WO2001031043A1

WO2001031043A1 - Increasing isoprenoid biosynthesis

Info

Publication number: WO2001031043A1
Application number: PCT/GB2000/004141
Authority: WO
Inventors: Nigel G. Halford; Sandra Janet Hey; Michael Henry Beale
Original assignee: The University Of Bristol
Priority date: 1999-10-27
Filing date: 2000-10-27
Publication date: 2001-05-03
Also published as: AU1043001A; GB9925453D0

Abstract

This invention relates to methods of increasing isoprenoid biosynthesis and/or accumulation, especially in higher plants by genetic manipulation.

Description

INCREASING ISOPRENOID BIOSYNTHESIS

This invention relates to methods of modifying plants and, in particular, to methods of increasing isoprenoid biosynthesis and/or accumulation, especially in higher plants and particularly in crop plants. The invention particularly relates to increasing sterol biosynthesis.

The isoprenoids are a large family (> 10,000 members) of compounds with diverse roles in higher plants. They include the sterols, the plant hormones such as the gibberellins and abscisic acid, various components of photosynthetic pigments, the phytoalexins and a variety of other specialised terpenoids. The isoprenoids are of interest to plant biotechnologists because they contribute to various characteristics such as the nutritional quality, flavour, and colour of crop plants and their products, such as fruits and vegetable oils. For example, the carotenoids lycopene and β-carotene are responsible for the colour of tomatoes and carrots respectively.

Isopentenyl diphosphate (IPP), or "isopentyl pyrophosphate", is the precursor of all isoprenoids in eukaryotes. In animals and yeast, it is derived from acetyl-CoA via a biosynthetic pathway in which mevalonic acid, or mevalonate, is an intermediate. In animal cells, the NADPH-dependent reduction of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) to mevalonic acid is the overall rate-limiting step for the whole sterol biosynthetic pathway. HMG-CoA reductase (3-hydroxy-3-methylglutaryl-CoA reductase or HMGR) is the enzyme which catalyses this step and its activity is regulated through phosphorylation by a protein kinase, adenosine 5' phosphate (AMP) - activated protein kinase, AMPK (Clarke, P.R., and Hardie. D. G., (1990), EMBO J. 9, 2439-2446). It is now clear that AMPK is a homologue of the yeast protein kinase SNF1 and of plant SnRKls (reviewed by Halford, N. G., and Hardie, D. G., (1998) Plant Molec Biol 37, 735-748). HMGR kinase activities have been partially purified from a number of plant species and there is convincing immunological evidence that the major component of these activities corresponds to the SnRKl protein kinases (Ball, K. L., et al, (1995) FEBS Lett 37, 189-192; Barker J. H. A., et al, (1996) Plant Physiology 112. 1141-1149).

Phytosterols are plant sterols and can be divided in three groups based on methylation levels at C4: 4-desmethylsterols or end product sterols, 4α-monomethylsterols and 4, 4-di-methylsterols. The major group is the 4-desmethysterols with β-sitosterol, stigmasterol, and campesterol being the most abundant species. Other 4-desmethylsterols found in oilseeds include brassicasterol and ^Δ7-avenosterol. Phytosterols can occur in free form (free 3β-hydroxyl group) or as conjugates where the 3-hydroxy group is esterified by fatty acids, phenolic acids such as ferulic acid or with sugar moieties. For the purpose of this description the term sterol refers both to free sterols and conjugated sterols.

Mevalonate synthesis via HMGR is also a key step in isoprenoid biosynthesis in plants, although recent evidence suggests the existence of a second pathway for IPP synthesis (Eisenrach W.. et al, (1996) Proc Natl AcadSci USA 93. 6431-6436). In contrast to animal systems, plants contain multiple HMGR genes, the least number found so far being two (HMGR1 and HMGR2) in Arabidopsis (Enjuto M., et al, (1994) Proc Natl Acad Sci USA 91, 927-931). Plant HMGR activity is regulated in vivo by reversible phosphorylation of the enzyme (Sipat A. B., (1982) Phytochemistry 21, 2613-2618; Russell D. W., et al, (1985) Current topics in Plant Biochemistry (Randall et al, Eds) Columbia MO) as well as transcriptionally (the family members are differentially regulated) (Enjuto M., et al, (1994) supra). They have divergent N-terminal domains but highly conserved membrane-insertion sequences and C-terminal catalytic domains (Monfar M.. et al, (1990) Biochemistry of the mevalonic pathway to terpenoids (Towers. Stafford. Eds) Plenum Press. NY). The catalytic domain of Arabidopsis HMGR1 has been expressed in an active form in E.coli bacteria, and inactivated in vitro by the partially purified HMGR kinase activity from cauliflower through phosphorylation of serine-577 (Dale S.. et al, (1995) FEBS Lett 361, 191-195). This phosphorylation site is present in all of the plant HMGRs characterised so far (See Figure 1, Halford N.G., and Hardie D. G.(1998) supra).

The accompanying Fig. 1 (from Halford and Hardie supra) shows the regulatory phosphorylation sites on HMG-CoA reductases from different plant species. The residues required for recognition by the SnRKl family are highlighted as follows: (1) phosphorylated serine (P), bold and underlined; (2) hydrophobic residues at P-5, P+4, bold; (3) basic residues at P-4, underlined. All sequences are from the GENBANK/EMBL databases. An attempt has been made to upregulate HMGR activity in Arabidopsis by introducing additional copies of HMGR1 under the control of a CaMV35S promoter (Re E. B., et al, (1995) Plant J. 7, 771-784). As well as increasing the copy number of the gene, this also bypasses the transcriptional regulation of its expression. Although the transcript level was increased 40-fold over the level observed in wild-type plants, HMGR activity increased only 3-fold, and no significant change was seen in the accumulation of isoprenoids. In transgenic tobacco plants expressing a HMGR gene from the rubber plant, Hevea brasiliensis, (Schaller H., et al, (1995) Plant Phys 109, 761-770) and from hamster (Chappell J.. et al, (1995) Plant Physiol 109, 1337-1343), both using the CaMV35S gene promoter, enzyme activity increased 3-8 fold and in these cases sterol production did increase by 3-6 fold. However, observed changes in enzyme activity and sterol content in plants have so far only been reported in leaf tissue, and not in seed tissue.

Although transformed tobacco plants with the sense construction pGGh-1 shared a significant increase in HMGR activity in the plant extract, it was not possible to discriminate whether the increase was due to chimaeric HMGR or to the endogenous tobacco hMGR as a physiological response of the plant (Godoy-Hernandez G. C et al (1998) J. Plant Physiology 53. 415-424). Also it was not possible to determine whether the alterations in metabolism involved HMGR-related isoprenoid production.

An object of this invention is to increase the levels of isoprenoid. particularly, terpenoid. compounds, and particularly those of nutritional benefit, such as the fat soluble vitamins, like vitamin E and K and sterols, in crop plants and also their products such as rapeseed oil. Both classes of compounds may be efficacious in reducing coronary heart disease. For example, sterols from commonly used edible oils (soybean, rapeseed and sunflower), that is the 4-desmethyl sterols β-sitosterol, stigmasterol, and campesterol, have been shown to have a cholesterol lowering effect (Westrate & Meijer (1998) Eur JClin Nutr 52: 334-344, Jones et al (1997) Canadian Journal of Physiology and Pharmacology 75, 217-227; Pelletier et al (1995) Annals and Nutrition and Metabolism 39, 291-295) and vitamin E has also been shown to reduce atherosclerotic plaques via oxidation of LDL (Stenvinkel et al. (1995) Kidney International 5, 1899-191 1 ; Qiao et al (1993) Arteriosclerosis and thrombosis 13, 1885-1892). Similarly, vitamin K-dependant proteins, are known to play a regulatory role in vascular biology (Pellegrino et al (1996) Journal of Pediatric WO 01/31043 PCTV GBOO/04141

4 Gastroenterology and Nutrition 23, 413-414; Freeman et al. (1996) Journal of Biological Chemistry 271, 16227-16236). The proteins are blood coagulation and regulatory proteins that contain γ-carboxyglutamic acid and require calcium for their interaction with cell membranes, γ-carboxyglutamic acid is produced from glutamic acid on the nascent protein chain in a reaction that requires Vitamin K as a cofactor. They include blood clotting factor IX. The data currently suggests that in humans vitamin K-dependent proteins prevent the degeneration of an atherosclerotic vessel wall. In addition, vitamin K is also important in bone metabolism and in the prevention of postmenopausal osteoporosis (Akiyama et al. (1999) Japanese Journal of Pharmacology 80, 67-74; Raisz (1999) Journal of Bone and Mineral Metabolism 17, 79-89; Jie et al (1996) Calcified Tissue International 59, 352-356).

The present invention involves introducing novel HMGR genes, in the form of mutant plant and plant/non-plant or different plant chimaeric genes, into plants with the aim of increasing isoprenoid biosynthesis and/or accumulation by uncoupling HMGR from regulation by SnRKl. Transcriptional regulation of the HMGR genes can be avoided by using heterologous promoters. The inventors have shown an increase in seed sterol content, which has not been shown previously.

According to one aspect of the invention there is provided a method of modifying plants, the method comprising modifying a plant HMGR gene which encodes an unmodified HMGR gene product whose activity is regulated so that the modified HMGR gene encodes a modified gene product and placing the modified HMGR gene in a plant or plant cells, in which the modified HMGR gene product is not so regulated.

The unmodified HMGR gene product may be regulated by phosphorylation. Preferably, the modified gene product is no longer subject to regulatory phosphorylation.

The unmodified HMGR gene product may have at least one phosphorylation site. The or each phosphorylation site may include a serine. threonine or tyrosine residue. The or each phosphorylation site may be rendered inactive in the modified HMGR gene product by the replacement of at least one serine, threonine or tyrosine residue of the unmodified gene product with, for example, an alanine residue. Alteration of the phosphorylation site at any of the positions highlighted in Figure 1 could be as effective as substituting the serine residue, since SnRKl requires hydrophobic residues at positions +4 and -5 with respect to the serine, and a basic residue at -3 or -4.

The HMGR gene may be further modified to reduce transcriptional regulation. For example, the gene may be modified through the introduction of at least one heterologous promoter. In such a case, the heterologous promoter may, for example, be selected from the CaMV35S and ACP promoters such as, for example, a rapeseed ACP promoter. Homologous promoters can be used but such constructs may be subject to transcriptional regulation.

Alternatively, the plant HMGR gene may be modified by the inclusion of a heterologous sequence for a corresponding HMGR gene from another species

The heterologous sequence may, for example, be derived from yeast. In particular, it may be derived from S. cerevisae but other yeasts such as S. pombe and Candida spp. may be used. Alternatively, it may be derived from another plant species or from fungi or another organism which synthesises isoprenoids.

In either method, the phosphorylation site may fit the consensus sequence:

-5 -3 i +4

Consensus sequence: XMXRXXSXXXL

L K T F V H I

FRX M

I V

The phosphorylation site may be selected from:

Arabidopsis thaliana 1 HMKYNRSSRDI

Camptotheca acuminata HMKYNRSNKDV

Catharanthus roseus HMKYNRSSKDI Hevea brasiliensis 1 Hls-KYNRSSKDM

Nicotiana sylvestris HMK YN RST K DV

Potato HMKYNRSIKDI

Rice HMMYNRSSKDV

Tomato 1 HMKYNRSTKDV

The invention also provides plants and plant reproductive material obtainable by a method of modifying plants according to the invention. The plants may be selected from higher plants such as the crop plants: tobacco, tomatoes, spinach, broccoli, peas, cauliflower and potatoes. Alternatively, the plants may be selected from oil plants such as rapeseed. palm, sunflower, soya bean and tea. The plants may also be selected from monocotyledonous plants, including seeds and the progeny or propagules thereof, for example Lolium. Zea, Triticum, Sorghum. Triticale, Bromus, Oryzae. Avena. Hordeum, Secale and Setaria, in particular maize, wheat, rice, and barley, as well as dicotyledonous plants, including but not limited to Fabaceae. Brassicaceae. Solanum especially oilseed rape, beans (notably soybeans), sunflower, potatoes, cabbages, spinach, broccoli, peas, cauliflower, tomato, forest trees, roses and tea.

The invention also provides a method of growing plants or plant cells or explants comprising culturing a plant, plant cell, explant or plant reproduction material for example host cultures, obtainable by a method of modifying plants according to the invention. For example, the plant cells and tissue cultures could be made de novo. for example by Agrobacterium tumefaciens-mediated transformation of plant explants and/or callus culture, or by Agrobacterium rhizogenes-mediated transformation of a plant (for example as described by Tepfer D. (1990) Physiologia Plantarum 79. 140146) to produce transgenic hairy roots. Plant cells and tissue cultures can also be produced by generating a transgenic plant, as described, and then inducing callus formation by hormone treatment or hairy root formation by Agrobacterium rhizogenes infection.

The invention also provides a method of producing isoprenoids comprising culturing a plant or plant cells or explants and collecting isoprenoids for the plant cells or media; and also isoprenoids obtainable by such a method. Isoprenoids obtainable by such a method include sterols (such as β-sitosterol, campesterol, stigmasterol, brassicasterol and Δ5-avenosterol), terpenoids (such as fat-soluble vitamins) and carotenoids.

The invention also provides seeds obtainable from plants, plant cells and explants and plant reproduction material according to the invention.

The invention further provides a method of producing isoprenoid-containing oil comprising extracting oil from seeds according to the invention.

The invention also provides a nucleotide sequence encoding a modified HMGR, wherein the amino acid sequence of the modified HMGR is altered relative to the amino acid sequence of unmodified HMGR. by amino acid substitution of at least one serine. threonine or tyrosine residue at a phosphorylation site within the HMGR.

The invention further provides a method for increasing pathogen, fungus and insect and mite pest resistance in plants by increasing the expression of an isoprenoid in the plant by modifying the plant as defined above. Examples of such fungus are Fusarium. Aspergillus, Phytopthera, Gaeumannomyces, Downy mildews, Colletotrichum, Cochliobolus, Tapesia, Magnaporthe, Stagonospora, Rhynchosporium, Septoria. Helminthosporium, and powdery mildews such as Blumeha and Erysiphe. Examples of insect and mite pests are Homoptera. Diptera. Lepidoptera. Coleoptera. Hemiptera. Hymenoptera. Dictyoptera. Orthoptera. arachnids and mites. The method may also include attracting beneficial species of insects and mites such as any species of Hymenoptera. Odonata. Hemiptera. Coleoptera. Neuroptera, and arachnids including spiders and predatory mite, or their larvae.

The invention also provides a nucleotide sequence encoding a chimaeric HMGR comprising an N-terminal domain-encoding region derived from a plant HMGR nucleotide sequence, and a C -terminal domain-encoding region HMGR nucleotide sequence derived from a different organism, such as a yeast. The nucleotide sequence may comprise a heterologous promoter such as CaMV355 or ACP.

The invention also provides a HMGR encoded by a nucleotide sequence according to the invention.

The invention further provides a method of increasing the levels of 4-desmethylsterols in plants and seeds by expression of a HMGR according to the invention.

Two particular strategies to produce novel modified HMGR enzymes that are uncoupled from phosphorylation control can be used.

The first strategy involves site directed mutagenesis of the active serine in the enzyme, thereby removing the target for the SnRKl s which phosphorylate the unmodified enzyme.

For example, the sequence of Arabidopsis HMGRl that encodes Ser⁵⁷⁷ can be altered for example from TCC to GCC, which encodes Ala.

The second strategy involves the construction of a chimaeric gene comprising the catalytic domain-encoding region of an HMGR gene from another isoprenoid-synthesizing organism, for example the yeast HMGR gene, and the N-terminal domain-encoding region of Arabidopsis HMGRl . The gene can then be produced by PCR amplification of the N-terminal region of Arabidopsis HMGRl. which should ensure that the chimaeric HMGR protein is targeted to the correct location in the plant cell and the C-terminal region of yeast HMGR using primers which incorporate a suitable restriction site at the "join", and ligation and cloning of the PCR products. The fusion point is preferably located at the C-terminal end of the linker region between the membrane-spanning domain and the catalytic domain. Other fusions are contemplated and are within the ambit of the skilled worker. These novel HMGR sequences can be placed in vectors downstream of the constitutive CaMV35S (Odell J. T., et al, (1985) Nature 313, 810-812) and acyl carrier protein (ACP) promoters. The ACP promoter De Silva J., et al, (1992) Plant Molec Biol 18, 1 163-1 172 WO92/18634) is active only in seed ("seed specific" - Gallie, D. R., et al (1989) Plant Cell 1, 301-311; promoters and introduced into tobacco and oilseed rape plants. A suitable ACP promoter-containing vector is pNH12. A suitable CaMV35S promoter containing vector is pJD330. The use of heterologous promotors avoids the transcriptional regulation of the HMGR gene which occurs with the unmodified gene.

The generation of plants and plant tissues in accordance with the invention will now be described, by way of example only, with reference to the following further drawings Figures 2 to 6 in which:

Fig. 2 shows the nucleotide and derived amino acid sequence of S cerevisiae HMG-CoA reductase gene HMGRl (EMBL database accession number M22002);

Fig. 3 shows the nucleotide and derived amino acid sequence of Arabidopsis HMG-CoA reductase gene HMGRl (EMBL database accession number J04537);

Fig. 4a shows a schematic diagram of the construction of genes comprising the acyl carrier protein (ACP) gene promoter, nopaline synthase gene terminator (terminator) and either the mutant arabidopis HMGRl containing the T1799-G (Serine577-alanine) substitution or the chimaeric arabidopsis/yeast HMGR gene.

Fig. 4b shows a schematic diagram of the construction of genes comprising the CaMV35S gene promoter. Ω enhancer sequence (Ω), nopaline synthase gene terminator (terminator) and either the mutant arabidopsis HMGRl containing the T1799-G (Serine577-alanine) substitution, or the chimaeric arabidopsis/yeast HMGR gene.

Fig. 5A shows a ATHMGRM sequence (i.e. mutant ATHMGR1 sequence) and Fig. 5B shows a chimeric HMGRl sequence used in constructs of the invention; and

Fig. 6 is an alignment of derived amino acid sequences of HMG-CoA reductases encoded by wild type Arabidopsis gene, HMGRl (athmgrl). a novel mutant gene, (athmgrm) in which the serine residue (S) at position 577 is replaced with an alanine residue (A), part of the yeast (Saccharomyces cerevisiae) wild type gene (schmgrl) and a novel chimaeric gene comprising the N-terminal membrane-spanning part of the Arabidopsis HMGRl gene and the C-terminal catalytic part of the yeast HMGRl gene. Matching residues are highlighted with a black background. Residue numbers are given on the right. Fig. 7 is an alignment of derived amino acid sequences of HMG-CoA reductases encoded by wild type Arabidopsis gene, HMGRl (athmgrl) and the mutant gene, (athmgrm) in which the serine residue (S) at position 577 is replaced with an alanine residue (A). Matching residues are highlighted with a black background.

Fig, 8 is an alignment of derived amino acid sequences of HMG-CoA reductases encoded by wild type Arabidopsis gene, HMGRl (athmgrl), yeast (Saccharomyces cerevisiae) wild type gene (schmgrl) and a novel chimaeric gene comprising the N-terminal membrane-spanning part of the Arabidopsis HMGRl gene and the C-terminal catalytic part of the yeast HMGRl gene. For clarity, only the N-terminal portion of the Arabidopsis protein and C-terminal portion of the yeast protein are included, but all of the novel chimaeric protein is shown. Matching residues are highlighted with a black background. Residue numbers are given on the right.

Fig. 9 is a bar chart comparing levels of EJD25 and MAS1 sterols in leaf material.

Fig. 10 is a bar chart comparing levels EJD25, ENH7 and MAS1 sterols in seed material.

1. Generation of engineered plants

Modified plants can be produced according to two strategies: either the HMGR gene is modified by site directed mutagenesis so as to encode a modified gene product which is resistant to phosphorylation because it lacks a specific serine residue (serine 577) or a more substantial modification is made to the HMGR gene so that a C terminal portion in the HMGR gene product is replaced by a coding region from a different organism.

a. Site directed mutagenesis of HMGR gene

Primers ATACAATAGAGCCAGCCGAGAC and GTCTCGGCTGGCTCTATTGTAT are generated and used for site-directed mutagenesis (for example using Stratagene Quickchange system) of the ATHMGR1 sequence to replace T¹⁷⁹⁹ with G. causing a Serine⁵⁷⁷ to alanine substitution in the encoded protein (See Fig. 5A). Alterations may be also performed to cause substitutions at positions 572, 573, 574 or 581 of the amino acid sequence, corresponding to the positions highlighted in Figure. 1. The modified gene, ATHMGRM, is shown schematically in Fig. 4 and its sequence is shown in Fig. 5. A. The modified HMGRl coding sequence is under the control of the ACP promoter. The terminator is the nopaline synthase (nos) termination sequence. The modified HMGR gene is then introduced into plants using conventional Agrobacterium tumefaciens - mediated transformation (Bevan, M, 1984 infra).

b. Production of chimaeric HMGR genes

ATHMGRl sequences can be amplified from Arabidopsis total RNA by rtPCR.

SCHMGR1 sequences are amplified from yeast total RNA by rtPCR. The following oligonucleotide primers can be used:

1. ACGTCCATGGATCTCCGTCGGAGGC

2. ACGTGAATTCAGATTCAGATCATGT

This pair are used to amplify the full-length ATHMGRl sequence (71 - 1858 in the sequence of Figure 3 below) and to incorporate Ncol and EcoRI restriction sites

3. AAACCTGCAGAGAACAAAGAGGTCGCC

4. ACGTGAATTCGACGTATGACTAAGTTTAGG

are used to amplify the catalytic domain of SCHMGR1 (encoded by base pairs 1970 - 3298 in sequence below) and to incorporate Pstl and EcoRI restriction sites within the amplified DΝA.

5. GTCTTCTGCAGGAAGCGATTCGGT

This oligonucleotide together with oligonucleotide

ACGTCCATGGATCTCCGTCGGAGGC can be used to amplify the targeting domain of AtHMGRl (71 - 578 below)

Two additional constructs can be made by cloning the mutant and chimaeric HMGR sequences downstream of an Ω-enhanced CaMV35S promoter in plasmid PJD330 (Gallie, D. R., et al (1989) supra). This promoter drives expression in a constitutive manner. This involves amplification of the sequences with the original 5' oligonucleotides and the following 3' oligonucleotides:

Mutant arabidopsis HMGR:

ACGTCCCGGGAGATTCAGATCATGT

Chimaeric HMGR:

ACGTCCCGGGACGTATGACTAAGTTTAGGA

These will introduce a Smal site at the 3' end (see Fig. 4b).

The resulting constructs are then introduced into plants as described above.

Mutant and chimaeric HMGR genes have been produced. The mutant gene was produced by converting T¹⁷⁹⁹ (Fig. 3) of the Arabidopsis gene to a G, by site directed mutagenesis, leading to a Serine to Alanine substitution in the SnRK phosphorylation site. This should remove the encoded protein from phosphorylational control by the kinase. The chimaeric gene was prepared by joining the targeting domain of the Arabidopsis gene to the catalytic domain of the yeast gene and lacks the SNFl /SnRKl phosphorylation site. The HMGR protein is not under the control of the Snfl kinase in yeast. The entire nucleotide sequences of these genes have been checked against those published. The sequences have been placed downstream of cauliflower mosaic virus 35S RNA and ACP promoters by cloning them into JD330 and NH12 plasmids respectively, to make a total of 4 chimaeric gene constructs, 35S-mutant HMGR (MAS), 35S-chimaeric HMGR (ASS), ACP-mutant HMGR (MAE) and ACP-chimaeric HMGR (MASE).

c. Plasmids containing the chimaeric gene constructs have been used to transform tobacco (SRI) using Agrobacterium-mediated transformation. Control plants have been produced containing promoter and terminator sequences without the HMGR inserts. The numbers of transgenic plants generated is given in Table 1 :

Table 1

The transgenic plants have been analysed by RT-PCR, measurement of HMGR activity, and also analysis of sterol content. 16 plants have been analysed for sterol content and at least one, MASl, containing the 35S mutant HMGR construct has been found to have a higher sterol content than controls in both leaves and seeds. Analyses of its sterol content compared with EJD25 (35S - empty cassettes) and ENH7 (ACP-empty cassettes) are shown in Figs. 9 and 10.

The inventors have shown that transforming a plant with an HMGR gene encoding a protein lacking in the target phosphorylation site recognized by the SnRKl protein kinase results in increased sterol biosynthesis.

d. Production of other plants which have been engineered

Other plants such as oilseed rape can be produced by transformation using Agrobacterium tumefaciens (See Bevan M. Nucl Acids Res. 1984; 12, 871 1-8721; Horsch. R. B.. (1985) Science 227, 1229-1231).

2. Generation of plant cells

a. Production of engineered tobacco cells

Plant cells can be produced from the plants described in Example 1 above or they could be made de novo, for example by Agrobacterium tumefaciens-mediated transformation of a callus culture, or by Agrobacterium rhizogenes-mediated transformation of a plant (for example as described in Tepfer, D. (1990) Physiologia Plantarum 79: 140-146) to produce hairy roots. Alternatively, plant and tissue cultures can be generated by producing a transgenic plant, as described, then inducing callus formation by hormone treatment or hairy root formation by Agrobacterium rhizogenes infection. Calluses can be produced as described for example by Mar et al (1997) Plant Molecular Biology 34, 31-43 with the technique being adapted by the skilled worker. Generally, calluses can be induced from many different plant tissues by treatment with an auxin (usually 2,4-dichlorophenoxyacetic acid).

The production of isoprenoids in hairy root cultures is well known. Examples of isoprenoid production in hairy root cultures are given by: Sim. S. J. et al (1994), Journal of Fermentation and Bioengineering 78. 229-234; Takeda, T. et al (1994) Chem. Pharm. Bull. 42, 730-732; Delbecque et al (1995) Eur. J. Entomol 92. 301-307; Hu. Z-B. and Alferman, A. W. (1993) Phytochemistry 32, 699-703; and Sato K. et al (1991) Phytochemistry 30. 1507-1510 by way of example.

b. Culture of plant cells

Plant cells produced as described above can be cultured under normal conditions.

3. Production of isoprenoids.

Plants and plant cells and explants produced as described above were grown under normal conditions and HMGR activity measured by the radiochemical method described by Chappell et al (1995) (Plant Physiology 109, 1337-1343). Sterol content was analysed by gas chromatography-mass spectroscopy (gc-ms)

A schematic representation of the preparation of isopentyl pyrophosphate is shown in the following flow diagram:

Flow diagram

Acetate

3-hydrpxy-3-methyl-glutaryl Co A (HMG-CoA)

Active HMG-CoA reductase

SnRKl

Mevaionate

Inactive HMG-CoA reductase, phosphorylated at Serine-577

Isopentyl pyrophosphate (IPP)

IPP is the precursor of all isoprenoids, including sterols. gibbereilins, ABA, phytoalexins, various pigments, carotenoids. fat-soluble vitamins (e.g E and K) and more.

Whilst the invention has been described in relation to increasing isoprenoids in oilseeds to enhance the value of the oil. the invention can be used to improve food quality or nutritional value of many crops. Other applications include increasing pathogen and insect resistance of plants, and in the production of pharmaceuticals, fragrances and other non-food substances in plants and plant callus or cell or explant cultures.

Claims

1. A method of modifying plants, the method comprising modifying a plant HMGR gene which encodes an unmodified HMGR gene product whose activity is regulated so that the modified HMGR gene encodes a modified HMGR gene product, and placing the modified HMGR gene in a plant or plant cells, in which the modified HMGR gene product is not so regulated.

2. A method according to claim 1 in which the unmodified HMGR gene product is regulated by phosphorylation.

3. A method according to claim 1 or 2 in which the modified HMGR gene product is no longer subject to regulatory phosphorylation.

4. A method according to claim 1, 2 or 3 in which the unmodified HMGR gene product has at least one phosphorylation site.

5. A method according to claim 4 in which the or each phosphorylation site includes a serine, threonine or tyrosine residue.

6. A method according to claim 5 in which the phosphorylation site has been rendered inactive in the modified HMGR gene product by the replacement of at least one serine threonine or tyrosine residue of the unmodified gene product.

7. A method according to claim 6 in which at least one serine. threonine or tyrosine residue is replaced by at least one alanine or other residue.

8. A method according to any preceding claim in which the HMGR gene is modified to reduce transcriptional regulation.

9. A method according to claim 8 in which the HMGR gene is modified through the introduction of at least one heterologous promoter.

10. A method according to claim 9 in which the heterologous promoter is selected from the CaMV35S and ACP promoters.

1 1. A method according to claim 9 wherein the ACP promoter is a rapeseed ACP promoter.

12. A method according to claim 1 in which the method comprises modifying a plant HMGR gene which encodes an unmodified HMGR gene product whose activity is regulated, by the inclusion of a heterologous sequence for a corresponding HMGR gene from another species.

13. A method according to claim 12 in which the heterologous sequence is derived from another plant species, yeast or fungi or another isoprenoid-producing organism.

14. A method according to claim 12 or 13 and in which the heterologous sequence is derived from a yeast, in which the yeast is selected from S. cerevisae. S. pombe and Candida spp.

15. A method according to any one of claims 4 to 7 in which the phosphorylation site fits the consensus sequence:

- 5 -3 4- +4

Consensus sequence: XMXRXXSXXXL

L K T F V H I

FRX M

I V

16. A method according to claim 15 wherein the phosphorylation site is selected from:

Arabidopsis thaliana 1 HMKYNRSSRDI

Camptotheca acuminata HMKYNRSNKDV

Catharanthus roseus HMKYNRSSKDI Hevea brasiliensis 1 HMKYNRSSKDM

Nicotiana sylvestris HMKYNRSTKDV

Potato HMKYNRSIKDI

Rice HMMYNRSSKDV

Tomato 1 HMKYNRSTKDV

17. A method according to any one of claims 1 to 16 in which the plant is selected from higher plants.

18. A method according to claim 17 in which the higher plant is a crop plant.

19. A method according to claim 18 in which the crop plant is selected from tobacco, tomatoes, vegetables such as spinach, broccoli, peas cauliflower and potatoes, oil plants such as rapeseed. palm, sunflower, soybean, tea, maize, wheat, rice, barley, beans, sunflower, cabbage, tomato, forest trees and roses.

20. Plants, plant cells and explants and plant reproductive material obtainable by a method according to any preceding claim.

21. A method of growing plants or plant cells or explants comprising culturing a plant, plant cell, explant or plant reproduction material according to claim 20.

22. A method of producing isoprenoids comprising culturing a plant, plant cell or explant according to claim 20 and collecting isoprenoids from the plant, plant cell or explant or media.

23. A method according to claim 22 in which the plant is selected from higher plants.

24. A method according to claim 23 in which the higher plant is a crop plant.

25. A method according to claim 24 in which the crop plant is selected from tobacco, tomatoes, vegetables such as spinach, broccoli, peas, cauliflower and potatoes, oil plants such as rapeseed, palm, sunflower, soybean, tea. maize, wheat, rice, barley, beans, sunflower, cabbage, forest trees and roses.

26. A method according to any one of claims 22 to 25 in which the isoprenoid is a sterol, a terpenoid or a carotenoid.

27. A method according to any one of claims 22 to 26 in which the isoprenoid is a fat soluble vitamin.

28. A method according to claim 26 and in which the isoprenoid is a sterol in which the sterol is β-sitosterol. campesterol, stigmasterol, brassicasterol or Δ5-avenosterol.

29. Isoprenoids obtainable by a method according to any one of claims 22 to 25.

30. Seeds obtained from plants, plant cells and explants and plant reproductive material according to claim 20.

31. A method of producing isoprenoid-containing oil comprising extracting the oil from seeds according to claim 30.

32. A nucleotide sequence encoding a modified HMGR. wherein the amino acid sequence of the modified HMGR is altered relative to the amino acid sequence of unmodified HMGR by amino acid substitution of at least one serine, threonine or tyrosine residue at a phosphorylation site within the HMGR.

33. A nucleotide sequence encoding a chimaeric HMGR comprising an N-terminal domain-encoding region derived from a plant HMGR nucleotide sequence, and a C-terminal domain-encoding region HMGR nucleotide sequence derived from a different organism.

34. A nucleotide sequence according to claim 33 wherein the different organism is a yeast.

35. A nucleotide sequence according to any one of claims 32 to 34 comprising a heterologous promoter.

36. A nucleotide sequence according to claim 35 wherein the heterologous promoter is CaMV355 or ACP.

37. A HMGR encoded by a nucleotide sequence according to any one of claims 32 to 36.

38. A method of increasing the levels of 4-desmethylsterols in plants and seeds by expression of a HMGR according to claim 37.

39. A method of increasing pathogen resistance in a plant, the method comprising increasing expression of an isoprenoid in the plant by a method of modifying the plant according to any one of claims 1 to 19.

40. A method according to claim 39 in which the plant is selected from monocotyledonous plants, including seeds and the progeny or propagules thereof, for example Lolium, Zea, Triticum. Sorghum, Triticale, Bromus, Oryzae, Avena, Hordeum. Secale and Setaria, in particular maize, wheat, rice, and barley, as well as dicotyledonous plants, including but not limited to Fabaceae, Brassicaceae. Solanum especially oilseed rape, beans (notably soybeans), sunflower, potatoes, cabbages, spinach, broccoli, peas, cauliflower, tomato, forest trees, roses and tea.

41. A method according to claim 39 in which the pathogen is a fungus.

42. A method according to claim 41 in which the fungus is any species of Fusarium, Aspergillus, Phytopthera, Gaeumannomyces, Downy mildews, Colletotrichum, Cochliobolus, Tapesia, Magnaporthe. Stagonospora, Rhynchosporium, Septoria, Helminthosporium, and powdery mildews such as Blumeria and Erysiphe.

43. A method of increasing resistance to insect and mite pests in a plant, the method comprising increasing expression of an isoprenoid in the plant by a method of modifying the plant according to any one of claims 1 to 19.

44. A method according to claim 43 in which the insect is any species of Homoptera, Diptera. Lepidoptera. Coleoptera, Hemiptera, Hymenoptera, Dictyoptera, Orthoptera, arachnids and mites.

45. A method according to claim 43 in which a beneficial insect or a mite, such as any species of Hymenoptera. Odonata. Hemiptera. Coleoptera, Neuroptera. and arachnids including spiders and predatory mite, or their larvae is attracted to the plant.