WO2001034633A2 - Methods for treatment of human huntington's disease and methods of screening for active agents - Google Patents

Abstract

Genes modulated by the expression of a mutant huntingtin protein associated with Huntington's Disease have been determined. A profile of mRNAs that are modulated has been established as neurodegeneration progresses through the disease. Levels of mRNA encoding components of neurotransmitters, calcium and retinoid signaling pathways at both early and late symptomatic disease states have been established. Methods for the treatment or amelioration of disease have been determined based on the mRNA profile determined. Further, methods for screening for agents active in ameliorating and/or preventing progression of Huntington's Disease can be determined by examining changes in the level of expression of the mRNAs and/or proteins of the Huntington's Disease profile of the present invention.

Description

METHODS FOR TREATMENT OF HUMAN HUNTINGTON'S DISEASE AND METHODS OF SCREENING FOR ACTIVE AGENTS

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

The United States Government may have certain rights in the present invention pursuant to the following grants received from the United States Public Health Service: NS10800, AG13617, NS38106 and HD28834.

BACKGROUND OF THE INVENTION

Huntington's Disease (HD) is an autosomal dominant neurodegenerative disorder manifest by psychiatric, cognitive and motor symptoms typically starting in mid- life and progressing relentlessly to death. HD affects 5 to 10 per 100,000 individuals in North America and Europe (Vonsattel and DiFiglia, J. Neuropathol. Exp. Neurol. 57:369- 384 (1998)). The disease-causing mutation in HD is an expansion of a "cag" repeat in the open reading frame of exon 1 of the IT15 gene resulting in an expansion of polyglutamines in the corresponding protein designated huntingtin (Huntington's Disease Collaborative Research Group, Cell 72:971-983 (1993)).

In HD, the striatum shows the greatest magnitude of neuronal degeneration. Within the striatum, degeneration is mostly attributable to the death of medium spiny GABAergic cells comprising more than 85% of all striatal neurons. The earliest and most marked losses generally occur among the dorsolateral enkephalin/D2-expressing neurons which project into the external globus palidus. Although huntingtin is ubiquitously expressed, the medium spiny GABAergic cells of the striatum are preferentially damaged in HD. There is no cure for this disorder, and there is currently no therapeutic approach to delay the onset of symptoms.

Positron emission tomography (PET) studies of presymptomatic human patients indicate that neurotransmitter receptor decreases occur prior to the onset of overt clinical symptoms (Lawrence et al., Brain 121 :1343-1355 (1998)). Decreases in neurotransmitter receptors has recently been demonstrated in a transgenic mouse HD model which are selective, in that certain receptors are decreased while others are not (Cha et al., Proc. Nat/. Acad. Set U.S.A. 95:6480-6485 (1998), Cha et al, Philos. Trans. Royal Soc. London B Biol. Sci. 354:981-989 (1999)).

The pattern of neurotransmitter receptor decreases cannot be attributed to degeneration of a specific population of cells, but rather appears to reflect down regulation of a specific subset of genes. These receptor changes, which occur both at the level of protein and mRΝA, precede and may thereby contribute to the onset of clinical symptoms. A transcription-related mechanism of huntingtin toxicity can also be inferred from other recent studies (Li et al., J. Neurosci. 19:5159-5172 (1999), Huang et al., Somat. Cell Mol. Genet. 24:217-233 (1998), Boutell et al., Hum. Mol. Genet. 8:1647-1655 (1999)).

The present invention provides evidence that mutated huntingtin-induced changes in gene expression extend to physiologically functional categories of genes in addition to neurotransmitter receptors. Based on the determination of the functional categories of genes impacted by expression of a mutated huntingtin protein provides a progressive model for Huntington's Disease progression, which in turn has offered a basis for multiple modes for pharmaceutical intervention to alleviate at least some symptoms associated with disease, if not a method for stopping neurodegeneration and disease progression.

SUMMARY OF THE INVENTION

The present invention provides an analysis of gene expression in a Huntington's Disease animal model which have been used to determine the scope of mR As affected by the expression of a mutant huntingtin protein as compared to gene expression in a wild type animal. Of over 6000 murine mRNAs that were measured, only a small number were decreased and these genes were remarkably restricted to genes encoding neurotransmitter, calcium, and retinoid signaling pathway components of neural cells. The present invention demonstrates that the decrease in the abundance of specific neurotransmitter receptors is associated with decreased expression of many genes that mediate the signaling response from these receptors. The data provide additional evidence that the mutant huntingtin protein compromises the ability of striatal neurons to receive and integrate afferent input and establishes a basis for rational therapeutic intervention. The present invention also demonstrates that the expression of many RNAs that encode proteins localized to raft and caveolar domains are selectively disrupted by mutant huntingtin protein and that treatments or agents that normalize the structure of raft/caveolar domains or the expression of raft/caveolar components can be of therapeutic benefit to individuals with Huntington's Disease.

In particular, the present invention provides a method for treating Huntington's Disease in a mammal in need of such treatment which comprises administration of a therapeutically effective amount of a retinoic acid receptor agonist or antagonist, a dopamine receptor agonist or antagonist, a calcium reducing and/or regulating agent, including, but not limited to, a ryanodine receptor agonist or antagonist, an IP₃ receptor agonist or antagonist, an agent that promotes expression and/or activity of calcium ATPase or a calcium channel agonist, an agent that increases cAMP-dependent gene expression, an agent that normalizes the structure of rafts/caveolae or the expression of raft/caveolar constituents, a nerve growth factor, an agonist of the opioid or cannabinoid signaling pathways, or an anti-inflammatory agent to said mammal. These retinoic acid receptor agonist and dopamine receptor agonist can be expected to decrease the neural degeneration associated with the expression of a mutated huntingtin protein that is known to correlate with the appearance of the symptoms of Huntington's Disease. Particularly preferred retinoic acid receptor agonists are those which interact with RAR- and RXR- specific retinoic acid receptors, e.g., 9-cz^'s-retinoic acid.

The present invention also comprises methods for screening for agents useful in the treatment of Huntington's Disease comprising the steps of contacting a cell which over expresses a mutant huntingtin protein having an extended polyglutamate region with a test agent; and monitoring the expression of a transcript or a translation product, wherein the transcript or translation product is of a gene encoding a component of a neurotransmitter, calcium or retinoid signaling pathway, or a lipid raft/caveolar domain, wherein the agent is identified as useful in treating Huntington's Disease if it increases the expression of said gene in comparison to the expression level of the transcript or translation product in a wild type cell. Agents which increase the expression of genes which encode a G protein-coupled receptor, a dopamine receptor, a glutamate receptor or an adenosine receptor are of particular interest. More specifically, agents which increase the expression of genes which encode the dopamine D2 receptor, enkephalin, a cannabinoid receptor, glutamic acid decarboxylase, neuron-specific enolase, phosphatidylinositol triphosphate (IP₃) receptor, protein kinase C isoform β II, dopamine D2 receptor, dopamine D4 receptor, adrenergic α2 receptor, orphan glucocorticoid-inducible receptor (GIR), α-actinin 2, a neuropeptide precursor for enkephalin, a neuropeptide precursor for somatostatin, an adenylyl cyclase, a phosphodiesterase, a protein kinase, a phosphatase, a small G-protein, plasma membrane calcium ATPase PMCA1 AB, type 1 ryanodine receptor, type 1 IP₃ receptor (P400), calcineurin, hippocalcin, calmodulin-dependent phosphodiesterase PDE1B1, calcium/calmodulin dependent protein kinase CAMk IV/G2, retinoic acid receptor RXRγ, retinol binding protein, clathrin-associated protein 19 (API 9), phosphatidylcholine transfer protein (PC-TP), creatine kinase B, indoleamine 2,3- dioxygenase, brain fatty acid-binding protein (B-FABP), hydroxysteroid sulfotransferase (mSTa2), fatty acid transport protein (FATP), troponin C, tctex-1, gas5, MP4, meis 2, stearoyl-CoA desaturase, inositol polyphosphate 1 -phosphate, lipoprotein lipase, pentylenetetrazol-related gene PTZ-17, seizure-related product 6 type 3 precursor, telencephalin (ICAM-5), GADD45, glutamate receptor subunit GluR6/β-2, a RAPGAP, EDG- 1 , ARD3 , N AP22, protein phosphatase inhibitor 1 , N 10, or a gene containing a retinoic acid or cAMP response element are useful.

The present invention also provides methods of screening for agents useful in the treatment of Huntington's Disease comprising contacting a cell which over expresses a mutant huntingtin protein having an extended polyglutamate region with a test agent; and monitoring expression of a transcript or translation product, wherein the transcript or translation product is dysregulated by the expression of the mutant huntingtin protein, wherein the agent is identified as useful in treating Huntington's Disease if it decreases the expression of said gene in comparison to the level of expression of the transcript or translation product in a wild type cell. Agents which decrease the expression of a gene which encode a stress or inflammation mediator, a gene which is associated with cell cycle regulation, or which decrease the expression of the gene which encodes heterotrimeric G protein subunit Gγ3 are of particular use. Also, of particular use in the treatment of Huntington's Disease are agents which decrease the expression of genes which encode rotamase/cyclophilin A, immunophilin P59, cathepsin S, apolipoprotein D or MHC β2. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 depicts the functional relationships of products of differentially expressed genes in striatal medium spiny neurons. Bold type indicates products of differentially expressed mRNAs. Plain lines with triangular arrows represent sequential events or positive regulation; blunt bars represent negative regulation. Hatched arrows represent the flow of ions. Only representative members of the PP1/DARPP-32 regulatory pathway are shown.

DESCRIPTION OF THE SPECIFIC EMBODIMENTS

In accordance with the present invention, there is provided a method of preventing and/or slowing the progression of Huntington's Disease in an individual in need of such treatment, which comprises administration to the individual a therapeutic amount of an agonist or antagonist of retinoic acid or dopamine receptor, a calcium regulating agent, a cAMP regulating agent, a nerve growth factor, or an agonist of the opioid or cannabinoid signaling pathways.

In a still further aspect, the present invention extends to the use of particular retinoic acid receptor agonists for the prevention neuron degeneration, improvement of nerve signaling and the slowing of progression of Huntington's Disease pathology. In a particular embodiment the agonist is RAR- or RXR-specific. A particularly preferred retinoic acid receptor agonist comprises 9-cis retinoic acid, and derivatives thereof.

Accordingly, it is a principal object of the present invention to provide a method of preventing and/or slowing the progression of symptoms associated with Huntington's Disease. Prevention and/or slowing of disease can be practiced by up regulation of gene expression in the dopamine, glutamate and/or adenosine signal transduction pathways and/or down regulation of the inflammatory pathways, by administration of a pharmaceutically acceptable amount of an agonist or antagonist to the retinoic acid or dopamine receptor, a mediator of cellular calcium intake, growth factors, immunosuppressants, or opioid or cannabinoid agonists.

The present invention provides additional evidence that retinoic acid receptors were decreased in striatum of transgenic mice expressing a mutated huntingtin protein (R6/2, HD mice) when compared to wild-type littermate controls. R6/2 mice express exon 1 of the human IT 15 gene containing an extremely expanded CAG repeat (140-147) under control of the human IT15 promoter. These animals appeared to develop normally through weaning, but display subtle deficits starting at 5-6 weeks of age which progresses to a resting tremor, involuntary movements, stereotypic grooming and handling- induced seizures by 9-12 weeks of age (Mangiarini et al., Cell 87:493-506 (1996), Carter et al., J. Neurosci. 19:3248-3257 (1999)).

Retinoic acid receptors that were decreased at least two fold included RXRγ, RARβ, RARα and RXRβ. Also, numerous genes that are induced by retinoids were also diminished in R6/2 striatum compared to wild-type striatum. Because retinoic acid signaling is critical for nerve cell differentiation and maintenance and striatal nerve function the present invention provides a method for slowing or preventing neural cell degeneration comprising administration of a retinoic acid agonist.

Previous studies show deletion of the RXRγl gene in mice results in reduced numbers of striatal neurons, reduced neurotransmitter synthetic enzyme levels in residual striatal neurons, and impaired extrapyramidal function (Saga et al. Genes to Cells 4:219- 228 (1999)). In Huntington's Disease, the population of neurons that undergoes the most severe degeneration is the Dopamine D2 Receptor (D2R)-expressing spiny neurons. In cultured neural cells, retinoic acid-induced D2R mRNA is reduced by 30-fold in 48 hours (Samad et al. Proc. Natl. Acad. Sci. USA 94:14349-14354 (1997)). The present invention provides data which demonstrate that message for the D2R and genes that are downstream of D2R are also diminished in R6/2 mice.

Dependence on locally-produced retinoids can explain why striatal neurons are affected to a greater degree than other brain neurons and why neuronal degeneration occurs in a mediolateral gradient across the striatum. As part of the present analysis of gene expression in transgenic murine models of Huntington's Disease, gene expression in wild-type mouse striatum was compared to that of wild type mouse cerebellum. The two brain regions differ primarily by the preponderance of spiny neurons in striatum and the predominance of granule cells in cerebellum. Comparison of gene expression in the two cell types indicates retinoic acid receptors, D2R, and other genes in the retinoid pathway were more highly expressed in striatal neurons than in cerebellar neurons, suggesting that striatal neurons can be more retinoid dependent than granule cells. This is likely due to reliance of striatal cells on local retinoids. The glial cells which surround striatal neurons have recently been shown to produce retinoids. This feature was unique to striatal glial cells. Furthermore, glial cells in the lateral striatum produce more retinoids than in the medial striatum resulting in a concentration gradient across the striatum (Toresson et al. Development 126:1317-1326 (1999)). The gradient formed is opposite to the gradient of neural degeneration in Huntington's Disease suggesting that the first neurons that degenerate in HD are those surrounded by the lowest concentration of retinoids.

Reliance on local retinoids can be one explanation for the delayed onset of striatal neurodegeneration in Huntington's Disease. As described above the D2 dopamine receptor gene expression is induced by retinoids. The opposite is also true. Signaling through the D2R induces retinoic acid receptors in neurons. As humans and mice age, fewer D2Rs are expressed on striatal neurons. The data provided herein are consistent with a model in which striatal neural degeneration is initiated when retinoid signaling drops below a critical threshold. Since R6/2 mice have diminished retinoid signaling even at young, minimally symptomatic ages, the present invention provides that mice and humans with expanded repeat Huntingtin gene expressed in striatal neurons drop below the minimal threshold of retinoid signaling during early adulthood, leading to degeneration of neurons that are retinoid-dependent. A similar mechanism likely occurs in Parkinson's disease and may explain the high prevalence of Parkinson's disease in the elderly population, even among those with no identifiable genetic defects. Therefore, retinoid-based therapy can likely be beneficial to Huntington's Disease patients, Parkinson's Disease patients and other patients with neurodegenerative diseases.

Because dopamine signaling increases retinoic acid receptor gene transcription, the present invention also provides that dopamine agonists could partially restore retinoid signaling pathways. Therefore, dopamine agonists, with or without concurrent retinoic acid agonists, can likely delay onset of neural degeneration. Some HD patients have taken L-DOPA, a dopamine precursor, with no apparent improvement in symptoms. The apparent inability of L-DOPA or other dopamine agonists to reverse motor symptoms in advanced stage HD does not preclude testing these agents for efficacy in delaying the onset of neurodegeneration and related symptoms.

The present invention provides evidence that mammals expressing a mutant huntingtin protein down regulate distinct sets of G-protein-coupled receptors and the signal transduction cascades to which these receptors are coupled, particularly those converging on the regulation and downstream targets of c AMP. Moreover, decreased expression of genes known to be cAMP responsive is evident. Thus, agents acting on cAMP -related signaling cascades can be effective Huntington's Disease treatments when used alone or together with dopaminergic agents by allowing neurons to regain normal responsiveness to extracellular signals.

The present invention further provides evidence for diminished expression of genes encoding calcium-transporting ATPases at the plasma membrane, sarcoplasmic reticulum and endoplasmic reticulum in expanded huntingtin transgenic mice. In addition, numerous other calcium-regulating genes (e.g., calcium channel components, proteins modulated by calcium and calcium binding proteins) are aberrantly expressed. These data provide a mechanistic understanding behind the recent observation that intracellular calcium levels are increased in striatal neurons that over express expanded repeat huntingtin.

Pharmacologic approaches that regulate free intracellular calcium, including but not limited to, calcium entry blockers and NMDA antagonists have the potential to normalize intracellular calcium levels and restore neuronal function. Genetic approaches, such as over expression of calbindin or other calcium buffering molecules provide an alternative method to approach slowing or preventing Huntington's Disease progression. The present invention discloses that the expression of a mutant huntingtin protein disrupts the expression of mRNAs encoding proteins known to be enriched in specialized plasma membrane microdomains known as lipid rafts and caveolae (Brown and London, Annu. Rev. Cell Dev. Biol. 14:111-136 (1998); Anderson, Annu. Rev. Biochem. 67:199-225 (1998); Okamoto et al., J. Biol. Chem. 273:5419-5422 (1998); Maekawa et al., J. Biol. Chem. 274:21369-21374 (1999)). These include, but are not limited to mRNAs encoding, for example, G-protein coupled receptors, heterotrimeric G-protein subunits, ryanodine receptors, IP₃ receptors, adenylyl cyclases, NAP22, protein kinase C, and calcium ATPase. Also, mutant huntingtin protein decreases the expression of mRNAs encoding proteins known to associate with and/or regulate raft/caveolar proteins. These include, but are not limited to mRNAs encoding, for example, Rapl A-associated proteins (e.g., RapGapl), ras-associated proteins, calmodulin-binding proteins (e.g., calcineurin) and clathrin-associated proteins (e.g., API 9). These data indicate that agents that restore the expression of raft/caveolar components will benefit a mammal expressing a mutated huntingtin protein by restoring raft/caveolar structure and function.

Interruption of nerve growth factor signaling has previously been proposed as a mechanism involved in Huntington's Disease progression (Kordower et al., Exp. Neurol. 159:4-20 (1999); Gouhier et al., Neurosci. Lett. 288:71-75 (2000). The present invention provides the first evidence that genes for a number of growth factors, growth factor receptors and downstream targets of growth factor pathways expression is decreased in animals demonstrating end stage disease in comparison to wild type controls. The growth factors and downstream targets of growth factor pathways primarily impacted included, but were not limited to, nerve growth factor targets (e.g., zif/268, Nur77 (N10), and Krox gene family members, heparin-binding EGF-like precursor, schwannoma-derived growth factor and insulin-like growth factor binding protein 4. In addition, multiple Ras- related pathway genes were found to be decreased in animals with late stage disease. Further, rap-related pathways can be effected.

The present invention provides the first identification of zif/268, Nur77, Krox gene family members, heparin-binding EGF like precursor, schwannoma-derived growth factor and insulin-like growth factor binding protein 4 are linked to the expression of disease symptoms in Huntington's Disease. The discovery that these genes are aberrantly expressed provides a means for intervention into disease progression and the destruction of neurons which usually accompanies the symptoms seen with Huntington's Disease as discussed below.

The most striking difference in gene expression profiles between animals having early symptoms of disease (6 week old R6/2 mice) and animals having end-stage neuron degeneration (12 week old R6/2 mice) in the present study was the overexpression of genes encoding inflammatory mediators in the animals having endstage disease (12 weeks in R6/2 mice). The group of genes affected included proteosome activators, ubiquitin genes, cathepsin precursors, apolipoprotein D, MHC class I, NF-kappa-B, interferon inducible genes. GABP-βl subunit, cyclophilin and calcineurin B. The present invention provides that inhibitors of any or all of these inflammation mediators are likely to reduce neurodegeneration, and therefore symptoms and Huntington's Disease progression. It is notable that agents that inhibit these pathways, including but not limited to, cyclosporin, FK-506 and steroids are currently used by other populations of patients and are known to enter the central nervous system. The present invention proposes that abnormal processing of the expanded repeat Huntingtin protein or other metabolic deviations caused by the expanded gene signals the spiny neurons to degenerate or signal surrounding cells (immune, glial or other) to damage the striatal neurons. Therefore, the present invention provides an alternative method for inhibiting the neural degeneration seen in Huntington's Disease which can either slow the progression of the appearance of symptoms, or can prevent Huntington's Disease. Patients having Huntington's Disease are known to be at increased risk for developing depression and suicidal tendencies. One possible explanation for these symptoms proposed in the art is that the symptoms are due to diminished signaling through neurotransmitter pathways that normally generate a sense of well being. The microarray analysis provided by the present invention demonstrates that the R6/2 transgenic mice have a decreased expression of genes encoding enkephalin, the delta opioid receptor and the neuronal cannabinoid receptor (CB1). Pharmacologic restoration of these pathways should provide a reduction in the psychological symptoms of Huntington's Disease. In addition, other neurotransmitter receptors, some of which contribute to mood are also disrupted (e.g., muscarinic cholinergic receptors, D2A dopamine receptor, glutamate receptor channel subunit β-2, and α-2 adrenergic receptors). The present results suggest that existing or novel opioid, cannabinoid, or other neurotransmitter receptor agonists or antagonists can provide relief from psychiatric symptoms for Huntington's Disease patients.

The microarray study of a transgenic murine model of Huntington's Disease described herein provides the first comprehensive analysis of gene expression in minimally symptomatic and end-stage Huntington's Disease. The data reveal multiple pathways involved in disease progression including the retinoid, dopamine, calcium, growth factors/cytokine, opioid and cannabinoid signaling pathways. The data also implicate the onset of an inflammatory reaction in the striata of HD model mice that may contribute to physical degeneration of striatal neurons. Degeneration of neuronal cells seen in

Huntington's Disease could be through apoptosis or other programmed cell death events. The latter is supported by recent work showing that HD mice carrying a dominant negative inhibitor of caspase activity lived longer with fewer symptoms than control HD animals with normal caspase activity. Likewise, HD mice treated with caspase inhibitors lived longer with fewer symptoms than controls. Taken together with the natural history of

Huntington's Disease, these data suggest that patients may benefit from a combination of therapy regimens. Specifically, retinoids and dopamine agonists may be used early in the disease to delay the involvement of other pathways. Calcium regulating agents can be added when neuronal firing becomes impaired by increased resting intracellular calcium levels and a decreased capacity to trigger calcium-mediated signals on demand. The later stages of disease may be attenuated by anti-inflammatory agents, immune suppressants or inhibitors of cell death programs. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a mammal, especially a human. The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to prevent, or reduce, by at least about 30 percent, more preferably by at least 50 percent, most preferably by at least 90 percent, the occurrence of symptoms associated with the expression of a mutated huntingtin protein in a patient.

In its primary aspect, the present invention concerns the administration of a therapeutically effective amount of one or more retinoic acid agonists, dopamine agonists or antagonists, calcium-regulating agents, or cAMP-regulating agents for the treatment of Huntington's Disease. In particular, the agents will be effective to prevent or slow neuronal degeneration which is responsible for the majority of Huntington's Disease symptomatology in a mammalian patient. The therapeutic retinoic acid agonist-containing compositions are conventionally administered orally or parenterally, as by ingestion or injection of a unit dose, for example. The term "unit dose" when used in reference to a therapeutic composition of the present invention refers to physically discrete units suitable as unitary dosage for humans, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent; i.e., carrier, or vehicle.

The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, and the severity of the condition under treatment. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosages may range from about 0.1 to 20, preferably about 0.5 to about 10, and more preferably 1 to 5, milligrams of active ingredient per kilogram body weight of individual per day, and depend on the route of administration. Typically, the unit dosage form contains from about 0.5 mg to about 750 mg depending upon the activity of the particular retinoic acid agonist being utilized as the active ingredient.

The present invention also includes therapeutic or pharmaceutical compositions comprising compounds detected in the screening assay described below. For example, additional retinoic acid agonists or antagonists which prevent or inhibit the loss of dopamine receptor expression and the expression of genes downstream of the receptors. Such compositions and methods are useful for treating or ameliorating at least some symptoms of Huntington's Disease or other neurological degenerative conditions associated with the expression of a mutated huntingtin protein. Symptoms usually associated with Huntington's Disease include, but are not limited to, neuronal degeneration; inefficient neuron transmission; irregular, spasmotic, involuntary movements of the limbs and facial muscles; dystonia, bradykinesia, cognitive disruptions, and the like. The compositions and methods of the invention are also useful in preventing the reduction or increase in the expression of genes associated with expression of mutated huntingtin protein. The therapeutic or pharmaceutical compositions of the present invention can be administered by any suitable route known in the art including, for example, intravenous, subcutaneous, intramuscular, transdermal, intrathecal or intracerebral or administration to cells in ex vivo treatment protocols. Administration can be either rapid as by injection or over a period of time as by slow infusion or administration of slow release formulation. For compositions which require direct administration to the central nervous system, administration can be by injection or infusion into the cerebral spinal fluid (CSF). The formulation can also include one or more agents capable of promoting penetration of the blood-brain barrier if increased access to the central nervous system is required.

Compounds provided herein can be formulated into pharmaceutical compositions by admixture with pharmaceutically acceptable nontoxic excipients and carriers. As noted above, such compositions may be prepared for use in parenteral administration, particularly in the form of liquid solutions or suspensions; or oral administration, particularly in the form of tablets or capsules; or intranasally, particularly in the form of powders, nasal drops, or aerosols; or dermally, via, for example, trans-dermal patches. The composition may conveniently be administered in unit dosage form and may be prepared by any of the methods well known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences (Mack Pub. Co., Easton, Pa., 1980).

Formulations for parenteral administration may contain as common excipients sterile water or saline, polyalkylene glycols such as polyethylene glycol, oils and vegetable origin, hydrogenated naphthalenes and the like. In particular, biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene- polyoxypropylene copolymers may be useful excipients to control the release of the active compounds. Other potentially useful parenteral delivery systems for these active compounds include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation administration contain as excipients, for example, lactose, or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or oily solutions for administration in the form of nasal drops, or as a gel to be applied intranasally. Formulations for transdermal patches are preferably lipophilic emulsions.

The agents of the present invention can be employed as the sole active agent in a pharmaceutical or can be used in combination with other active ingredients, e.g., other growth factors which could facilitate neuronal survival or axonal regeneration in diseases or disorders. The concentrations of the compounds described herein in a therapeutic composition will vary depending upon a number of factors, including the dosage of the drug to be administered, the chemical characteristics (e.g., hydrophobicity) of the compounds employed, and the route of administration. The preferred dosage of drug to be administered is likely to depend on such variables as the type and extent of progression of the disease or disorder, the overall health status of the particular patient, the relative biological efficacy of the compound selected, and formulation of the compound excipient, and its route of administration.

It is a further object of the present invention to provide a method of screening for agents useful in the treatment of neural degeneration and other symptoms associated with Huntington's Disease by determining the ability of the potential therapeutic agent to modulate the expression of genes determined to be effected by the expression of the mutated huntingtin protein. In a particular embodiment the present invention provides a sampling of approximately 6500 murine genes and EST clusters for the effects of the expression of a mutated huntingtin protein on their expression. This massive screening permitted the identification of many genes which were heretofore not known to be modulated by or associated with the expression of a mutated huntingtin protein. With this information mRNA and/or translation products of the genes determined to be modulated can be interrogated specifically in HD model systems and in humans for diagnosis of Huntington's Disease and/or for disease prognosis.

The present invention also includes an assay system for screening of potential agents effective in the treatment of Huntington's Disease. In particular the assay can screen for agents which are effective to prevent neuronal degeneration, nerve impulse transmission, and can potentially slow the progression of symptoms associated with Huntington's Disease in individuals in need of such therapy. In one instance, the test agent can be administered to a transgenic animal that over expresses a mutant huntingtin protein in an assay to determine the effect on the expression of genes in the dopamine, glutamate and adenosine signal transduction pathways, to determine its effect thereon, and thereby screen for potential usage as an anti-neurodegeneration agent. This type of assay conveniently can be conducted using a hybridization assay. A typical method of hybridization comprises gene arrays which can simultaneously monitor the expression of the several genes of interest, and thus avoid the more costly and less efficient screening of one gene at a time.

Further, the level of expression of the genes identified by the present study provides a basis for determining the status of a patient through the stages of progression of Huntington's Disease and further provides a method for determining the effect of agents on the expression of the genes identified by the present invention. The level of expression of an RNA transcript or its translation product can be determined using any techniques known in the art. Specific oligonucleotide probes for the relevant genes can be used in hybridization experiments, as is known in the art. Any hybridization format for determining specific RNA levels can be used, including, but not limited to, Northern blots, slot blots, and hybridization to oligonucleotide arrays.

Specificity of hybridization can be assessed by varying degrees of stringency of the hybridization conditions. In addition, comparison of mismatch to perfect match oligonucleotide probes can be used to determine specificity of binding. To assess specific translation product (protein) expression levels, antibodies specific for the protein can be used readily. Again, any format known in the art for measuring specific protein levels can be used, including sandwich assays, ELI S As, immunoprecipitations, and Western blots. Any of monoclonal antibodies, polyclonal antibodies, single chain antibodies, and antibody fragments can be used in such assays. Specificity of immunologic reactions can be assessed using competitor antibodies or proteins, as well as, by varying the immunoreaction conditions. Monitoring expression product levels involves determining amounts of a specific expression product. Amounts determined need not be absolute amounts, but can be relative amounts determined under different conditions, for example, in the presence or absence of a test agent. Probes according to the present invention can be labeled or unlabeled, tethered to another substance or in solution, synthetically made or isolated from nature. Probes can be nucleic acids, either RNA or DNA, which contain naturally occurring nucleotide bases or modified bases. The probes can contain normal nucleotide bonds or peptide bonds. Oligonucleotide probes can be of any length which provides meaningful specificity or hybridization. Useful probes can be as small as 10 nucleotides, and preferably they are between 12 and 30 nucleotides in length. However, oligonucleotide probes can be significantly longer, in the range of about 30 to about 100 nucleotides, about 100 to about 500 nucleotides, or about 500 to about 1000 nucleotides. Probes can be attached to polymers, either soluble or non-soluble. Probes can be attached or bonded to solid substrates such as filters, sheets, chips, and beads.

High density arrays are particularly preferred for monitoring the expression control at the transcriptional, RNA processing or degradation level, the fabrication and application of high density arrays in gene expression monitoring have been disclosed previously in, for example, WO97/10365, WO92/10588, US 5,744,305, US 5,800,992, and US 5,807,522. In some embodiments using high density arrays, high density oligonucleotide arrays are synthesized using methods such as the Very Large Scale Immobilization Polymer Synthesis (VLSIPS) disclosed in US 5,445,934.

Each oligonucleotide occupies a known location on a substrate. A nucleic acid target sample is hybridized with a high density array of oligonucleotides and then the amount of target nucleic acids hybridized to each probe in the array is quantified. One preferred quantifying method is to use confocal microscope and fluorescent labels. The GENECHIP system (Affymetrix, Santa Clara, CA) is particularly suitable for quantifying the hybridization; however, it will be apparent to those of skill in the art that similar systems or other effectively equivalent detection methods can also be used.

In one embodiment, oligonucleotide probes for interrogating essentially all genes from a mammal suffering from Huntington's Disease and wild type can be determined from publicly available gene databases, GenBank, and the like. The probes can be attached to a solid phase support, such as in an array, and interrogated such as by hybridization. Typically, the mammal can be a transgenic animal model for Huntington's Disease and a wild type control. Libraries of human genes are also encompassed by the present invention and are particularly preferred for the configuration of arrays comprising the probes for the genes determined to by dysregulated by the expression of a mutated huntingtin protein as disclosed in the present invention. In one embodiment, oligonucleotide probes for interrogating essentially all murine genes and all known murine EST clusters from publicly available gene data bases (i.e., GenBank 8/96 release, and the like) are attached to a solid support. Such a support is preferably an array wherein nucleic acid molecules are attached to the substrate in a predetermined position. In one particular embodiment, the nucleic acid molecules are synthesized on the substrate. In another embodiment the nucleic acid molecules are applied to the solid support after synthesis or isolation. It is particularly preferred that the genes demonstrating dysregulated expression in response to the expression of a mutated huntingtin protein as disclosed herein are synthesized or applied to the solid support. Test samples for mRNA are typically harvested from the tissue samples and can be used directly or processed as follows. The sample RNA is reverse transcribed using reverse transcriptase to form cDNA. A promoter is ligated to the cDNA at its 5', 3' or both ends. (5' and 3' refer to orientation on the coding strand of DNA). If two promoters are used on one cDNA they can be the same or different. The cDNA is then used as a template to transcribe in vitro to form test mRNA. The test RNA can then be used to hybridize to nucleic acid molecules or probes, preferably on a solid support, more preferably on a oligonucleotide array. These processing steps are well known to the skilled artisan.

Test samples are particularly preferred to be isolated from the striata of controls and from transgenic animals which express the mutated human IT15 gene which contains an extremely expanded CAG repeat. Cells of the two types can be contacted with a test agent. Expression of one or more of the genes disclosed in the present invention as dysregulated by the expression of the mutated huntingtin protein is monitored in the present of the test agent. A test agent which mimics one or more of the regulatory effects of the mutated huntingtin gene us a potential therapeutic agent for treating Huntington's Disease. Such agents can subsequently be tested in a number of other assays to determine their ultimate usefulness as a therapeutic agent. These methods are well known to the skilled artisan.

The following examples are offered by way of illustration, not by way of limitation.

EXAMPLES

Methods:

Female R6/2 mice (Mangiarini et al., Cell 87:493-506 (1996)) and wild-type controls (FI) were purchased from the Jackson Laboratory (Bar Harbor, ME), and sacrificed at 5-6 or 11-12 weeks of age. R6/2 mice express exon 1 of the human IT15 gene containing an extremely expanded CAG repeat (140-147) under control of the human IT 15 promoter. These animals appeared to develop normally through weaning, but displayed subtle deficits starting at 5-6 weeks of age which progressed to a resting tremor, involuntary movements, stereotypic grooming and handling-induced seizures by 9-12 weeks of age (Mangiarini et al., Cell 87:493-506 (1996), Carter et al., J. Neurosci. 19:3248-3257 (1999)).

N171-82Q mice and controls (N171-18Q and wild-type, (Schilling et al., Hum. Mol. Genet. 8:397-407 (1999)) were sacrificed at 4 months of age (late symptomatic stage for the N 171 -82Q mice). The N 171 mice carry a transgene encoding the N-terminal 171 amino acids of human huntingtin with a polyglutamine repeat length of 18 (N171-18Q) or 82 (N171-82Q), expressed under the control of the PrP promoter. Phenotypically, N171- 82Q animals show loss of coordination, tremors, hypokinesis, gait abnormalities, and premature death. Gene expression changes in R6/2 and N 171 -82Q mice have been attributed to an N-terminal portion of the human huntingtin protein expressed from a partial IT 15 transgene. A similar N-terminal proteolytic fragment of huntingtin has been detected in HD brains and HD models (Ross et al., Philos. Trans. Royal Soc. London B. Biol. Sci. 354:1005-1011 (1999). Tissue from mice aged 5-6 weeks and 9-12 weeks were prepared for RNA hybridization by dissecting bilaterally the striata. The striatal tissue was removed and immediately to dry ice and stored at -70°C until processing. For in situ hybridization histochemistry (ISHH) and autoradiographic studies, whole brains were frozen whole by immersion in isopentane on dry ice for 3 min. Frozen tissue was then stored at -70°C until sectioned. Cryostat sections (12 μm) containing striatum and cortex were thaw mounted onto polylysine-coated glass slides.

RNA Extraction and cRNA Labeling:

RNA was extracted from dissected striata using a single-step RNA isolation reagent (Chomczynski et al. Anal. Biochem. 162: 156-159 (1987), Chomczynski

Biotechniques 15:15:532-534 (1993)); TRI-Reagent (Sigma, St. Louis, MO) according to the manufacturer's recommended protocol, except that the isopropanol precipitation step was performed at -20°C overnight. RNA pellets were resuspended in nuclease-free water and quantitated spectrophotometrically. Labeled cRNA was prepared as follows. Briefly, RNA from the striata of 6

R6/2 or 6 age-matched wild-type animals at each age were combined to form each sample, consisting of 70 to 100 μg of total RNA. PolyA⁺ RNA was isolated from the samples using OLIGOTEX mRNA isolation kits (Qiagen, Chatsworth, CA). Following PolyA⁺ RNA isolation the samples were split in half and all further procedures were performed on each pool independently. Biotinylated cRNAs were prepared by PCR and biotinylation using the Affymetrix protocol. Labeled cRNA (32 μg) was fragmented in 40 μl of 40 mM Tris- acetate pH 8.0, 100 mM KOAc, 30 mM MgOAc for 35 minutes at 95° C. The fragmented cRNA was brought to a final volume of 300 μl in hybridization buffer containing 100 mM MES, 20 mM EDTA, 0.01% Tween 20 (all from Sigma Chemical, St. Louis, MO), 1M NaCI (Ambion, Austin, TX), 0.5 mg/ml acetylated Bovine Serum Albumin (BSA) (GibcoBRL, Gaithersburg, MD), 0.1 mg/ml herring sperm DNA (Promega, Madison, WI) and biotinylated control RNA designated B2, BioB, BioC, BioD, and Cre (American Type Culture Collection, Manassas, VA) at 50, 1.5, 5, 25, 100 pM respectively.

Methods for Array Hybridization:

Array hybridization was carried out using arrays containing probes which can interrogate approximately 6,500 murine genes and EST clusters from GenBank (8/96 release) designated Mu6500K A, B, C, and D oligonucleotide arrays. The arrays were prehybridized, hybridized, washed, and stained as recommended by the manufacturer (Affymetrix, Santa Clara, CA) using a GENECHIP FLUIDICS STATION 400 (Affymetrix). The arrays were hybridized sequentially over the course of four days using 200 μl of cRNA (0.1 μg per μl) per hybridization. After hybridization of one array, the aliquot was recovered from the array, recombined with the unused portion of the sample and frozen. This process was repeated with each sample until the sample had been hybridized to the entire set of four arrays. Immediately after washing and staining, the probed arrays were scanned with a Hewlett-Packard GENEARRAY scanner. The scanned images were analyzed and compared using GENECHIP3.1 software (Affymetrix). Images were globally scaled to compensate for minor variations in fluorescence and to bring the mean Average Difference for all of the genes on each array to 2500 intensity units.

Criteria for Selecting Genes Affected by Huntington Disease Progression:

Each R6/2 sample was compared to both age-matched control samples, thus for each age of mice four mutant to wild-type comparisons were obtained. The default parameters in the GENECHIP3.1 software were used to designate an mRNA as Increased, Decreased, or Not-Changed in the R6/2 striata relative to the controls.

The GENECHIP3.1 DIFFERENCE CALL1 DECISION MATRIX is a metric based on the magnitude and sign of the hybridization signal difference between the two samples being compared plus a tallying of the various oligonucleotide probes that have a positive or negative signal change. Typically, genes on the array are represented by an average of 20 probe pairs. mRNAs that were determined, or called, Increased or Decreased in at least three of the four comparisons were designated for inclusion for further analysis. A union of the two lists is presented in Table 1. As above, the persistent expression of genes in cells not affected by mutant huntingtin serves to reduce the apparent magnitude of any changes.

Table 1

Call Fold Changi Call Fold Change

6 12 6 12 Gene Genbaπk Notes 6 12 6 12 Gene Genbank # Notes

Signal Traπsduction Metabolism

D D -1 8 -2 2 enkephalm 13227 R, A nc D -1 7 -1 5 gamma enolase (neural enolase) W48081 R, A nc D -1 4 -1 4 preprosomatostatin X51468 R, A D nc -3 2 1 1 gamma enolase (neural enolase) W61845 R,A nc D -1 6 -2 6 L-glutamate decarboxylase (GAD) 55253 R, A D -1 5 -1 4 creatine kinase B M74149 A

D D -1 6 -2 6 D2A dopamine receptor X55674 R nc -1 9 -1 1 creatine kinase B chain W75072

D nc -4 1 1 3 D4 dopamine receptor U19880 R nc -2 1 1 0 PC-1 nucleotide pyrophosphatase (NPPase) AA103282 nc D 1 2 -3 5 glutamate receptor channel subunit beta-2 X66117 R nc -1 7 1 0 carbonic anhydrase isozyme II K00811 nc D -1 5 -2 5 neuronal cannabinoid receptor (CB1) U22948 D -1 8 -2 0 indoleamine 2,3-dιoxygenase M69109

D D -1 8 -4 2 G protein coupled receptor (GIR) M80481 nc -2 1 1 2 citrate transport protein AA023087 nc D -2 9 -3 5 alpha-2 adrenergic receptor 97516 A D -2 7 -5 8 phosphatidylcho ne-transfer protein (PC-TP) W 1070

D nc -2 3 -1 1 c-mer tyrosine kinase receptor U21301 D -1 1 -1 8 lipoprotein lipase M60847

D nc -2 3 1 4 probable G protein-coupled receptor EDG-1 W53059 nc -1 6 -1 3 stearoyl-CoA desaturase (SCD2) M26270

D D -5 1 -2 2 Ca/calmodulin-dependent pro kinase IV/GR calspermin W64026 nc 2 5 -1 2 hydroxysteroid sulfotransferase (mSTa2) L27121 nc D -1 3 -1 9 protein kinase C beta-ll X53532 nc 3 9 1 5 brain fatty acid-binding protein (B-FABP) U04827

D nc -1 9 -1 3 protein kinase C-gamma L28035 nc -1 8 -1 2 fatty acid transport protein (FATP) U15976

D nc -9 8 -1 7 seπne/threoπine protein kinase SGK W50888 1 0 1 5 spermidine/spermine N1-acetyltransferase L10244

D nc -1 6 -1 5 seππe/threoπine protein kinase SGK AA163305 -1 8 -1 3 myo-ιnosιtol-1 (or 4)-monophosphatase AA124192

D nc -1 4 1 2 mouse developmental kinase 2 ( DK2) Z49085 -1 1 2 3 inositol polyphosphate 1 -phosphatase U27295

D nc -2 6 1 3 ιnh^*bιto^r protein of cAMP-dependent protein kinase 63554

D D -2 3 -3 5 embryonic stem cell phosphatase (Esp) U36488 Cytoskeleton and Cell Adhesion nc D -1 2 -2 0 protein tyrosine phosphatase STEP61 U28217 nc -3 5 -1 3 ankyπn B, brain variant 2 AA153265

D nc -2 2 -1 7 phosphotyrosine protein phosphatase ACP1/ACP2 AA035993 nc -1 1 neural cadheπn M31131

D nc -2 0 -1 4 protein phosphatase type 1 (dιs2m2) M27073 D -1 9 telencephalin (ICAM 5) U06483

D D -2 3 -2 6 protein phosphatase inhibitor 1 AA116737 nc -1 1 Connexin 30 Z70023

D nc -2 2 -1 1 calcineurin B subunit W47892 R D -2 3 laminin receptor J02870

D nc -3 1 -1 6 calcineurin B subunit isoform 1 W50866 R D -2 1 alpha-actinin 2 (F-actin cross linking protein) W34429 nc D -1 4 -1 9 neurogranin / RC3 AA01781 R nc D -2 3 myosin I L00923 nc D -1 5 -2 5 RAP1 GTPase activating protein (RAP1GAP) W66617 D nc -1 4 myosin V M33467 nc D -1 1 -2 4 RAP1 GTPase activating protein (RAP1GAP) AA013851 nc -1 7 thrombospondin 3 (Thbs3) L04302 nc D 1 3 -2 2 RAP1 GTPase activating protein (RAP1GAP) W11780 nc 6 -1 8 gas 3 (Peripheral Myelin Protein 22) M32240 nc I 1 1 2 4 G-protein G(l)/G(S)/G(0) gamma-3 subunit AA049022 nc 4 -1 5 alpha-tubu n isotype M-alpha-4 13444

D nc -2 2 1 5 RHO-related GTP-binding protein RHOG AA063858 nc 2 0 1 5 alpha-tubulm isotype M-alpha-2 M13445

D nc -1 7 1 3 GTP-bindiπg protein GTR1 W49091 3 1 3 4 tctex-1 W15873

I nc 2 4 -1 1 G25K GTP-binding protein GP (cdc42 homolog) W59479 I 1 3 2 4 troponm C W29418

D nc -2 1 1 0 adenylyl cyclase, type II W98391 R

D D -5 1 -6 8 adenylyl cyclase, type V 79953 R Miscellaneous nc I -1 1 1 8 adenylyl cyclase, type VII U12919 I nc 22 15 thymosin B4 (Ptmb4) W41883

Table 1

Call Fold Chanc e Call Fold Chang e

6 12 6 12 Gene Genbank Notes 6 12 6 12 Gene Genbank # Notes

D D -1 8 -3 9 calmodulin-dependent phosphodiesterase (PDE1 B1) L01695 R I nc -1 2 -2 5 protein synthesis elongation factor Tu M22432

D D -3 7 -3 0 neuron calcium-binding protein Hippocalciπ (P23K) W54905 I nc 1 7 1 4 lnt-6 / elF3 P48 L35556

D nc -1 6 1 0 eukaryotic init factor 4A-lιke prot C1 F5 10 W13878

Ion Channels D nc -4 3 1 0 signal sequence receptor gamma subunit W78418

D D -1 9 -2 3 calcium-transporting ATPase (PMCA1AB) W97373 A D nc -1 7 -1 8 ERp99/GRP94 ER traπsmembrane protein M77003

D D -2 2 -2 4 cerebellum P400 protein (IP3 receptor) X15373 D D -3 3 -3 7 brain protein H5 (CDCrel-1) AA020101

D D -3 9 -4 9 RyR1 ryanodine receptor X83932 R D D -2 3 -2 2 alpha2,8-sιalyltransferase X80502 nc D -1 2 -1 7 voltage-dependent calcium channel beta-3 subunit U20372 D nc -1 5 -1 9 N-glycaπ alpha 2,8-sιalyltransferase X83562 nc D -1 1 -1 6 voltage-dependent sodium channel beta-1 subunit L48687 D nc -2 7 -1 2 19K protein W46015 nc D -1 7 -1 8 potassium channel betal subunit X97281 nc D -1 4 -2 1 ADP-πbosylatioπ factor-like protein 3 (ARD3) 77226 nc D -1 2 -2 0 brain potassium channel proteιn-1 (MBK-1) Y00305 nc D -1 7 -2 1 clathπn-associated protein 19 (AP19) M62418

D nc -3 9 -3 4 inwardly-rectifying K+ channel protein (mb-IRK3) U11075 D nc -3 2 -1 3 synaptoponn AA067362

D nc -1 8 1 2 probable phosphoseπne amiπotransferase (EPIP AA068780

Transcription D nc -2 3 1 3 probable phosphoseππe aminotransferase (EPIP) W48921

D D -2 8 -2 9 zιf268 (NGFI A) M22326 R, A D nc -1 8 -1 3 T-lymphocyte activated protein (CHX1) AA013648

D D -1 4 -3 0 N10 (NGFI-B) (NUR77) X 16995 A D nc -2 9 -1 6 putative regulatory protein TSC-22 AA097366 nc D -1 2 -3 1 junB J03236 R, A o nc -2 1 -2 8 FISP-12 protein M70641 nc D 1 8 -1 5 Hox-3 2 X55318 R nc D -1 5 -2 1 seizure-related product 6 type 3 precursor D29763 nc D -1 4 -3 9 albumin gene D-Box binding protein U29762 D D -1 8 -1 9 pentyleπetetrazol related PTZ-17 X70398 nc D -1 1 -1 6 brain factor-1 U36760 D nc -1 5 -1 2 zinc finger protein (MOK2) M32057

D nc -1 8 -1 6 Id4 helix-loop-hehx protein X75018 I nc 2 6 1 3 DNA-binding protein L20450

D nc -5 0 -1 5 Meιs2 U57343 R nc I 1 0 2 1 CIRP Cold Inducible RNA-binding Protein D78135

D nc -1 8 -1 5 retinol binding protein (RBP) W1 367 R nc 1 1 0 2 0 fibrillann Z22593 nc D -1 4 -2 4 retinoid X receptor gamma (RXR-gamma) X66225 R, A nc D -1 1 -2 3 L1 Md-9 repetitive sequence M29325 nc I 1 0 1 9 cerebral cortex transcnptional regulator T-Braιn-1 U49251 D nc -2 5 -1 2 cytoplasmic protein Ndr1 U60593

I nc 1 6 1 0 myelm gene expression factor (MEF-2) U13262 D nc -1 5 -1 1 apolipoprotein E precursor AA036067

I nc 3 3 2 2 NF-kappa-B DNA binding subunit M57999 D nc -1 2 -2 1 novel protein unknown function W84167

D nc -1 4 1 0 novel protein unknown function W50329

Stress or Inflammatory Response I nc 2 7 -1 2 amyloid-like protein 1 precursor (APLP) W62304

1 nc 1 7 1 2 DBA 2J delta proteasome subunit gene U 13393 nc 1 1 7 1 6 NAP22 AA031158

1 nc 2 2 2 2 rotamase (cyclophilin A) AA06055 I I nc 4 9 -1 3 MP4 gene for a proline-nch protein X58438

1 nc 1 8 1 6 immuπophihn P59 X70887 I nc 3 7 1 9 novel protein unknown function U38981

1 nc 1 5 1 4 heat shock cognate 71 kD protein AA11457 R nc 1 1 7 1 5 vacuolar ATPase subunit A gene U13837 nc 1 1 2 2 7 MHC class I B(2)-mtcroglobulιn (W4 allele) AA05970 I nc 1 1 4 1 7 cytochrome c oxidase subunit Vila W91222 nc 1 -1 2 2 1 cathepsiπ S precursor AA146437 nc 1 1 6 1 7 thioredoxin W08120 nc 1 1 5 1 8 apolipoprotein D L39123 I I nc 2 0 1 5 thioredoxin-dependent peroxide reductase X82067 nc 1 1 1 3 2 proteasome activator PA28 alpha subunit U60328 I I nc 2 0 2 1 Ran/TC4 binding protein (RanBPI) X56045

D nc -1 3 -1 4 leukocyte neutral protease inhhibitor (LNPI) AA145127

D nc -1 8 1 1 macrophage inflammatory proteιn-1 -beta W67046

Table 1 Call Fold Change Call Fold Change 6 12 6 12 Gene Genbank Notes 6 12 6 12 Gene Genbank * Notes

Cell Cycle

I nc 2 4 1 5 topoisomerase I D10061 I

I nc 3 9 1 8 pπmase large subunit D13545 nc I 1 1 1 7 PCNA (DNA polymerase delta auxiliary protein) X57800 nc I 1 8 3 0 Xeroderma Pigmentosum group A Correcting gene X74351 nc I 1 8 2 7 caltractiπ (centπn) AA153569 nc I 1 5 2 0 gas5 (growth arrest specific protein) X59728 I

D nc -2 7 1 2 growth arrest DNA damage inducible protein 45 L28177 I

D nc -1 4 1 4 bcl-x transmembrane deleted (bcl-x long) U10102

D = Decrease called in 3 of 4 comparisons of R6/2 to control

I = Increase called in 3 of 4 comparisons of R6/2 to control

R = retinoid-responsive genes/proteins, I = interferon-responsive genes, and A = cAMP-responsive genes/proteins

Preparation of Probe Sequences for In situ and Northern Hybridization:

Probe sequences used for in situ and Northern hybridization were cloned by RT-PCR, obtained as I.M.A.G.E. Consortium clones (Genome Systems, St. Louis, MO) or ordered as custom oligonucleotides (Gibco BRL). Oligonucleotide primers and probes were either designed (those listing GenBank accession numbers) using OLIGO 4.06 software (National Biosciences, Plymouth, MN) and analyzed for specificity by database searching using BLASTN (National Center for Biotechnology Information, Bethesda, MD) or selected based on use in previous studies. T7 and SP6 promoter sequences (CTGTAAT ACGACTCACTATAGGG (SEQ ID NO: 1) and GGGATTTAGGTGACAC TATAGAA (SEQ ID NO: 2), respectively) were added to the 5' ends of PCR primers in some cases for use in in vitro transcription of riboprobes.

Gene-specific sequences of primers used to clone probes by RT-PCR were as follows: α-actinin 2 (GenBank # AA800206): CGTAGAGGGCAGGAGAAG (SEQ ID NO: 3) and TTTGACAGGAGGAAGAATGG (SEQ ID NO: 4); NMDA-NR1 : GGAG TGGAACGGAATGATGG (SEQ ID NO: 5) and AAAGCCTGAGCGGAA GAACA (outer) (SEQ ID NO: 6) and CTGTAAT ACGACTCACTATAGGGTTATGCAGCC TTTTCAGAGC (SEQ ID NO: 7) and GGGATTTAGGTGACACTATAGAAGCACGG CCGAGTCCCAGAT (inner) (SEQ ID NO: 8); zif268 (GenBank # M22326): GTTCGG CTCCTTTCCTCACT (SEQ ID NO: 9) and GCCTCTTGCGTTCATCACTC (outer) (SEQ ID NO: 10) and TGAAGAAGGCGATGGTGGAGA (SEQ ID NO: 11) and GGCAGAGG AAGACGATGAA (inner) (SEQ ID NO: 12).

PCR-generated probe templates were purified using the STRATAPREP PCR Purification Kit (Stratagene, La Jolla, CA). The following in situ probes were obtained as I.M.A.G.E. Consortium clones: GIR (ID #421187); Gγ3 (ID#47893); and PA28α (ID#598746). Oligonucleotide in situ probes were comprised of: DARPP-32 (GenBank # U23160): GAGCTGGCTCGGGGGCGCGGGCACAGAGAA (SEQ ID NO: 13); junB: ACTGGGCGCAGGCGGGCGGGCCGGAGTCCAGTGTGTGAGCTGCGCC (SEQ ID NO: 14); N10: GTGGTCACGCGGTCCTGGGCTCGTTGCTGGTGTTCCATATTGAGC (SEQ ID NO: 15); β-actin: GCCGATCCACACGGAGTACTTGCGCTCAGGAGGAGC AATGATCTT (SEQ ID NO: 16); preproenkephalin (GenBank # M28263): ATCTGCAT CCTTCTTCATGAAACCGCCATACCTCTTGGCAAGGATCTC (SEQ ID NO: 17). Probes used for Northern blots were generated by PCR subcloning partial I.M.A.G.E. Consortium clone sequences: PA28α (primers: AGAAGAAAGGGGACGAA GAC (SEQ ID NO: 18) and TGTTTGGGAGGCAGAGTGAG (SEQ ID NO: 19); Gγ₃ (primers: CTCCCCACTGACCCTACATC (SEQ ID NO: 20) and CTGCCTTGGACAC CTTTATC (SEQ ID NO: 21)); glucocorticoid-induced receptor (GIR) (primers: TGACA GCTATCGCAGTGGAC (SEQ ID NO: 22) and CAGCAGAGGGCAAAGAGGAC (SEQ ID NO: 23)). The identities of PCR products and I.M.A.G.E. Consortium clones were confirmed by sequencing.

Northern Analysis :

Northern analysis was conducted by denaturing 2 μg of each RNA sample in IX MOPS containing 50% formamide and 3% formaldehyde The denatured samples were electrophoresed through a 1.2% agarose gel containing 3% formaldehyde, and electorphoretically transferred to a nylon membrane. Random-primed ³²P-radiolabeled cDNA probes (s.a. = approx. 6.0 X 10⁹ dpm/μg) were prepared using a PRIME-IT kit (Stratagene). Oligonucleotide probes were labeled using an oligonucleotide 3' end labeling system (RENAISSANCE, NEN Life Sciences). Hybridization took place overnight at 42°C, and final high-stringency washes were performed with 0.5 X SSC (for oligonucleotide probes) or 0.1 X SSC (for cDNA probes) plus 0.1% SDS at 42°C. Hybridization was detected by autoradiography using a Molecular Dynamics PHOSPHORIMAGER (Sunnyvale, CA) and signal was quantitated using IMAGEQUANT Software (Version 1.2).

In situ Hybridization Histochemistry:

PCR products and I.M.A.G.E. clones (above) were used as templates for in vitro transcription of S-labeled riboprobes. Oligonucleotide probes were prepared using the Renaissance oligonucleotide 3' end labeling system and purified with NENsorb columns (NEN Life Sciences). In situ hybridization histochemistry was conducted according to Landwehrmeyer et al., (cRNA probes) or Augood et al. (oligonucleotide probes) with 12 μm fresh-frozen cryostat sections of mouse brain (Landwehrmeyer et al., Annals Neurol. 37:218-230 (1995), Augood et al., Neurosci. 88:521-534 (1999)). Autoradiograms were obtained on Hyperfilm β-Max (Amersham, Arlington Heights, IL) by 2 to 28 day exposure.

Receptor and Adenylyl Cyclase Autoradiography:

All studies were performed on coded samples blinded as to the genotype status of the animals. Dopamine Di and D₂ receptor assays used a buffer containing 25 mM Tris-HCl pH 7.5, 100 mM NaCI, 1 mM MgCl₂, 1 μM pargyline, and 0.001% ascorbate. For D_\ receptors, slides were incubated with 1.65 nM [ H]SCH-23390 (specific activity 70.3 Ci/mmol, NEN Life Sciences) for 2.5 h. Nonspecific binding was defined in the presence 1 μM c/s-flupentixol (Richfield et al., Brain Res. 383:121-128 (1986). For D₂ receptors, slides were incubated with 180 pM [³H]YM-09151-2 (specific activity 85.5 Ci/mmol) for 3 h. Nonspecific binding were defined in the presence 50 μM dopamine (Cox and Waszczak Eur. J. Pharmacol. 199:103-106 (1991)). For adenosine A2a receptors, the buffer used was 50 mM Tris-HCl pH 7.4 with 10 mM MgCl₂. Following a preincubation for 30 min at room temperature in buffer containing 2 IU/ml adenosine deaminase, slides were incubated in buffer containing 5 nM [³H]CGS 21680 (specific activity 39.5 Ci/mmol) for 90 min (Jarvis et al. Eur. J. Pharmacol. 168:243-246 (1989)). Nonspecific binding was defined in the presence of 20 μM 2-chloroadenosine. Slides were rinsed for 5 min in ice cold buffer, then quickly in ice cold ddH2θ, and dried rapidly under a stream of warm air.

For adenylyl cyclase, slides were incubated in 10 nM [ Hjforskolin in 50 mM Tris-HCl with 100 mM NaCI and 5 mM MgCl2 for 10 min at room temperature (Worley et al., Proc. Natl. Acad. Sci. USA 83:4053-4057 (1986)). Slides were rinsed twice for two minutes at 4°C and then dried. Slides were apposed to tritium-sensitive film

(HYPERFILM H, Amersham) with calibrated radioactive standards and allowed to expose for 1 to 3 weeks. Films were developed and analyzed using a computer based image analysis system (Ml, Imaging Research, St. Catharine's, Ontario, Canada). Image density corresponding to binding of [ Hjligand was converted to pmol/mg protein using calibrated radioactive standards and non-specific binding was subtracted. Results

Gene expression was analyzed in striata of R6/2 mice at both 6 weeks and 12 weeks of age. These age groups represented stages of minimal and pronounced deterioration in neurologic function, respectively. At each age, RNA was extracted from pooled striata of mice carrying the expanded exon 1 HD transgene and from wild-type littermate controls. Each RNA sample was divided in half and analyzed using two sets of Affymetrix murine expression arrays. The arrays were composed of probes capable of interrogating approximately 6500 murine genes and EST clusters from GenBank (8/96) release. Within each age group four comparisons were made (each data set from the HD transgenics to each of the two control data sets). Using the Affymetrix algorithm for assessing gene expression differences, mRNAs were identified that differed between R6/2 mice and controls in at least three of the four comparisons. mRNAs that met these criteria are presented in Table 1.

1.7% and 1.2% of the genes tallied on the microarrays were changed in R6/2 mice compared to controls at 6 and 12 weeks, respectively. mRNAs that were decreased in R6/2 mice outnumbered those increased by 3:1. Increases were restricted largely to mRNAs associated with inflammatory and cell cycle function, while decreases were observed primarily in mRNAs involved in signal transduction, ion channels, transcription, metabolism and cell structure.

It is important to note that the striata represent a mixed population of neurons and glia, and therefore the reported fold-change might not accurately reflect the magnitude of change within an affected sub-population of cells. It is likely however, that most of the neuron-specific gene changes are attributable to GABAergic medium spiny neurons, since these represent more than 85% of the neuronal population in striatum.

In agreement with prior studies of R6/2 animals and human HD cases, the microarray data showed decreased mRNA for dopamine D2 receptors and enkephalin. (Cha et al., Proc. Natl. Acad. Sci. U.S.A. 95:6480-6485 (1998), Cha et al., Philos. Trans. Royal Soc. London B Biol. Sci. 354:981-989 (1999), Albin et al. Annals Neurol. 30:542-549

(1991), Augood et al., Neuroscience 72:1023-1036 (1996)). The average fold changes as assessed by the microarrays were similar to RNA decreases previously observed by in situ hybridization histochemistry in R6/2 mice. Additional parallels between findings in human HD brains and mRNA changes detected in R6/2 striata by the microarray method include decreases in cannabinoid receptor (Glass et al., Neuroscience 56:523-527 (1993)), glutamic acid decarboxylase (Enna et al., N. Engl. J. Med. 294:1305-1309 (1976)), neuron-specific enolase (Marangos et al., J. Neurochem. 37:1338-1340 (1981)), phosphatidylinositol triphosphate (IP₃) receptor (Tanaka et al., Adv. Neurol. 60: 175-180 (1993), Warsh et al., J. Neurochem. 56:1417-1422 (1991)), L-type calcium channel (Sen et al., Brain Res. 611 :216- 221 (1993)) and protein kinase C isoform beta II (Tanaka et al., Adv. Neurol. 60:175-180 (1993)). These results demonstrate that gene expression changes in the 6 and 12-week old R6/2 striata mirror many of the described changes in Huntington's disease.

The most striking finding was that one third of the mRΝAs that were decreased in R6/2 mice encode neuronal signaling molecules (Table 1). This study extends previous observations that dopamine, glutamate and adenosine receptors are decreased in the R6/2 model of HD by demonstrating that multiple components of each of these signaling pathways are decreased at the mRΝA level. mRΝAs encoding the G protein-coupled receptors dopamine D2, dopamine D4, cannabinoid CB 1 , adrenergic α2 and an orphan glucocorticoid- inducible receptor (GIR); were decreased in R6/2 mice. Expression of the suspected HD modifier gene GluR6 16 was also decreased. mRΝAs for some receptor interacting proteins were affected, including α-actinin 2 (which was decreased) and the heterotrimeric G-protein subunit Gγ3 (which was increased). Decreases in mRΝAs encoding the GABA- synthesizing enzyme glutamic acid decarboxylase and the neuropeptide precursors for enkephalin and somatostatin were also observed.

Dysregulation of genes encoding signal transduction proteins in R6/2 mice extends beyond plasma membrane-bound receptors and involves many intracellular signaling components. These include adenylyl cyclases and phosphodiesterases, protein kinases and phosphatases, small G-proteins, and inhibitors or regulatory subunits of these enzymes. The skilled artisan can easily imagine ways that these changes could affect synaptic transmission and plasticity, because the proteins in this category integrate, amplify and limit signals controlling many neuronal functions. In several instances, genes that encode proteins of opposing function are decreased. These balanced disruptions are consistent with the notion that expression of genes having opposing roles in signaling cascades is coordinately regulated. Decreased expression of immediate early genes that are normally upregulated by neuronal stimulation (Table 1), and reduced levels of adenylyl cyclase (see below) strongly suggest that neuronal signal transduction is generally diminished.

Calcium dysregulation has been postulated to be a component of HD pathology (Schousboe et al., Clin. Neurosci. 4:194-198 (1997), Hodgson, et al., Neuron 23 : 181 - 192 ( 1999)), but the mechanisms by which such changes might occur have not been well defined. The present data revealed that this problem might be attributable, at least in part, to the down regulation of genes whose products regulate calcium homeostasis and calcium signaling. Calcium-related mRNAs that showed decreased expression in the R6/2 striata include a plasma membrane calcium ATPase (PMCA1 AB), the type 1 ryanodine receptor, the type 1 IP receptor (P400), calcineurin, hippocalcin, a calmodulin-dependent phosphodiesterase (PDElBl/PDEβ2), and a calcium/calmodulin dependent protein kinase (CAMK IV/Gr). In addition, many of the proteins in the signal transduction group are regulated or modulated by calcium and calcium-sensing proteins. One possible mechanism by which mutant huntingtin may cause calcium signaling disturbances is through physical association with a calmodulin-containing complex (Bao et al., Proc. Natl. Acad. Sci. USA 93:5037-5042 (1996)).

Nuclear hormone receptors were also examined. Retinoids (vitamin A- derivatives) bind to nuclear hormone receptors and induce transcription of genes involved in neural differentiation and other processes (Clagett-Dame and Plum, Gene Express. 7:299-342 (1997)). Expression of the striatally-enriched retinoic acid receptor, RXRγ, and a retinol binding protein was decreased in R6/2 striata compared to controls. In addition, over 20%) of the genes less abundantly expressed in R6/2 striatum contain retinoic acid response elements and are induced by retinoic acid receptor agonists in cell culture experiments (See, Table 1). The expression of mRNAs encoding proteins known to be enriched in specialized plasma membrane microdomains known as lipid rafts and caveolae (Brown and London, Annu. Rev. Cell Dev. Biol. 14:111-136 (1998); Anderson, Annu. Rev. Biochem. 67:199-225 (1998); Okamoto et al, J. Biol.Chem. 273:5419-5422 (1998); Maekawa et al., J. Biol. Chem. 274:21369-21374 (1999). These include mRNAs encoding G-protein- coupled receptors, heterotrimeric G-protein subunits, ryanodine receptors, IP₃ receptors, adenylyl cyclases, NAP22, protein kinase C, calcium ATPase. Mutant huntingtin protein also decreases the expression of mRNAs encoding proteins known to associate with and/or regulate raft/caveolar proteins. These include mRNAs encoding rap-associated proteins (e.g., RAPGAPl), ras-associated proteins, calmodulin-binding proteins (e.g., calcineurin) and clathrin-associated proteins (e.g., API 9). (See, Table 1).

Unchanged expression of genes associated with neurodegenerative events or diabetes:

Previous histopathologic studies of R6/2 mice demonstrated that the striata of these animals show neither gross neuronal loss nor gliosis through 13 weeks of age (Mangiarini et al., Cell 87:493-506 (1996)). Consistent with these findings, no decreases in the expression of axonal or dendritic neuronal marker genes (e.g., MAP2 or neurofilaments) or increases in the expression of glial marker genes (e.g. , glial fibrillary acidic protein, myelin basic protein or major histocompatibility complex II components) were observed. Likewise, numerous genes known to be expressed in medium spiny neurons (e.g., NMDA- NR1, preprotachykinin) were unchanged. These findings indicate that decreased expression of neuronal signaling genes are not due to large shifts in striatal cell populations. While many components of signaling cascades implicated in human HD were obviously changed in the R6/2 brains, some mechanisms previously associated with the disease were represented only minimally. For example, very few changes were detected in mRNAs that encode mitochondrial proteins, proteolytic enzymes, or apoptotic molecules. This may be due to their regulation by post-transcriptional mechanisms. Alternatively, these HD-related toxicities may be modest, and thus undetectable, at the R6/2 timepoints selected.

At 12 weeks, R6/2 animals are diabetic, showing both elevated baseline glucose levels and abnormal glucose tolerance tests, whereas 6-week animals handle glucose normally by these criteria. Changes in mRNAs associated with glucose metabolism were not prominent in R6/2 mice at either age. Concordance of the 6 and 12- week data thus indicate that diabetes in R6/2 mice does not obscure the detection of bona fide huntingtin-induced changes in gene expression.

Increased expression of genes associated with inflammation:

Of over 6000 genes represented on the microarrays, only 22 were increased in 6-week old R6/2 mice and 21 were increased in 12-week old mice compared to controls. In contrast to the mRNAs that were decreased in R6/2 mice, the increases in gene expression were generally not concentrated in discrete functional categories. The possible exceptions were mRNAs that encode stress or inflammation mediators and the expression of genes associated with cell cycle regulation. mRNAs increased at six weeks included rotamase/cyclophilin A and immunophilin P59. The proteins encoded by these genes regulate the function of calcineurin, ryanodine receptors, and IP3 receptors and are inhibited by immunosuppressants such as cyclosporin and FK506. At the 12-week timepoint, cathepsin S, apolipoprotein D and MHC β2 microglobulin mRNAs were increased. These mRNAs are also induced in a mouse scrapie model, which represents another "protein aggregation" disease (Dandoy-Dron et al., J Biol. Sci. 273:7691-7697 (1998)). Several inflammation-related mRNAs and other mRNAs that are increased in R6/2 mice were induced by interferon-α in mouse primary fibroblasts that were assayed on Mu6500 microarrays (Table 1). Whether these mRNAs can be coordinately regulated in R6/2 mice by immune mediators remains to be determined.

Confirmation of microarray findings:

Confirmation of changes in mRNA expression detected by the microarrays was obtained by Northern blotting and in situ Hybridization Histology (ISHH) experiments using independent litters of R6/2 mice. Northern hybridization results correspond to the array data for three decreased genes (zif268, GIR, PC-TP), one unchanged gene (NMDA- NRl), and two increased genes (Gγ3, PA28α) in R6/2 mice. The fold change estimated by Northern analysis was uniformly within two-fold of the microarray results. Messenger RNAs were also measured in brain tissue sections by in situ hybridization histochemistry as described above. Striatal decreases were confirmed for six genes at 6 and 12 weeks and striatal increases in two genes at 12 weeks by this method. These studies confirmed the array data with regard to differences in expression levels, and provided anatomic resolution in the striatum and cortex. Cortical decreases of junB, N10 and zif268 at 6 and 12 weeks and cortical increases of Gγ3 and PA28α at 12 weeks were observed.

Striatal gene expression profiles from 6-week old R6/2 mice were directly compared to those from 12-week old animals to determine whether there were changes indicative of disease progression. While many genes in both R6/2 animals and controls were dynamic between the two timepoints, mRNAs characteristic of mature medium spiny neurons, such as preproenkephalin, dopamine D2 receptors and glutamic acid decarboxylase, decreased as neurologic symptoms progressed. This was confirmed by the ISHH data for preproenkephalin and DARPP-32, another mRNA characteristic of this cell population (Greengard et al., Neuron 23:435-447 (1999)). Previous ISHH assays have also shown progressive decreases in adenosine A2a receptor and dopamine Dl and D2 receptor mRNA (Cha et al., Proc. Natl. Acad. Sci. U.S.A. 95, 6480-6485 (1998)). Type II and V adenylyl cyclases were decreased while type VII adenylyl cyclase was increased in the microarray analysis. [³H]forskolin binding assays were performed to determine the overall impact on adenylyl cyclase levels. [³H]forskolin binds to all adenylyl cyclase subtypes and provides a measure of adenylyl cyclase protein levels. [³H]forskolin binding was decreased in R6/2 striata to 23.9% of wild-type in 12-week animals (p < 0.0053, n = 5).

Signaling molecules affected in R6/2s are also decreased in other HD transgenic mice:

The comparisons of R6/2 data to littermate controls demonstrated that the presence of the expanded repeat ITI5 exon 1 transgene resulted in the mRNA changes described above. The expression of a subset of these genes in N171-82Q transgenic mice (described above, Schilling et al., Hum. Mol. Genet. 8:397-407 (1999)) was examined to determine the extent to which these changes might be specific to the R6/2 mouse model. Significant decreases in symptomatic 4-month-old N171-82Q mice relative to N 171-18Q or wild-type mice were observed in binding assays for dopamine D2 receptors (78%> control), adenosine A2a receptors (61% control) and adenylyl cyclase (71% control), and in situ hybridization for D2 (61%) control), N10 (49% control), preproenkephalin (59%) control), and DARPP-32 (62% control, Table 2). ISHH for junB, Gγ3 and zif268 were not different from controls (n = 3). Overall, the concordance between microarray, Northern, in situ and binding analyses performed on independent litters of mice from two transgenic lines suggest that gene expression changes are characteristic of HD pathogenesis.

Table 2. Summary of Differences in Binding and ISHH in N171-82Q Mice

Gene % Control D Value Assav n Control. N 171 -820

Dopamine D2 Receptor 78.4 0.0290 Binding 8, 6

Adenosine A2a Receptor 60.7 0.0027 Binding 8, 6

Adenylyl Cyclase 70.6 0.0003 Binding 8, 6

Dopamine D2 Receptor 61.3 0.0032 ISHH 3, 3

N10 48.8 0.006 ISHH 3, 3

Preproenkephalin 58.7 0.013 ISHH 3, 3

DARPP-32 62.2 0.003 ISHH 3, 3 junB 66.7 0.478 ISHH 3, 3 zif268 93.0 0.673 ISHH 3, 3

Gγ3 1 1 1.5 0.710 ISHH 3, 3

Summary

Changes in gene expression in striata of huntingtin-transgenic mice indicate that neurotransmitter-and calcium-related signaling components are dramatically affected by a mutant IT15 allele. As these comprise an early change in R6/2 brains and coincide with the onset of neurologic symptoms, they can comprise a major etiologic component of HD. Also, changes in pathways not previously examined in HD suggest other deficits in signaling pathways which can be important to transcriptional activity and maintenance of a mature medium spiny neuronal phenotype. The present data also corroborate previous evidence for an immune response and proteosomal activation which may occur upstream of gliosis and cell death. It is proposed that interventions via the newly pathways can curb or ameliorate some or all of the symptoms and can also slow the progress of Huntington's Disease.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.

All publications and patent documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication or patent document were so individually denoted.

Claims

WHAT IS CLAIMED IS:

1. A method of treating Huntington's Disease in a mammal in need of such treatment, which comprises administration of a therapeutically effective amount of a retinoic acid receptor agonist, a retinoic acid receptor antagonist, a dopamine receptor agonist, a dopamine receptor antagonist, a calcium reducing agent, a calcium ATPase enhancer, a calcium binding protein, a cAMP regulating agent, an IP₃ receptor agonist, an IP₃ receptor antagonist, a ryanodine receptor agonist, a ryanodine receptor antagonist, a raft/caveolin structure normalizing agent, a raft/caveolar constituent expression normalizing agent, a nerve growth factor, an agonist of the opioid or cannabinoid signaling pathways, or an anti-inflammatory agent to said mammal.

2. The method of claim 1, wherein treating Huntington's Disease comprises decreasing neurologic degeneration associated with an expansion of a mutant huntingtin protein having an extended region of polyglutamines.

3. The method of claim 2, wherein the retinoic acid receptor agonist is a RAR-specific agonist or a RXR specific agonist.

4. The method of claim 2, wherein the retinoic acid receptor agonist is 9-cis-retinoic acid.

5. A method of screening for agents useful in the treatment of Huntington's Disease, comprising: contacting a cell that overexpresses a mutant huntingtin protein having an extended polyglutamate region with a test agent; monitoring expression of a transcript or translation product, wherein the transcript or translation product is of a gene encoding a component of a neurotransmitter, calcium, or retinoid signaling pathway, a calcium-regulatory pathway, a cAMP regulatory pathway, or a lipid raft/caveolar domain, wherein an agent is identified as useful in treating Huntington's Disease if it increases the expression of said gene in comparison to the expression level of the transcript or translation product in a wild type cell.

6. The method of claim 5, wherein the gene encodes a G protein- coupled receptor, a dopamine receptor, a glutamate receptor, or an adenosine receptor.

7. The method of claim 5, wherein the gene encodes the dopamine D2 receptor, enkephalin, a cannabinoid receptor, glutamic acid decarboxylase, neuron-specific enolase, phosphatidylinositol triphosphate (IP₃) receptor, protein kinase C isoform II, dopamine D2 receptor, dopamine D4 receptor, adrenergic α2 receptor, orphan glucocorticoid-inducible receptor (GIR), α-actinin 2, a neuropeptide precursor for enkephalin, a neuropeptide precursor for somatostatin, an adenylyl cyclase, a phosphodiesterase, a protein kinase, a phosphatase, a small G-protein, plasma membrane calcium ATPase PMCA1 AB, type 1 ryanodine receptor, type 1 IP₃ receptor (P400), calcineurin, hippocalcin, calmodulin-dependent phosphodiesterase PDE1 B 1 , calcium calmodulin dependent protein kinase CAMk IV/G2, retinoic acid receptor RXRγ, retinol binding protein, or a gene containing a retinoic acid response element, a gene containing a cAMP response element, or a gene encoding a protein localized to a lipid raft/caveolar domain.

8. A method of screening for agents useful in the treatment of Huntington's Disease, comprising: contacting a cell that overexpresses a mutant huntingtin protein having an extended polyglutamate region with a test agent; monitoring expression of a transcript or translation product, wherein the transcript or translation product is dysregulated by the expression of the mutant huntingtin protein, wherein an agent is identified as useful in treating Huntington's Disease if it decreases the expression of said gene in comparison to the expression level of the transcript or translation product in a wild type cell.

9. The method of claim 8, wherein the gene encodes a stress or inflammation mediator, or the gene is associated with cell cycle regulation.

10. The method of claim 9, wherein the gene encodes rotamase/ cyclophilin A or immunophilin P59.

11. The method of claim 9, wherein the gene encodes cathepsin S, apolipoprotein D or MHC β2 microglobulin.

12. The method of claim 8, wherein the gene encodes for heterotrimeric G protein subunit Gγ3.

13. The use of an agent comprising a retinoic acid receptor agonist, a retinoic acid receptor antagonist, a dopamine receptor agonist , a dopamine receptor antagonist, a calcium-concentration-regulating agent, a cAMP-regulating agent, a nerve growth factor, an agonist of the opioid signaling pathway, an agonist of the cannabinoid signaling pathway, or an anti-inflammatory agent for the manufactureof a medicament for the treatment of Huntington's Disease in a mammal, the treatment comprising administering to the mammal a therapeutically effective amount of the agent.

14. The use of claim 13 , wherein the administration of an effective amount of the agent decreases the neurologic degeneration associated with an expansion of a mutant huntingtin protein having an extended region of glutamine residues.

15. The use of claim 13, wherein the retinoic acid receptor agonist is a RAR-specifc agonist or a RXR-specific agonist.

16. The use of claim 13, wherein the retinoic acid receptor agonist is 9- cis-retinoic acid.

17. A pharmaceutical composition useful for treating Huntington's Disease in a mammal, the composition comprising a retinoic acid receptor agonist, a retinoic acid receptor antagonist, a dopamine receptor agonist , a dopamine receptor antagonist, a calcium-concentration-regulating agent, a cAMP-regulating agent, a nerve growth factor, an agonist of the opioid signaling pathway, an agonist of the cannabinoid signaling pathway, or an anti-inflammatory agent.