50ng ml LPS; 10 U/ml IFN ⁇ ), or LPS alone (50ng/ml) for 22 hours prior to RNA isolation.
  • LPS/EFN ⁇ 50ng ml LPS; 10 U/ml IFN ⁇
  • LPS alone 50ng/ml
  • the transcript detected using MM_3 is expressed in kidney, liver, lymph node, and various regions of the brain (midbrain, brainstem, and cerebellum), although expression in the brain and lymph node is minimal.
  • MM_3 is not expressed in the lung, heart, spleen, testis, or cortex.
  • Figure 7A-F shows the results of in situ hybridization analysis using an antisense cRNA probe directed against the 3' end of clone MM_3, showing the pattern of clone MM_3 mRNA expression in vivo 24 hours after an intracranial injection of LPS/IFN ⁇ , where Figures 7(A-C) show coronal sections through anterior (7 A) and posterior (B) regions of the cerebrum and 7(C) shows a coronal section of the cerebellum of a control C57B1/6J mouse.
  • Figures 7(D-F) show coronal sections through anterior (7D) and posterior (E) regions of the cerebrum and 7(F) shows a coronal section of the cerebellum of a C57B1/6J mouse sacrificed 24 hours after an intracerebral injection of LPS/EFN ⁇ .
  • MM_3 expression is dramatically up-regulated in cells lining the ventricles and near the injection site.
  • the northern blot analyses revealed a mRNA of about 2-3 kb (data not shown) which conesponds to the mouse glucocorticoid-attenuated response gene 49 GARG)/TRG2. This gene has been described in murine Swiss 3T3 (Smith et al., Arch. Biochem.
  • the GARG gene product which is a 43 amino acid protein of about 47,200 D.
  • the protein has multiple tetratricopeptide repeat (TPR) domains, which are loosely conserved 34 amino-acid residue repeat units involved in specific protein-protein interactions, including apoptosis-dependent ubiquitination of cyclin B, transcriptional repression, and protein import into peroxisomes and mitochondria (Goebel et al., Trends Biochem. Sci., 16:173-177 (1991)).
  • TPR tetratricopeptide repeat
  • the present invention provides novel data regarding the expression of GARG/IRG2 in microglia. Specifically, the present results show that GARG/IRG2 gene expression is enriched in microglia as compared to macrophages and is up-fegulated by LPS/IFN ⁇ to a much higher extent and with greatly sustained kinetics in microglia as compared to macrophages. Based on these results which indicate that the GARG/ERG2 gene is associated primarily with the activated state, MM_3 has the characteristics of a marker for activated microglial cells.
  • labeled MM_3 or fragments thereof can be used as probes for northern blots and in situ hybridization to indicate activated microglia.
  • translations of MM 3 (“MM 3 peptides") can be used to make antibodies that are useful for identifying conesponding polypeptides in techniques such as western blotting, immunocytochemistry, and ELISA assays using standard techniques such as those described in U.S. Patent No. 4,900,811, inco ⁇ orated by reference herein.
  • MM_3 could be useful as a therapeutic agent, given its hypothesized role as an antibacterial or antiviral protein, or a mediator of the cellular response to LPS/IFN ⁇ .
  • the clone MM 11 (digital address AGGT 315) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5' -PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-G-G-T; SEQ JD NO: 73) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The insert, when sequenced, had the sequence presented as SEQ ED NO: 1.
  • the results of TOGA analysis indicate that MM 11 is differentially expressed in treated versus untreated microglia and macrophage cells.
  • Northern Blot analyses were performed to determine the pattern of expression in unstimulated and stimulated microglia, macrophage, and dendritic cells.
  • Total RNA was prepared from microglia isolated from mixed glial cultures, peritoneal macrophage cells, and bone manow-derived dendritic cells, as described in
  • Example 3 The microglia and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation. The dendritic cells were not stimulated prior to RNA isolation.
  • the cytoplasmic RNA was isolated from the various tissues and cells using the method described in Example 3. Shown in Figure 8, northern blot analyses were performed as described in Example 3, except that 10 ⁇ g of total RNA was loaded into each lane and MM_11 insert DNA was radiolabeled and used as a probe.
  • Figure 8 shows that the transcript detected using MM_11 is enriched in microglia as compared to macrophage and dendritic cells. Further, MM_11 is dramatically reduced after either LPS stimulation or LPS/TFNy stimulation. While low level of expression of MM_11 can be detected in macrophage and dendritic cells, the expression of MM 11 is more than 20-fold greater in microglial cells. The expression of MM_11 is repressed in both microglia and macrophages after 22 hour of LPS/EFN ⁇ treatment. Northern blot analysis also indicated that MM_11 is expressed at very low levels in most tissues and not expressed in neurons.
  • the full-length transcript detected using MM_11 is of unknown identity, but matches an EST in the GenBank database. Preliminary size analysis indicates that the transcript is approximately 1 kb in size (data not shown).
  • MM_11 is abundantly expressed in unstimulated microglia, but not macrophage or dendritic cells suggests that the MM_11 gene product may be useful as a neural-specific marker by which to identify microglia.
  • labeled MM_11 or fragments thereof can be used as probes for northern blots and in situ hybridization to differentiate microglia from macrophage cells in the CNS.
  • Translations of MM_11 (“MM_11 peptides”) can be used to make antibodies that are useful for identifying conesponding polypeptides in techniques such as western blotting, immunocytochemistry, and ELISA assays using standard techniques as described above.
  • MM_11 is down-regulated in LPS/IFN ⁇ -stimulated microglia, suggesting that this molecule could be regulated by a cytokine or other agent involved in the inflammatory response.
  • EXAMPLE 5 Further Characterization of MM 12
  • the clone MM_12 (digital address ACAA 381) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5 -PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-C-A-A; SEQ ID NO: 74) paired with a 3'-PCR primer (SEQ XD NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 381bp PCR product was isolated and characterized as described below.
  • the sequence of the insert is given by SEQ ID NO: 2.
  • MM_12 is differentially expressed in treated versus untreated microglia and macrophage cells.
  • the MM_12 clone conesponds with GenBank sequence U25096 which is identified as the mouse Kruppel-like factor (LKLF).
  • Northern blot analyses were performed: 1) to determine the pattem of expression in various tissues and cells and 2) to determine differences in expression between unstimulated and stimulated microglia, macrophage, and dendritic cells.
  • RNA was prepared from the following murine cell cultures: microglia isolated from murine mixed glial cultures, peritoneal macrophage cells, and bone marrow- derived dendritic cells.
  • the microglial, macrophage, and dendritic cells were prepared according to the previously described methods in Example 3.
  • the glial and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation. Dendritic cells were not treated.
  • poly A enriched mRNA was prepared from a variety of freshly-isolated murine tissues, including lung, heart, kidney, liver, spleen, lymph node, testis, and several regions of the brain (cortex, midbrain, brainstem, and cerebellum).
  • the total RNA and poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using either lO ⁇ g of total RNA ( Figure 9B) or 2 ⁇ g of poly A enriched mRNA ( Figure 9B).
  • the MM_12 insert DNA was radiolabeled and used as the oligonucleotide probe.
  • a transcript detected using MM_12 shows greater expression in microglia than in macrophages or dendritic cells. Furthermore, its expression in microglia is slightly reduced after 22 hour LPS/IFN ⁇ treatment. In contrast, the expression of the transcript is increased LPS/EFN ⁇ - stimulated macrophage cells compared with unstimulated cells. Longer exposure of the northern blot reveals very weak expression of the transcript in both the unstimulated macrophages and dendritic cells.
  • the transcript detected using MM_12 is expressed in most adult mouse tissues. However its expression is most abundant in lymph node, lung and heart.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation. The results are shown in Figure 10.
  • poly A enriched mRNA was prepared from freshly-isolated murine spleen and brain tissues of neonatal (postnatal day 1, PI) and adult mice.
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_12 insert was radiolabeled and used as the oligonucleotide probe. The results are shown in Figure 10.
  • MM 12 is expressed in both the spleen and the brain, with greater expression in the spleen. MM_12 is also expressed in stimulated and unstimulated microglia and macrophage. Interestingly, the expression of MM_12 is dramatically down-regulated in macrophages (5-10 fold) upon stimulation.
  • the transcript detected by MM_12 is approximately 1.5-3 kb as determined by preliminary size analysis and conesponds with an identified Kruppel-like factor (LKLF) gene.
  • the LKLF gene is a zinc-finger transcription factor gene (Anderson et al., Mol. Cell Biol, 15:5957-5965 (1995)). Such factors bind to regulatory regions of the DNA, influencing the transcriptional activity of the gene. Primarily examined in the lung and in T-cells, the LKLF gene has been shown to be developmentally regulated with discrete patterns of expression in different tissues. Anderson et al. reports that the highest level of LKLF expression is in lung tissue, with reduced levels found in spleen, skeletal muscle, testes, heart and uterus. Other northern blot analysis indicates that this molecule is enriched in the lung and in lymph node tissue.
  • MM_12 has the characteristics of a marker for microglial cells in normal or unactivated CNS. As discussed in the above examples, labeled MM_12 or fragments thereof can be used as probes for northern blots and in situ hybridization to differentiate microglia from macrophage cells in the CNS. Translations of MM_12 (“MM_12 peptides”) can be used to make antibodies that are useful for identifying conesponding polypeptides as described in U.S. Patent No. 4,900,811.
  • the clone MM_14 (digital address TATA 249) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-A-T-A; SEQ JD NO: 75) paired with 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The sequence determined for the insert is given in SEQ ID NO: 4.
  • MM_14 is expressed in control (1753) and stimulated (1610) macrophages, but not in control (32) or stimulated (113) microglial cells.
  • Northern blot analysis has confirmed a low level of expression in LPS/IFN ⁇ stimulated macrophages.
  • RTPl mouse Ral interacting protein
  • RIP1 is believed to be involved in intracellular signaling along G-mediated pathways, based on data which shows that RJP1 binds to Ral in a GTP-dependent manner.
  • the Ral protein is one of a large family of low molecular weight GTPases, the most well-known of which is Ras.
  • Ral is a 206 amino acid protein which shares greater than 50% homology with Ras.
  • the Ral proteins are the major GTP binding protein in human platelets and are also abundant in the supernatant fraction of rabbit and bovine brains.
  • Park et al. reports that RIP1 is expressed in a wide variety of tissues, including ovaries, skeletal muscle, heart, brain, lung, kidney, liver and spleen (Park et al., Oncogene, X X :2349-2355 (1995)).
  • MM 14 is identical to the 3'region of the REP1 protein.
  • REP 1 has recently been shown to associate with both the TNF receptors. Depending on the relative expression of these TNF receptors, REP 1 has been reported to either promote or suppress apoptosis. In general it is thought to prevent apoptosis in macrophages and promote apoptosis in fibroblasts. Differential expression between microglia and macrophages indicates that these cells differ in their apoptotic or TNFR signal transduction pathways.
  • MM_14 may be useful as a marker to differentiate between microglia and macrophage cells in CNS tissue.
  • MM_18 The clone MM_18 (TTGG 262) was obtained using the above-described TOGA analysis methods.
  • the TOGA data was generated with a 5 -PCR primer (C-G-A-C-G-G- T-A-T-C-G-G-T-T-G-G; SEQ ID NO: 76) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 262 bp PCR product was isolated and characterized as described below.
  • the sequence of the insert is given in SEQ JD NO: 8.
  • the results of TOGA analysis indicate that MM 18 is differentially expressed in microglia and macrophage cells.
  • the MM_18 clone conesponds with GenBank sequence X67319 which is identified as the GOLLI-MBP/transcript overlapping myelin basic protein.
  • Northern blot analyses were performed to determine the pattern of expression in various tissues and cells and to determine differences in expression between unstimulated and stimulated microglia and macrophage cells.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from a variety of freshly-isolated murine tissues, including lung, heart, kidney, liver, spleen, lymph node, testis and tissues isolated from several regions of the brain (cortex, midbrain, brainstem, and cerebellum).
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_ 18 insert DNA was radiolabeled and used as the oligonucleotide probe.
  • the MM_18 probe detected four distinct mRNA transcripts ranging in size from about 1-2 kb to about 6 kb which can be seen in both Figures 11 A and 1 IB.
  • transcripts 2 and 3 are present in both microglia and macrophage cells. Interestingly, transcript 3 is strongly up-regulated following LPS/IFN ⁇ treatment. In macrophage cells, the up-regulation is strongest after 1 hour and decreases after 22 hours. Also, transcript 2 is present only in stimulated microglia and macrophage cultures, suggesting that it is induced by LPS/EFN ⁇ treatment. Transcripts 1 and 4 are present in both microglia and macrophage cells, but show greater level of expression in macrophages.
  • transcripts 2 and 3 are present in all tissues examined (transcripts 2 and 3 are visible in lung and spleen samples upon long exposure). In brain sections, transcript 1 is also easily detected. Transcript 4 is present in highest abundance in lymph node and testis, exhibiting a lower level of expression in other tissues. A longer exposure of the northern blot revealed that transcript 4 is expressed at the same levels as transcripts 2 and 3 in the spleen. Transcript 3 is the major transcript detected in testes. Additional northern blots not shown reveal that the expression of transcripts 2, 3, and 4 in the spleen was the same in neonatal (1 day post-natal) and adult tissue. Similarly, the expression of transcripts 2 and 3 in brain was the same in neonatal (1 day post-natal) and adult tissue.
  • Transcripts 2 and 3 were present in all tissues screened. Novel transcript 4 was present in the lymph nodes, spleen and testes. Transcript 1 was specific to CNS tissue. The present data also show that the novel transcripts are transiently up-regulated by LPS/IFN ⁇ in macrophage cells. All transcripts were of relatively low abundance and are differentially regulated during development. Using an antibody specific for the known GOLLI-MBP isoforms, this molecule was found to be expressed in cells that organize lymphocytic infiltrates in inflamed tissue and also within the healthy lymph node.
  • GOLLI-MBP expression can be readily detected in macrophages isolated from the inflamed CNS but only very weakly in microglia isolated from the same CNS. GOLLI- MBP could not be detected by RT-PCR in microglia isolated from healthy CNS.
  • MM_18 The developmental profile of MM_18 was also examined, as shown in Figure 13.
  • Poly A+ mRNA was isolated from embryonic (days 14, 16, 18), post-natal (days 1, 5, 10, 20, 25, 30), and adult brain and probed with MM_18.
  • Poly A+ mRNA was also isolated from embryonic (day 16) and adult liver and subjected to northern blot analysis.
  • the expression of MM_18 decreases after birth and maintains about the same level of expression in post-natal day 1-30 and adult mice.
  • MM 18 is also expressed at about the same level in embryonic and adult liver.
  • Figure 14B-E shows an immunocytochemistry using an antibody specific for the known GOLLI-MBP isoforms to determine protein expression in pancreas, thymus, liver and lymph nodes. This molecule was found to be expressed in cells that organize lymphocytic infiltrates in inflamed tissue and also within the healthy lymph node.
  • GOLLI-myelin basic protein MM 18 conesponds to the 3' end of exon 5c of the GOLLI-myelin basic protein (GOLLI-MBP) gene.
  • the MBP gene was shown to be composed of overlapping genes and subsequently termed the GOLLI-MBP gene.
  • the GOLLI-MBP gene encodes for two families of proteins which include the classic MBPs (consisting of six isoforms), and the GOLLI-MBPs, (consisting of three isoforms).
  • Two of the GOLLI-MBP isoforms J37 and BG21 contain sequences which are in frame with and thus share sequences in common with the classic MBPs.
  • GOLLI-MBP exons 5a and 5b conespond to exons la and lb of the classic MBP (there is no exon lc which conesponds to exon 5c in the classic MBP).
  • a description of the various mRNAs and principal protein products of the GOLLI-MBP gene is found in Voskuhl, R., lmm. Rev., 164: 81-92 (1998), which is inco ⁇ orated in its entirety by reference herein (see also, Grima et al., J. Neurochem., 59:2318-2323 (1992)).
  • transcripts were detected as shown in Figure 12.
  • the upper panel of Figure 12 shows a 16 hour exposure of the blot and the lower panel shows a two week exposure of the blot.
  • the largest transcript is labeled in Figure 12 as (133 amino acids GOLLI-protein)-(MBPl-56)-(6 amino acids GOLLI protein) and describes the protein that is encoded by this transcript.
  • This protein is a fusion of GOLLI sequence and myelin basic protein sequence.
  • MBP 1-56 refers to amino acids 1-56 of myelin basic protein.
  • This transcript is also the same as BG21 and is the same as transcript #1 detected by the probe in Figure 11.
  • the smallest transcript detected on this blot ( Figure 12) is labeled as (133 amino acids GOLLI-protein)-(MBPl-102)-(MBP155-168) and describes the protein that is encoded by this transcript.
  • This protein is also a fusion of GOLLI amino acids 1-133 joined to MBP amino acids 1-102 joined to MBP amino acids 155-168.
  • This transcript is also refened to as J37. M41 expression was not detected in microglia or macrophages.
  • a third novel transcript, intermediate in size is detected between BG21 and J37 as shown in Figure 12. This exon 5A containing transcript has not been previously described. All transcripts are expressed at much higher levels in macrophages than in microglia.
  • Figure 15 provides a schematic diagram of MM 18 in relation to the GOLLI- MBP gene transcripts.
  • MBP is one of the major structural proteins of CNS myelin. Autoimmune attacks directed against MBP induce multiple sclerosis-like symptoms in animal models. The discovery that GOLLI-MBP is expressed by cells of the immune system suggests that the expression of this molecule may play a role in either preventing autoimmune attacks against myelin under normal, healthy conditions or inducing or aggravating autoimmune attacks against CNS myelin under neurodegenerative conditions.
  • Figure 16 demonstrates that in cells isolated from the adult mouse CNS, GOLLI- MBP (MM_18) expression is higher in CD45 high macrophages that in CD45 ,ow in ermediate microglia.
  • the clone MM_20 (digital address TGTG 411) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-G-T-G; SEQ ID NO: 77) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 411 bp PCR product was isolated and characterized as described below.
  • the sequence of the insert is given in SEQ ID NO: 10.
  • MM_20 is differentially expressed in microglia and macrophage cells.
  • the MM_20 clone conesponds with GenBank sequence X03920, which is identified as glutathione peroxidase.
  • Northern Blot analyses were performed to determine the pattern of expression in various tissues and cells and to determine differences in expression between unstimulated and stimulated microglia and macrophage cells.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from freshly-isolated murine spleen and brain tissues of neonatal (postnatal day 1, PI) and adult mice.
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_20 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 17 shows that a transcript detected using MM_20 is present in spleen, brain, microglial cells and macrophages.
  • the level of expression is higher in both neonatal and adult spleen tissue than in the conesponding brain tissues.
  • the expression of the transcript in both microglia cells and macrophage cells is down-regulated following 22 hour treatment with LPS/IFN ⁇ .
  • Figure 18 shows a longer exposure northern blot of MM_20 expression in unstimulated and stimulated (for 1 or 24 hours) microglia and macrophage cells.
  • each lane was loaded with 2 ⁇ g mRNA.
  • Other northern blot studies have confirmed the expression pattern predicted in TOGA profiles, namely that while MM_20 expression is down-regulated in microglia, it is up-regulated in astrocytes in response to stimulation.
  • the transcript detected using MM_20 is approximately 2-3 kb in size as determined by preliminary size analysis and conesponds with the enzyme glutathione peroxidase.
  • Glutathione peroxidase is believed to play an important protective role under conditions of oxidative stress.
  • Excitotoxic processes in the brain which occur under conditions of stroke and primary neurodegenerative diseases are accompanied by an excessive formation of reactive oxygen intermediates, such as superoxide and other oxygen free radicals.
  • Superoxide dismutase catalyzes the removal of oxygen from superoxide, resulting in the generation of peroxides which are then removed enzymatically by catalase and glutathione peroxidase.
  • MM_20 can be useful as a marker of glutathione peroxidase expression in these and other instances.
  • the clone MM_21 (digital address TCAT 410) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5' -PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-C-A-T; SEQ ID NO: 78) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 410 bp PCR product was isolated and characterized as described below. The sequence of the insert is given in SEQ ED NO: 11.
  • MM_21 is differentially expressed in microglia and macrophage cells.
  • Table 2 the MM 21 clone conesponds with GenBank sequence AA183527 which is presently unidentified.
  • Northern blot analyses were performed to determine the pattern of expression in various tissues and cells and to determine differences in expression between unstimulated and stimulated microglia and macrophage cells.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from freshly-isolated murine spleen and brain tissues of postnatal day 1 (PI) and adult mice, as well as from murine lung, heart, kidney, liver, spleen, lymph nodes, testes and brain tissue (cortex, midbrain, brainstem, cerebellum).
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_21 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 19A shows that the expression of the transcript detected by MM_21 is very restricted.
  • the transcript is present in 1 hour stimulated macrophages, but not in microglia cells. Furthermore, the transcript is not expressed in spleen or brain tissue. Interestingly, in macrophage cells, expression of the detected transcript is strongly up-regulated within 1 hour of LPS/ FNy exposure. However, this up-regulation is transitory, as the expression is negligible after 22 hour exposure to LPS/IFN ⁇ . Notably, several transcripts are detected in the 1 hour treated macrophages, conesponding to sizes greater than 7 kb.
  • the data shown in Figure 19B further indicate that the expression is tissue-specific. MM_21 is not expressed in any of the tissues tested except lymph node, where it shows strong expression.
  • FIGS. 19A and 19B indicate that the expression of the transcript detected by MM_21 is tissue-specific and highly regulated. The observation that the expression of this transcript is limited to the lymph nodes is interesting.
  • T- and B-lymphocytes as well as macrophages and dendritic cells, infiltrate a tissue site and organize into structures that resemble lymph nodes.
  • the formation of neo-lymph nodes at the site of inflammation is a feature not only of many CNS diseases, such as multiple sclerosis, but also of peripheral inflammatory diseases, such as type I juvenile autoimmune diabetes (Lo, et al., Immunol. Rev. 169:225-239 (1999)).
  • Activation of stromal tissue and/or infiltrating macrophages has been speculated to induce neo-lymph node formation at the site of inflammation.
  • MM_21 The transcript detected by MM_21 is one of the first examples of a molecule with such restricted tissue expression.
  • MM_21 can be a diagnostic indicator of early autoimmune or of early inflammatory disease and lymph node formation.
  • labeled MM_21 or fragments thereof can be used as probes for northern blots and in situ hybridization to detect an inflammatory or autoimmune response.
  • Translations of MM_21 (“MM 21 peptides”) can be used to make antibodies that are useful for identifying conesponding polypeptides as described in U.S. Patent No. 4,900,811.
  • the clone MM_23 (digital address TCGG 314) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5 -PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-C-G-G-G; SEQ ED NO: 79) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 314 bp PCR product was isolated and characterized as described below.
  • the sequence of the insert is given in SEQ ID NO: 13.
  • the results of TOGA analysis indicate that MM 23 is differentially expressed in microglia and macrophage cells.
  • Northern Blot analyses were performed to determine the pattern of expression in various tissues and cells and to determine differences in expression between unstimulated and stimulated microglia and macrophage cells.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from freshly-isolated murine spleen and brain tissues of neonatal (postnatal day 1, PI) and adult mice, as well as from murine lung, heart, kidney, liver, lymph nodes, testes and brain tissues (cortex, midbrain, brainstem, cerebellum).
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_23 insert was radiolabeled and used as the oligonucleotide probe.
  • Figures 20A shows that a transcript detected by MM_23 is expressed in microglial cells and is up-regulated by 22 hour exposure to LPS/EFN ⁇ . Longer exposure northern blots show that the transcript is expressed in macrophage cells that have been exposed to LPS/EFN ⁇ for 1 hour or 22 hours (Figure 20C). Additionally, the transcript is present in both neonatal and adult brain tissue, exhibiting slightly higher expression in adult tissue. The detected transcript is also expressed at very low levels in spleen.
  • Figure 20B shows that the transcript is widely expressed in a variety of tissues, including the cortex, midbrain, brainstem, cerebellum, heart, kidney, liver, and testis. It is also expressed at lower levels in the lung and lymph nodes. Thus, while MM_23 is expressed at low levels in a variety of tissue and in both microglia and macrophages, it is enriched in microglia.
  • MM_23 expression was examined by northern blot analysis as shown in Figure 21.
  • PolyA+ mRNA was isolated from embryonic (day 14, 16, 18), post-natal (day 1, 5, 10, 15, 20, 25, 30), and adult brain, as well as embryonic (day 16) and adult liver.
  • the level of MM_23 expression decreases during embryonic development and is not expressed in post-natal or adult brain.
  • MM_23 is not expressed in embryonic or adult liver.
  • MM_23 shows 82% identity at the nucleotide level and 97%> identity to the translation product of the recently cloned human molecule AFl 50087, a small zinc fingerlike protein. Thus MM_23 is likely the murine homologue of this molecule.
  • the AFl 50087 sequence is found on the X chromosome.
  • the human homologue of the molecule detected with MM_23 has been cloned and entered directly into GenBank as a DDP-like molecule that is the homologue to the yeast protein TEM10.
  • TIM 10 has been identified as a mitochondrial protein encoded by the cellular (but not the mitochondrial) genome. The expression of this molecule has not been well- characterized outside of the yeast system. In yeast, TIM 10 is involved in facilitating protein transport into the mitochondria of the cell.
  • the transcript detected with MM_23 is about 0.7 kb in size and shares significant homology at the amino acid level to the deafhess/dystonia peptide (DDP) gene.
  • DDP deafhess/dystonia peptide
  • MM_23 the human sequences yv59a08.
  • Sl and AFl 50087 show approximately 49%> homology with the deafhess/dystonia gene (DDP).
  • the human sequences have been identified as belonging to a family of proteins defined by the DDP gene, although on a nucleotide level, no significant homology exists.
  • the DDP gene is believed to encode an evolutionarily conserved novel polypeptide necessary for normal human neurological development.
  • DDP The DDP gene was originally identified through positional and deletion studies where the absence of the DDP sequence was associated with deafness, dystonia, and mental deficiency (Jin et al., Nature Genetics, 14:177-180 (1996)).
  • the clinical findings in DDP and related disorders suggest a progressive neurodegenerative disorder affecting the central nervous system, basal ganglia, corticospinal tract and possibly the brain stem.
  • DDP contains two exons and a single intron of approximately 2 kb.
  • a 1.2 kb DDP transcript has been detected in a range of adult and fetal tissues, including skeletal muscle, heart and brain, showing highest levels of expression in fetal and adult brain.
  • the predicted 97 amino acid DDP protein has a molecular weight of 11 kD. As shown in Figure 22, DDP exhibits high similarity with a predicted 11.4 kD protein from the fission yeast S. pombe based on exon predictions from genomic sequence (GenBank Z54308, gene SPAC13G6.04). The predicted yeast protein has 98 amino acids with high similarity to DDP over 63 amino acids (40% identity; 60%> similarity). A second predicted polypeptide translated from the EST yv59a08.sl (GenBank N57799) also has similarity to DDP over 64 amino acids (42%) identity; 62% similarity). Likewise, MM_23 shares significant similarity with the DDP protein (41% identity).
  • the transcript detected by MM_23 is highly expressed in fetal brain and continues to be highly expressed in adult brain, suggesting that it may be involved in neurological development. While the present data indicate that this molecule is expressed at a low level in a variety of tissues, it is enriched in microglia as compared to macrophage cells. The differential expression of this molecule again reveals sustained physiological differences between microglia and macrophages. Further, given the differential expression it is possible that MM 23 could be useful as a marker to differentiate between microglia and macrophages in normal CNS.
  • the MM_23 sequence shown in Figure 23 (SEQ ED NO: 106) has been cloned into an expression vector. Nucleotides 212-252 of SEQ JD NO: 106 are homologous to nucleotides 1-41 of SEQ ED NO: 13.
  • the open reading frame of MM_23 was amplified under high fidelity PCR conditions, using a pfu:Taq polymerase unit ratio of 2:1 and primers ATGGCCGAGCTTGGTGAAGCGGAC (SEQ ED NO: 107) and CTGCCCTCCTTTCTGTACGATCTG (SEQ ID NO: 108), in which the former contains the MM_23 initiator methionine triplet.
  • the PCR product was isolated from a preparative gel, TA cloned into pBAD-TOPO (Invitrogen, Carlsbad, CA), and used to transform
  • Plasmid was isolated from a single transformant and the sequence of its insert was determined and found to be identical to the MM_23 open reading frame.
  • a map of the pBAD-TOPO expression vector is shown in Figure 24.
  • the described MM_23 expression vector can be used to generate protein for functional studies and for the production of MM_23-specific antibodies.
  • MM_23 can be used in research and diagnostic testing to monitor the presence of DDP and related gene products.
  • labeled MM 23 or fragments thereof can be used as probes for northern blots and in situ hybridization.
  • Translations of MM_23 (“MM_23 peptides") can be used to make antibodies that are useful for identifying conesponding polypeptides in techniques such as western blotting, immunocytochemistry, and ELISA assays using standard techniques such as those described in U.S. Patent No. 4,900,811.
  • EXAMPLE 11 Further Characterization of MM 37 The clone MM_37 (digital address CGGG 246) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-C-G-G-G; SEQ ED NO: 117) paired with a 3'-PCR primer (SEQ ED NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 246 bp PCR product was isolated and characterized as described below. The sequence of the insert is given in SEQ ID NO: 25.
  • Ml 4689 which conesponds with the mouse surfeit locus surfeit 3 gene.
  • Northern Blot analyses were performed to determine the differences in expression between unstimulated and stimulated microglia and macrophage cells.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells, and dendritic cells as previously described.
  • the microglial, macrophage and dendritic cells were isolated according to the previously described methods.
  • the microglia and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • MM_37 is expressed in unstimulated and stimulated microglia and unstimulated dendritic cells, but not in macrophage cells.
  • MM_37 is identical to the mouse surfeit locus surfeit 3 gene. While many of the genes in this locus have been well studied, this molecule has only been minimally characterized.
  • Northern blot analysis validates the expression pattern predicted by the TOGA profile. By northern blot analysis, we find that the expression of this molecule modestly increases during development, but that its expression is easily detected at all pre- and post-natal time points.
  • the clone MM_22 (digital address TCTT 296) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-T-C-T-T; SEQ ID NO: 118) paired with 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 296 bp PCR product was isolated and characterized as described below. The sequence of the insert is given in SEQ ID NO: 12.
  • the MM 22 clone conesponds to the 3' region of the murine homologue of Cas ligand with multiple Src homology 3 domains (CMS) (AA122524).
  • CMS multiple Src homology 3 domains
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from freshly-isolated brain tissue of neonatal (postnatal day 1, PI) and adult mice, as well as from murine lung, heart, kidney, liver, spleen, lymph nodes, testes and brain tissues (cortex, midbrain, brainstem, cerebellum).
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_22 insert was radiolabeled and used as the oligonucleotide probe.
  • MM_22 is a transcript of about 6 kb that is weakly expressed ubiquitously throughout the body. In brain tissue, MM_22 expression is very low in the cortex and cerebellum.
  • Figure 26B shows that MM_22 is weakly expressed in post-natal and adult brain as well as unstimulated and stimulated glial cells. MM_22 does not appear to be expressed in macrophage cells. The highest level of expression was found in fibroblast cells.
  • the clone MM 59 (digital address GGCC 255) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5 -PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-G-G-C-C; SEQ ID NO: 119) paired with a 3'-PCR primer (SEQ ED NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The resultant 255 bp PCR product was isolated and characterized as described below. The sequence of the insert is given in SEQ ED NO: 32.
  • MM_59 is homologous to BRAK (509 bp), KEC (1884bp) (M34815) and BMAC (L12030). See Table 2.
  • the BRAK CXC chemokine which is down regulated in cancer cell lines, is also known as BMAC (Sleeman et al., International Immun., 12:677 (2000)).
  • BMAC BMAC
  • BRAK BMAC has been found to be a chemoattractant for macrophages and B cells. See Sleeman et al. Using MM_59 as a probe, two transcripts of approximately 0.5 kb and 1.9kb are detected on northern blots.
  • BMAC generates a CXC chemokine that differs only by the amino acids 16-18. In BRAK KEC, this amino acid sequence is CAS, in BMAC, it is YTA.
  • MM_59 was cloned from 3 different mouse templates (microglia, mixed glial cultures and brain). From each template, only the BMAC and not the BRAK/KEK orf was cloned. By northern blot analysis, MM_59 was shown to be expressed at high levels in the rodent CNS, ovaries and gut, with the larger transcript being expressed at approximately 5-10 fold higher levels than the smaller transcript. Similar expression, but at lower levels can be detected in most tissues examined. The expression of this molecule may be regulated in a cell-type specific manner. Microglial but not astrocytic or macrophage expression of this molecule is down regulated in response to acute LPS/TFN ⁇ treatment. Treating microglia with LPS almost completely suppresses MM_59 expression.
  • MM 59 expression appears to be unlike most chemokines, its expression in a knock-out mouse model that lacks the NFkb subunit relB (relB KO) was examined.
  • the relB KO mouse develops a spontaneous pattern of tissue inflammation, in which all tissues with the exception of the brain, ovaries and gut eventually become totally inflamed by granulocytes. Analyzing the tissue distribution of MM_59 by northern blot, we found that the rate and propensity for a tissue in the relB KO mice to become inflamed was inversely conelated with the levels of MM_59. For example, while brain, ovary and testes are all considered immunologically privileged sites, only the testes was inflamed.
  • MM_59 is expressed by glial and neuronal cells. Within the CNS, MM_59 expression was found to be highest in intemeurons of the cortex and hippocampus, in the purkinje cell layer of the cerebellum, in the septum, the inferior colliculus and the islands of Calleja. As analyzed on a northern blot purchased from Clontech, MM 59 expression throughout the human CNS appeared to parallel that observed in mouse CNS by in situ hybridization analysis.
  • Figure 31 shows the level of CXCL14 (MM_59) expression in human brain tissue.
  • Lane 1 is amygdala
  • lane 2 is caudate nucleus
  • lane 3 is co ⁇ us collosum
  • lane 4 is hippocampus
  • lane 5 is whole brain
  • lane 6 is substratia nigra
  • lane 7 is thalamus.
  • BMAC has been demonstrated to be a potent chemoattractant for macrophages and B cells and to be highly expressed in leukocytes infiltrating the immunosuppressive environment of malignant tumors.
  • Various northern Blot analyses were performed to determine the pattern of expression in various tissues and cells and to determine differences in expression between unstimulated and stimulated microglia and macrophage cells and dendritic cells.
  • the developmental profile of MM 59 expression was determined.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures and peritoneal macrophage cells, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • poly A enriched mRNA was prepared from murine lung, heart, kidney, liver, spleen, lymph nodes, testes and brain tissues (cortex, midbrain, brainstem, cerebellum).
  • poly A+ mRNA was prepared from embryonic (day 14, 16, 18) and post-natal (day 1, 5, 10, 15, 20, 25, 30) and adult brain, as well as embryonic (day 16) and adult liver.
  • the poly A enriched mRNA was prepared as described in Example 3.
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_59 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 27A shows the northern analyses of the above-described tissues. MM_59 recognizes two transcripts of approximately 0.5 kb and 1.9 kb in northern blots. Figure 27A shows that MM_59 is expressed in microglia, but is undetectable in macrophage and dendritic cells. The level of expression in the 0.5 kb transcript is much greater than the expression of the 1.9 kb transcript. Further, the expression of both transcripts is dramatically down-regulated by LPS or LPS/IFN ⁇ stimulation.
  • Figure 27B shows that MM_59 is expressed in embryonic brain, with the level of expression of the 1.9 kb transcript increasing over time after birth. The highest level of expression was found in adult brain.
  • the lower panel of Figure 27B shows a longer expression of the northern blot.
  • the level of expression of the 0.5 kb transcript was lower than that of the 1.9 kb transcript.
  • the 0.5 kb transcript appeared to have the same or slightly greater expression in embryonic brain tissue.
  • MM_59 is not expressed in embryonic or adult liver.
  • Figure 27C shows that MM_59 is expressed at high levels in the CNS, with the larger transcript being expressed at approximately 5-10 fold higher levels than the smaller transcript.
  • Figure 27D which displays a longer exposure of the northern blot shown in Figure 27C, similar expression can be found in other tissues, although the expression is much lower than the expression found in the CNS.
  • Figure 28 shows a northern blot analyses of MM_59 (GGCC 255), where an agarose gel containing 2 ⁇ g of polyA enriched RNA from brain, kidney, and heart tissue taken from control mice (lanes 1, 3, 5) and from brain, kidney, and heart tissue taken from relb knockout mice (lacking the NF-kB subunit relb gene; lanes 2, 4, 6) was blotted after electrophoresis and probed with radiolabeled MM_59.
  • MM_59 is abundantly expressed throughout healthy adult mouse CNS. Expression of MM_59 is especially abundant in a subset of intemeurons located in the cortex and hippocampus, the islands of Calleja, and the Purkinje cell layer of the cerebellum. See Figure 29.
  • in situ analyses were performed. Brains were removed from mice that had been euthanized by halothane inhalation and then perfused with 4% paraformaldehyde in saline. Brains were prepared and analyzed for MM_59 expression by in situ hybridization as detailed in de Lecea et al. Mol. Brain Res. 25:286-296 (1994). A 35 S-labeled riboprobe was prepared from a plasmid containing nucleotides 1282-1768 of the reported KEC sequence (accession number AF192557).
  • FIG. 29A-F depict sections taken from the rostral ( Figure 29 A) to the caudal ( Figure 29F) of the healthy adult mouse brain.
  • MM_59 expression is detected in intemeurons of the cortex, islands of Calleja and the septum as shown in Figure 29A-C.
  • Figure 29D MM_59 expression is detected in the cigulate cortex, intemeurons of the cortex and hippocampus.
  • Figure 29E-F shows that MM 59 expression in the cerebellum is detected in the Purkinje layer. MM_59 expression was also detected in the inferior colliculus as shown in Figure 29E.
  • MM_59 expression has also been detected in the brains of other species, as shown in Figures 30-32.
  • Figure 30 shows the level of CXCL14 (MM_59) expression as determined by northern blot analysis.
  • Lane 1 contained RNA extracted from rat brain tissue
  • lane 2 contained RNA extracted from rat liver tissue
  • lane 3 contained RNA extracted from mouse brain tissue
  • lane 4 contained RNA extracted from mouse liver tissue
  • lane 5 contained RNA extracted from monkey brain tissue
  • lane 6 contained RNA extracted from monkey liver tissue.
  • the expression of MM_59 in rat, mouse, and monkey brain is higher than that seen in the liver of the same species.
  • Brain region specific expression of MM 59 was detected in the human brain.
  • Figure 31 shows the level of CXCL14 (MM_59) expression in human brain tissue.
  • Lane 1 contained RNA extracted from amygdala
  • lane 2 contained RNA extracted from caudate nucleus
  • lane 3 contained RNA extracted from co ⁇ us callosum
  • lane 4 contained RNA extracted from hippocampus
  • lane 5 contained RNA extracted from whole brain
  • lane 6 contained RNA extracted from substratia nigra
  • lane 7 contained RNA extracted from thalamus.
  • the expression pattern showed higher expression in gray matter structures than in the white matter of the co ⁇ us callosum.
  • Figure 32 shows the level of CXCL14 (MM_59) expression in rat tissue.
  • Lane 1 contained RNA extracted from olfactory bulb
  • lane 2 contained RNA extracted from hippocampus
  • lane 3 contained RNA extracted from thalamus
  • lane 4 contained RNA extracted from cerebellum
  • lane 5 contained RNA extracted from liver
  • lane 6 contained RNA extracted from kidney
  • lane 7 contained RNA extracted from heart
  • lane 8 contained RNA extracted from whole brain
  • lane 9 contained RNA extracted from cortex
  • lane 10 contained RNA extracted from liver
  • lane 11 contained RNA extracted from ovaries
  • lane 12 contained RNA extracted from testes.
  • MM_59/ BRAK KEC may play a role in immunosuppression and the maintenance of immune privilege of the CNS.
  • RelB knockout mice lacking the NF-kB subunit RelB develop spontaneous macrophage and granulocyte inflammation in all tissues except the brain.
  • Northern Blot analyses was performed using RNA extracted from brain, kidney and heart tissue taken from control mice and RelB knockout mice. As shown in Figure 28, the level of MM_59 mRNA expression in kidney and heart tissue of RelB knockout mice is significantly decreased compared with the level of expression found in control mice.
  • the clone MM_6 (digital address ATGG 384) was obtained using the above- described TOGA analysis methods.
  • the TOGA data was generated with a 5'-PCR primer (C-G-A-C-G-G-T-A-T-C-G-G-A-T-G-G; SEQ ED NO: 120) paired with a 3'-PCR primer (SEQ ID NO: 68) labeled with 6-carboxyfluorescein (6FAM, ABI) at the 5' terminus.
  • PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software.
  • the resultant 384 bp PCR product was isolated and characterized as described below. The sequence of the insert is given in SEQ ID NO: 24.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells, and dendritic cells as previously described.
  • the microglial, macrophage and dendritic cells were isolated according to the previously described methods.
  • the microglia and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • LPS/IFN ⁇ 50 ng/ml LPS; 10 U/ml IFN ⁇
  • apolipoprotein D (apoD) is expressed in stimulated microglia.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells, and dendritic cells as previously described.
  • the microglial, macrophage and dendritic cells were isolated according to the previously described methods.
  • the microglia and macrophage cells were either unstimulated or stimulated for 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml EFN ⁇ ) prior to RNA isolation.
  • apoD is expressed in low levels in unstimulated microglia, but not in macrophage or dendritic cells. The level of expression is greatly increased in stimulated microglia.
  • Figure 35 demonstrates the upregulation in expression of apoD (MM_66) in the CNS after intracranial inj ection of LPS/EFN ⁇ .
  • the clone MM 115 (digital address CGTG 160) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_115 was expressed by microglia at a level approximately four-fold that seen in macrophages (Table 1). The resultant PCR product was sequenced directly as described above. The sequence of the insert is given in SEQ ED NO: 57.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 24 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation.
  • LPS/IFN ⁇ 50 ng/ml LPS; 10 U/ml IFN ⁇
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_115 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 36 demonstrates that the expression of MM_115 is higher in microglia and dendritic cells compared to macrophages, showing an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglia (untreated, lane 1; treated 24 hours with LPS/IFN ⁇ , lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/IFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_115.
  • Figure 37 shows the results of an analysis of in situ hybridization of MM_115 in a coronal section through an anterior level of the cerebrum of an adult mouse. Labelling in the cortex was greater than that in subcortical regions.
  • the clone MM_80 (digital address TTCG 211) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_80 was expressed by microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ XD NO: 47.
  • UI,sl NIH_BMAP_M_S3.2 Mus musculus cDNA clone UI-M-BH2.2-aot-b-08-0-UI 3' (AW122698.1).
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_80 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 38 shows northern blot analyses of MM_80 and MM_81 in various adult mouse tissues, where an agarose gel containing polyA enriched RNA was blotted after electrophoresis and probed with radiolabeled MM_80 and MM_81. Expression of both clones was highest in the CNS (cerebral cortex, lane 1; midbrain, lane 2; brainstem, lane 3; cerebellum, lane 4). MM_80, but not MM_81, was detected in liver (lane 8), testes (lane 11), kidney (lane 7) and heart (lane 6). Neither MM_80, nor MM_81, was detected in lung (lane 5), spleen (lane 9), and lymph node (lane 10).
  • the clone MM_81 (digital address TAAG 387) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%o acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_81 was expressed by unstimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ED NO: 48.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic cells as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_81 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 38 shows northern blot analyses of MM 80 and MM_81 in various adult mouse tissues, where an agarose gel containing polyA enriched RNA was blotted after electrophoresis and probed with radiolabeled MM_80 and MM_81. Expression of both clones was highest in the CNS (cerebral cortex, lane 1; midbrain, lane 2; brainstem, lane 3; cerebellum, lane 4). MM_80, but not MM_81, was detected in liver (lane 8), testes (lane 11), kidney (lane 7) and heart (lane 6). Neither MM_80, nor MM_81, was detected in lung (lane 5), spleen (lane 9), and lymph node (lane 10).
  • Figure 39 shows the results of an analysis of in situ hybridization of MM_8l in a coronal section of the cerebellum of an adult mouse. MM_81 could be detected only in the cerebellum.
  • MM_90 (digital address GAGC 419) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_90 was expressed by unstimulated microglia at a higher level than that seen in macrophages (Table 1).
  • Figure 40A-D shows the results of an analysis of in situ hybridization of MM_90 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing the pattern of MM_90 mRNA expression in vivo in untreated control (A,B) and in the brain of a mouse 24 hours after an intracranial injection of LPS/IFN ⁇ , showing expression in the hypothalamus (A, C) and thalamus (B, D).
  • MM_100 (digital address ATCG 400) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_100 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ED NO: 54.
  • Figure 41 shows the results of an analysis of in situ hybridization of MM 100 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in the hippocampus and lateral cortex in untreated control (A) and in the brain of a mouse 24 hours after an intracranial injection of LPS/EFN ⁇ (B).
  • the clone MM 101 (digital address ATCG 435) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_101 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ JD NO: 55.
  • Figure 42 shows the results of an analysis of in situ hybridization of MM_101 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior (A) and posterior levels (B) of the brain.
  • MM_102 (digital address ATCT 208) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_102 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1).
  • the MM_102 clone conesponds to computer assembled sequence based on ESTs: AI256075, AI646534, C86260, AI256514, AI195552, AI430738, AI173243, AA960218, AI427669, AI414333, AU041540, AI266934.
  • Analysis of in situ hybridization determined the regional distribution of expression the brains of untreated mice. Also, a BLAST analysis of this sequence shows an alignment with AI132688 (EST) and AI256075 (EST).
  • Figure 43 shows the results of an analysis of in situ hybridization of MM 102 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in the cerebrum of an untreated control (A) and in the cerebrum (B) and cerebellum (C) of a mouse 24 hours after an intracranial injection of LPS/IFN ⁇ .
  • MM_48 (digital address TGCC 268) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_48 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ED NO: 38.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic cells as previously described. The microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 24 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM 48 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 44 demonstrates that the expression of MM_48 can be detected in stimulated microglia, showing an agarose gel containing 2 ⁇ g of polyA enriched RNA from microglia (untreated, lane 1; treated 24 hours with LPS/IFN, lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/IFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_48.
  • the clone MM_51 (digital address GCGC 301) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%o acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_51 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ID NO: 28.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic cells as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/IFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation
  • Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_51 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 45 demonstrates that the expression of MM_51 is higher in microglia than in macrophages, showing an agarose gel containing polyA enriched RNA from microglia (untreated, lane 1; treated 24 hours with LPS/IFN ⁇ , lane 2; treated 24 hours with LPS, lane 3), macrophages (untreated, lane 4; treated 24 hours with LPS/IFN ⁇ , lane 5), and dendritic cells (lane 6) blotted after electrophoresis and probed with radiolabeled MM_51.
  • the clone MM_75 (digital address GACC 172) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_75 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ED NO: 45.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic cells as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3.
  • the microglia and macrophage cells were either unstimulated or stimulated for 1 hour or 22 hours with LPS/EFN ⁇ (50 ng/ml LPS; 10 U/ml IFN ⁇ ) prior to RNA isolation Northern blot analyses were performed according to the method described in Example 3, using 2 ⁇ g of poly A enriched mRNA.
  • the MM_75 insert was radiolabeled and used as the oligonucleotide probe.
  • Figure 46 shows the results of northern blot analyses of clone MM_75, where an agarose gel containing 2 ⁇ g of poly A enriched mRNA from various murine tissue and cells was blotted after electrophoresis and probed with radiolabeled MM_75.
  • Cells from mixed glial cultures (lanes 5,6) and peritoneal macrophage cultures (lanes 7-9) were either untreated (control) or treated with LPS/EFN- ⁇ (50 ng/ml LPS; 10 U/ml IFN- ⁇ ) of 1 hour or 24 hours prior to mRNA isolation. Tissues from postnatal day 1 spleen, adult spleen, postnatal day 1 brain and adult brain, were untreated.
  • the clone MM_106 (digital address CCAC 292) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_106 was expressed by both unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of MM_106 is given in SEQ ED NO: 180.
  • Poly A enriched mRNA was prepared from microglia isolated from murine mixed glial cultures, peritoneal macrophage cells and dendritic cells, as well as form various adult mouse tissues, as previously described.
  • the microglial and macrophage cells were isolated according to the previously described methods in Example 3. Only 1 transcript was detected by northern blot analysis, with similar levels of expression being detected in all regions of the brain, in the kidney and in the liver. Expression was only weakly detected in macrophages and in LPS-stimulated kidney fibroblasts. The expression of MM_106 was more than 5-fold higher in LPS-stimulated kidney fibroblasts isolated from a mouse model lacking the expression of the NF-kb subunit, relB. MM_106 expression was not detected in lymph node, heart, lung or testes.
  • Figure 47 shows the results of an analysis of in situ hybridization of MM_106 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in posterior levels of the brain.
  • MM_106 expression was detected in hippocampal neurons, in the Purkinje cell layer of the cerebellum, in the amygdala and in glia throughout the CNS .
  • the clone MM_151 (digital address AGTT 435) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5% acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_151 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ JD NO: 64.
  • MM_151 was performed to determine the regional distribution of expression in the adult mouse brain.
  • Figure 48 shows the results of an analysis of in situ hybridization of MM_151 in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior levels of the brain. Expression is weakly detected in glia throughout the brain but not in neurons.
  • EXAMPLE 28 Further Characterization of MM 78
  • the clone MM_78 (digital address TTTC 437) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%o acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_78 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the insert is given in SEQ ED NO: 174.
  • the MM_78 clone conesponds to M.musculus PN-1 mRNA for protease-nexin 1 (X70296.1). This molecule is known to be expressed during gonadal development and during CNS inflammation and/or neurodegeneration. Its expression in microglia and macrophages has not been examined. Analysis of in situ hybridization of MM_78 was performed to determine the regional distribution of expression in the adult mouse brain.
  • Figure 49 shows the results of an analysis of in situ hybridization of MM_78 in coronal sections of the brain of an adult mouse using an antisense cRNA probe. Expression is found in the cerebral cortex and in subcortical structures of the hemispheres.
  • EXAMPLE 29 Further Characterization of MM 71 and MM 92
  • the clone MM_71 (digital address AAGG 394) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%) acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM 71 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the MM_71 clone is given in SEQ JD NO: 43.
  • MM_71 expression is detected in microglia but not macrophages or dendritic cells. While MM_ 71 expression can be detected in most tissues, it is most abundant in lymph node, kidney and liver. Within the brain, MM_71 expression is nearly as high in the cortex as in the lymph node. MM_71 expression can be detected in midbrain, brainstem and cerebellum but at much lower levels. Using a probe derived from MM_71, two transcripts can be detected in all tissues.
  • the clone MM_92 (digital address AAGG 409) was obtained using the above- described TOGA analysis methods. PCR products were resolved by gel electrophoresis on 4.5%> acrylamide gels and fluorescence data acquired on ABI377 automated sequencers. Data were analyzed using GeneScan software. The TOGA results showed that MM_92 was expressed by unstimulated and stimulated microglia at a higher level than that seen in macrophages (Table 1). The sequence of the MM_92 clone is given in SEQ JD NO: 177.
  • MM_92 showed 100%) alignment for DST nucleotide range 1 - 323 to AI121233, All 18543, AA986119 ((Mouse ESTs similar to insulin-like growth factor binding protein 4 (human)), but does not share homology with other molecules entered in GenBank.
  • Figure 50 shows the results of an analysis of in situ hybridization in coronal sections of the brain of an adult mouse using an antisense cRNA probe showing expression in vivo in anterior (A) and posterior (B, C) levels of the brain.
  • MM_1 1 showed 96% alignment for DST nucleotide range 1 - 201 with accession # AF213458 1 (Mus musculus triggering receptor expressed on myeloid cells 2) Same analysis of MM_15 showed 100% , ; alignment for DST nucleotide range 3 - 144 with accession # U47330, U47328, V00747 (Mus musculus MHC) Subsequent analysis of MM_16 showed I I 99%> alignment for DST nucleotide range 5 - 210 with accession # AF093677 (Mus musculus ATPase subunit 6)
  • MM_32 showed 99% alignment for DST nucleotide range 1 - 210 with accession # AF093677 (Mus musculus ATPase subunit 6)
  • MM_38 showed 98% alignment for DST nucleotide range 1 - 209 with accession # AF179241 , 99% alignment for DST nucleotide range 1 - 200 with accession # NM_01 1303 and X95281, 99% alignment for DST nucleotide range 1 - 113 with AF061743 (Mus musculus retinal short-chain dehydrogenase/reductase)
  • Same analysis of MM_48 showed 88% alignment for DST nucleotide range 39 - 21 1 with accession # AI840424 (EST)
  • MM_59 Subsequent analysis of MM_59 showed 99% alignment for DST nucleotide range 1 - 195 to accession # AF144754 1 (Mus musculus BMAC) Same analysis of MM_68 showed 96% alignment for DST nucleotide range 1 - 217 with accession # M95780 (Rat G protein gamma-5 subunit mRNA)
  • MM 71 Same analysis of MM 71 showed 100% alignment for DST nucleotide range 1 - 323 with accession AI121233 and AA9861 19 (Mouse ESTs similar to insulin-like growth factor binding protein 4 (human))
  • MM 1 1 showed 98% alignment of DST nucleotide range 1 - 310 to accession # AA529455 (EST. mouse NADH-ubiquinone oxidoreductase chain 1). Same analysis of MM 1 18 showed 87% alignment of DST nucleotide range 1 - 149 to accession # AFl 12200.1 (H.
  • MM 15 Same analysis of MM 15 showed 100% alignment for DST nucleotide range 3 - 144 with accession # U47330, U47328, V00747 (Mus musculus MHC) Subsequent analysis of MM 16 showed 99% alignment for DST nucleotide range 5 - 210 with accession # AF093677 (Mus musculus ATPase subunit 6)
  • MM_32 showed 99% alignment for DST nucleotide range 1 - 210 with accession # AF093677 (Mus musculus ATPase subunit 6)
  • MM_38 showed 98% alignment for DST nucleotide range 1 - 209 with accession # AF179241 , 99% alignment for DST nucleotide range 1 - 200 with accession # NM_01 1303 and X95281 , 99% alignment for DST nucleotide range 1 - 1 13 with AF061743 (Mus musculus retinal short-chain dehydrogenase/reductase)
  • MM 59 showed 99% alignment for DST nucleotide range 1 - 195 to accession # AFl 44754 1 (Mus musculus BMAC) Same analysis of MM_48 showed 88% alignment for DST nucleotide range 39 - 211 with accession # AI840424 (EST) Same analysis of MM_68 showed 96% alignment for DST nucleotide range 1 - 217 with accession # M95780 (Rat G protein gamma-5 subunit mRNA)
  • MM_71 Same analysis of MM_71 showed 100% alignment for DST nucleotide range 1 - 323 with accession AI121233 and AA9861 19 (Mouse ESTs similar to insulin-like growth factor binding protein 4 (human)
  • MM 75 Same analysis of MM 75 showed 100% alignment for DST nucleotide range 1 - 112 with accession # M60579 •
  • MM_1 1 showed 98% alignment of DST nucleotide range 1 - 310 to accession # AA529455 (EST mouse NADH-ubiquinone oxidoreductase chain 1) Same analysis of MM 1 18 ; showed 87% alignment of DST nucleotide range 1 - 149 to accession # AFl 12200 1 (H sapiens NADH-oxidoreductase B 18 subunit) Same analysis of MM_124 showed 94% alignment of DST nucleotide range 1 - 315 to accession # Ml 2672 1 (Rat guanine nucleotide-binding protein G-i, alpha subunit) Same analysis of MM_142 : showed alignment to multiple parts of AC002327 1 (DST may contain a repetitive sequence) Same analysis of MM_151 showed 96% alignment of DST nucleotide range 1 - 377 to accession # AFl 33093 1 (Mus musculus X chromosome Llcam loc

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente invention concerne des polynucléotides, des polypeptides, des kits et des procédés relatifs aux gènes régulés caractéristiques des microglies et des macrophages.
PCT/US2000/030585 1999-11-12 2000-11-06 Expression genetique modulee par l'activation de microglies ou de macrophages WO2001034770A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU15867/01A AU1586701A (en) 1999-11-12 2000-11-06 Gene expression modulated by activation of microglia or macrophages

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
USPCT/US99/26824 1999-11-12
PCT/US1999/026824 WO2000028013A2 (fr) 1998-11-12 1999-11-12 Expression genique modulee par l'activation de microglia ou de macrophages
US18677000P 2000-03-03 2000-03-03
US60/186,770 2000-03-03
US21246500P 2000-06-19 2000-06-19
US60/212,465 2000-06-19

Publications (2)

Publication Number Publication Date
WO2001034770A2 true WO2001034770A2 (fr) 2001-05-17
WO2001034770A3 WO2001034770A3 (fr) 2001-12-20

Family

ID=27378789

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/030585 WO2001034770A2 (fr) 1999-11-12 2000-11-06 Expression genetique modulee par l'activation de microglies ou de macrophages

Country Status (2)

Country Link
AU (1) AU1586701A (fr)
WO (1) WO2001034770A2 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002063007A2 (fr) * 2001-02-08 2002-08-15 Incyte Genomics, Inc. Proteine associee a timm8b

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
CARNINCI ET AL.: 'Thermostabilization and thermoactivation of thermolabile enzymes by trehalose and its application for the synthesis of full lenght cDNA' PROC. NATL. ACAD. SCI. USA vol. 95, no. 2, January 1998, pages 520 - 524, XP002941376 *
GRIMA ET AL.: 'A Novel transcript overlapping the myelin basic protein gene' JOURNAL OF NEUROCHEMISTRY vol. 59, no. 6, 1992, pages 2318 - 2323, XP002941375 *
WATSON ET AL.: 'The science used in the recombinant DNA industry', 1983, W.H. FREEMAN AND COMPANY, NEW YORK XP002941377 Recombinant DNA; A Short Course * page 231 - page 241 * *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002063007A2 (fr) * 2001-02-08 2002-08-15 Incyte Genomics, Inc. Proteine associee a timm8b
WO2002063007A3 (fr) * 2001-02-08 2003-05-01 Incyte Genomics Inc Proteine associee a timm8b

Also Published As

Publication number Publication date
WO2001034770A3 (fr) 2001-12-20
AU1586701A (en) 2001-06-06

Similar Documents

Publication Publication Date Title
US7098316B2 (en) Human proteins
US20090088555A1 (en) 44 Human Secreted Proteins
US20080020969A1 (en) 36 Human Secreted Proteins
JP2001524814A (ja) ２８種類のヒト分泌タンパク質
EP1093457B1 (fr) Analogue de chaine gamma commune de recepteur de cytokine
US6844170B1 (en) Cytokine receptor common gamma chain like
US20070042416A1 (en) Dendritic Enriched Secreted Lymphocyte Activation Molecule
WO2001034770A2 (fr) Expression genetique modulee par l'activation de microglies ou de macrophages
CA2321970A1 (fr) Proteines secretees par l'homme
WO2001029179A2 (fr) Regulation de l'expression genetique par des neuromodulateurs
CA2389110A1 (fr) Regulation de l'expression genetique au moyen d'agents neuroleptiques
WO2000028013A2 (fr) Expression genique modulee par l'activation de microglia ou de macrophages
WO2002031114A2 (fr) Expression genique module dans l'ileite
WO2001012647A1 (fr) Expression genique modulee en tumorigenese de l'ataxie-telangiectasie
WO2002031116A2 (fr) Expression genique modulee dans des maladies enteriques inflammatoires spontanees
CA2376667A1 (fr) Expression genique modulee dans des inflammations gastro-intestinales
WO2002042420A2 (fr) Modulation de l'expression de genes lors de l'hyperplasie de l'intima de l'artere carotide
WO2001054651A2 (fr) Modulation de l'expression genique dans la formation de lesions atherosclereuses grasses
WO2003091390A2 (fr) Regulation de l'expression genique par des neuromodulateurs et identification d'une nouvelle proteine induite par le ngf denommee pincher
EP1333092A2 (fr) 28 protéines secrétées par l'homme
WO2000073324A9 (fr) Modulation d'expression genique dans une inflammation gastro-intestinale
WO2002081726A2 (fr) Modulation de l'expression genetique dans des modeles genetiques murins de l'atherosclerose
EP1557426A2 (fr) 45 Protéines humaines secrétées
EP1439224A2 (fr) 67 protéines humaines secretées

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase