WO2001025255A2

WO2001025255A2 - Novel zinc finger protein

Info

Publication number: WO2001025255A2
Application number: PCT/US2000/027620
Authority: WO
Inventors: Olivia M. Pereira-Smith; Qitao Ran
Original assignee: Baylor College Of Medicine
Priority date: 1999-10-07
Filing date: 2000-10-06
Publication date: 2001-04-12
Also published as: WO2001025255A3; AU7866400A; WO2001025255A9

Abstract

The invention relates to a nucleotide sequence encoding a novel zinc finger protein, and fragments and derivatives thereof, wherein the nucleotide sequence is upregulated in gene expression in senescent and quiescent cells. The invention also relates to an amino acid sequence of a novel zinc finger protein, and fragments and derivatives thereof wherein said sequence is characterized by eight tandemly repeated zinc fingers and the presence of a complete KRAB box which is necessary for transcriptional repression and localization of the protein to the nuclear matrix. The invention also relates to the novel zinc finger protein being a transcriptional activator, particularly in the presence of a coactivator.

Description

Novel Zinc Finger Protein

The work herein was supported by grants from the Unites States Government. The United States Government may have certain rights in the invention.

FIELD OF THE INVENTION

This invention relates to the nucleotide sequence of SEQ ID NO:l, the amino acid sequence of SEQ ID NO:2, and fragments and derivatives thereof for a novel zinc finger protein.

BACKGROUND OF THE INVENTION

The zinc finger is a well-defined DNA binding domain. Many zinc finger- containing proteins have been identified and grouped into a number of subfamilies (Klug and Schwabe, 1995). The classic C H₂ zinc finger protein family has the largest number of family members based on the consensus sequence: CX₂CX₃FX₅LX₂HX₃H, where X indicates the presence of any amino acids between conserved residues. Depending on the conserved domain at the N terminus, those proteins have been further classified into at least four groups: FAX (finger-associated boxes) (Knochel et al, 1989), FAR (finger-associated repeats) (Klocke et al, 1994), POZ (pox virus and zinc fingers, also known as (Zin) (Numoto et al, 1993; Bardwell and Treisman, 1994), and KRAB (Kruppel- associated box) (Bellefroid et al, 1991). KRAB zinc finger genes constitute about one-third of all known C₂H₂ genes, and there are about 300 KRAB genes in the vertebrate genome. The KRAB domain is rich in acidic amino acids, and contains box-A and box-B, which have the potential to form two -helices. It has been shown that the KRAB A box, when tethered to a promoter by the Gal 4 DNA binding domain, inhibits both activated and basal levels of transcription, and the effect is distance independent (Witzgall et al, 1994; Margolin et al, 1994). Some members of the KRAB zinc finger protein have been shown to bind double stranded DNA (Elser et al, 1997), RNA and the RNA polymerase II largest subunit (Grondin et al, 1997; Grondin et al, 1996).

Recently, a RING finger protein, KAP-1/TIF lβ (Friedman et al, 1996; Moosmann et al, 1996), was identified as a protein that interacts with the KRAB domain. The Kap-1/TIF lβ protein has several interesting motifs in its sequence, including a RING finger-Bl-B2 structure, a coiled-coil domain, a PHD finger and Bromo-like domain. KAP-1/TIF lβ acts as a corepressor to mediate KRAB domain repression. It has been suggested that KRAB containing zinc finger proteins perform their biological functions by recruiting KAP-1/TIF lβ through their KRAB domains. KAP-1/TIF lβ/KRIP-1 was found to interact with HP -1 like proteins such as M31, M32, hHPlα, hHPl (Friedman et al, 1996), thus changing the structure of the chromatin and inhibiting transcription. Given the abundance of KRAB zinc finger genes in the human genome, this pathway is emerging as an important pathway for regulation of gene expression.

SUMMARY OF THE INVENTION

An embodiment of the present invention is a nucleotide sequence of SEQ

ID NO:l. An additional embodiment of the present invention is an amino acid sequence of SEQ ID NO:2. In a specific embodiment the sequence is a zinc finger protein. In a specific embodiment said sequence is a tumor suppressor.

Another embodiment of the present invention is a method of regulating gene expression in a cell comprising the step of repressing transcription of a nucleic acid sequence by administering to the cell a nucleic acid sequence of SEQ ID NO:l encoding an amino acid sequence of SEQ ID NO:2 or by administering SEQ ID NO:2 to the cell. A further embodiment of the present invention is a method to identify transformed cells comprising the step of determining the expression level of the nucleic acid sequence of SEQ ID NO:l. In specific embodiments said expression level is determined by nucleic acid hybridization, polymerase chain reaction, or by reporter sequence assay. In a further specific embodiment said reporter sequence is selected from the group consisting of ampicillin, neomycin, kanamycin, β-galactosidase, β-glucuronidase, chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), blue fluorescent protein (BFP), and luciferase.

Another embodiment is a method of identifying a transformed cell comprising the step of determining the subcellular localization of an amino acid sequence of SEQ ID NO:2 in a cell, wherein when the sequence is located substantially other than to a nuclear matrix, the cell is a transformed cell. In specific embodiments the subcellular localization of SEQ ID NO:2 is determined by a method selected from the group consisting of association of an amino acid sequence of SEQ ID NO:2 with the nuclear matrix, epitope tagging, subcellular fractionation, immunofluorescence, immunoblot, or with antibodies to SEQ ID NO:2.

An additional embodiment is a method of generating a transformed cell comprising the step of reducing the expression level of a nucleic acid sequence of

SEQ ID NO:l in a cell to be transformed. In a specific embodiment said level is reduced by inhibiting synthesis of said nucleic acid sequence. An additional embodiment is a method of generating a transformed cell comprising the step of reducing the level of an amino acid sequence of SEQ ID NO:2 in a cell to be transformed. In specific embodiments the level is reduced by inhibiting synthesis of, by increasing breakdown of, by administering antibodies to or by administering an antagonist to an amino acid sequence of SEQ ID NO:2. In another specific embodiment said amino acid level is reduced by transfecting into a cell to be transformed an antisense sequence of a nucleic acid sequence of SEQ ID NO: 1. An additional embodiment is a method of generating a transformed cell comprising the step of altering the amino acid sequence of SEQ ID NO:2.

Another embodiment of the present invention is a method to inhibit proliferation of cell growth comprising the step of increasing the level of the nucleic acid sequence of SEQ ID NO: l in a cell. In specific embodiments, the level is increased by upregulating expression of or by transfection of the cell with a nucleic acid sequence of SEQ ID NO: 1.

An additional embodiment of the present invention is a method to inhibit proliferation of cell growth comprising the step of increasing the level of the amino acid sequence of SEQ ID NO:2 in cells. In specific embodiments said level is increased by protein transduction or by decreasing protein degradation.

In another embodiment a method of inhibiting proliferation of cell growth comprises the step of altering an amino acid sequence of SEQ ID NO:2, wherein when the sequence is altered, the proliferation of cell growth is inhibited. In a specific embodiment said alteration creates a dominant negative mutant.

An additional embodiment is a nucleic acid sequence of SEQ ID NO: l, or fragments and derivatives thereof wherein said sequence and fragments and derivatives encode a KRAB domain. Another embodiment is a nucleic acid sequence of SEQ ID NO: l, wherein the sequence comprises an alteration in a sequence which encodes a KRAB domain.

Another embodiment of the present invention is a method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in the cell by administering to the cell an amino acid sequence encoded by SEQ ID NO: l or an amino acid sequence of SEQ ID NO:2. In another specific embodiment, the nucleic acid sequence is p21 or pl6.

In another embodiment, there is a method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in the cell by administering an amino acid sequence encoded by SEQ ID NO: l or by administering an amino acid sequence of SEQ ID NO: 2 wherein said administration further includes a coactivator. In additional specific embodiments the nucleic acid sequence is p21 or pl6. In other specific embodiments the nucleic acid sequence is upregulated in quiescent or senescent cells. In another specific embodiment the coactivator is selected from the group consisting of

VP16, MRG15, MRGX and MORF4.

In another embodiment of the present invention there is a complex for upregulating transcription of a nucleic acid sequence wherein said complex comprises SEQ ID NO:2 and an amino acid sequence selected from the group consisting of VP16, MRG15, MRGX and MORF4. In a specific embodiment, the nucleic acid sequence is selected from the group consisting of p21 and pl6.

Another embodiment of the present invention is a non-human knockout animal comprising either a defective allele of SEQ ID NO:l or two defective alleles of SEQ ID NO: 1. In a specific embodiment, the animal is a mouse.

An additional embodiment of the present invention there is a transgenic non-human animal comprising an expression cassette, wherein the cassette comprises a nucleic acid encoding SEQ ID NO:l, or a functionally active fragment thereof, under the control of a promoter active in eukaryotic cells. In specific embodiments, the promoter is constitutive, tissue-specific, or inducible. In another specific embodiment, the animal is a mouse.

An additional embodiment of the present inventionis a monoclonal antibody that binds immunologically to a polypeptide comprising SEQ ID NO:2. Another embodiment of the present invention is a polyclonal antisera, antibodies of which bind immunologically to a polypeptide comprising SEQ ID NO:2.

A further embodiment of the present invention is a method of screening for a peptide which interacts with a polypeptide of SEQ ID NO:2, comprising the steps of introducing into a cell a first nucleic acid comprising a DNA segment encoding a test peptide, wherein the test peptide is fused to a DNA binding domain, and a second nucleic acid comprising a DNA segment encoding at least a part of the polypeptide of SEQ ID NO:2, wherein the at least part of the polypeptide of SEQ ID NO:2 is fused to a DNA activation domain; and assaying for an interaction between the test peptide and the at least part of the polypeptide of SEQ ID NO:2 by assaying for an interaction between the DNA binding domain and the DNA activation domain. In a specific embodiment, the DNA binding domain and the DNA activation domain are selected from the group consisting of GAL4 and LexA.

In an embodiment of the present invention there is a kit comprising primers for amplification of a nucleic acid sequence of SEQ ID NO:l. In a specific embodiment the primers are selected from the group consisting of SEQ

ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ

ID NO: 10.

In an additional embodiment of the present invention there is a pharmaceutical composition comprising a nucleic acid sequence of SEQ ID NO:l and a pharmaceutically acceptable carrier. In specific embodiments the nucleic acid sequence is contained on a recombinant vector, wherein the vector is selected from the group consisting of a plasmid, an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a liposome, a lipid, and a combination thereof.

In another embodiment of the present invention there is a pharmaceutical composition comprising an amino acid sequence of SEQ ID NO: 2 and a pharmaceutically acceptable caπier.

Other and further objects, features and advantages would be apparent and eventually more readily understood by reading the following specification and by reference to the company drawing forming a part thereof or any examples of the presently prefeπed embodiments of the invention which are given for the puφose of the disclosure. DESCRIPTION OF THE DRAWINGS

FIGS. 1A and IB are sequence and sequence comparisons of ZFQR.

FIG. 1A is the predicted ZFQR protein sequence. The eight zinc fingers are underlined, and the KRAB domain is double-lined.

FIG. IB is a comparison of the KRAB domains of ZFQR and other members of the KRAB zinc finger gene family. The identical and similar residues are highlighted in dark and gray, respectively.

FIG. 2 shows expression of ZFQR in multiple tissues. A human multiple tissue Northern blot hybridized with the ZFQR gene specific probe 16zf indicates the mRNA levels in various tissues.

FIG. 3A and 3B demonstrate upregulation of ZFQR mRNA in non- dividing cells.

FIG. 3A shows a Ribonuclease Protection Assay performed with total RNA from young (Y), senescent (S), quiescent (Q) and serum stimulated quiescent (24H) HCA2 using a probe specific to ZFQR. Beta-actin was used as a loading control.

FIG. 3B shows a histogram representation of the ratio of ZFQR mRNA versus beta-actin. The ratio of young cells is arbitrarily assigned as 1.

FIGS. 4A and 4B demonstrate localization of ZFQR protein in cells.

FIG. 4A shows immunolocalization of pcDNA-ZFQR-HA transfected into HeLa cells and stained with anti-HA antibody 48 hours later.

FIG. 4B shows immunolocalization of pcDNA-ZFQR (KRABminus)-HA transfected into HeLa cells and stained with anti-HA antibody 48 hours later.

FIG. 4C demonstrates various fractionations of pcDNA-ZFQR-HA transfected HeLa cells. Protein from an equal number of cells (2.5 x 106) was run on a SDS-PAGE gel and Western analyzed with anti-HA antibody. The same blot was analyzed with anti-lamin antibody to indicate the nuclear matrix portions, with anti-beta tubulin to indicate cytosolic protein portion.

FIG. 4D shows pcDNA-ZFQR(KRABminus)-HA transfected HeLa cells that were fractionated and analyzed as in FIG. 4C.

FIG. 5 illustrates that ZFQR inhibits CAT activity. HeLa cells were transfected with pTK-CAT together with the following constructs: control(pM), ZFQR(pM-ZFQR), KRABminus(pM-ZFQR(KRABminus)). The CAT activity in the control experiments is assigned as 100%>.

FIG. 6 illustrates sodium butyrate does not reverse the transcription inhibition effect of ZFQR.

FIG. 7 illustrates that ZFQR stimulates transcription levels of the Elb promoter in the presence of VP16.

FIG. 8 illustrates that ZFQR stimulates transcription levels of the TK promoter in the presence of VP16.

FIG. 9 shows that mutants of ZFQR behave similarly to stimulate transcription of the CAT reporter sequence compared to wild type.

FIG. 10 demonstrates that ZFQR stimulates transcription of a small region (up to -240 bp ) of p21 promoter.

FIG. 11 demonstrates that ZFQR stimulates transcription of a larger region (up to -2400 bp ) of p21 promoter.

FIG. 12 illustrates that MRG15 enhances the upregulation by ZFQR of a reporter construct. DESCRIPTION OF THE INVENTION

I. Definitions

The term "altering" as used herein is defined as changing or making an alteration to a sequence. The sequence may be a nucleic acid sequence or an amino acid sequence. Altering an amino acid sequence may include, for example, a changing of one or more amino acids, substituting one or more amino acids, deleting one or more amino acids, truncating the amino acid sequence, adding amino acids to the amino acid sequence, or modifying one or more amino acids, such as by methylation, acetylation, myristilation, and the like.

The term "antisense" as used herein is defined as the nucleic acid sequence which is complementary to the sense sequence of a gene and its associated transcribed mRNA.

The term "cell cycle" as used herein is defined as the period from one cell division to the following cell division.

The term "cell cycle gene" as used herein is defined as a gene involved in progression through the cell cycle. Examples of cell cycle genes include the cdc genes, the cdk genes, and p53.

The term "coactivator" as used herein is defined as a biological entity which facilitates, enhances or initiates activation of transcription or upregulation of transcription of a nucleic acid sequence. The coactivator may be selected from the group consisting of a nucleic acid, an amino acid, lipid, carbohydrate, sugar, prion, or combination thereof. The activation or upregulation of transcription may be through a direct interaction with an amino acid sequence of SEQ ID NO:2, or it may be through indirect means. Indirect means can include interacting with a complex in which the coactivator and an amino acid sequence of SEQ ID NO:2 do not physically touch. In a specific embodiment the coactivator may bind DNA itself or bind another biological entity which binds DNA, and as a result enhances or allows the ability an amino acid sequence of SEQ ID NO:2 to associate with DNA.

The term "fragments and derivatives thereof as used herein refers to subregions of a sequence which still retain the function of the sequence or could alternatively contain a mutation, chemical modification, deletion, or addition which enhances or decreases the function of said subregion.

The term "nucleic acid hybridization" as used herein is defined as the method well known in the art in which a nucleic acid probe is used to detect the presence of a complementary nucleic acid molecule.

The term "oncogene" as used herein is defined as a nucleic acid sequence which encodes a polypeptide capable of facilitating transformation of a eukaryotic cell.

The term "polymerase chain reaction" as used herein is defined as the method well known in the art in which a nucleic acid sequence is amplified using oligonucleotide primers and a thermolabile DNA polymerase.

The term "RACE" as used herein refers to Rapid Amplification of cDNA

Ends, a method well known in the art to clone cDNAs.

The term "repressing" as used herein is defined as reducing, suppressing or limiting the amount of expression of a nucleic acid sequence. In a specific embodiment the expression level is not repressed completely but only partially.

The term "transcription" as used herein is refeπed to as the generation of an RNA molecule from a DNA template.

The term "transformation" as used herein is refeπed to as the conversion of eukaryotic cells to a state of uncontrolled growth.

The term "transformed cell" as used herein is defined as a cell which has undergone transformation. The term "tumor suppressor" as used herein is defined as a nucleic acid sequence which encodes a polypeptide involved in regulation of cell growth. Recessive mutations lead to development of a tumor. Examples include the retinoblastoma gene or the p53 gene.

The term "two hybrid screen" as used herein refers to a screen to elucidate or characterize the function of a protein by identifying other proteins with which it interacts (see elsewhere herein).

The term "upregulating" as used herein is defined as increasing expression of a nucleic acid sequence to a level over that of wild type endogenous levels.

II. The Present Invention

As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more.

An embodiment of the present invention is a nucleotide sequence of SEQ ID NO:l and fragments and derivatives thereof. Fragments may be any region or regions of said sequence. Derivatives may include sequences which contain one or more mutations. Mutations of nucleic acid sequence can be nonsense, missense, frame shift, insertion or deletion of one or more base pairs. Mutations could lead to a truncated protein or a protein increased in size and could alter the conformation of the protein or could directly affect an amino acid required for the function of the protein. In a specific embodiment, the nucleic acid sequence of SEQ ID NO: l encodes a tumor suppressor. Loss of function of said tumor suppressor activity would affect regulation of cell growth, thereby allowing said cell to proliferate uncontrollably. One skilled in the art is aware that loss of such activity would, in this case, most likely be generated by a recessive mutation, which would lead to development of uncontrolled growth or a tumor. That is, loss of activity of the sequence encoded by SEQ ID NO:l would no longer provide the constraint on the cell cycle.

An additional embodiment of the present invention is an amino acid sequence of SEQ ID NO:2 of a novel zinc finger protein and fragments and derivatives thereof. Fragments may include any portion of said sequence.

Derivatives of the amino acid sequence of SEQ ID NO:2 include alterations to the protein such as a change, loss or addition of an amino acid, truncation or fragmentation of the protein or increase in the size of the protein. Alterations can increase degradation of the protein, can decrease degradation of the protein, can change conformation of the protein or can be present in a hydrophobic or hydrophilic domain of the protein. The alteration need not be in an active site of the protein, but may be present in the KRAB domain or a zinc finger domain. Alterations can include modifications to the protein such as phosphorylation, myristilation, acetylation or methylation. The present invention includes an alteration to the protein which does not affect its function. In a specific embodiment, said amino acid sequence is a tumor suppressor.

A skilled artisan is aware of obtaining sequences within the scope of the invention. In specific embodiments, the sequences are obtained from publicly available repositories such as GenBank (http://www.ncbi.nlm.nih.gov/Genbank/GenbankOverview.html) or, alternatively, from commercially available databases (such as www.celera.com). SEQ ID NO: 2 is GenBank Accession No. AF309561. In other embodiments, SEQ ID NO: 14 (GenBank Accession No. AAG17439) is used interchangeably with SEQ ID NO:2 in the invention. Amino acid sequences which are also within the scope of the methods of the present invention include the following GenBank Accession Nos:

BAB14191 (SEQ ID NO:15); NP_055465 (SEQ ID NO:16); NP_003419 (SEQ ID NO: 17); AF226869 (SEQ ID NO: 18); NP_057349 (SEQ ID NO: 19); CAA17278 (SEQ ID NO:20); NP_003437 (SEQ ID NO:21); AAD23608 (SEQ ID NO:22); NP_062721 (SEQ ID NO:23); P21506 (SEQ ID NO:24); SI 0397 (SEQ ID NO:25); NP_003399 (SEQ ID NO:26); NP_065704 (SEQ ID NO:27); AAD23607 (SEQ ID NO:28); NPJD03420 (SEQ ID NO:29); NP_065703 (SEQ ID NO:30); NP_057620 (SEQ ID NO:31); NP_009084); CAC03544 (SEQ ID NO:32); NP_060572 (SEQ ID NO:33); B32891 (SEQ ID NO:34); NP_061121 (SEQ ID NO:35); AAD50527 (SEQ ID NO:36); O075820 (SEQ ID NO:37); AAC32423 (SEQ ID NO:38); BAB13385 (SEQ ID NO:39); AAD23606 (SEQ ID

NO:40); AAD14472 (SEQ ID NO:41); BAB15104 (SEQ ID NO:42); NP_037388 (SEQ ID NO:43); AAF71790 (SEQ ID NO:44); CAB46856 (SEQ ID NO:45); NP_003421 (SEQ ID NO:46); AAF88036 (SEQ ID NO:47); Q06730 (SEQ ID NO:48); BAA34724 (SEQ ID NO:49); NP_037530 (SEQ ID NO:50); AAC39798 (SEQ ID NO:51); NP_065708 (SEQ ID NO:52); CAB55432 (SEQ ID NO:53);

NP_003414 (SEQ ID NO:54); S47071 (SEQ ID NO:55); NP_003427 (SEQ ID NO:56); BAB15677 (SEQ ID NO:57); BAB14287 (SEQ ID NO:58); NP_003436 (SEQ ID NO:59); AAB61447 (SEQ ID NO:60); AAF75235 (SEQ ID NO:61).

SEQ ID NO:l, in certain embodiments, is used interchangeably with SEQ ID NO: 62 (GenBank Accession No. AF295096) and SEQ ID NO:63 (GenBank

Accession No. AK023467). Nucleic acid sequences which are also within the scope of the methods of the present invention include the following GenBank Accession Nos: AK021864 (SEQ ID NO:64); AK022706 (SEQ ID NO:65); AK000909 (SEQ ID NO:66); AK023652 (SEQ ID NO:67); NM_014650 (SEQ ID NO:68); AB018341 (SEQ ID NO:69); AK025594 (SEQ ID NO:70); AK026949

(SEQ ID NO:71); NM_014930 (SEQ ID NO:71); Z98304 (SEQ ID NO:72); X60155 (SEQ ID NO:73); M92443 (SEQ ID NO:74); AB023189 (SEQ ID NO:75); AC008806 (SEQ ID NO:76); HSHZF32 (SEQ ID NO: 77); AK025281 (SEQ ID NO: 78); AC007228 (SEQ ID NO: 79); AL022345 (SEQ ID NO: 80); AL031393 (SEQ ID NO: 81); AK026980 (SEQ ID NO: 82); AC022148 (SEQ ID

NO: 83); AC011815 (SEQ ID NO: 84); NM_016536 (SEQ ID NO: 85); AF226869 (SEQ ID NO: 86); AF161544 (SEQ ID NO: 87); AL110217 (SEQ ID NO: 88); AK024222 (SEQ ID NO: 89); AK022636 (SEQ ID NO: 90); AF205588 (SEQ ID NO: 91); D31763 (SEQ ID NO: 92); AC009756 (SEQ ID NO: 93); NM_003428 (SEQ ID NO: 94); NM_003408 (SEQ ID NO: 95); AL117339 (SEQ ID NO: 96); NM_018651 (SEQ ID NO: 97); AF154846 (SEQ ID NO: 98); NM_003446 (SEQ ID NO: 99); U28687 (SEQ ID NO: 100); L32164 (SEQ ID NO: 101); NM_020652; AF217226 (SEQ ID NO: 102); NMJD18102 (SEQ ID NO: 103); AF118808 (SEQ ID NO: 104); AK001331 (SEQ ID NO: 105); AJ245589 (SEQ ID NO: 106); and X81804 (SEQ ID NO: 107).

In certain embodiments, the term ZFQR is used interchangeably with a zinc finger-containing protein or gene which encodes a zinc finger-containing protein, preferably of the KRAB classification. Furthermore, other sequences for use in methods in the present invention include: VP16 nucleic acid sequence (SEQ ID NO: 14), VP16 amino acid sequence (SEQ ID NO: 15), MORF4 nucleic acid sequence (SEQ ID NO: 16), MORF4 amino acid sequence (SEQ ID NO: 17), MRG15 nucleic acid sequence (SEQ ID NO: 18), MRG15 amino acid sequence (SEQ ID NO: 19), MRGX nucleic acid sequence (SEQ ID NO:20), and MRGX amino acid sequence (SEQ ID NO:21).

Another embodiment of the present invention is a method of regulating gene expression comprising the step of repressing transcription of a nucleic acid sequence by administering a nucleic acid sequence of SEQ ID NO:l which encodes an amino acid sequence of SEQ ID NO:2. As shown in the Examples, the zinc finger protein of the present invention acts as a transcriptional repressor. The expression pattern shown in the Examples of upregulation of expression in nondividing or senescent cells suggests that it acts to repress transcription of a cell cycle gene or an oncogene. A skilled artisan is aware that oncogenes are associated with tumor formation and often encode transcription factors. An example of an oncogene known to bind DNA is c-myc whose expression is elevated but coding sequence remains unaltered. Nevertheless, there remains a correlation between tumorigenic phenotypes and abeπant high expression of c- Myc protein.

A further embodiment of the present invention is a method to identify transformed cells comprising the step of determining the expression level of the nucleic acid sequence of SEQ ID NO:l. One skilled in the art is aware that expression levels may be determined by nucleic acid hybridization. Detection by nucleic acid hybridization includes that by Southern or Northern analysis, and hybridization is detected by a variety of ways including radioactivity, color change, light emission or fluorescence. Furthermore, one skilled in the art would know that a specific method of nucleic acid hybridization could be utilized in the form of nucleic acid chip hybridization in which nucleic acids are present on an immobilized surface such as a microchip or microchips and are subjected to hybridization techniques sensitive enough to detect hybridization. An additional method to determine expression levels is by quantitative PCR performed by methods well known in the art. Finally, expression levels may be determined by detecting quantity or activity of a reporter sequence. Quantities may be detected by assaying the expression level of the reporter sequence itself or by assaying, for instance, enzymatic activity or presence of the gene product encoded by the reporter sequence. In a specific embodiment of the present invention, the reporter sequence is selected from the group consisting of ampicillin, neomycin, kanamycin, beta-galactosidase, beta-glucuronidase, chloramphenicol acetlytransferase (CAT), green fluorescent protein (GFP), blue fluorescent protein (BFP), and luciferase. A skilled artisan is aware that modifications to the reporter sequences are within the scope of the invention, such as use of the enhanced green fluorescent protein (EGFP).

An additional method to identify transformed cells includes identification of the subcellular location of an amino acid sequence of SEQ ID NO:2. In a specific embodiment said transformed cells are identified by associating SEQ ID NO:2 with a nuclear matrix. Said characterization may be identified by methods well known in the art. Epitope tagging would allow identification of said amino acid sequence in which an epitope tag such as HA, myc, FLAG, glutathione-S- transferase (GST), green fluorescent protein (GFP) or similar tags are added onto the amino acid sequence of SEQ ID NO:2 or fragment thereof. Subcellular fractionation as shown in Example 6 allows the association of an amino acid sequence with specific subcellular regions. Alternatively, immunofluorescence may be used to identify subcellular location by using antibodies to SEQ ID NO:2 which either directly or indirectly indicate location of an amino acid sequence through fluorescence or other methods well known in the art. Finally, an immunoblot may be used to distinguish the subcellular location by demonstrating presence or absence of an amino acid sequence between samples derived from different subcellular regions. Antibodies used in any of the methods of the invention may be monoclonal or polyclonal and may be to the entire portion of SEQ ID NO: 2 or may be to a peptide or a portion of the amino acid sequence of SEQ ID NO:2. The protein for the antibody induction does not require biological activity; however, the protein fragment or oligopeptide must be antigenic. Peptides used to induce specific antibodies may have an amino acid sequence consisting of at least five amino acids, preferably at least ten.

Another embodiment of the present invention is a method to generate a transformed cell comprising the step of reducing the expression level of a nucleic acid sequence of SEQ ID NO:l. In a specific embodiment, said level is reduced by inhibiting synthesis of the nucleic acid sequence of SEQ ID NO:l. This may be direct as in alteration of a component required for transcription of said sequence or it may be indirect by affecting function of an upstream effector. That is, synthesis may be inhibited by alteration or mutation of a cis sequence in the regulatory region(s) of the nucleic acid sequence of SEQ ID NO:l or may be in trans, affecting an upstream factor. A skilled artisan is aware that loss of repression leading to transformation may require alteration of one or both copies of the genomic sequence of SEQ ID NO:l.

An additional embodiment is a method of generating a transformed cell comprising the step of reducing the level of an amino acid sequence of SEQ ID NO:2 in said cell to be transformed. In a specific embodiment, said level is reduced by inhibiting synthesis of said amino acid sequence of SEQ ID NO:2 in a cell to be transformed. Inhibition of synthesis may occur through alteration of the coπesponding mRNA which encodes the amino acid sequence or an alteration may be present in a factor required for synthesis of said amino acid sequence. Additionally, the level of the amino acid sequence of SEQ ID NO: 2 in a cell to be transformed may be reduced by increasing its breakdown. One skilled in the art is aware of intrinsic sequences which target the polypeptide for degradation and is also aware of pathways involved in degradation of proteins. Addition of a sequence involved in protein degradation to the amino acid sequence of SEQ ID NO:2 or a fragment thereof may be used to target it for degradation, thereby reducing the level of said sequence. An additional embodiment of the present invention includes lowering the level of the amino acid sequence in a cell to be transformed by administering antibodies to it to sequester said sequence from available pools.

One specific embodiment for reducing amino acid levels is a method for the administration of an antagonist which binds to the amino acid sequence of SEQ ID NO: 2 or its target and blocks or modulates its biological or immunological activity, thereby rendering it unable to produce action on a target.

The antagonist may include proteins, soluble receptors, nucleic acids, carbohydrates or other molecules which bind to the amino acid sequence of SEQ ID NO:2. Finally, in another specific embodiment, said amino acid level is reduced by transfecting into a cell to be transformed an antisense sequence of a nucleic acid sequence of SEQ ID NO: l . A skilled artisan is aware that the antisense sequence may be complementary to the entire sequence of SEQ ID NO:l or a fragment thereof. One skilled in the art is aware that hybridization of an antisense sequence to the complementary sense sequence of the mRNA prohibits production of the protein.

Another embodiment of the present invention is a method to inhibit proliferation of cell growth comprising the step of increasing the level of a nucleic acid sequence of SEQ ID NO:l in a cell. In a specific embodiment, said level is increased by upregulating expression of the nucleic acid sequence of SEQ ID NO: l . This may be through indirect or direct methods. That is, the expression level may be increased by mutation or alteration of the promoter sequence for SEQ ID NO: 1. In addition, it may be that an alteration or mutation of a sequence which acts in trans to affect the expression of nucleic acid sequence of SEQ ID NO:l may be used. Furthermore, the level of the nucleic acid sequence of SEQ ID NO: 1 may be increased in a cell by transfecting into a cell multiple copies of a nucleic acid sequence of SEQ ID NO:l or a vector capable of generating multiple copies by methods well known in the art. Said vector may be a plasmid, a virus, a linear fragment, a liposome, or any vehicle capable of delivering a nucleic acid of interest into a cell or a specific subcellular region or organelle. The transfected sequence may be transient or it may be integrated into the cellular genome. A skilled artisan is aware that the sequences of the present invention are functional unless otherwise stated.

An additional embodiment of the present invention is a method to inhibit proliferation of cell growth comprising the step of increasing the level of amino acid sequence of SEQ ID NO:2 in a cell. In a specific embodiment, said level may be increased in a cell by the act of protein transduction. Recent advances in the technology for delivering protein into cells allows an efficient method to increase the amino acid level of SEQ ID NO:2 in a cell (Schwarze et al, 1999). In a specific embodiment, the protein transduction domain from the human immunodeficiency virus (HIV) TAT protein is fused to the amino acid sequence of SEQ ID NO:l or a fragment or derivative thereof. Another specific embodiment to increase the level of the amino acid sequence of SEQ ID NO:2 in a cell is by decreasing protein degradation. As discussed above, there are sequences which are important for targeting a protein for degradation, for instance, by the ubiquitination pathway, and a sequence which may be present in the amino acid sequence of SEQ ID NO: 2 important for such targeting may be altered or removed to prevent or delay degradation. Finally, another embodiment for a method for inhibiting proliferation of cell growth comprises the step of altering an amino acid sequence of SEQ ID NO:2. Alterations to inhibit proliferation of cell growth would be those which are important for increasing or enhancing the function of the native amino acid sequence of SEQ ID NO:2. Types of alterations can include modifications such as phosphorylation, myristilation, acetylation, methylation or the act of losing such modifications. For instance, one way to alter the amino acid sequence would be to prevent the loss of a phosphate group through dephosphorylation. In a specific embodiment the amino acid sequence of SEQ ID NO: 2 is altered to create a dominant negative mutant. Said mutant is generated by removal of a domain important for some function of the amino acid sequence. A skilled artisan is aware that partial or complete removal of said domain will negatively affect its function or that an alteration of any kind may negatively affect its function. The defective sequence may titrate away native factors in a cell to inhibit their function.

A skilled artisan is aware that the action of the amino acid sequence of

SEQ ID NO:2 may be manifested through quantitative or qualitative means. That is, downstream effects, including action on target genes, may be sensitive to either slight or significant changes in the levels of said sequence or may be sensitive to modest or drastic alterations in the nature of the sequence itself, or both.

An additional embodiment is a nucleic acid sequence of SEQ ID NO:l or fragments and derivatives thereof wherein said fragments and derivatives encode a KRAB domain. As shown in the following Examples, the KRAB domain of the amino acid sequence of SEQ ID NO:2 is important for repression of transcription of a reporter sequence and for association with a nuclear matrix. Therefore, a skilled artisan is aware that the methods discussed above may concern the KRAB domain alone.

In an embodiment of the present invention there is a method of regulating gene expression comprising the step of upregulating transcription of a nucleic acid sequence by administering a nucleic acid sequence of SEQ ID NO:l or amino acid sequence of SEQ ID NO:2 and a coactivator. In a specific embodiment the nucleic acid sequence affects a disease. It is an object of the present invention to provide to a cell a therapeutically effective amount of the sequences. Therapeutically effective as used herein is defined as the amount of a compound or sequence required to improve some symptom associated with a disease. A therapeutically effective amount is not required to cure a disease but will provide a treatment for a disease. It is another object of the present invention to provide to a cell a physiologically significant amount of, for instance, SEQ ID NO:l or SEQ ID NO:2. Physiologically significant as used herein is defined as the amount of a compound or sequence required to effect a change at the molecular level of a cell.

Another embodiment of the present invention is a non-human knockout animal comprising either a defective allele of SEQ ID NO:l or two defective alleles of SEQ ID NO:l. In a specific embodiment, the animal is a mouse.

ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ

ID NO: 10.

In an additional embodiment of the present invention there is a pharmaceutical composition comprising a nucleic acid sequence of SEQ ID NO:l and a pharmaceutically acceptable carrier. In specific embodiments the nucleic acid sequence is contained on a recombinant vector, wherein the vector is selected from the group consisting of a plasmid, an adenoviral vector, an adeno-associated vector, a retroviral vector, a liposome, a lipid, and a combination thereof.

In another embodiment of the present invention there is a pharmaceutical composition comprising an amino acid sequence of SEQ ID NO:2 and a pharmaceutically acceptable caπier.

III. ZFQR Nucleic Acids

A. Nucleic Acids and Uses Thereof Certain aspects of the present invention concern at least one ZFQR nucleic acid. In certain aspects, the at least one ZFQR nucleic acid comprises a wild-type or mutant ZFQR nucleic acid. In particular aspects, the ZFQR nucleic acid encodes for at least one transcribed nucleic acid. In certain aspects, the ZFQR nucleic acid comprises at least one transcribed nucleic acid. In particular aspects, the ZFQR nucleic acid encodes at least one ZFQR protein, polypeptide or peptide, or biologically functional equivalent thereof. In other aspects, the ZFQR nucleic acid comprises at least one nucleic acid segment of SEQ ID NO:l, or at least one biologically functional equivalent thereof. The present invention also concerns the isolation or creation of at least one recombinant construct or at least one recombinant host cell through the application of recombinant nucleic acid technology known to those of skill in the art or as described herein. The recombinant construct or host cell may comprise at least one ZFQR nucleic acid, and may express at least one ZFQR protein, peptide or peptide, or at least one biologically functional equivalent thereof.

As used herein "wild-type" refers to the naturally occurring sequence of a nucleic acid at a genetic locus in the genome of an organism, and sequences transcribed or translated from such a nucleic acid. Thus, the term "wild-type" also may refer to the amino acid sequence encoded by the nucleic acid. As a genetic locus may have more than one sequence or alleles in a population of individuals, the term "wild-type" encompasses all such naturally occurring alleles. As used herein the term "polymoφhic" means that variation exists (i.e. two or more alleles exist) at a genetic locus in the individuals of a population. As used herein "mutant" refers to a change in the sequence of a nucleic acid or its encoded protein, polypeptide or peptide that is the result of the hand of man.

A nucleic acid may be made by any technique known to one of ordinary skill in the art. Non-limiting examples of synthetic nucleic acid, particularly a synthetic oligonucleotide, include a nucleic acid made by in vitro chemically synthesis using phosphotriester, phosphite or phosphoramidite chemistry and solid phase techniques such as described in EP 266,032, incoφorated herein by reference, or via deoxynucleoside H-phosphonate intermediates as described by Froehler et al, 1986, and U.S. Patent Serial No. 5,705,629, each incoφorated herein by reference. A non-limiting example of enzymatically produced nucleic acid include one produced by enzymes in amplification reactions such as PCR™

(see for example, U.S. Patent 4,683,202 and U.S. Patent 4,682,195, each incoφorated herein by reference), or the synthesis of oligonucleotides described in U.S. Patent No. 5,645,897, incoφorated herein by reference. A non-limiting example of a biologically produced nucleic acid includes recombinant nucleic acid production in living cells, such as recombinant DNA vector production in bacteria (see for example, Sambrook et al. 1989, incoφorated herein by reference).

A nucleic acid may be purified on polyacrylamide gels, cesium chloride centrifugation gradients, or by any other means known to one of ordinary skill in the art (see for example, Sambrook et al. 1989, incoφorated herein by reference).

The term "nucleic acid" will generally refer to at least one molecule or strand of DNA, RNA or a derivative or mimic thereof, comprising at least one nucleobase, such as, for example, a naturally occuπing purine or pyrimidine base found in DNA (e.g. adenine "A," guanine "G," thymine "T" and cytosine "C") or RNA (e.g. A, G, uracil "U" and C). The term "nucleic acid" encompass the terms

"oligonucleotide" and "polynucleotide." The term "oligonucleotide" refers to at least one molecule of between about 3 and about 100 nucleobases in length. The term "polynucleotide" refers to at least one molecule of greater than about 100 nucleobases in length. These definitions generally refer to at least one single- stranded molecule, but in specific embodiments will also encompass at least one additional strand that is partially, substantially or fully complementary to the at least one single-stranded molecule. Thus, a nucleic acid may encompass at least one double-stranded molecule or at least one triple-stranded molecule that comprises one or more complementary strand(s) or "complement(s)" of a particular sequence comprising a strand of the molecule. As used herein, a single stranded nucleic acid may be denoted by the prefix "ss", a double stranded nucleic acid by the prefix "ds", and a triple stranded nucleic acid by the prefix "ts."

Thus, the present invention also encompasses at least one nucleic acid that is complementary to a ZFQR nucleic acid. In particular embodiments the invention encompasses at least one nucleic acid or nucleic acid segment complementary to the sequence set forth in SEQ ID NO: 1. Nucleic acid(s) that are "complementary" or "complement(s)" are those that are capable of base- pairing according to the standard Watson-Crick, Hoogsteen or reverse Hoogsteen binding complementarity rules. As used herein, the term "complementary" or "complement(s)" also refers to nucleic acid(s) that are substantially complementary, as may be assessed by the same nucleotide comparison set forth above. The term "substantially complementary" refers to a nucleic acid comprising at least one sequence of consecutive nucleobases, or semiconsecutive nucleobases if one or more nucleobase moieties are not present in the molecule, are capable of hybridizing to at least one nucleic acid strand or duplex even if less than all nucleobases do not base pair with a counteφart nucleobase. In certain embodiments, a "substantially complementary" nucleic acid contains at least one sequence in which about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, to about 100%>, and any range therein, of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization. In certain embodiments, the term "substantially complementary" refers to at least one nucleic acid that may hybridize to at least one nucleic acid strand or duplex in stringent conditions. In certain embodiments, a "partly complementary" nucleic acid comprises at least one sequence that may hybridize in low stringency conditions to at least one single or double stranded nucleic acid, or contains at least one sequence in which less than about 70%> of the nucleobase sequence is capable of base-pairing with at least one single or double stranded nucleic acid molecule during hybridization.

As used herein, "hybridization", "hybridizes" or "capable of hybridizing" is understood to mean the forming of a double or triple stranded molecule or a molecule with partial double or triple stranded nature. The term "hybridization",

"hybridize(s)" or "capable of hybridizing" encompasses the terms "stringent condition(s)" or "high stringency" and the terms "low stringency" or "low stringency condition(s)."

As used herein "stringent condition(s)" or "high stringency" are those that allow hybridization between or within one or more nucleic acid strand(s) containing complementary sequence(s), but precludes hybridization of random sequences. Stringent conditions tolerate little, if any, mismatch between a nucleic acid and a target strand. Such conditions are well known to those of ordinary skill in the art, and are prefeπed for applications requiring high selectivity. Non-limiting applications include isolating at least one nucleic acid, such as a gene or nucleic acid segment thereof, or detecting at least one specific mRNA transcript or nucleic acid segment thereof, and the like.

Stringent conditions may comprise low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.15 M NaCl at temperatures of about 50°C to about 70°C. It is understood that the temperature and ionic strength of a desired stringency are determined in part by the length of the particular nucleic acid(s), the length and nucleobase content of the target sequence(s), the charge composition of the nucleic acid(s), and to the presence of formamide, tetramethylammonium chloride or other solvent(s) in the hybridization mixture. It is generally appreciated that conditions may be rendered more stringent, such as, for example, the addition of increasing amounts of formamide.

It is also understood that these ranges, compositions and conditions for hybridization are mentioned by way of non-limiting example only, and that the desired stringency for a particular hybridization reaction is often determined empirically by comparison to one or more positive or negative controls. Depending on the application envisioned it is prefeπed to employ varying conditions of hybridization to achieve varying degrees of selectivity of the nucleic acid(s) towards target sequence(s). In a non-limiting example, identification or isolation of related target nucleic acid(s) that do not hybridize to a nucleic acid under stringent conditions may be achieved by hybridization at low temperature and/or high ionic strength. Such conditions are termed "low stringency" or "low stringency conditions", and non- limiting examples of low stringency include hybridization performed at about 0.15 M to about 0.9 M NaCl at a temperature range of about 20°C to about 50°C. Of course, it is within the skill of one in the art to further modify the low or high stringency conditions to suite a particular application.

One or more nucleic acid(s) may comprise, or be composed entirely of, at least one derivative or mimic of at least one nucleobase, a nucleobase linker moiety and/or backbone moiety that may be present in a naturally occurring nucleic acid. As used herein a "derivative" refers to a chemically modified or altered form of a naturally occuπing molecule, while the terms "mimic" or "analog" refers to a molecule that may or may not structurally resemble a naturally occuπing molecule, but functions similarly to the naturally occurring molecule. As used herein, a "moiety" generally refers to a smaller chemical or molecular component of a larger chemical or molecular structure, and is encompassed by the term "molecule."

As used herein a "nucleobase" refers to a naturally occurring heterocyclic base, such as A, T, G, C or U ("naturally occurring nucleobase(s)"), found in at least one naturally occurring nucleic acid (i.e. DNA and RNA), and their naturally or non-naturally occurring derivatives and mimics. Non-limiting examples of nucleobases include purines and pyrimidines, as well as derivatives and mimics thereof, which generally can form one or more hydrogen bonds ("anneal" or "hybridize") with at least one naturally occuπing nucleobase in manner that may substitute for naturally occurring nucleobase pairing (e.g. the hydrogen bonding between A and T, G and C, and A and U).

Nucleobase, nucleoside and nucleotide mimics or derivatives are well known in the art, and have been described in exemplary references such as, for example, Scheit, Nucleotide Analogs (John Wiley, New York, 1980), incoφorated herein by reference. "Purine" and "pyrimidine" nucleobases encompass naturally occurring purine and pyrimidine nucleobases and also derivatives and mimics thereof, including but not limited to, those purines and pyrimidines substituted by one or more of alkyl, caboxyalkyl, amino, hydroxyl, halogen (i.e. fluoro, chloro, bromo, or iodo), thiol, or alkylthiol wherein the alkyl group comprises of from about 1, about 2, about 3, about 4, about 5, to about 6 carbon atoms. Non-limiting examples of purines and pyrimidines include deazapurines, 2,6-diaminopurine, 5-fluorouracil, xanthine, hypoxanthine, 8- bromoguanine, 8-chloroguanine, bromothymine, 8-aminoguanine, 8- hydroxyguanine, 8-methylguanine, 8-thioguanine, azaguanines, 2-aminopurine, 5- ethylcytosine, 5-methylcyosine, 5-bromouracil, 5-ethyluracil, 5-iodouracil, 5- chlorouracil, 5-propyluracil, thiouracil, 2-methyladenine, methylthioadenine,

N,N-diemethyladenine, azaadenines, 8-bromoadenine, 8-hydroxyadenine, 6- hydroxyaminopurine, 6-thiopurine, 4-(6-aminohexyl/cytosine), and the like. A table of exemplary, but not limiting, purine and pyrimidine derivatives and mimics is also provided herein below.

As used herein, "nucleoside" refers to an individual chemical unit comprising a nucleobase covalently attached to a nucleobase linker moiety. A non-limiting example of a "nucleobase linker moiety" is a sugar comprising 5- carbon atoms (a "5 -carbon sugar"), including but not limited to deoxyribose, ribose or arabinose, and derivatives or mimics of 5-carbon sugars. Non-limiting examples of derivatives or mimics of 5-carbon sugars include 2'-fluoro-2'- deoxyribose or carbocyclic sugars where a carbon is substituted for the oxygen atom in the sugar ring. By way of non-limiting example, nucleosides comprising purine (i.e. A and G) or 7-deazapurine nucleobases typically covalently attach the

9 position of the purine or 7-deazapurine to the 1 '-position of a 5-carbon sugar. In another non-limiting example, nucleosides comprising pyrimidine nucleobases (i.e. C, T or U) typically covalently attach the 1 position of the pyrimidine to 1'- position of a 5-carbon sugar (Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). However, other types of covalent attachments of a nucleobase to a nucleobase linker moiety are known in the art, and non-limiting examples are described herein.

As used herein, a "nucleotide" refers to a nucleoside further comprising a "backbone moiety" generally used for the covalent attachment of one or more nucleotides to another molecule or to each other to form one or more nucleic acids. The "backbone moiety" in naturally occurring nucleotides typically comprises a phosphorus moiety, which is covalently attached to a 5-carbon sugar. The attachment of the backbone moiety typically occurs at either the 3'- or 5'- position of the 5-carbon sugar. However, other types of attachments are known in the art, particularly when the nucleotide comprises derivatives or mimics of a naturally occuπing 5-carbon sugar or phosphorus moiety, and non-limiting examples are described herein.

A non-limiting example of a nucleic acid comprising such nucleoside or nucleotide derivatives and mimics is a "poly ether nucleic acid", described in U.S. Patent Serial No. 5,908,845, incoφorated herein by reference, wherein one or more nucleobases are linked to chiral carbon atoms in a polyether backbone. Another example of a nucleic acid comprising nucleoside or nucleotide derivatives or mimics is a "peptide nucleic acid", also known as a "PNA", "peptide-based nucleic acid mimics" or "PENAMs", described in U.S. Patent Serial Nos. 5,786,461, 5891,625, 5,773,571, 5,766,855, 5,736,336, 5,719,262, 5,714,331, 5,539,082, and WO 92/20702, each of which is incoφorated herein by reference. A peptide nucleic acid generally comprises at least one nucleobase and at least one nucleobase linker moiety that is either not a 5-carbon sugar and/or at least one backbone moiety that is not a phosphate backbone moiety. Examples of nucleobase linker moieties described for PNAs include aza nitrogen atoms, amido and/or ureido tethers (see for example, U.S. Patent No. 5,539,082). Examples of backbone moieties described for PNAs include an aminoethylglycine, polyamide, polyethyl, polythioamide, polysulfinamide or polysulfonamide backbone moiety.

Peptide nucleic acids generally have enhanced sequence specificity, binding properties, and resistance to enzymatic degradation in comparison to molecules such as DNA and RNA (Egholm et al, Nature 1993, 365, 566; PCT/EP/01219). In addition, U.S. Patent Nos. 5,766,855, 5,719,262, 5,714,331 and 5,736,336 describe PNAs comprising naturally and non-naturally occurring nucleobases and alkylamine side chains with further improvements in sequence specificity, solubility and binding affinity. These properties promote double or triple helix formation between a target nucleic acid and the PNA. U.S. Patent No. 5,641,625 describes that the binding of a PNA may to a target sequence has applications the creation of PNA probes to nucleotide sequences, modulating (i.e. enhancing or reducing) gene expression by binding of a PNA to an expressed nucleotide sequence, and cleavage of specific dsDNA molecules. In certain embodiments, nucleic acid analogues such as one or more peptide nucleic acids may be used to inhibit nucleic acid amplification, such as in PCR, to reduce false positives and discriminate between single base mutants, as described in U.S. Patent Serial No. 5891,625.

U.S. Patent 5,786,461 describes PNAs with amino acid side chains attached to the PNA backbone to enhance solubility. The neutrality of the PNA backbone may contribute to the thermal stability of PNA/DNA and PNA/RNA duplexes by reducing charge repulsion. The melting temperature of PNA containing duplexes, or temperature at which the strands of the duplex release into single stranded molecules, has been described as less dependent upon salt concentration.

One method for increasing amount of cellular uptake property of PNAs is to attach a lipophilic group. U.S. application Ser. No. 117,363, filed Sep. 3, 1993, describes several alkylamino functionalities and their use in the attachment of such pendant groups to oligonucleosides. U.S. application Ser. No. 07/943,516, filed Sep. 11, 1992, and its corresponding published PCT application WO 94/06815, describe other novel amine-containing compounds and their incoφoration into oligonucleotides for, inter alia, the puφoses of enhancing cellular uptake, increasing lipophilicity, causing greater cellular retention and increasing the distribution of the compound within the cell.

Additional non-limiting examples of nucleosides, nucleotides or nucleic acids comprising 5-carbon sugar and/or backbone moiety derivatives or mimics are provided in Table 2 herein below.

In certain aspect, the present invention concerns at least one nucleic acid that is an isolated nucleic acid. As used herein, the term "isolated nucleic acid" refers to at least one nucleic acid molecule that has been isolated free of, or is otherwise free of, the bulk of the total genomic and transcribed nucleic acids of one or more cells, particularly mammalian cells, and more particularly human and mouse cells. In certain embodiments, "isolated nucleic acid" refers to a nucleic acid that has been isolated free of, or is otherwise free of, bulk of cellular components and macromolecules such as lipids, proteins, small biological molecules, and the like. As different species may have a RNA or a DNA containing genome, the term "isolated nucleic acid" encompasses both the terms "isolated DNA" and "isolated RNA". Thus, the isolated nucleic acid may comprise a RNA or DNA molecule isolated from, or otherwise free of, the bulk of total RNA, DNA or other nucleic acids of a particular species. As used herein, an isolated nucleic acid isolated from a particular species is referred to as a "species specific nucleic acid." When designating a nucleic acid isolated from a particular species, such as human, such a type of nucleic acid may be identified by the name of the species. For example, a nucleic acid isolated from one or more humans would be an "isolated human nucleic acid", a nucleic acid isolated from human would be an "isolated human nucleic acid", etc.

Of course, more than one copy of an isolated nucleic acid may be isolated from biological material, or produced in vitro, using standard techniques that are known to those of skill in the art. In particular embodiments, the isolated nucleic acid is capable of expressing a protein, polypeptide or peptide that has ZFQR activity. In other embodiments, the isolated nucleic acid comprises an isolated ZFQR gene.

Herein certain embodiments, a "gene" refers to a nucleic acid that is transcribed. As used herein, a "gene segment" is a nucleic acid segment of a gene.

In certain aspects, the gene includes regulatory sequences involved in transcription, or message production or composition. In particular embodiments, the gene comprises transcribed sequences that encode for a protein, polypeptide or peptide. In other particular aspects, the gene comprises a ZFQR nucleic acid, and/or encodes a ZFQR polypeptide or peptide coding sequences. In keeping with the terminology described herein, an "isolated gene" may comprise transcribed nucleic acid(s), regulatory sequences, coding sequences, or the like, isolated substantially away from other such sequences, such as other naturally occuπing genes, regulatory sequences, polypeptide or peptide encoding sequences, etc. In this respect, the term "gene" is used for simplicity to refer to a nucleic acid comprising a nucleotide sequence that is transcribed, and the complement thereof. In particular aspects, the transcribed nucleotide sequence comprises at least one functional protein, polypeptide and/or peptide encoding unit. As will be understood by those in the art, this function term "gene" includes both genomic sequences, RNA or cDNA sequences or smaller engineered nucleic acid segments, including nucleic acid segments of a non-transcribed part of a gene, including but not limited to the non-transcribed promoter or enhancer regions of a gene. Smaller engineered gene nucleic acid segments may express, or may be adapted to express using nucleic acid manipulation technology, proteins, polypeptides, domains, peptides, fusion proteins, mutants and/or such like. "Isolated substantially away from other coding sequences" means that the gene of interest, in this case the ZFQR gene(s), forms the significant part of the coding region of the nucleic acid, or that the nucleic acid does not contain large portions of naturally-occurring coding nucleic acids, such as large chromosomal fragments, other functional genes, RNA or cDNA coding regions. Of course, this refers to the nucleic acid as originally isolated, and does not exclude genes or coding regions later added to the nucleic acid by the hand of man.

In certain embodiments, the nucleic acid is a nucleic acid segment. As used herein, the term "nucleic acid segment", are smaller fragments of a nucleic acid, such as for non-limiting example, those that encode only part of the ZFQR peptide or polypeptide sequence. Thus, a "nucleic acid segment" may comprise any part of the ZFQR gene sequence(s), of from about 2 nucleotides to the full length of the ZFQR peptide or polypeptide-encoding region. In certain embodiments, the "nucleic acid segment" encompasses the full length ZFQR gene(s) sequence. In particular embodiments, the nucleic acid comprises any part of the SEQ ID NO: l sequence(s), of from about 2 nucleotides to the full length of the sequence disclosed in SEQ ID NO: l .

Various nucleic acid segments may be designed based on a particular nucleic acid sequence, and may be of any length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all nucleic acid segments can be created: n to n + y where n is an integer from 1 to the last number of the sequence and y is the length of the nucleic acid segment minus one, where n + y does not exceed the last number of the sequence. Thus, for a 10-mer, the nucleic acid segments coπespond to bases 1 to 10, 2 to 1 1, 3 to 12 ... and or so on. For a 15-mer, the nucleic acid segments coπespond to bases 1 to 15, 2 to 16, 3 to 17 ... and/or so on. For a 20-mer, the nucleic segments coπespond to bases 1 to 20, 2 to 21, 3 to 22 ... and/or so on. In certain embodiments, the nucleic acid segment may be a probe or primer. As used herein, a "probe" is relatively short nucleic acid, such as an oligonucleotide, which is used to identify a complementary nucleic acid.. As used herein, a "primer" is a relatively short nucleic acid, such as an oligonucleotide, used to prime polymerization of a nucleic acid. A non-limiting example of this would be the creation of nucleic acid segments of various lengths and sequence composition for probes and primers based on the sequences disclosed in SEQ ID NO:l The nucleic acid(s) of the present invention, regardless of the length of the sequence itself, may be combined with other nucleic acid sequences, including but not limited to, promoters, enhancers, polyadenylation signals, restriction enzyme sites, multiple cloning sites, coding segments, and the like, to create one or more nucleic acid construct(s). The length overall length may vary considerably between nucleic acid constructs. Thus, a nucleic acid segment of almost any length may be employed, with the total length preferably being limited by the ease of preparation or use in the intended recombinant nucleic acid protocol.

In a non-limiting example, one or more nucleic acid constructs may be prepared that include a contiguous stretch of nucleotides identical to or complementary to SEQ ID NO:l. A nucleic acid construct may be about 5, about

10, about 15, about 20, about 30, about 40, about 50, about 100, about 200, about 500, about 1,000, about 2,000, about 3,000, about 5,000, about 10,000, about 15,000, about 20,000, about 30,000, about 50,000, about 100,000, about 250,000, about 500,000, about 750,000, to about 1 ,000,000 nucleotides in length, as well as constructs of greater size, up to and including chromosomal sizes (including all intermediate lengths and intermediate ranges), given the advent of nucleic acids constructs such as a yeast artificial chromosome are known to those of ordinary skill in the art. It will be readily understood that "intermediate lengths" and "intermediate ranges", as used herein, means any length or range including or between the quoted values (i.e. all integers including and between such values).

Non-limiting examples of intermediate lengths include about 11, about 12, about 13, about 16, about 17, about 18, about 19, etc.; about 21, about 22, about 23, etc.; about 31, about 32, etc.; about 51, about 52, about 53, etc.; about 101, about 102, about 103, etc.; about 151, about 152, about 153, etc.; about 1,001, about 1002, etc,; about 50,001, about 50,002, etc; about 750,001, about 750,002, etc.; about

1,000,001, about 1,000,002, etc. Non-limiting examples of intermediate ranges include about 3 to about 32, about 150 to about 500,001, about 3,032 to about 7,145, about 5,000 to about 15,000, about 20,007 to about 1,000,003, etc.

In particular embodiments, the invention concerns one or more recombinant vector(s) comprising nucleic acid sequences that encode an ZFQR protein, polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in, SEQ ID NO:2, coπesponding to human ZFQR. In other embodiments, the invention concerns recombinant vector(s) comprising nucleic acid sequences that encode a human ZFQR protein, polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially as set forth in SEQ ID NO:2. In particular aspects, the recombinant vectors are DNA vectors.

The term "a sequence essentially as set forth in SEQ ID NO:2" means that the sequence substantially corresponds to a portion of SEQ ID NO:2 and has relatively few amino acids that are not identical to, or a biologically functional equivalent of, the amino acids of SEQ ID NO:2. Thus, "a sequence essentially as set forth in SEQ ID NO:l" encompasses nucleic acids, nucleic acid segments, and genes that comprise part or all of the nucleic acid sequences as set forth in SEQ ID NO: 1. The term "biologically functional equivalent" is well understood in the art and is further defined in detail herein. Accordingly, a sequence that has between about 70% and about 80%>; or more preferably, between about 81%> and about 90%>; or even more preferably, between about 91%. and about 99%>; of amino acids that are identical or functionally equivalent to the amino acids of SEQ ID NO:2 will be a sequence that is "essentially as set forth in

SEQ ID NO:2", provided the biological activity of the protein, polypeptide or peptide is maintained.

In certain other embodiments, the invention concerns at least one recombinant vector that include within its sequence a nucleic acid sequence essentially as set forth in SEQ ID NO: 1. In particular embodiments, the recombinant vector comprises DNA sequences that encode protein(s), polypeptide(s) or peptide(s) exhibiting ZFQR activity.

The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine and serine, and also refers to codons that encode biologically equivalent amino acids. For optimization of expression of ZFQR in human cells, the codons are shown in Table 3 in preference of use from left to right. Thus, the most prefeπed codon for alanine is thus "GCC", and the least is "GCG" (see Table 3, below).

Information on codon usage in a variety of non-human organisms is known in the art (see for example, Bennetzen and Hall, 1982; Ikemura, 1981a, 1981b, 1982; Grantham et al, 1980, 1981; Wada et al, 1990; each of these references are incoφorated herein by reference in their entirety). Thus, it is contemplated that codon usage may be optimized for other animals, as well as other organisms such as fungi, plants, prokaryotes, virus and the like, as well as organelles that contain nucleic acids, such as mitochondria, chloroplasts and the like, based on the preferred codon usage as would be known to those of ordinary skill in the art. As an example, and not a limitation, Table 4 provides information regarding bovine, porcine and ovine codon preference in a format that is easily used to create "bovanized," "porcinized," and "ovinized" constructs of the present invention. As a general guideline, the codons are shown in preference of use from left to right, in creating a "bovanized," "porcinized," or "ovinized" peptide, polypeptide or protein encoding sequences.

It will also be understood that amino acid sequences or nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, or various combinations thereof, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein, polypeptide or peptide activity where expression of a proteinaceous composition is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' and/or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

Excepting intronic and flanking regions, and allowing for the degeneracy of the genetic code, nucleic acid sequences that have between about 70%> and about 79%; or more preferably, between about 80% and about 89%>; or even more particularly, between about 90% and about 99%>; of nucleotides that are identical to the nucleotides of SEQ ID NO :1 will be nucleic acid sequences that are "essentially as set forth in SEQ ID NO: l".

It will also be understood that this invention is not limited to the particular nucleic acid or amino acid sequences of SEQ ID NO:2. Recombinant vectors and isolated nucleic acid segments may therefore variously include these coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, and they may encode larger polypeptides or peptides that nevertheless include such coding regions or may encode biologically functional equivalent proteins, polypeptide or peptides that have variant amino acids sequences.

The ^* nucleic acids of the present invention encompass biologically functional equivalent ZFQR proteins, polypeptides, or peptides. Such sequences may arise as a consequence of codon redundancy or functional equivalency that are known to occur naturally within nucleic acid sequences or the proteins, polypeptides or peptides thus encoded. Alternatively, functionally equivalent proteins, polypeptides or peptides may be created via the application of recombinant DNA technology, in which changes in the protein, polypeptide or peptide structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced, for example, through the application of site-directed mutagenesis techniques as discussed herein below, e.g., to introduce improvements or alterations to the antigenicity of the protein, polypeptide or peptide, or to test mutants in order to examine ZFQR protein, polypeptide or peptide activity at the molecular level.

Fusion proteins, polypeptides or peptides may be prepared, e.g., where the ZFQR coding regions are aligned within the same expression unit with other proteins, polypeptides or peptides having desired functions. Non-limiting examples of such desired functions of expression sequences include purification or immunodetection puφoses for the added expression sequences, e.g., proteinaceous compositions that may be purified by affinity chromatography or the enzyme labeling of coding regions, respectively. Encompassed by the invention are nucleic acid sequences encoding relatively small peptides or fusion peptides, such as, for example, peptides of from about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, to about 100 amino acids in length, or more preferably, of from about 15 to about 30 amino acids in length; as set forth in SEQ ID NO: 2 and also larger polypeptides up to and including proteins coπesponding to the full-length sequences set forth in SEQ ID NO:2.

As used herein an "organism" may be a prokaryote, eukaryote, virus and the like. As used herein the term "sequence" encompasses both the terms "nucleic acid" and "proteinaceous" or "proteinaceous composition." As used herein, the term "proteinaceous composition" encompasses the terms "protein", "polypeptide" and "peptide." As used herein "artificial sequence" refers to a sequence of a nucleic acid not derived from sequence naturally occurring at a genetic locus, as well as the sequence of any proteins, polypeptides or peptides encoded by such a nucleic acid. A "synthetic sequence", refers to a nucleic acid or proteinaceous composition produced by chemical synthesis in vitro, rather than enzymatic production in vitro (i.e. an "enzymatically produced" sequence) or biological production in vivo (i.e. a "biologically produced" sequence).

IV. Nucleic Acid Detection

In addition to their use in directing the expression of ZFQR or other proteins, polypeptides and/or peptides, the nucleic acid sequences disclosed herein have a variety of other uses. For example, they have utility as probes or primers for embodiments involving nucleic acid hybridization.

A. Hybridization

The use of a probe or primer of between 13 and 100 nucleotides, preferably between 17 and 100 nucleotides in length, or in some aspects of the invention up to 1-2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length are generally prefeπed, to increase stability and/or selectivity of the hybrid molecules obtained. One will generally prefer to design nucleic acid molecules for hybridization having one or more complementary sequences of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.

Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNAs and/or RNAs or to provide primers for amplification of DNA or RNA from samples. Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of the probe or primers for the target sequence. For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

For certain applications, for example, site-directed mutagenesis, it is appreciated that lower stringency conditions are prefeπed. Under these conditions, hybridization may occur even though the sequences of the hybridizing strands are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Hybridization conditions can be readily manipulated depending on the desired results.

In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl₂, 1.0 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, at temperatures ranging from approximately 40°C to about 72°C.

In certain embodiments, it will be advantageous to employ nucleic acids of defined sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In prefeπed embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a detection means that is visibly or spectrophotometrically detectable, to identify specific hybridization with complementary nucleic acid containing samples. In general, it is envisioned that the probes or primers described herein will be useful as reagents in solution hybridization, as in PCR™, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single- stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The conditions selected will depend on the particular circumstances (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Optimization of hybridization conditions for the particular application of interest is well known to those of skill in the art. After washing of the hybridized molecules to remove non-specifically bound probe molecules, hybridization is detected, and/or quantified, by determining the amount of bound label. Representative solid phase hybridization methods are disclosed in U.S. Patent Nos. 5,843,663, 5,900,481 and 5,919,626. Other methods of hybridization that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,849,481, 5,849,486 and 5,851,772. The relevant portions of these and other references identified in this section of the Specification are incoφorated herein by reference.

B. Amplification of Nucleic Acids

Nucleic acids used as a template for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al, 1989). In certain embodiments, analysis is performed on whole cell or tissue homogenates or biological fluid samples without substantial purification of the template nucleic acid. The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to first convert the RNA to a complementary DNA.

The term "primer," as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template- dependent process. Typically, primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is prefeπed.

Pairs of primers designed to selectively hybridize to nucleic acids corresponding to ZFQR are contacted with the template nucleic acid under conditions that permit selective hybridization. Depending upon the desired application, high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers. In other embodiments, hybridization may occur under reduced stringency to allow for amplification of nucleic acids contain one or more mismatches with the primer sequences. Once hybridized, the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also refeπed to as "cycles," are conducted until a sufficient amount of amplification product is produced.

The amplification product may be detected or quantified. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incoφorated radiolabel or fluorescent label or even via a system using electrical and/or thermal impulse signals (Affymax technology; Bellus, 1994).

A number of template dependent processes are available to amplify the oligonucleotide sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (refeπed to as PCR™) which is described in detail in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al, 1990, each of which is incoφorated herein by reference in their entirety. A reverse transcriptase PCR ^M amplification procedure may be performed to quantify the amount of mRNA amplified. Methods of reverse transcribing RNA into cDNA are well known and described in Sambrook et al, 1989. Alternative methods for reverse transcription utilize thermostable DNA polymerases. These methods are described in WO 90/07641. Polymerase chain reaction methodologies are well known in the art. Representative methods of RT-PCR are described in U.S. Patent

No. 5,882,864.

Another method for amplification is ligase chain reaction ("LCR"), disclosed in European Application No. 320 308, incoφorated herein by reference in its entirety. U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence. A method based on PCR™ and oligonucleotide ligase assy (OLA), disclosed in U.S. Patent 5,912,148, may also be used.

Alternative methods for amplification of target nucleic acid sequences that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,843,650, 5,846,709, 5,846,783, 5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776, 5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825,

5,939,291 and 5,942,391, GB Application No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of which is incoφorated herein by reference in its entirety.

Qbeta Replicase, described in PCT Application No. PCT/US87/00880, may also be used as an amplification method in the present invention. In this method, a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence which may then be detected.

An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]-triphosphates in one strand of a restriction site may also be useful in the amplification of nucleic acids in the present invention (Walker et al, 1992). Strand Displacement Amplification (SDA), disclosed in U.S. Patent No. 5,916,779, is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e., nick translation.

Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al, 1989; Gingeras et al, PCT Application WO 88/10315, incoφorated herein by reference in their entirety). Davey et al. , European Application No. 329 822 disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double- stranded DNA (dsDNA), which may be used in accordance with the present invention.

Miller et al, PCT Application WO 89/06700 (incoφorated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter region primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e., new templates are not produced from the resultant RNA transcripts. Other amplification methods include "race" and "one-sided PCR" (Frohman, 1990; Ohara et al. , 1989). C. Detection of Nucleic Acids

Following any amplification, it may be desirable to separate the amplification product from the template and/or the excess primer. In one embodiment, amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al,

1989). Separated amplification products may be cut out and eluted from the gel for further manipulation. Using low melting point agarose gels, the separated band may be removed by heating the gel, followed by extraction of the nucleic acid. Separation of nucleic acids may also be effected by chromatographic techniques known in art. There are many kinds of chromatography which may be used in the practice of the present invention, including adsoφtion, partition, ion- exchange, hydroxylapatite, molecular sieve, reverse-phase, column, paper, thin- layer, and gas chromatography as well as HPLC. In certain embodiments, the amplification products are visualized. A typical visualization method involves staining of a gel with ethidium bromide and visualization of bands under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the separated amplification products can be exposed to x-ray film or visualized under the appropriate excitatory spectra.

In one embodiment, following separation of amplification products, a labeled nucleic acid probe is brought into contact with the amplified marker sequence. The probe preferably is conjugated to a chromophore but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, or another binding partner carrying a detectable moiety.

In particular embodiments, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art. See Sambrook et al, 1989. One example of the foregoing is described in U.S. Patent No. 5,279,721, incoφorated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention.

Other methods of nucleic acid detection that may be used in the practice of the instant invention are disclosed in U.S. Patent Nos. 5,840,873, 5,843,640,

5,843,651, 5,846,708, 5,846,717, 5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993, 5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024, 5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862, 5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is incoφorated herein by reference.

D. Other Assays

Other methods for genetic screening may be used within the scope of the present invention, for example, to detect mutations in genomic DNA, cDNA and/or RNA samples. Methods used to detect point mutations include denaturing gradient gel electrophoresis ("DGGE"), restriction fragment length polymoφhism analysis ("RFLP"), chemical or enzymatic cleavage methods, direct sequencing of target regions amplified by PCR™ (see above), single-strand conformation polymoφhism analysis ("SSCP") and other methods well known in the art. One method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA/DNA or RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single or multiple base point mutations.

U.S. Patent No. 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.

Other investigators have described the use of RNase I in mismatch assays. The use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is reported to cleave three out of four known mismatches. Others have described using the MutS protein or other DNA-repair enzymes for detection of single-base mismatches.

Alternative methods for detection of deletion, insertion or substititution mutations that may be used in the practice of the present invention are disclosed in U.S. Patent Nos. 5,849,483, 5,851,770, 5,866,337, 5,925,525 and 5,928,870, each of which is incoφorated herein by reference in its entirety.

E. Kits All the essential materials and/or reagents required for detecting ZFQR in a sample may be assembled together in a kit. This generally will comprise a probe or primers designed to hybridize specifically to individual nucleic acids of interest in the practice of the present invention, including ZFQR. Also included may be enzymes suitable for amplifying nucleic acids, including various polymerases (reverse transcriptase, Taq, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification. Such kits may also include enzymes and other reagents suitable for detection of specific nucleic acids or amplification products. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent or enzyme as well as for each probe or primer pair. V. Nucleic Acid-Based Expression Systems

A. Vectors

The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Maniatis et al, 1988 and Ausubel et al, 1994, both incoφorated herein by reference.

The term "expression vector" refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed.

In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra. 1. Promoters and Enhancers

A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements at which regulatory proteins and molecules may bind such as RNA polymerase and other transcription factors. The phrases "operatively positioned," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a coπect functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cw-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

A promoter may be one naturally associated with a gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence.

Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally occuπing," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression. In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR™, in connection with the compositions disclosed herein (see U.S. Patent 4,683,202, U.S. Patent 5,928,906, each incoφorated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

Naturally, it will be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (1989), incoφorated herein by reference. The promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous.

Table 5 lists several elements/promoters that may be employed, in the context of the present invention, to regulate the expression of a gene. This list is not intended to be exhaustive of all the possible elements involved in the promotion of expression but, merely, to be exemplary thereof. Table 6 provides examples of inducible elements, which are regions of a nucleic acid sequence that can be activated in response to a specific stimulus.

The identity of tissue-specific promoters or elements, as well as assays to characterize their activity, is well known to those of skill in the art. Examples of such regions include the human LIMK2 gene (Nomoto et al. 1999), the somatostatin receptor 2 gene (Kraus et al, 1998), murine epididymal retinoic acid-binding gene (Lareyre et al, 1999), human CD4 (Zhao-Emonet et al, 1998), mouse alpha2 (XI) collagen (Tsumaki, et al, 1998), DIA dopamine receptor gene (Lee, et al, 1997), insulin- like growth factor II (Wu et al, 1997), human platelet endothelial cell adhesion molecule- 1 (Almendro et al, 1996).

2. Initiation Signals and Internal Ribosome Binding Sites

A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in- frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements. In certain embodiments of the invention, the use of internal ribosome entry sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome-scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family

(polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Patent 5,925,565 and 5,935,819, herein incoφorated by reference).

3. Multiple Cloning Sites

Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites, any of which can be used in conjunction with standard recombinant technology to digest the vector. (See Carbonelli et al, 1999, Levenson et al, 1998, and Cocea, 1997, incoφorated herein by reference.) "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology. 4. Splicing Sites

Most transcribed eukaryotic RNA molecules will undergo RNA splicing to remove introns from the primary transcripts. Vectors containing genomic eukaryotic sequences may require donor and/or acceptor splicing sites to ensure proper processing of the transcript for protein expression. (See Chandler et al,

1997, herein incoφorated by reference.)

5. Polyadenylation Signals

In expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and/or any such sequence may be employed. Prefeπed embodiments include the SV40 polyadenylation signal and/or the bovine growth hormone polyadenylation signal, convenient and/or known to function well in various target cells. Also contemplated as an element of the expression cassette is a transcriptional termination site. These elements can serve to enhance message levels and/or to minimize read through from the cassette into other sequences.

6. Origins of Replication In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.

7. Selectable and Screenable Markers

In certain embodiments of the invention, the cells contain nucleic acid construct of the present invention, a cell may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as heφes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product.

Further examples of selectable and screenable markers are well known to one of skill in the art.

B. Host Cells As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that are capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors. A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny. Host cells may be derived from prokaryotes or eukaryotes, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded nucleic acid sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Bacterial cells used as host cells for vector replication and/or expression include DH5α,

JM109, and KC8, as well as a number of commercially available bacterial hosts such as SURE^® Competent Cells and SOLOPACK™ Gold Cells (STRATAGENE^®, La Jolla). Alternatively, bacterial cells such as E. coli LE392 could be used as host cells for phage viruses. Examples of eukaryotic host cells for replication and/or expression of a vector include HeLa, NIH3T3, Jurkat, 293, Cos, CHO, Saos, and PC12. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector.

Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.

C. Expression Systems Numerous expression systems exist that comprise at least a part or all of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available.

The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S.

Patent No. 5,871,986, 4,879,236, both herein incoφorated by reference, and which can be bought, for example, under the name MAXBAC^® 2.0 from INVITROGEN^® and BACPACK™ BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH^®. Other examples of expression systems include STRATAGENE^®'S COMPLETE

CONTROL™ Inducible Mammalian Expression System, which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN^®, which carries the T-REX™ (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length

CMV promoter. INVITROGEN^® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.

VI. Therapeutics

The role which ZFQR plays in the gene regulation and its effect on disease is not yet completely understood. However, upon confirmation of the active role of ZFQR in disease, the present invention will provide disease therapy by provision of the appropriate wild-type gene. In these aspects of the present invention, ZFQR is provided to an animal with disease, such as cancer, or in aging, in the same manner that other disease suppressors are provided, following identification of a cell type that lacks ZFQR or has an abeπant ZFQR.

In alternative aspects, where the levels or activity of ZFQR is too high, then inhibition of ZFQR, or the gene encoding ZFQR, would be adopted as a therapeutic strategy. Inhibitors would be any molecule that reduces the activity or amounts of ZFQR or a gene encoding ZFQR, including antisense, ribozymes and the like, as well as small molecule inhibitors.

A. Gene Therapy The general approach to the aspects of the present invention concerning prostate disease therapeutics is to provide a cell with a ZFQR protein or peptide, thereby permitting the proper regulatory activity of the proteins to take effect. While it is conceivable that the protein may be delivered directly, a prefeπed embodiment involves providing a nucleic acid encoding a ZFQR protein to the cell. Following this provision, the polypeptide is synthesized by the transcriptional and translational machinery of the cell, as well as any that may be provided by the expression construct. In providing antisense, ribozymes and other inhibitors, the prefeπed mode is also to provide a nucleic acid encoding the construct to the cell. All such approaches are herein encompassed within the term "gene therapy". In certain embodiments of the invention, the nucleic acid encoding the gene may be stably integrated into the genome of the cell. In yet further embodiments, the nucleic acid may be stably maintained in the cell as a separate, episomal segment of DNA. Such nucleic acid segments or "episomes" encode sequences sufficient to permit maintenance and replication independent of or in synchronization with the host cell cycle. How the expression construct is delivered to a cell and where in the cell the nucleic acid remains is dependent on the type of expression construct employed.

1. DNA Delivery Using Viral Vectors The ability of certain viruses to infect cells or enter cells via receptor- mediated endocytosis, and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells. Prefeπed gene therapy vectors of the present invention will generally be viral vectors.

Although some viruses that can accept foreign genetic material are limited in the number of nucleotides they can accommodate and in the range of cells they infect, these viruses have been demonstrated to successfully effect gene expression. However, adenoviruses do not integrate their genetic material into the host genome and therefore do not require host replication for gene expression, making them ideally suited for rapid, efficient, heterologous gene expression. Techniques for preparing replication-defective infective viruses are well known in the art.

Of course, in using viral delivery systems, one will desire to purify the virion sufficiently to render it essentially free of undesirable contaminants, such as defective interfering viral particles or endotoxins and other pyrogens such that it will not cause any untoward reactions in the cell, animal or individual receiving the vector construct. A prefeπed means of purifying the vector involves the use of buoyant density gradients, such as cesium chloride gradient centrifugation.

a. Adenoviral Vectors A particular method for delivery of the expression constructs involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue-specific transforming construct that has been cloned therein.

The expression vector comprises a genetically engineered form of adenovirus. Knowledge of the genetic organization or adenovirus, a 36 kb, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral

DNA with foreign sequences up to 7 kb (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the adenoviral infection of host cells does not result in chromosomal integration because adenoviral DNA can replicate in an episomal manner without potential genotoxicity. Also, adenoviruses are structurally stable, and no genome reaπangement has been detected after extensive amplification. Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target-cell range and high infectivity. Both ends of the viral genome contain 100-200 base pair inverted repeats (ITRs), which are cis elements necessary for viral DNA replication and packaging. The early (E) and late (L) regions of the genome contain different transcription units that are divided by the onset of viral DNA replication. The El region (E1A and E1B) encodes proteins responsible for the regulation of transcription of the viral genome and a few cellular genes. The expression of the E2 region (E2A and E2B) results in the synthesis of the proteins for viral DNA replication. These proteins are involved in DNA replication, late gene expression and host cell shut-off (Renan, 1990). The products of the late genes, including the majority of the viral capsid proteins, are expressed only after significant processing of a single primary transcript issued by the major late promoter (MLP). The MLP, (located at 16.8 m.u.) is particularly efficient during the late phase of infection, and all the mRNA's issued from this promoter possess a 5 '-tripartite leader (TPL) sequence which makes them prefeπed mRNA's for translation.

In a cuπent system, recombinant adenovirus is generated from homologous recombination between shuttle vector and provirus vector. Due to the possible recombination between two pro viral vectors, wild- type adenovirus may be generated from this process. Therefore, it is critical to isolate a single clone of virus from an individual plaque and examine its genomic structure.

Generation and propagation of the cuπent adenovirus vectors, which are replication deficient, depend on a unique helper cell line, designated 293, which was transformed from human embryonic kidney cells by Ad5 DNA fragments and constitutively expresses El proteins (E1A and E1B; Graham et al, 1977). Since the E3 region is dispensable from the adenovirus genome (Jones and Shenk, 1978), the current adenovirus vectors, with the help of 293 cells, carry foreign DNA in either the El, the D3 or both regions (Graham and Prevec, 1991). In nature, adenovirus can package approximately 105% of the wild-type genome (Ghosh-Choudhury et al, 1987), providing capacity for about 2 extra kb of DNA. Combined with the approximately 5.5 kb of DNA that is replaceable in the El and

E3 regions, the maximum capacity of the cuπent adenovirus vector is under 7.5 kb, or about 15%> of the total length of the vector. More than 80% of the adenovirus viral genome remains in the vector backbone.

Helper cell lines may be derived from human cells such as human embryonic kidney cells, muscle cells, hematopoietic cells or other human embryonic mesenchymal or epithelial cells. Alternatively, the helper cells may be derived from the cells of other mammalian species that are permissive for human adenovirus. Such cells include, e.g., Vero cells or other monkey embryonic mesenchymal or epithelial cells. As stated above, the prefeπed helper cell line is 293.

Recently, Racher et al. (1995) disclosed improved methods for culturing 293 cells and propagating adenovirus. In one format, natural cell aggregates are grown by inoculating individual cells into 1 liter siliconized spinner flasks (Techne, Cambridge, UK) containing 100-200 ml of medium. Following stirring at 40 φm, the cell viability is estimated with trypan blue. In another format,

Fibra-Cel microcarriers (Bibby Sterlin, Stone, UK) (5 g/1) is employed as follows. A cell inoculum, resuspended in 5 ml of medium, is added to the carrier (50 ml) in a 250 ml Erlenmeyer flask and left stationary, with occasional agitation, for 1 to 4 h. The medium is then replaced with 50 ml of fresh medium and shaking initiated. For virus production, cells are allowed to grow to about 80%o confluence, after which time the medium is replaced (to 25%> of the final volume) and adenovirus added at an MOI of 0.05. Cultures are left stationary overnight, following which the volume is increased to 100% and shaking commenced for another 72 h. Other than the requirement that the adenovirus vector be replication defective, or at least conditionally defective, the nature of the adenovirus vector is not believed to be crucial to the successful practice of the invention. The adenovirus may be of any of the 42 different known serotypes or subgroups A-F. Adenovirus type 5 of subgroup C is the prefeπed starting material in order to obtain the conditional replication-defective adenovirus vector for use in the present invention. This is because Adenovirus type 5 is a human adenovirus about which a great deal of biochemical and genetic information is known, and it has historically been used for most constructions employing adenovirus as a vector.

As stated above, the typical vector according to the present invention is replication defective and will not have an adenovirus El region. Thus, it will be most convenient to introduce the transforming construct at the position from which the El -coding sequences have been removed. However, the position of insertion of the construct within the adenovirus sequences is not critical to the invention. The polynucleotide encoding the gene of interest may also be inserted in lieu of the deleted E3 region in E3 replacement vectors as described by

Karlsson et al. (1986) or in the E4 region where a helper cell line or helper virus complements the E4 defect.

Adenovirus growth and manipulation is known to those of skill in the art, and exhibits broad host range in vitro and in vivo. This group of viruses can be obtained in high titers, e.g., 10⁹ to 10¹¹ plaque-forming units per ml, and they are highly infective. The life cycle of adenovirus does not require integration into the host cell genome. The foreign genes delivered by adenovirus vectors are episomal and, therefore, have low genotoxicity to host cells. No side effects have been reported in studies of vaccination with wild-type adenovirus (Couch et al, 1963; Top et al, 1971), demonstrating their safety and therapeutic potential as in vivo gene transfer vectors.

Adenovirus vectors have been used in eukaryotic gene expression (Levrero et al, 1991 ; Gomez-Foix et al, 1992) and vaccine development (Grunhaus and Horwitz, 1992; Graham and Prevec, 1992). Recently, animal studies suggested that recombinant adenovirus could be used for gene therapy

(Stratford -Perricaudet and Perricaudet, 1991 ; Stratford-Peπicaudet et al, 1991 ; Rich et al, 1993). Studies in administering recombinant adenovirus to different tissues include trachea instillation (Rosenfeld et al, 1991 ; Rosenfeld et al, 1992), muscle injection (Ragot et al, 1993), peripheral intravenous injections (Herz and Gerard, 1993) and stereotactic inoculation into the brain (Le Gal La Salle et al, 1993). Recombinant adenovirus and adeno-associated virus (see below) can both infect and transduce non-dividing human primary cells.

b. AAV Vectors

Adeno-associated virus (AAV) is an attractive vector system for use in the cell transduction of the present invention as it has a high frequency of integration and it can infect nondividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue culture (Muzyczka, 1992) or in vivo. AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin et al, 1986; Lebkowski et al, 1988; McLaughlin et al, 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patent No. 5,139,941 and U.S. Patent No. 4,797,368, each incoφorated herein by reference.

Studies demonstrating the use of AAV in gene delivery include LaFace et al. (1988); Zhou et al. (1993); Flotte et al. (1993); and Walsh et al. (1994). Recombinant AAV vectors have been used successfully for in vitro and in vivo transduction of marker genes (Kaplitt et al, 1994; Lebkowski et al, 1988;

Samulski et al, 1989; Yoder et al, 1994; Zhou et al, 1994; Hermonat and Muzyczka, 1984; Tratschin et al, 1985; McLaughlin et al, 1988) and genes involved in human diseases (Flotte et al, 1992; Luo et al, 1994; Ohi et al, 1990; Walsh et al, 1994; Wei et al, 1994). Recently, an AAV vector has been approved for phase I human trials for the treatment of cystic fibrosis.

AAV is a dependent parvovirus in that it requires coinfection with another virus (either adenovirus or a member of the heφes virus family) to undergo a productive infection in cultured cells (Muzyczka, 1992). In the absence of coinfection with helper virus, the wild type AAV genome integrates through its ends into human chromosome 19 where it resides in a latent state as a provirus

(Kotin et al, 1990; Samulski et al, 1991). rAAV, however, is not restricted to chromosome 19 for integration unless the AAV Rep protein is also expressed (Shelling and Smith, 1994). When a cell carrying an AAV provirus is superinfected with a helper virus, the AAV genome is "rescued" from the chromosome or from a recombinant plasmid, and a normal productive infection is established (Samulski et al, 1989; McLaughlin et al, 1988; Kotin et al, 1990;

Muzyczka, 1992).

Typically, recombinant AAV (rAAV) virus is made by cotransfecting a plasmid containing the gene of interest flanked by the two AAV terminal repeats (McLaughlin et al, 1988; Samulski et al, 1989; each incoφorated herein by reference) and an expression plasmid containing the wild type AAV coding sequences without the terminal repeats, for example pIM45 (McCarty et al, 1991; incoφorated herein by reference). The cells are also infected or transfected with adenovirus or plasmids carrying the adenovirus genes required for AAV helper function. rAAV virus stocks made in such fashion are contaminated with adenovirus which must be physically separated from the rAAV particles (for example, by cesium chloride density centrifugation). Alternatively, adenovirus vectors containing the AAV coding regions or cell lines containing the AAV coding regions and some or all of the adenovirus helper genes could be used (Yang et al, 1994; Clark et al, 1995). Cell lines carrying the rAAV DNA as an integrated provirus can also be used (Flotte et al, 1995).

c. Retroviral Vectors

Retroviruses have promise as gene delivery vectors due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992).

The retroviruses are a group of single-stranded RNA viruses characterized by an ability to convert their RNA to double-stranded DNA in infected cells by a process of reverse-transcription (Coffin, 1990). The resulting DNA then stably integrates into cellular chromosomes as a provirus and directs synthesis of viral proteins. The integration results in the retention of the viral gene sequences in the recipient cell and its descendants. The retroviral genome contains three genes, gag, pol, and env that code for capsid proteins, polymerase enzyme, and envelope components, respectively. A sequence found upstream from the gag gene contains a signal for packaging of the genome into virions. Two long terminal repeat (LTR) sequences are present at the 5' and 3' ends of the viral genome.

These contain strong promoter and enhancer sequences and are also required for integration in the host cell genome (Coffin, 1990).

In order to construct a retroviral vector, a nucleic acid encoding a gene of interest is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into this cell line (by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al, 1983). The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).

Concern with the use of defective retrovirus vectors is the potential appearance of wild-type replication-competent virus in the packaging cells. This can result from recombination events in which the intact sequence from the recombinant virus inserts upstream from the gag, pol, env sequence integrated in the host cell genome. However, new packaging cell lines are now available that should greatly decrease the likelihood of recombination (Markowitz et al, 1988; Hersdorffer et /., 1990).

Gene delivery using second-generation retroviral vectors has been reported. Kasahara et al. (1994) prepared an engineered variant of the Moloney murine leukemia virus, that normally infects only mouse cells, and modified an envelope protein so that the virus specifically bound to, and infected, human cells bearing the erythropoietin (EPO) receptor. This was achieved by inserting a portion of the EPO sequence into an envelope protein to create a chimeric protein with a new binding specificity.

d. Other Viral Vectors

Other viral vectors may be employed as expression constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988), sindbis virus, cytomegalovirus and heφes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990).

With the recent recognition of defective hepatitis B viruses, new insight was gained into the structure-function relationship of different viral sequences. In vitro studies showed that the virus could retain the ability for helper-dependent packaging and reverse transcription despite the deletion of up to 80% of its genome (Horwich et al, 1990). This suggested that large portions of the genome could be replaced with foreign genetic material. Chang et al. recently introduced the chloramphenicol acetyltransferase (CAT) gene into duck hepatitis B virus genome in the place of the polymerase, surface, and pre-surface coding sequences.

It was cotransfected with wild-type virus into an avian hepatoma cell line. Culture media containing high titers of the recombinant virus were used to infect primary duckling hepatocytes. Stable CAT gene expression was detected for at least 24 days after transfection (Chang et al, 1991). In certain further embodiments, the gene therapy vector will be HSV. A factor that makes HSV an attractive vector is the size and organization of the genome. Because HSV is large, incoφoration of multiple genes or expression cassettes is less problematic than in other smaller viral systems. In addition, the availability of different viral control sequences with varying performance (temporal, strength, etc.) makes it possible to control expression to a greater extent than in other systems. It also is an advantage that the virus has relatively few spliced messages, further easing genetic manipulations. HSV also is relatively easy to manipulate and can be grown to high titers. Thus, delivery is less of a problem, both in terms of volumes needed to attain sufficient MOI and in a lessened need for repeat dosings.

e. Modified Viruses

In still further embodiments of the present invention, the nucleic acids to be delivered are housed within an infective virus that has been engineered to express a specific binding ligand. The virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell. A novel approach designed to allow specific targeting of retrovirus vectors was recently developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors. Another approach- to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al, 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al, 1989).

2. Other Methods of DNA Delivery

In various embodiments of the invention, DNA is delivered to a cell as an expression construct. In order to effect expression of a gene construct, the expression construct must be delivered into a cell. As described herein, the prefeπed mechanism for delivery is via viral infection, where the expression construct is encapsidated in an infectious viral particle. However, several non- viral methods for the transfer of expression constructs into cells also are contemplated by the present invention. In one embodiment of the present invention, the expression construct may consist only of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned which physically or chemically permeabilize the cell membrane. Some of these techniques may be successfully adapted for in vivo or ex vivo use, as discussed below.

a. Liposome-Mediated Transfection In a further embodiment of the invention, the expression construct may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Also contemplated is an expression construct complexed with Lipofectamine (Gibco BRL).

Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987). Wong et al. (1980) demonstrated the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells.

In certain embodiments of the invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-

1) (Kato et al, 1991). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In other embodiments, the delivery vehicle may comprise a ligand and a liposome. Where a bacterial promoter is employed in the DNA construct, it also will be desirable to include within the liposome an appropriate bacterial polymerase. b. Electroporation

In certain embodiments of the present invention, the expression construct is introduced into the cell via electroporation. Electroporation involves the exposure of a suspension of cells and DNA to a high-voltage electric discharge.

Transfection of eukaryotic cells using electroporation has been quite successful. Mouse pre-B lymphocytes have been transfected with human kappa- immunoglobulin genes (Potter et al, 1984), and rat hepatocytes have been transfected with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al, 1986) in this manner.

c. Calcium Phosphate Precipitation or DEAE-

Dextran Treatment

In other embodiments of the present invention, the expression construct is introduced to the cells using calcium phosphate precipitation. Human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973) using this technique. Also in this manner, mouse L(A9), mouse C127, CHO, CV- 1, BHK, NIH3T3 and HeLa cells were transfected with a neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes were transfected with a variety of marker genes (Rippe et al, 1990). In another embodiment, the expression construct is delivered into the cell using DEAE-dextran followed by polyethylene glycol. In this manner, reporter plasmids were introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).

d. Particle Bombardment

Another embodiment of the invention for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA-coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al, 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical cuπent, which in turn provides the motive force (Yang et al, 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

e. Direct Microinj ection or Sonication Loading

Further embodiments of the present invention include the introduction of the expression construct by direct microinj ection or sonication loading. Direct microinj ection has been used to introduce nucleic acid constructs into Xenopus oocytes (Harland and Weintraub, 1985), and LTK^" fibroblasts have been transfected with the thymidine kinase gene by sonication loading (Fechheimer et al, 1987).

f. Adenoviral Assisted Transfection

In certain embodiments of the present invention, the expression construct is introduced into the cell using adenovirus-assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al, 1992; Curiel, 1994).

g. Receptor Mediated Transfection Still further expression constructs that may be employed to deliver the tissue-specific promoter and transforming construct to the target cells are receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in the target cells. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention.

Specific delivery in the context of another mammalian cell type is described by Wu and Wu (1993; incoφorated herein by reference).

Certain receptor-mediated gene targeting vehicles comprise a cell receptor-specific ligand and a DNA-binding agent. Others comprise a cell receptor-specific ligand to which the DNA construct to be delivered has been operatively attached. Several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987; Wagner et al, 1990; Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique. In the context of the present invention, the ligand will be chosen to correspond to a receptor specifically expressed on the neuro endocrine target cell population. In other embodiments, the DNA delivery vehicle component of a cell- specific gene targeting vehicle may comprise a specific binding ligand in combination with a liposome. The nucleic acids to be delivered are housed within the liposome and the specific binding ligand is functionally incoφorated into the liposome membrane. The liposome will thus specifically bind to the receptors of the target cell and deliver the contents to the cell. Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor.

In still further embodiments, the DNA delivery vehicle component of the targeted delivery vehicles may be a liposome itself, which will preferably comprise one or more lipids or glycoproteins that direct cell-specific binding. For example, Nicolau et al. (1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, incoφorated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes. It is contemplated that the tissue- specific transforming constructs of the present invention can be specifically delivered into the target cells in a similar manner.

B. Antisense

In the alternative embodiments discussed above, the ZFQR nucleic acids employed may actually encode antisense constructs that hybridize, under intracellular conditions, to ZFQR nucleic acids. The term "antisense construct" is intended to refer to nucleic acids, preferably oligonucleotides, that are complementary to the base sequences of a target DNA or RNA. Targeting double-stranded (ds) DNA with an antisense construct leads to triple-helix formation; targeting RNA will lead to double-helix formation. Antisense nucleic acids, when introduced into a target cell, specifically bind to their target polynucleotide, for example ZFQR, and interfere with transcription, RNA processing, transport, translation and/or stability. Antisense RNA constructs, or DNA encoding such antisense RNAs, may be employed to inhibit ZFQR gene transcription or translation or both within the cells of the present invention. Antisense constructs may be designed to bind to the promoter and other control regions, exons, introns or even exon-intron boundaries of a gene. Antisense RNA constructs, or DNA encoding such antisense RNA's, may be employed to inhibit gene transcription or translation or both within a host cell, either in vitro or in vivo, such as within a host animal, including a human subject. Nucleic acid sequences which comprise "complementary nucleotides" are those which are capable of base-pairing according to the standard Watson-Crick complementarity rules. That is, that the larger purines will base pair with the smaller pyrimidines to form combinations of guanine paired with cytosine (G:C) and adenine paired with either thymine (A:T), in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Inclusion of less common bases such as inosine, 5-methylcytosine, 6-methyladenine, hypoxanthine and others in hybridizing sequences does not interfere with pairing.

As used herein, the term "complementary" means nucleic acid sequences that are substantially complementary over their entire length and have very few base mismatches. For example, nucleic acid sequences of fifteen bases in length may be termed complementary when they have a complementary nucleotide at thirteen or fourteen positions with only a single mismatch. Naturally, nucleic acid sequences which are "completely complementary" will be nucleic acid sequences which are entirely complementary throughout their entire length and have no base mismatches.

Other sequences with lower degrees of homology also are contemplated. For example, an antisense construct which has limited regions of high homology, but also contains a non-homologous region (e.g., a ribozyme) could be designed. These molecules, though having less than 50%> homology, would bind to target sequences under appropriate conditions. While all or part of the ZFQR gene sequences may be employed in the context of antisense construction, short oligonucleotides are easier to make and increase in vivo accessibility. However, both binding affinity and sequence specificity of an antisense oligonucleotide to its complementary target increases with increasing length. One can readily determine whether a given antisense nucleic acid is effective at targeting of the coπesponding host cell gene simply by testing the constructs in vitro to determine whether the function of the endogenous gene is affected or whether the expression of related genes having complementary sequences is affected. In certain embodiments, one may wish to employ antisense constructs which include other elements, for example, those which include C-5 propyne pyrimidines. Oligonucleotides which contain C-5 propyne analogues of uridine and cytidine have been shown to bind RNA with high affinity and to be potent antisense inhibitors of gene expression.

C. Ribozymes

Another method for inhibiting ZFQR expression contemplated in the present invention is via ribozymes. Although proteins traditionally have been used for catalysis of nucleic acids, another class of macromolecules has emerged as useful in this endeavor. Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlach et al, 1987; Forster and Symons, 1987). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et al, 1981 ; Michel and Westhof, 1990; Reinhold-Hurek and Shub, 1992). This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction. Ribozyme catalysis has primarily been observed as part of sequence- specific cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cech et al, 1981). For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes. Thus, sequence-specific ribozyme-mediated inhibition of gene expression may be particularly suited to therapeutic applications (Scanlon et al, 1991 ; Sarver et al,

1990; Sioud et al, 1992). Recently, it was reported that ribozymes elicited genetic changes in some cells lines to which they were applied; the altered genes included the oncogenes H-ras, c-fos and genes of HIV. Most of this work involved the modification of a target mRNA, based on a specific mutant codon that is cleaved by a specific ribozyme.

Several different ribozyme motifs have been described with RNA cleavage activity (Symons, 1992). Examples that are expected to function equivalently for the down regulation of ZFQR include sequences from the Group I self splicing introns including Tobacco Ringspot Virus (Prody et al, 1986), Avocado Sunblotch Viroid (Palukaitis et al, 1979; Symons, 1981), and Lucerne Transient

Streak Virus (Forster and Symons, 1987). Sequences from these and related viruses are refeπed to as hammerhead ribozyme based on a predicted folded secondary structure.

Other suitable ribozymes include sequences from RNase P with RNA cleavage activity (Yuan et al, 1992, Yuan and Altman, 1994, U.S. Patent Nos.

5,168,053 and 5,624,824), haiφin ribozyme structures (Berzal-Heπanz et al, 1992; Chowrira et al, 1993) and Hepatitis Delta virus based ribozymes (U.S. Patent No. 5,625,047). The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach, 1988, Symons, 1992, Chowrira et al, 1994; Thompson et al, 1995).

The other variable on ribozyme design is the selection of a cleavage site on a given target RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a site by complimentary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA is a uracil (U) followed by either an adenine, cytosine or uracil (A,C or U) (Peπiman et al, 1992; Thompson et al, 1995). The frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1000 bases, 187 dinucleotide cleavage sites are statistically possible.

The large number of possible cleavage sites in prostate specific transglutaminase, cytokeratin 15, and semenogelin II coupled with the growing number of sequences with demonstrated catalytic RNA cleavage activity indicates that a large number of ribozymes that have the potential to downregulate prostate specific transglutaminase, cytokeratin 15, and semenogelin II are available. Additionally, due to the sequence variation among the prostate specific transglutaminase, cytokeratin 15, and semenogelin II, ribozymes could be designed to specifically cleave prostate specific transglutaminase, cytokeratin 15, or semenogelin II. Designing and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al. (1994) and Lieber and Strauss (1995), each incoφorated by reference. The identification of operative and preferred sequences for use in prostate specific transglutaminase, cytokeratin 15, and semenogelin II-targeted ribozymes is simply a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art.

D. Homologous Recombination

Although genetic transformation tends to be quite efficient, it is also accompanied by problems associated with random insertion. Random integration can lead to the inactivation of essential genes, or to the abeπant expression of the introduced gene. Additional problems associated with genetic transformation include mosaicism due to multiple integrations, and technical difficulties associated with generation of replication defective recombinant viral vectors.

Some of these drawbacks can be overcome by the utilization of a technique known as homologous recombination (Koller and Smithies, 1992). This technique allows the precise modification of existing genes, overcomes the problems of positional effects and insertional inactivation, and allows the inactivation of specific genes, as well as the replacement of one gene for another. Methods for homologous recombination are described in U. S. Patent 5,614,396, incoφorated herein in its entirety by reference. Thus a prefeπed method for the delivery of transgenic constructs involves the use of homologous recombination. Homologous recombination relies, like antisense, on the tendency of nucleic acids to base pair with complementary sequences. In this instance, the base pairing serves to facilitate the interaction of two separate nucleic acid molecules so that strand breakage and repair can take place. In other words, the "homologous" aspect of the method relies on sequence homology to bring two complementary sequences into close proximity, while the "recombination" aspect provides for one complementary sequence to replace the other by virtue of the breaking of certain bonds and the formation of others.

Put into practice, homologous recombination is used as follows. First, a site for integration is selected within the host cell. Sequences homologous to the integration site are then included in a genetic construct, flanking the selected gene to be integrated into the genome. Flanking, in this context, simply means that target homologous sequences are located both upstream (5') and downstream (3') of the selected gene. These sequences should coπespond to some sequences upstream and downstream of the target gene. The construct is then introduced into the cell, thus permitting recombination between the cellular sequences and the construct.

As a practical matter, the genetic construct will normally act as far more than a vehicle to insert the gene into the genome. For example, it is important to be able to select for recombinants and, therefore, it is common to include within the construct a selectable marker gene. This gene permits selection of cells that have integrated the construct into their genomic DNA by conferring resistance to various biostatic and biocidal drugs. In addition, this technique may be used to "knock-out" (delete) or interrupt a particular gene. Thus, another approach for inhibiting prostate specific transglutaminase, cytokeratin 15, and semenogelin II involves the use of homologous recombination, or "knock-out technology". This is accomplished by including a mutated or vastly deleted form of the heterologous gene between the flanking regions within the construct. The arrangement of a construct to effect homologous recombination might be as follows:

...vector* 5 '-flanking sequence*selected gene* selectable marker gene'flanking sequence-3 ' 'vector...

Thus, using this kind of construct, it is possible, in a single recombinatorial event, to (i) "knock out" an endogenous gene, (ii) provide a selectable marker for identifying such an event and (iii) introduce a transgene for expression.

Another refinement of the homologous recombination approach involves the use of a "negative" selectable marker. One example of the use of the cytosine deaminase gene in a negative selection method is described in U.S. Patent No. 5,624,830. The negative selection marker, unlike the selectable marker, causes death of cells which express the marker. Thus, it is used to identify undesirable recombination events. When seeking to select homologous recombinants using a selectable marker, it is difficult in the initial screening step to identify proper homologous recombinants from recombinants generated from random, non- sequence specific events. These recombinants also may contain the selectable marker gene and may express the heterologous protein of interest, but will, in all likelihood, not have the desired phenotype. By attaching a negative selectable marker to the construct, but outside of the flanking regions, one can select against many random recombination events that will incoφorate the negative selectable marker. Homologous recombination should not introduce the negative selectable marker, as it is outside of the flanking sequences. E. Marker genes

In certain aspects of the present invention, specific cells are tagged with specific genetic markers to provide information about the fate of the tagged cells. Therefore, the present invention also provides recombinant candidate screening and selection methods which are based upon whole cell assays and which, preferably, employ a reporter gene that confers on its recombinant hosts a readily detectable phenotype that emerges only under conditions where a general DNA promoter positioned upstream of the reporter gene is functional. Generally, reporter genes encode a polypeptide (marker protein) not otherwise produced by the host cell which is detectable by analysis of the cell culture, e.g., by fluorometric, radioisotopic or spectrophotometric analysis of the cell culture.

In other aspects of the present invention, a genetic marker is provided which is detectable by standard genetic analysis techniques, such as DNA amplification by PCR™ or hybridization using fluorometric, radioisotopic or spectrophotometric probes.

1. Screening

Exemplary enzymes include esterases, phosphatases, proteases (tissue plasminogen activator or urokinase) and other enzymes capable of being detected by their activity, as will be known to those skilled in the art. Contemplated for use in the present invention is green fluorescent protein (GFP) as a marker for transgene expression (Chalfie et al, 1994). The use of GFP does not need exogenously added substrates, only iπadiation by near UV or blue light, and thus has significant potential for use in monitoring gene expression in living cells.

Other particular examples are the enzyme chloramphenicol acetyltransferase (CAT) which may be employed with a radiolabelled substrate, firefly and bacterial luciferase, and the bacterial enzymes β-galactosidase and β- glucuronidase. Other marker genes within this class are well known to those of skill in the art, and are suitable for use in the present invention. 2. Selection

Another class of reporter genes which confer detectable characteristics on a host cell are those which encode polypeptides, generally enzymes, which render their transformants resistant against toxins. Examples of this class of reporter genes are the neo gene (Colberre-Garapin et al, 1981) which protects host cells against toxic levels of the antibiotic G418, the gene conferring streptomycin resistance (U. S. Patent 4,430,434), the gene conferring hygromycin B resistance

(Santerre et al, 1984; U. S. Patents 4,727,028, 4,960,704 and 4,559,302), a gene encoding dihydrofolate reductase, which confers resistance to methotrexate (Alt et al, 1978), the enzyme HPRT, along with many others well known in the art

(Kaufman, 1990).

F. Excision of Transgenes

In certain embodiments of the present invention, rescue of a ZFQR gene or genetic construct is desired. The present invention contemplates the use of site- specific recombination systems to rescue specific genes out of a genome, and to excise specific transgenic constructs from the genome.

Members of the integrase family are proteins that bind to a DNA recognition sequence, and are involved in DNA recognition, synapsis, cleavage, strand exchange, and religation. Currently, the family of integrases includes 28 proteins from bacteria, phage, and yeast which have a common invariant His-Arg- Tyr triad (Abremski and Hoess, 1992). Four of the most widely used site-specific recombination systems for eukaryotic applications include: Cre-loxP from bacteriophage Pl (Austin et al, 1981); FLP-FRT from the 2μ plasmid of Saccharomyces cerevisiae (Andrews et al, 1985); R-RS from

Zygosaccharomyces rouxii (Maeser and Kahmann, 1991) and gin-gix from bacteriophage Mu (Onouchi et al, 1995). The Cre-loxP and FLP-FRT systems have been developed to a greater extent than the latter two systems. The R-RS system, like the Cre-loxP and FLP-FRT systems, requires only the protein and its recognition site. The Gin recombinase selectively mediates DNA inversion between two inversely oriented recombination sites (gix) and requires the assistance of three additional factors: negative supercoiling, an enhancer sequence and its binding protein Fis.

The present invention contemplates the use of the CrelLox site-specific recombination system (Sauer, 1993, available through Gibco/BRL, Inc., Gaithersburg, Md.) to rescue specific genes out of a genome, and to excise specific transgenic constructs from the genome. The Cre (causes recombination)- lox P (locus of crossing-over(x)) recombination system, isolated from bacteriophage Pl, requires only the Cre enzyme and its loxP recognition site on both partner molecules (Sternberg and Hamilton, 1981). The loxP site consists of two symmetrical 13 bp protein binding regions separated by an 8 bp spacer region, which is recognized by the Cre recombinase, a 35 kDa protein. Nucleic acid sequences for loxP (Hoess et al, 1982) and Cre (Sternberg et al, 1986) are known. If the two lox P sites are cis to each other, an excision reaction occurs; however, if the two sites are trans to one another, an integration event occurs. The Cre protein catalyzes a site-specific recombination event. This event is bidirectional, i.e., Cre will catalyze the insertion of sequences at a LoxP site or excise sequences that lie between two Lox? sites. Thus, if a construct for insertion also has flanking LoxP sites, introduction of the Cre protein, or a polynucleotide encoding the Cre protein, into the cell will catalyze the removal of the construct DNA. This technology is enabled in U.S. Patent No. 4,959,317, which is hereby incoφorated by reference in its entirety.

An initial in vivo study in bacteria showed that the Cre excises loxP- flanked DNA extrachromosomally in cells expressing the recombinase (Abremski et al, 1988). A major question regarding this system was whether site-specific recombination in eukaryotes could be promoted by a bacterial protein. However,

Sauer (1987) showed that the system excises DNA in S. cerevisiae with the same level of efficiency as in bacteria.

Further studies with the Cre-loxP system, in particular the ES cells system in mice, has demonstrated the usefulness of the excision reaction for the generation of unique transgenic animals. Homologous recombination followed by

Cre-mediated deletion of a loxP-flanked neo-tk cassette was used to introduce mutations into ES cells. This strategy was repeated for a total of 4 rounds in the same line to alter both alleles of the rep-3 and mMsh2 loci, genes involved in DNA mismatch repair (Abuin and Bradley, 1996). Similarly, a transgene which consists of the 35S promoter/luciferase gene/loxP/35S promoter/hpt gene/loxP (luc⁺hyg⁺) was introduced into tobacco. Subsequent treatment with Cre causes the deletion of the hyg gene (luc⁺hyg^s) at 50% efficiency (Dale and Ow, 1991). Transgenic mice which have the Ig light chain K constant region targeted with a loxP-flanked neo gene were bred to Cre-producing mice to remove the selectable marker from the early embryo (Lakso et al, 1996). This general approach for removal of markers stems from issues raised by regulatory groups and consumers concerned about the introduction of new genes into a population.

An analogous system contemplated for use in the present invention is the

FLP/FRT system. This system was used to target the histone 4 gene in mouse ES cells with a FRT-flanked neo cassette followed by deletion of the marker by FLP- mediated recombination. The FLP protein could be obtained from an inducible promoter driving the FLP or by using the protein itself (Wigley et al, 1994).

The present invention also contemplates the use of recombination activating genes (RAG) 1 and 2 to excise specific transgenic constructs from the genome, as well as to rescue specific genes from the genome. RAG-1 (GenBank accession number M29475) and RAG-2 (GenBank accession numbers M64796 and M33828) recognize specific recombination signal sequences (RSSs) and catalyze V(D)J recombination required for the assembly of immunoglobulin and T cell receptor genes (Schatz et al, 1989; Oettinger et al, 1990; Cumo and Oettinger, 1994). Transgenic expression of RAG-1 and RAG-2 proteins in non- lymphoid cells supports V(D)J recombination of reporter substrates (Oettinger et al, 1990). For use in the present invention, the transforming construct of interest is engineered to contain flanking RSSs. Following transformation, the transforming construct that is internal to the RSSs can be deleted from the genome by the transient expression of RAG-1 and RAG-2 in the transformed cell. VI. Rational Drug Design

The goal of rational drug design is to produce structural analogs of biologically active compounds. By creating such analogs, it is possible to fashion drugs which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for the ZFQR of the invention or a fragment thereof. This could be accomplished by X-ray crystallography, computer modeling or by a combination of both approaches. An alternative approach, involves the random replacement of functional groups throughout the ZFQR, and the resulting affect on function determined.

It also is possible to isolate a ZFQR specific antibody, selected by a functional assay, and then solve its crystal structure. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies to a functional, pharmacologically active antibody. As a minor image of a minor image, the binding site of anti-idiotype would be expected to be an analog of the original antigen. The anti-idiotype could then be used to identify and isolate peptides from banks of chemically- or biologically-produced peptides.

Selected peptides would then serve as the pharmacore. Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.

Thus, one may design drugs which have enhanced and improved biological activity, for example, DNA binding relative to a starting ZFQR of the invention. By virtue of the chemical isolation procedures and descriptions well known in the art, sufficient amounts of the ZFQR of the invention can be produced to perform crystallographic studies. In addition, knowledge of the chemical characteristics of these compounds permits computer employed predictions of structure- function relationships. VIII. Antibody Preparation

A. Polyclonal antibodies

Polyclonal antibodies to ZFQR generally are raised in animals by multiple subcutaneous (sc) or intraperitoneal (ip) injections of the ZFQR and an adjuvant.

It may be useful to conjugate the ZFQR or a fragment containing the target amino acid sequence to a protein that is immunogenic in the species to be immunized, e.g. keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, or soybean trypsin inhibitor using a bifunctional or derivatizing agent, for example maleimidobenzoyl sulfosuccinimide ester (conjugation through cysteine residues),

N-hydroxysuccinimide (through lysine residues), glytaraldehyde, succinic anhydride, SOCl₂, or Ri N=C=NR, where R and Ri. are different alkyl groups.

Animals are immunized against the immunogenic conjugates or derivatives by combining 1 mg of 1 μg of conjugate (for rabbits or mice, respectively) with 3 volumes of Freud's complete adjuvant and injecting the solution intradermally at multiple sites. One month later the animals are boosted with 1/5 to 1/10 the original amount of conjugate in Freud's complete adjuvant by subcutaneous injection at multiple sites. Seven to fourteen days later the animals are bled and the serum is assayed for anti-ZFQR antibody titer. Animals are boosted until the titer plateaus. Preferably, the animal boosted with the conjugate of the same ZFQR, but conjugated to a different protein and/or through a different cross-linking reagent. Conjugates also can be made in recombinant cell culture as protein fusions. Also, aggregating agents such as alum are used to enhance the immune response.

B. Monoclonal antibodies

Monoclonal antibodies are obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. Thus, the modifier "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies.

For example, the anti-ZFQR monoclonal antibodies of the invention may be made using the hybridoma method first described by Kohler & Milstein, Nature 256:495 (1975), or may be made by recombinant DNA methods (Cabilly, et al, U.S. Pat. No. 4,816,567). In the hybridoma method, a mouse or other appropriate host animal, such as hamster is immunized as hereinabove described to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the protein used for immunization. Alternatively, lymphocytes may be immunized in vitro. Lymphocytes then are fused with myeloma cells using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, pp.59-103 (Academic Press, 1986)).

The hybridoma cells thus prepared are seeded and grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, parental myeloma cells. For example, if the parental myeloma cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (HAT medium), which substances prevent the growth of HGPRT-deficient cells.

Preferred myeloma cells are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. Among these, prefeπed myeloma cell lines are murine myeloma lines, such as those derived from MOPC-21 and MPC-11 mouse tumors available from the Salk Institute Cell Distribution Center,

San Diego, Calif. USA, and SP-2 cells available from the American Type Culture Collection, Rockville, Md. USA.

Culture medium in which hybridoma cells are growing is assayed for production of monoclonal antibodies directed against ZFQR. Preferably, the binding specificity of monoclonal antibodies produced by hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).

The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson & Pollard, Anal. Biochem.

107:220 (1980).

After hybridoma cells are identified that produce antibodies of the desired specificity, affinity, and/or activity, the clones may be subcloned by limiting dilution procedures and grown by standard methods. Goding, Monoclonal Antibodies: Principles and Practice, pp.59-104 (Academic Press, 1986). Suitable culture media for this puφose include, for example, Dulbecco's Modified Eagle's Medium or RPMI-1640 medium. In addition, the hybridoma cells may be grown in vivo as ascites tumors in an animal.

The monoclonal antibodies secreted by the subclones are suitably separated from the culture medium, ascites fluid, or serum by conventional immunoglobulin purification procedures such as, for example, protein A-

Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

DNA encoding the monoclonal antibodies of the invention is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a prefeπed source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences, Morrison, et al, Proc. Nat. Acad. Sci. 81, 6851 (1984), or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non- immunoglobulin polypeptide. In that manner, "chimeric" or "hybrid" antibodies are prepared that have the binding specificity of an anti-ZFQR monoclonal antibody herein.

Typically such non-immunoglobulin polypeptides are substituted for the constant domains of an antibody of the invention, or they are substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for a ZFQR and another antigen-combining site having specificity for a different antigen.

Chimeric or hybrid antibodies also may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this puφose include iminothiolate and methyl-4-mercaptobutyrimidate.

For diagnostic applications, the antibodies of the invention typically will be labeled with a detectable moiety. The detectable moiety can be any one which is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as ³H, ¹⁴C, ³²P, ³⁵S, or

¹²⁵I, a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; biotin; radioactive isotopic labels, such as, e.g., .³H, ¹⁴C, ³²P, ³⁵S, or ¹²⁵I, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.

Any method known in the art for separately conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter, et al, Nature 144:945 (1962); David, et al, Biochemistry 13:1014 (1974); Pain, et al, J. Immunol. Meth. 40:219 (1981); and Nygren, J. Histochem. and Cytochem. 30:407 (1982). The antibodies of the present invention may be employed in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).

Competitive binding assays rely on the ability of a labeled standard (which may be ZFQR or an immunologically reactive portion thereof) to compete with the test sample analyte (ZFQR) for binding with a limited amount of antibody. The amount of ZFQR in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies generally are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound.

Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three part complex. David & Greene, U.S. Pat. No. 4,376,110. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti- immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.

C. Humanized antibodies

Methods for humanizing non-human antibodies are well known in the art.

Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al, Nature 321, 522-525 (1986); Riechmann et al, Nature 332, 323-327 (1988); Verhoeyen et al, Science 239, 1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the coπesponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (Cabilly, supra), wherein substantially less than an intact human variable domain has been substituted by the coπesponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. It is important that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three- dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e. the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding. For further details see U.S. application Ser. No.

07/934,373 filed Aug. 21, 1992, which is a continuation-in-part of application Ser. No. 07/715,272 filed Jun. 14, 1991.

D. Human antibodies

Human monoclonal antibodies can be made by the hybridoma method. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described, for example, by Kozbor, J. Immunol. 133, 3001 (1984), and Brodeur, et al, Monoclonal Antibody Production Techniques and Applications, pp.51-63 (Marcel Dekker, Inc., New York, 1987). It is now possible to produce transgenic animals (e.g. mice) that are capable, upon immunization, of producing a repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene aπay in such germ-line mutant mice will result in the production of human antibodies upon antigen challenge. See, e.g. Jakobovits et al, Proc. Natl. Acad. Sci. USA 90, 2551-255 (1993); Jakobovits et al, Nature 362, 255-258 (1993).

Alternatively, the phage display technology (McCafferty et al, Nature 348, 552-553 [1990]) can be used to produce human antibodies and antibody fragments in vitro, from immunoglobulin variable (V) domain gene repertoires from unimmunized donors. According to this technique, antibody V domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, such as Ml 3 or fd, and displayed as functional antibody fragments on the surface of the phage particle.

Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. Thus, the phage mimicks some of the properties of the B-cell. Phage display can be performed in a variety of formats; for their review see, e.g.

Johnson, Kevin S. and Chiswell, David J., Cuπent Opinion in Structural Biology 3, 564-571 (1993). Several sources of V-gene segments can be used for phage display. Clackson et al, Nature 352, 624-628 (1991) isolated a diverse array of anti-oxazolone antibodies from a small random combinatorial library of V genes derived from the spleens of immunized mice. A repertoire of V genes from unimmunized human donors can be constructed and antibodies to a diverse array of antigens (including self-antigens) can be isolated essentially following the techniques described by Marks et al, J. Mol. Biol. 222, 581-597 (1991), or Griffith et al, EMBO J. 12, 725-734 (1993). In a natural immune response, antibody genes accumulate mutations at a high rate (somatic hypermutation).

Some of the changes introduced will confer higher affinity, and B cells displaying high-affinity surface immunoglobulin are preferentially replicated and differentiated during subsequent antigen challenge. This natural process can be mimicked by employing the technique known as "chain shuffling" (Marks et al, Bio/Technol. 10, 779-783 [1992]). In this method, the affinity of "primary" human antibodies obtained by phage display can be improved by sequentially replacing the heavy and light chain V region genes with repertoires of naturally occuπing variants (repertoires) of V domain genes obtained from unimmunized donors. This technique allows the production of antibodies and antibody fragments with affinities in the nM range. A strategy for making very large phage antibody repertoires (also known as "the mother-of-all libraries") has been described by Waterhouse et al, Nucl. Acids Res. 21, 2265-2266 (1993), and the isolation of a high affinity human antibody directly from such large phage library is reported by Griffith et al, EMBO J. (1994), in press. Gene shuffling can also be used to derive human antibodies from rodent antibodies, where the human antibody has similar affinities and specificities to the starting rodent antibody. According to this method, which is also referred to as "epitope imprinting", the heavy or light chain V domain gene of rodent antibodies obtained by phage display technique is replaced with a repertoire of human V domain genes, creating rodent-human chimeras. Selection on antigen results in isolation of human variable capable of restoring a functional antigen-binding site, i.e. the epitope governs (imprints) the choice of partner. When the process is repeated in order to replace the remaining rodent V domain, a human antibody is obtained (see PCT patent application WO 93/06213, published Apr. 1, 1993). Unlike traditional humanization of rodent antibodies by CDR grafting, this technique provides completely human antibodies, which have no framework or CDR residues of rodent origin.

E. Bispecific antibodies

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for a ZFQR, the other one is for any other antigen, and preferably for another receptor or receptor subunit. For example, bispecific antibodies specifically binding a ZFQR and neurotrophic factor, or two different ZFQRs are within the scope of the present invention. Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the coexpression of two immunoglobulin heavy chain-light chain pairs, where the two heavy chains have different specificities (Millstein and Cuello, Nature 305, 537-539 (1983)). Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules, of which only one has the coπect bispecific structure. The purification of the correct molecule, which is usually done by affinity chromatography steps, is rather cumbersome, and the product yields are low. Similar procedures are disclosed in PCT application publication No. WO 93/08829 (published May 13, 1993), and in Traunecker et al, EMBO 10, 3655- 3659 (1991 ). According to a different and more prefeπed approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge, CH2 and CH3 regions. It is prefeπed to have the first heavy chain constant region (CHI) containing the site necessary for light chain binding, present in at least one of the fusions. DNAs encoding the immunoglobulin heavy chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are cotransfected into a suitable host organism. This provides for great flexibility in adjusting the mutual proportions of the three polypeptide fragments in embodiments when unequal ratios of the three polypeptide chains used in the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains in one expression vector when the expression of at least two polypeptide chains in equal ratios results in high yields or when the ratios are of no particular significance. In a preferred embodiment of this approach, the bispecific antibodies are composed of a hybrid immunoglobulin heavy chain with a first binding specificity in one arm, and a hybrid immunoglobulin heavy chain-light chain pair (providing a second binding specificity) in the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain in only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed in copending application Ser. No. 07/931,811 filed Aug. 17, 1992. For further details of generating bispecific antibodies see, for example, Suresh et al, Methods in Enzymology 121, 210

(1986).

F. Heteroconjugate antibodies

Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells (U.S. Pat. No. 4,676,980), and for treatment of HIV infection (PCT application publication Nos. WO 91/00360 and WO 92/200373; EP 03089). Heteroconjugate antibodies may be made using any convenient cross-linking methods. Suitable cross-linking agents are well known in the art, and are disclosed in U.S. Pat. No. 4,676,980, along with a number of cross-linking techniques. IX. Immunological Detection

A. Immunoassays

In still further embodiments, the present invention thus concerns immunodetection methods for binding, purifying, removing, quantifying or otherwise generally detecting biological components. The encoded proteins or peptides of the present invention may be employed to detect antibodies having reactivity therewith, or, alternatively, antibodies prepared in accordance with the present invention, may be employed to detect the encoded proteins or peptides, such as ZFQR. The steps of various useful immunodetection methods have been described in the scientific literature, such as, e.g., Nakamura et al. (1987; incoφorated herein by reference). Immunoassays, in their most simple and direct sense, are binding assays. Certain prefeπed immunoassays are the various types of enzyme linked immunosorbent assays (ELISAs) and radioimmunoassays (RIA). Immunohistochemical detection using tissue sections also is particularly useful.

However, it will be readily appreciated that detection is not limited to such techniques, and Western blotting, dot blotting, FACS analyses, and the like also may be used in connection with the present invention.

In general, immunobinding methods include obtaining a sample suspected of containing a protein, peptide or antibody, and contacting the sample with an antibody or protein or peptide in accordance with the present invention, as the case may be, under conditions effective to allow the formation of immunocomplexes.

The immunobinding methods of this invention include methods for detecting or quantifying the amount of a reactive component in a sample, which methods require the detection or quantitation of any immune complexes formed during the binding process. Here, one would obtain a sample suspected of containing a ZFQR or related cancer marker protein, peptide or a coπesponding antibody, and contact the sample with an antibody or encoded protein or peptide, as the case may be, and then detect or quantify the amount of immune complexes formed under the specific conditions. In terms of antigen detection, the biological sample analyzed may be any sample that is suspected of containing a cancer-specific antigen, such as a melanoma, glioblastoma, astrocytoma and carcinoma of the breast, gastric, colon, pancreas, renal, ovarian, lung, prostate, hepatic, lung, lymph node or bone maπow tissue section or specimen, a homogenized tissue extract, an isolated cell, a cell membrane preparation, separated or purified forms of any of the above protein- containing compositions, or even any biological fluid that comes into contact with cancer tissues, including blood, lymphatic fluid, seminal fluid and urine.

Contacting the chosen biological sample with the protein, peptide or antibody under conditions effective and for a period of time sufficient to allow the formation of immune complexes (primary immune complexes) is generally a matter of simply adding the composition to the sample and incubating the mixture for a period of time long enough for the antibodies to form immune complexes with, i.e., to bind to, any antigens present, such as ZFQR. After this time, the sample-antibody composition, such as a tissue section, ELISA plate, dot blot or

Western blot, will generally be washed to remove any non-specifically bound antibody species, allowing only those antibodies specifically bound within the primary immune complexes to be detected.

In general, the detection of immunocomplex formation is well known in the art and may be achieved through the application of numerous approaches.

These methods are generally based upon the detection of a label or marker, such as any radioactive, fluorescent, biological or enzymatic tags or labels of standard use in the art. U.S. Patents concerning the use of such labels include 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275,149 and 4,366,241, each incoφorated herein by reference. Of course, one may find additional advantages through the use of a secondary binding ligand such as a second antibody or a biotin/avidin ligand binding aπangement, as is known in the art.

The encoded protein, peptide or coπesponding antibody employed in the detection may itself be linked to a detectable label, wherein one would then simply detect this label, thereby allowing the amount of the primary immune complexes in the composition to be determined. Alternatively, the first added component that becomes bound within the primary immune complexes may be detected by means of a second binding ligand that has binding affinity for the encoded protein, peptide or corresponding antibody. In these cases, the second binding ligand may be linked to a detectable label. The second binding ligand is itself often an antibody, which may thus be termed a "secondary" antibody. The primary immune complexes are contacted with the labeled, secondary binding ligand, or antibody, under conditions effective and for a period of time sufficient to allow the formation of secondary immune complexes. The secondary immune complexes are then generally washed to remove any non-specifically bound labeled secondary antibodies or ligands, and the remaining label in the secondary immune complexes is then detected.

Further methods include the detection of primary immune complexes by a two step approach. A second binding ligand, such as an antibody, that has binding affinity for the encoded protein, peptide or coπesponding antibody is used to form secondary immune complexes, as described above. After washing, the secondary immune complexes are contacted with a third binding ligand or antibody that has binding affinity for the second antibody, again under conditions effective and for a period of time sufficient to allow the formation of immune complexes (tertiary immune complexes). The third ligand or antibody is linked to a detectable label, allowing detection of the tertiary immune complexes thus formed. This system may provide for signal amplification if this is desired.

The immunodetection methods of the present invention have evident utility in the diagnosis of cancer. Here, a biological or clinical sample suspected of containing either the encoded protein or peptide or coπesponding antibody is used. However, these embodiments also have applications to non-clinical samples, such as in the titering of antigen or antibody samples, in the selection of hybridomas, and the like.

B. ELISAs As noted, it is contemplated that the proteins or peptides of the invention, such as ZFQR, will find utility in ELISAs. In one exemplary ELISA, antibodies binding to the encoded proteins of the invention are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate. Then, a test composition suspected of containing the disease marker antigen, e.g., ZFQR, such as a clinical sample, is added to the wells. After binding and washing to remove non- specifically bound immunocomplexes, the bound antigen may be detected.

Detection is generally achieved by the addition of a second antibody specific for the target protein that is linked to a detectable label. This type of ELISA is a simple "sandwich ELISA". Detection also may be achieved by the addition of a second antibody, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label.

In another exemplary ELISA, the samples suspected of containing the disease marker antigen, such as ZFQR, are immobilized onto the well surface and then contacted with the antibodies of the invention. After binding and washing to remove non-specifically bound immunecomplexes, the bound antibody is detected. Where the initial antibodies are linked to a detectable label, the immunecomplexes may be detected directly. Again, the immunecomplexes may be detected using a second antibody that has binding affinity for the first antibody, with the second antibody being linked to a detectable label.

Another ELISA in which the proteins or peptides, such as ZFQR, are immobilized, involves the use of antibody competition in the detection. In this ELISA, labeled antibodies are added to the wells, allowed to bind to the ZFQR or related marker protein, and detected by means of their label. The amount of marker antigen in an unknown sample is then determined by mixing the sample with the labeled antibodies before or during incubation with coated wells. The presence of marker antigen in the sample acts to reduce the amount of antibody available for binding to the well and thus reduces the ultimate signal. This is appropriate for detecting antibodies in an unknown sample, where the unlabeled antibodies bind to the antigen-coated wells and also reduces the amount of antigen available to bind the labeled antibodies. Irrespective of the format employed, ELISAs have certain features in common, such as coating, incubating or binding, washing to remove non- specifically bound species, and detecting the bound immunecomplexes. These are described as follows: In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period of hours. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder. The coating allows for blocking of nonspecific adsoφtion sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. In ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of a protein or antibody to the well, coating with a non-reactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the control human cancer and/or clinical or biological sample to be tested under conditions effective to allow immunecomplex (antigen/antibody) formation.

Detection of the immunecomplex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand.

"Under conditions effective to allow immunecomplex (antigen/antibody) formation" means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background.

The "suitable" conditions also mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours, at temperatures preferably on the order of 25° to 27°C, or may be overnight at about 4°C or so.

Following all incubation steps in an ELISA, the contacted surface is washed so as to remove non-complexed material. A preferred washing procedure includes washing with a solution such as PBS/Tween, or borate buffer. Following the formation of specific immunecomplexes between the test sample and the originally bound material, and subsequent washing, the occuπence of even minute amounts of immunecomplexes may be determined.

To provide a detecting means, the second or third antibody will have an associated label to allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, one will desire to contact and incubate the first or second immunecomplex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immunecomplex formation (e.g., incubation for 2 hours at room temperature in a PBS -containing solution such as PBS-Tween).

After incubation with the labeled antibody, and subsequent to washing to remove unbound material, the amount of label is quantified, e.g. , by incubation with a chromogenic substrate such as urea and bromocresol puφle or 2,2'-azido- di-(3-ethyl-benzthiazoline-6-sulfonic acid [ABTS] and H₂O₂, in the case of peroxidase as the enzyme label. Quantitation is then achieved by measuring the degree of color generation, e.g., using a visible spectra spectrophotometer.

C. Immunohistochemistry

The antibodies of the present invention, such as anti-ZFQR antibodies, also may be used in conjunction with both fresh-frozen and formalin-fixed, paraffin-embedded tissue blocks prepared from study by immunohistochemistry (IHC). For example, each tissue block consists of 50 mg of residual "pulverized" tumor. The method of preparing tissue blocks from these particulate specimens has been successfully used in previous IHC studies of various prognostic factors, e.g., in breast, and is well known to those of skill in the art (Brown et al, 1990;

Abbondanzo et al, 1990; Allred et al, 1990).

Briefly, frozen-sections may be prepared by rehydrating 50 ng of frozen

"pulverized" tumor at room temperature in phosphate buffered saline (PBS) in small plastic capsules; pelleting the particles by centrifugation; resuspending them in a viscous embedding medium (OCT); inverting the capsule and pelleting again by centrifugation; snap-freezing in -70°C isopentane; cutting the plastic capsule and removing the frozen cylinder of tissue; securing the tissue cylinder on a cryostat microtome chuck; and cutting 25-50 serial sections containing an average of about 500 remarkably intact tumor cells.

Permanent-sections may be prepared by a similar method involving rehydration of the 50 mg sample in a plastic micro fuge tube; pelleting; resuspending in 10% formalin for 4 hours fixation; washing/pelleting; resuspending in warm 2.5%o agar; pelleting; cooling in ice water to harden the agar; removing the tissue/agar block from the tube; infiltrating and embedding the block in paraffin; and cutting up to 50 serial permanent sections.

D. FACS Analyses

Fluorescent activated cell sorting, flow cytometry or flow microfluorometry provides the means of scanning individual cells for the presence of an antigen, such as ZFQR. The method employs instrumentation that is capable of activating, and detecting the excitation emissions of labeled cells in a liquid medium.

FACS is unique in its ability to provide a rapid, reliable, quantitative, and multiparameter analysis on either living or fixed cells. The cancer antibodies of the present invention provide a useful tool for the analysis and quantitation of antigenic cancer markers of individual cells.

Cells would generally be obtained by biopsy or culture. FACS analyses would probably be most useful when desiring to analyze a number of cancer antigens at a given time, e.g., to follow an antigen profile during disease progression. E. In vivo Imaging

The invention also provides in vivo methods of imaging cancer using antibody conjugates. The term "in vivo imaging" refers to any non-invasive method that permits the detection of a labeled antibody, or fragment thereof, that specifically binds to cancer cells located in the body of an animal or human subject .

The imaging methods generally involve administering to an animal or subject an imaging-effective amount of a detectably-labeled specific antibody or fragment thereof (in a pharmaceutically effective caπier), such as a ZFQR antibody, and then detecting the binding of the labeled antibody to the tissue. The detectable label is preferably a spin-labeled molecule or a radioactive isotope that is detectable by non-invasive methods.

An "imaging effective amount" is an amount of a detectably-labeled antibody, or fragment thereof, that when administered is sufficient to enable later detection of binding of the antibody or fragment to cancer tissue. The effective amount of the antibody-marker conjugate is allowed sufficient time to come into contact with reactive antigens that be present within the tissues of the patient, and the patient is then exposed to a detection device to identify the detectable marker.

Antibody conjugates or constructs for imaging thus have the ability to provide an image of the tumor, for example, through magnetic resonance imaging, x-ray imaging, computerized emission tomography and the like. Elements particularly useful in Magnetic Resonance Imaging ("MRI") include the nuclear magnetic spin-resonance isotopes ¹⁵⁷Gd, ⁵⁵Mn, ¹⁶²Dy, ⁵²Cr, and ⁵⁶Fe, with gadolinium often being prefeπed. Radioactive substances, such as technicium⁹⁹™ or indium¹¹¹, that may be detected using a gamma scintillation camera or detector, also may be used. Further examples of metallic ions suitable for use in this inven ₊tio„n a „„re_<_, ¹²³T 1, 131τ 1, 131τ 1, °⁷T R>„u, ⁶1 Cu_ _, 6 G>„a, 12₅1τ, 68^ Ga„, 72 A_Λ „s, 89 Z,r, a„nd, 201^ T,I. A factor to consider in selecting a radionuchde for in vivo diagnosis is that the half-life of a nuclide be long enough so that it is still detectable at the time of maximum uptake by the target, but short enough so that deleterious radiation upon the host, as well as background, is minimized. Ideally, a radionuchde used for in vivo imaging will lack a particulate emission, but produce a large number of photons in a 140-2000 keV range, which may be readily detected by conventional gamma cameras. A radionuchde may be bound to an antibody either directly or indirectly by using an intermediary functional group. Intermediary functional groups which are often used to bind radioisotopes which exist as metallic ions to antibody are diethylenetriaminepentaacetic acid (DTP A) and ethylene diaminetetracetic acid (EDTA). Administration of the labeled antibody may be local or systemic and accomplished intravenously, intra-arterially, via the spinal fluid or the like. Administration also may be intradermal or intracavitary, depending upon the body site under examination. After a sufficient time has lapsed for the labeled antibody or fragment to bind to the diseased tissue, in this case cancer tissue, for example 30 minutes to 48 hours, the area of the subject under investigation is then examined by the imaging technique. MRI, SPECT, planar scintillation imaging and other emerging imaging techniques may all be used.

The distribution of the bound radioactive isotope and its increase or decrease with time is monitored and recorded. By comparing the results with data obtained from studies of clinically normal individuals, the presence and extent of the diseased tissue can be determined.

The exact imaging protocol will necessarily vary depending upon factors specific to the patient, and depending upon the body site under examination, method of administration, type of label used and the like. The determination of specific procedures is, however, routine to the skilled artisan. Although dosages for imaging embodiments are dependent upon the age and weight of patient, a one time dose of about 0.1 to about 20 mg, more preferably, about 1.0 to about 2.0 mg of antibody-conjugate per patient is contemplated to be useful. F. Immunodetection Kits

In further embodiments, the invention provides immunological kits for use in detecting cancer cells, e.g., in biological samples. Such kits will generally comprise one or more antibodies that have immunospecificity for proteins or peptides, such as ZFQR, encoded by the nucleic acid markers of cancer identified in the present invention.

As the ZFQR and related marker proteins or peptides may be employed to detect antibodies and the anti-marker antibodies may be employed to detect proteins or peptides, either or both of such components may be provided in the kit. The immunodetection kits will thus comprise, in suitable container means, a

ZFQR or related marker protein or peptide, or a first antibody that binds to such a marker protein or peptide, and an immunodetection reagent.

Kits comprising antibodies, such as anti-ZFQR antibodies, will be prefeπed in many cases. In more prefeπed embodiments, it is contemplated that the antibodies will be those that bind to the ZFQR epitopes. Monoclonal antibodies are readily prepared and will often be preferred. Where marker proteins or peptides are provided, it is generally prefeπed that they be highly purified.

In certain embodiments, the protein or peptide, or the first antibody that binds to the marker protein or peptide, such as an anti-ZFQR antibody, may be bound to a solid support, such as a column matrix or well of a microtitre plate.

The immunodetection reagents of the kit may take any one of a variety of forms, including those detectable labels that are associated with, or linked to, the given antibody or antigen itself. Detectable labels that are associated with or attached to a secondary binding ligand are also contemplated. Exemplary secondary ligands are those secondary antibodies that have binding affinity for the first antibody or antigen.

Further suitable immunodetection reagents for use in the present kits include the two-component reagent that comprises a secondary antibody that has binding affinity for the first antibody or antigen (generally anti-ZFQR), along with a third antibody that has binding affinity for the second antibody, wherein the third antibody is linked to a detectable label.

As noted above in the discussion of antibody conjugates, a number of exemplary labels are known in the art and all such labels may be employed in connection with the present invention. Radiolabels, nuclear magnetic spin-resonance isotopes, fluorescent labels and enzyme tags capable of generating a colored product upon contact with an appropriate substrate are suitable examples.

The kits may contain antibody-label conjugates either in fully conjugated form, in the form of intermediates, or as separate moieties to be conjugated by the user of the kit.

The kits may further comprise a suitably aliquoted composition of the cancer protein or antigen, such as ZFQR, whether labeled or unlabeled, as may be used to prepare a standard curve for a detection assay. The kits of the invention, regardless of type, will generally comprise one or more containers into which the biological agents are placed and, preferably, suitable aliquoted. The components of the kits may be packaged either in aqueous media or in lyophilized form.

The immunodetection kits of the invention, although containing at least one novel marker antibody or antigen, as may be based on ZFQR, also may contain one or more of a variety of other cancer marker antibodies or antigens, if so desired. Such kits could thus provide a panel of cancer markers, as may be better used in testing a variety of patients. By way of example, such additional markers could include, tumor markers such as PSA, p97, SeLex, g HCG, as well as p53, cyclin pl, pl 6, tyrosinase, MAGE, BAGE, PAGE, MUC18, βHCG, p21 or plό.

The container means of the kits will generally include at least one vial, test tube, flask, bottle, or even syringe or other container means, into which the antibody or antigen may be placed, and preferably, suitably aliquoted. Where a second or third binding ligand or additional component is provided, the kit will also generally contain a second, third or other additional container into which this ligand or component may be placed.

The kits of the present invention will also typically include a means for containing the antibody, antigen, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow- molded plastic containers into which the desired vials are retained.

G. ELISA

As a part of the practice of the present invention, the principles of an enzyme-linked immunoassay (ELISA) may be used. ELISA was first introduced by Engvall and Perlmann (1971) and has become a powerful analytical tool using a variety of protocols (Engvall, 1980; Engvall, 1976; Engvall, 1977; Gripenberg et al, 1978; Makler et al, 1981; Samgadharan et al, 1984). ELISA allows for substances to be passively adsorbed to solid supports such as plastic to enable facile handling under laboratory conditions. For a comprehensive treatise on

ELISA the skilled artisan is refeπed to "ELISA; Theory and Practise" (Crowther, 1995 incoφorated herein by reference).

The sensitivity of ELISA methods is dependent on the turnover of the enzyme used and the ease of detection of the product of the enzyme reaction. Enhancement of the sensitivity of these assay systems can be achieved by the use of fluorescent and radioactive substrates for the enzymes. The inventor has recently developed a new assay methodology for clotting factors which involves coagulation, the enzyme-linked coagulation assay (ELCA). The assay involves coating microtiter plates with fibrinogen and adding enzyme labeled fibrinogen in solution. When thrombin is added the fibrinogen is converted to fibrin and the solution phase labeled fibrin binds to the solid phase unlabelled fibrin (U.S. Patent No. 4,668,621 incoφorated herein by reference). Immunoassays encompassed by the present invention include, but are not limited to those described in U.S. Patent No. 4,367,110 (double monoclonal antibody sandwich assay) and U.S. Patent No. 4,452,901 (western blot). Other assays include immunoprecipitation of labeled ligands and immunocytochemistry, both in vitro and in vivo.

As used herein the term "sandwich ELISA" refers to an assay in which antibodies specific for the antigen of choice are immobilized onto a selected surface exhibiting protein affinity, such as a well in a polystyrene microtiter plate.

A non-specific protein, such as BSA is often added to block the remainder of the well. Then, a test composition suspected of containing the desired antigen, such as a clinical sample, is added to the wells. After binding and then washing to remove unbound proteins, the bound antigen may be detected. Detection is generally achieved by the addition of another antibody, specific for the desired antigen, that is linked to a detectable label. Detection may also be achieved by the addition of a second antibody specific for the desired antigen, followed by the addition of a third antibody that has binding affinity for the second antibody, with the third antibody being linked to a detectable label. In the current invention, the prefeπed form of 'sandwich ELISA' is the formation of a complex with hapten- and detector-labeled antibodies and binding of the same onto a solid phase consisting of anti-hapten absorbent.

The sandwich ELISA may also be practiced by immobilizing the antigen onto the well surface and then binding the antibody from serum. After binding and appropriate washing, the bound immune complexes are detected. Where the initial antigen specific antibodies are linked to a detectable label, the immune complexes may be detected directly. Again, the immune complexes may be detected using a second antibody that has binding affinity for the first antigen specific antibody, with the second antibody being linked to a detectable label. This is the form of the assay which can have very high background when performed in the presence of high concentrations of serum.

Competition ELISAs are also possible in which test samples compete for binding with known amounts of labeled antigens or antibodies. The amount of reactive species in the unknown sample is determined by mixing the sample with the known labeled species before or during incubation with coated wells. The presence of reactive species in the sample acts to reduce the amount of labeled species available for binding to the well and thus reduces the ultimate signal. Antigen or antibodies may also be linked to a solid support, such as in the form of beads, dipstick, membrane or column matrix, and the sample to be analyzed applied to the immobilized antigen or antibody. The cuπent invention is distinct from competitive ELISA because the analyte is not measured on the basis of competition of unlabeled and labeled antigen for a limited number of binding sites. The displacement of the intact complex using hapten elution from the anti- hapten absorbent is competitive displacement, however.

In coating a plate with either antigen or antibody, one will generally incubate the wells of the plate with a solution of the antigen or antibody, either overnight or for a specified period. The wells of the plate will then be washed to remove incompletely adsorbed material. Any remaining available surfaces of the wells are then "coated" with a nonspecific protein that is antigenically neutral with regard to the test antisera. These include bovine serum albumin (BSA), casein and solutions of milk powder. The coating allows for blocking of nonspecific adsoφtion sites on the immobilizing surface and thus reduces the background caused by nonspecific binding of antisera onto the surface. This approach is very useful, but does not completely prevent non-specific binding of analytes. This non-specific binding is increasingly noticeable when high concentrations of detector-labeled antibodies are used or when highly sensitive assays are employed.

In standard ELISAs, it is probably more customary to use a secondary or tertiary detection means rather than a direct procedure. Thus, after binding of the antigen or antibody to the well, coating with a nonreactive material to reduce background, and washing to remove unbound material, the immobilizing surface is contacted with the clinical or biological sample to be tested under conditions effective to allow immune complex (antigen/antibody) formation. Detection of the immune complex then requires a labeled secondary binding ligand or antibody, or a secondary binding ligand or antibody in conjunction with a labeled tertiary antibody or third binding ligand. It is not the custom in standard ELISA protocols to specifically elute bound complexes for subsequent analysis, as in the cuπent invention, and in fact the inventor is not aware of any previous case of application of this principle.

"Under conditions effective to allow immune complex (antigen antibody) formation" means that the conditions preferably include diluting the antigens and antibodies with solutions such as BSA, bovine gamma globulin (BGG) and phosphate buffered saline (PBS)/Tween. These added agents also tend to assist in the reduction of nonspecific background. The suitable conditions also may mean that the incubation is at a temperature and for a period of time sufficient to allow effective binding. Incubation steps are typically from about 1 to 2 to 4 hours, at temperatures preferably on the order of 25° to 37°C, or may be overnight at about

4°C or so. It is important to recognize that, in the application of the current invention, it is essential to choose conditions for binding and assay which do not disrupt or destroy the complex analyte that one wishes to subsequently separate and further analyze. Following all incubation steps in an ELISA, the contacted surface is washed so as to remove noncomplexed material. Washing often includes washing with a solution of PBS/Tween, or borate buffer. Following the formation of specific immune complexes between the test sample and the originally bound material, and subsequent washing, the occuπence of immune complexes labeled with detector may be determined.

To provide a detecting means, the second or third antibody will have an associated label to allow detection. Preferably, this will be an enzyme that will generate color development upon incubating with an appropriate chromogenic substrate. Thus, for example, typical practice is to contact and incubate the first or second immune complex with a urease, glucose oxidase, alkaline phosphatase or hydrogen peroxidase-conjugated antibody for a period of time and under conditions that favor the development of further immune complex formation, e.g., incubation for 2 hours at room temperature in a PBS -containing solution such as PBSTween. It is to be recognized that these enzymes are typically measured by using pH change (urease), oxidative reactions (glucose oxidase, peroxidase), or measurement at elevated pH (alkaline phosphatase). All of these detection methods are therefore likely to destroy the intact complex that one would wish to subsequently isolate.

It is therefore a requirement of the cuπent invention that, when one desires to separate and analyze further a complex analyte, it is necessary to employ a detection method which is non-destructive of the complex formed. In the inventor's laboratory, the method devised for sensitive measurement of analytes is the Enzyme-linked coagulation assay, or ELCA (U.S. Patent No. 4,668,621), which uses the coagulation cascade combined with the labeling enzyme RVV-XA as a universal detection system. The advantage of this system for the current invention, is that the coagulation reactions can be performed at physiological pH in the presence of a wide variety of buffers. It is therefore possible to retain the integrity of complex analytes. The present invention does not depend exclusively on the use of the ELCA method; alternative reactions for detection of bound analyte can be performed under gentle conditions using other detector molecules. Examples applicable in selected cases include chemiluminescent labels, described in U.S. Patent Nos. 5,310,687, 5,238,808 and 5,221,605.

X. Lipid Compositions

In certain embodiments, the present invention concerns a novel composition comprising one or more lipids associated with at least one ZFQR. A lipid is a substance that is characteristically insoluble in water and extractable with an organic solvent. Lipids include, for example, the substances comprising the fatty droplets that naturally occur in the cytoplasm as well as the class of compounds which are well known to those of skill in the art which contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, amino alcohols, and aldehydes. Of course, compounds other than those specifically described herein that are understood by one of skill in the art as lipids are also encompassed by the compositions and methods of the present invention.

I l l A lipid may be naturally occuπing or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, teφenes, lysolipids, glycosphingolipids, glucolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof.

A. Lipid Types

A neutral fat may comprise a glycerol and a fatty acid. A typical glycerol is a three-carbon alcohol. A fatty acid generally is a molecule comprising a carbon chain with an acidic moeity (e.g., carboxylic acid) at an end of the chain.

The carbon chain may of a fatty acid may be of any length, however, it is prefeπed that the length of the carbon chain be of from about 2, about 5, about 10, about 15, about 20, about 25, to about 30 or more carbon atoms, and any range derivable therein. However, a prefeπed range is from about 14 to about 24 carbon atoms in the chain portion of the fatty acid, with about 16 to about 18 carbon atoms being particularly prefeπed in certain embodiments. In certain embodiments the fatty acid carbon chain may comprise an odd number of carbon atoms, however, an even number of carbon atoms in the chain may be prefeπed in certain embodiments. A fatty acid comprising only single bonds in its carbon chain is called saturated, while a fatty acid comprising at least one double bond in its chain is called unsaturated.

Specific fatty acids include, but are not limited to, linoleic acid, oleic acid, palmitic acid, linolenic acid, stearic acid, lauric acid, myristic acid, arachidic acid, palmitoleic acid, arachidonic acid ricinoleic acid, tuberculosteric acid, lactobacillic acid. An acidic group of one or more fatty acids is covalently bonded to one or more hydroxyl groups of a glycerol. Thus, a monoglyceride comprises a glycerol and one fatty acid, a diglyceride comprises a glycerol and two fatty acids, and a triglyceride comprises a glycerol and three fatty acids. A phospholipid generally comprises either glycerol or a sphingosine moiety, an ionic phosphate group to produce an amphipathic compound, and one or more fatty acids. Types of phospholipids include, for example, phophoglycerides, wherein a phosphate group is linked to the first carbon of glycerol of a diglyceride, and sphingophospholipids (e.g., sphingomyelin), wherein a phosphate group is esterified to a sphingosine amino alcohol. Another example of a sphingophospholipid is a sulfatide, which comprises an ionic sulfate group that makes the molecule amphipathic. A phopholipid may, of course, comprise further chemical groups, such as for example, an alcohol attached to the phosphate group. Examples of such alcohol groups include serine, ethanolamine, choline, glycerol and inositol. Thus, specific phosphoglycerides include a phosphatidyl serine, a phosphatidyl ethanolamine, a phosphatidyl choline, a phosphatidyl glycerol or a phosphotidyl inositol. Other phospholipids include a phosphatidic acid or a diacetyl phosphate. In one aspect, a phosphatidylcholine comprises a dioleoylphosphatidylcholine (a.k.a. cardiolipin), an egg phosphatidylcholine, a dipalmitoyl phosphalidycholine, a monomyristoyl phosphatidylcholine, a monopalmitoyl phosphatidylcholine, a monostearoyl phosphatidylcholine, a monooleoyl phosphatidylcholine, a dibutroyl phosphatidylcholine, a divaleroyl phosphatidylcholine, a dicaproyl phosphatidylcholine, a diheptanoyl phosphatidylcholine, a dicapryloyl phosphatidylcholine or a distearoyl phosphatidylcholine.

A glycolipid is related to a sphinogophospholipid, but comprises a carbohydrate group rather than a phosphate group attached to a primary hydroxyl group of the sphingosine. A type of glycolipid called a cerebroside comprises one sugar group (e.g., a glucose or galactose) attached to the primary hydroxyl group.

Another example of a glycolipid is a ganglioside (e.g., a monosialoganglioside, a GM1), which comprises about 2, about 3, about 4, about 5, about 6, to about 7 or so sugar groups, that may be in a branched chain, attached to the primary hydroxyl group. In other embodiments, the glycolipid is a ceramide (e.g., lactosylceramide). A steroid is a four-membered ring system derivative of a phenanthrene. Steroids often possess regulatory functions in cells, tissues and organisms, and include, for example, hormones and related compounds in the progestagen (e.g., progesterone), glucocoricoid (e.g., cortisol), mineralocorticoid (e.g., aldosterone), androgen (e.g., testosterone) and estrogen (e.g., estrone) families. Cholesterol is another example of a steroid, and generally serves structural rather than regulatory functions. Vitamin D is another example of a sterol, and is involved in calcium absoφtion from the intestine.

A teφene is a lipid comprising one or more five carbon isoprene groups. Teφenes have various biological functions, and include, for example, vitamin A, coenyzme Q and carotenoids (e.g., lycopene and β-carotene).

B. Charged and Neutral Lipid Compositions

In certain embodiments, a lipid component of a composition is uncharged or primarily uncharged. In one embodiment, a lipid component of a composition comprises one or more neutral lipids. In another aspect, a lipid component of a composition may be substantially free of anionic and cationic lipids, such as certain phospholipids (e.g., phosphatidyl choline) and cholesterol. In certain aspects, a lipid component of an uncharged or primarily uncharged lipid composition comprises about 95%>, about 96%, about 97%>, about 98%, about 99%> or 100%) lipids without a charge, substantially uncharged lipid(s), and/or a lipid mixture with equal numbers of positive and negative charges.

In other aspects, a lipid composition may be charged. For example, charged phospholipids may be used for preparing a lipid composition according to the present invention and can carry a net positive charge or a net negative charge.

In a non-limiting example, diacetyl phosphate can be employed to confer a negative charge on the lipid composition, and stearylamine can be used to confer a positive charge on the lipid composition. C. Making Lipids

Lipids can be obtained from natural sources, commercial sources or chemically synthesized, as would be known to one of ordinary skill in the art. For example, phospholipids can be from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine. In another example, lipids suitable for use according to the present invention can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma Chemical Co., dicetyl phosphate ("DCP") is obtained from K & K Laboratories (Plainview, NY); cholesterol ("Choi") is obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, Ala.). In certain embodiments, stock solutions of lipids in chloroform or chloroform/methanol can be stored at about -20°C. Preferably, chloroform is used as the only solvent since it is more readily evaporated than methanol.

D. Lipid Composition Structures

In a prefeπed embodiment of the invention, the ZFQR may be associated with a lipid. A ZFQR associated with a lipid may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure. A lipid or lipid/ZFQR associated composition of the present invention is not limited to any particular structure. For example, they may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape. In another example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. In another non-limiting example, a lipofectamine (Gibco BRL)-ZFQR or Superfect (Qiagen)-ZFQR complex is also contemplated. In certain embodiments, a lipid composition may comprise about 1%_>, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96%, about 97%>, about 98%o, about 99%, about 100%, or any range derivable therein, of a particular lipid, lipid type or non-lipid component such as a drug, protein, sugar, nucleic acids or other material disclosed herein or as would be known to one of skill in the art. In a non-limiting example, a lipid composition may comprise about 10% to about 20% neutral lipids, and about 33% to about 34% of a cerebroside, and about 1% cholesterol. In another non-limiting example, a liposome may comprise about 4% to about 12% teφenes, wherein about 1% of the micelle is specifically lycopene, leaving about 3% to about 11%> of the liposome as comprising other teφenes; and about 10%>to about 35% phosphatidyl choline, and about 1% of a drug. Thus, it is contemplated that lipid compositions of the present invention may comprise any of the lipids, lipid types or other components in any combination or percentage range.

1. Emulsions

A lipid may be comprised in an emulsion. A lipid emulsion is a substantially permanent heterogenous liquid mixture of two or more liquids that do not normally dissolve in each other, by mechanical agitation or by small amounts of additional substances known as emulsifiers. Methods for preparing lipid emulsions and adding additional components are well known in the art (e.g.,

Modern Pharmaceutics, 1990, incoφorated herein by reference). For example, one or more lipids are added to ethanol or chloroform or any other suitable organic solvent and agitated by hand or mechanical techniques.

The solvent is then evaporated from the mixture leaving a dried glaze of lipid.

The lipids are resuspended in aqueous media, such as phosphate buffered saline, resulting in an emulsion. To achieve a more homogeneous size distribution of the emulsified lipids, the mixture may be sonicated using conventional sonication techniques, further emulsified using microfluidization (using, for example, a Microfluidizer, Newton, Mass.), and/or extruded under high pressure (such as, for example, 600 psi) using an Extruder Device (Lipex Biomembranes, Vancouver, Canada). 2. Micelles

A lipid may be comprised in a micelle. A micelle is a cluster or aggregate of lipid compounds, generally in the form of a lipid monolayer, and may be prepared using any micelle producing protocol known to those of skill in the art (e.g., Canfield et al, 1990; El-Gorab et al, 1973; Colloidal Surfactant, 1963; and Catalysis in Micellar and Macromolecular Systems, 1975, each incoφorated herein by reference). For example, one or more lipids are typically made into a suspension in an organic solvent, the solvent is evaporated, the lipid is resuspended in an aqueous medium, sonicated and then centrifuged.

E. Liposomes In particular embodiments, a lipid comprises a liposome. A "liposome" is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes may be characterized as having vesicular structures with a bilayer membrane, generally comprising a phospholipid, and an inner medium that generally comprises an aqueous composition.

A multilamellar liposome has multiple lipid layers separated by aqueous medium. They form spontaneously when lipids comprising phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991).

Lipophilic molecules or molecules with lipophilic regions may also dissolve in or associate with the lipid bilayer.

In certain less preferred embodiments, phospholipids from natural sources, such as egg or soybean phosphatidylcholine, brain phosphatidic acid, brain or plant phosphatidylinositol, heart cardiolipin and plant or bacterial phosphatidylethanolamine are preferably not used as the primary phosphatide, i.e., constituting 50%> or more of the total phosphatide composition or a liposome, because of the instability and leakiness of the resulting liposomes.

In particular embodiments, a lipid and/or ZFQR may be, for example, encapsulated in the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that is associated with both the liposome and the ZFQR, entrapped in a liposome, complexed with a liposome, etc.

1. Making Liposomes

A liposome used according to the present invention can be made by different methods, as would be known to one of ordinary skill in the art. Phospholipids can form a variety of structures other than liposomes when dispersed in water, depending on the molar ratio of lipid to water. At low ratios the liposome is the prefeπed structure.

For example, a phospholipid (Avanti Polar Lipids, Alabaster, AL), such as for example the neutral phospholipid dioleoylphosphatidylcholine (DOPC), is dissolved in tert-butanol. The lipid(s) is then mixed with the ZFQR, and/or other component(s). Tween 20 is added to the lipid mixture such that Tween 20 is about 5% of the composition's weight. Excess tert-butanol is added to this mixture such that the volume of tert-butanol is at least 95%. The mixture is vortexed, frozen in a dry ice/acetone bath and lyophilized overnight. The lyophilized preparation is stored at -20°C and can be used up to three months. When required the lyophilized liposomes are reconstituted in 0.9%> saline. The average diameter of the particles obtained using Tween 20 for encapsulating the

ZFQR is about 0.7 to about 1.0 μm in diameter.

Alternatively, a liposome can be prepared by mixing lipids in a solvent in a container, e.g., a glass, pear-shaped flask. The container should have a volume ten-times greater than the volume of the expected suspension of liposomes. Using a rotary evaporator, the solvent is removed at approximately 40°C under negative pressure. The solvent normally is removed within about 5 min. to 2 hours, depending on the desired volume of the liposomes. The composition can be dried further in a desiccator under vacuum. The dried lipids generally are discarded after about 1 week because of a tendency to deteriorate with time.

Dried lipids can be hydrated at approximately 25-50 mM phospholipid in sterile, pyrogen-free water by shaking until all the lipid film is resuspended. The aqueous liposomes can be then separated into aliquots, each placed in a vial, lyophilized and sealed under vacuum.

In other alternative methods, liposomes can be prepared in accordance with other known laboratory procedures (e.g., see Bangham et al, 1965; Gregoriadis, 1979; Deamer and Uster 1983, Szoka and Papahadjopoulos, 1978, each incoφorated herein by reference in relevant part). These methods differ in their respective abilities to entrap aqueous material and their respective aqueous space-to-lipid ratios.

The dried lipids or lyophilized liposomes prepared as described above may be dehydrated and reconstituted in a solution of inhibitory peptide and diluted to an appropriate concentration with an suitable solvent, e.g., DPBS. The mixture is then vigorously shaken in a vortex mixer. Unencapsulated additional materials, such as agents including but not limited to hormones, drugs, nucleic acid constructs and the like, are removed by centrifugation at 29,000 x g and the liposomal pellets washed. The washed liposomes are resuspended at an appropriate total phospholipid concentration, e.g., about 50-200 mM. The amount of additional material or active agent encapsulated can be determined in accordance with standard methods. After determination of the amount of additional material or active agent encapsulated in the liposome preparation, the liposomes may be diluted to appropriate concentrations and stored at 4°C until use. A pharmaceutical composition comprising the liposomes will usually include a sterile, pharmaceutically acceptable carrier or diluent, such as water or saline solution.

The size of a liposome varies depending on the method of synthesis. Liposomes in the present invention can be a variety of sizes. In certain embodiements, the liposomes are small, e.g., less than about 100 nm, about 90 nm, about 80 nm, about 70 nm, about 60 nm, or less than about 50 nm in external diameter. In preparing such liposomes, any protocol described herein, or as would be known to one of ordinary skill in the art may be used. Additional non- limiting examples of preparing liposomes are described in U.S. Patent Nos. 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505, and 4,921,706;

International Applications PCT/US85/01161 and PCT/US89/05040; U.K. Patent Application GB 2193095 A; Mayer et al, 1986; Hope et al, 1985; Mayhew et al. 1987; Mayhew et al, 1984; Cheng et al, 1987; and Liposome Technology, 1984, each incoφorated herein by reference). A liposome suspended in an aqueous solution is generally in the shape of a spherical vesicle, having one or more concentric layers of lipid bilayer molecules. Each layer consists of a parallel array of molecules represented by the formula XY, wherein X is a hydrophilic moiety and Y is a hydrophobic moiety. In aqueous suspension, the concentric layers are aπanged such that the hydrophilic moieties tend to remain in contact with an aqueous phase and the hydrophobic regions tend to self-associate. For example, when aqueous phases are present both within and without the liposome, the lipid molecules may form a bilayer, known as a lamella, of the arrangement XY-YX. Aggregates of lipids may form when the hydrophilic and hydrophobic parts of more than one lipid molecule become associated with each other. The size and shape of these aggregates will depend upon many different variables, such as the nature of the solvent and the presence of other compounds in the solution.

The production of lipid formulations often is accomplished by sonication or serial extrusion of liposomal mixtures after (I) reverse phase evaporation (II) dehydration-rehydration (III) detergent dialysis and (IV) thin film hydration. In one aspect, a contemplated method for preparing liposomes in certain embodiments is heating sonicating, and sequential extrusion of the lipids through filters or membranes of decreasing pore size, thereby resulting in the formation of small, stable liposome structures. This preparation produces liposomal ZFQR or liposomes only of appropriate and uniform size, which are structurally stable and produce maximal activity. Such techniques are well-known to those of skill in the art (see, for example Martin, 1990).

Once manufactured, lipid structures can be used to encapsulate compounds that are toxic (e.g., chemotherapeutics) or labile (e.g., nucleic acids) when in circulation. The physical characteristics of liposomes depend on pH, ionic strength and/or the presence of divalent cations. Liposomes can show low permeability to ionic and/or polar substances, but at elevated temperatures undergo a phase transition which markedly alters their permeability. The phase transition involves a change from a closely packed, ordered structure, known as the gel state, to a loosely packed, less-ordered structure, known as the fluid state.

This occurs at a characteristic phase-transition temperature and/or results in an increase in permeability to ions, sugars and/or drugs. Liposomal encapsulation has resulted in a lower toxicity and a longer serum half-life for such compounds (Gabizon et al, 1990). Liposomes interact with cells to deliver agents via four different mechanisms: Endocytosis by phagocytic cells of the reticuloendothelial system such as macrophages and/or neutrophils; adsoφtion to the cell surface, either by nonspecific weak hydrophobic and/or electrostatic forces, and/or by specific interactions with cell-surface components; fusion with the plasma cell membrane by insertion of the lipid bilayer of the liposome into the plasma membrane, with simultaneous release of liposomal contents into the cytoplasm; and/or by transfer of liposomal lipids to cellular and/or subcellular membranes, and/or vice versa, without any association of the liposome contents. Varying the liposome formulation can alter which mechanism is operative, although more than one may operate at the same time.

Numerous disease treatments are using lipid based gene transfer strategies to enhance conventional or establish novel therapies, in particular therapies for treating hypeφroliferative diseases. Advances in liposome formulations have improved the efficiency of gene transfer in vivo (Templeton et al, 1997) and it is contemplated that liposomes are prepared by these methods. Alternate methods of preparing lipid-based formulations for nucleic acid delivery are described (WO 99/18933).

In another liposome formulation, an amphipathic vehicle called a solvent dilution microcarrier (SDMC) enables integration of particular molecules into the bi-layer of the lipid vehicle (U.S. Patent 5,879,703). The SDMCs can be used to deliver lipopolysaccharides, polypeptides, nucleic acids and the like. Of course, any other methods of liposome preparation can be used by the skilled artisan to obtain a desired liposome formulation in the present invention.

2. Liposome Targeting

Association of the ZFQR with a liposome may improve biodistribution and other properties of the ZFQR. For example, liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been very successful (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987). The feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo, HeLa and hepatoma cells has also been demonstrated (Wong et al, 1980). Successful liposome-mediated gene transfer in rats after intravenous injection has also been accomplished (Nicolau et al, 1987).

It is contemplated that a liposome/ZFQR composition may comprise additional materials for delivery to a tissue. For example, in certain embodiments of the invention, the lipid or liposome may be associated with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al, 1989). In another example, the lipid or liposome may be complexed or employed in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al, 1991). In yet further embodiments, the lipid may be complexed or employed in conjunction with both HVJ and HMG-1.

Targeted delivery is achieved by the addition of ligands without compromising the ability of these liposomes deliver large amounts of ZFQR. It is contemplated that this will enable delivery to specific cells, tissues and organs.

The targeting specificity of the ligand-based delivery systems are based on the distribution of the ligand receptors on different cell types. The targeting ligand may either be non-covalently or covalently associated with the lipid complex, and can be conjugated to the liposomes by a variety of methods.

a. Cross-linkers

Bifunctional cross-linking reagents have been extensively used for a variety of puφoses including preparation of affinity matrices, modification and stabilization of diverse structures, identification of ligand and receptor binding sites, and structural studies. Homobifunctional reagents that carry two identical functional groups proved to be highly efficient in inducing cross-linking between identical and different macromolecules or subunits of a macromolecule, and linking of polypeptide ligands to their specific binding sites. Heterobifunctional reagents contain two different functional groups. By taking advantage of the differential reactivities of the two different functional groups, cross-linking can be controlled both selectively and sequentially. The bifunctional cross-linking reagents can be divided according to the specificity of their functional groups, e.g., amino, sulfhydryl, guanidino, indole, carboxyl specific groups. Of these, reagents directed to free amino groups have become especially popular because of their commercial availability, ease of synthesis and the mild reaction conditions under which they can be applied. A majority of heterobifunctional cross-linking reagents contains a primary amine-reactive group and a thiol-reactive group.

Exemplary methods for cross-linking ligands to liposomes are described in U.S. Patent 5,603,872 and U.S. Patent 5,401,511, each specifically incoφorated herein by reference in its entirety). Various ligands can be covalently bound to liposomal surfaces through the cross-linking of amine residues. Liposomes, in particular, multilamellar vesicles (MLV) or unilamellar vesicles such as microemulsified liposomes (MEL) and large unilamellar liposomes (LUVET), each containing phosphatidylethanolamine (PE), have been prepared by established procedures. The inclusion of PE in the liposome provides an active functional residue, a primary amine, on the liposomal surface for cross-linking puφoses. Ligands such as epidermal growth factor (EGF) have been successfully linked with PE- posomes. Ligands are bound covalently to discrete sites on the liposome surfaces The number and surface density of these sites will be dictated by the liposome formulation and the liposome type The liposomal surfaces may also have sites for non-covalent association. To form covalent conjugates of ligands and liposomes, cross-linking reagents have been studied for effectiveness and biocompatibihty Cross-linking reagents include glutaraldehyde (GAD), bifunctional oxirane (OXR), ethylene glycol diglycidyl ether (EGDE), and a water soluble carbodnmide, preferably l-ethyl-3-(3-dιmethylammopropyl) carbodπmide (EDC) Through the complex chemistry of cross-linking, linkage of the amine residues of the recognizing substance and liposomes is established

In another example, heterobifunctional cross-linking reagents and methods of usmg the cross-linking reagents are described (U S Patent 5,889,155, specifically incoφorated herein by reference in its entirety) The cross-linking reagents combine a nucleophihc hydrazide residue with an electrophihc maleimide residue, allowing coupling m one example, of aldehydes to free thiols

The cross-linking reagent can be modified to cross-link vaπous functional groups and is thus useful for cross-linking polypeptides and sugars. Table 7 details certain hetero-bifunctional cross-linkers considered useful in the present invention

In instances where a particular polypeptide does not contain a residue amenable for a given cross-linking reagent in its native sequence, conservative genetic or synthetic amino acid changes in the primary sequence can be utilized. 2. Targeting Ligands

The targeting ligand can be either anchored in the hydrophobic portion of the complex or attached to reactive terminal groups of the hydrophilic portion of the complex. The targeting ligand can be attached to the liposome via a linkage to a reactive group, e.g., on the distal end of the hydrophilic polymer. Preferred reactive groups include amino groups, carboxylic groups, hydrazide groups, and thiol groups. The coupling of the targeting ligand to the hydrophilic polymer can be performed by standard methods of organic chemistry that are known to those skilled in the art. In certain embodiments, the total concentration of the targeting ligand can be from about 0.01 to about 10% mol.

Targeting ligands are any ligand specific for a characteristic component of the targeted region. Prefeπed targeting ligands include proteins such as polyclonal or monoclonal antibodies, antibody fragments, or chimeric antibodies, enzymes, or hormones, or sugars such as mono-, oligo- and poly-saccharides (see,

Heath et al, Chem. Phys. Lipids 40:347 (1986)). For example, disialoganglioside GD2 is a tumor antigen that has been identified neuroectodermal origin tumors, such as neuroblastoma, melanoma, small-cell lung carcenoma, glioma and certain sarcomas (Mujoo et al, 1986, Schulz et al, 1984). Liposomes containing anti- disialoganglioside GD2 monoclonal antibodies have been used to aid the targeting of the liposomes to cells expressing the tumor antigen (Montaldo et al, 1999; Pagan et al, 1999). In another non-limiting example, breast and gynecological cancer antigen specific antibodies are described in U.S. Patent No. 5,939,277, incoφorated herein by reference. In a further non-limiting example, prostate cancer specific antibodies are disclosed in U.S. Patent No. 6,107,090, incoφorated herein by reference. Thus, it is contemplated that the antibodies described herein or as would be known to one of ordinary skill in the art may be used to target specific tissues and cell types in combination with the compositions and methods of the present invention. In certain embodiments of the invention, contemplated targeting ligands interact with integrins, proteoglycans, glycoproteins, receptors or transporters. Suitable ligands include any that are specific for cells of the target organ, or for structures of the target organ exposed to the circulation as a result of local pathology, such as tumors.

In certain embodiments of the present invention, in order to enhance the transduction of cells, to increase transduction of target cells, or to limit transduction of undesired cells, antibody or cyclic peptide targeting moieties

(ligands) are associated with the lipid complex. Such methods are known in the art. For example, liposomes have been described further that specifically target cells of the mammalian central nervous system (U.S. Patent No. 5,786,214, incoφorated herein by reference). The liposomes are composed essentially of N-glutarylphosphatidylethanolamine, cholesterol and oleic acid, wherein a monoclonal antibody specific for neuroglia is conjugated to the liposomes. It is contemplated that a monoclonal antibody or antibody fragment may be used to target delivery to specific cells, tissues, or organs in the animal, such as for example, brain, heart, lung, liver, etc. Still further, a ZFQR may be delivered to a target cell via receptor-mediated delivery and/or targeting vehicles comprising a lipid or liposome. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis that will be occurring in a target cell. In view of the cell type-specific distribution of various receptors, this delivery method adds another degree of specificity to the present invention.

Thus, in certain aspects of the present invention, a ligand will be chosen to coπespond to a receptor specifically expressed on the target cell population. A cell-specific ZFQR delivery and/or targeting vehicle may comprise a specific binding ligand in combination with a liposome. The ZFQR to be delivered are housed within a liposome and the specific binding ligand is functionally incoφorated into a liposome membrane. The liposome will thus specifically bind to the receptor(s) of a target cell and deliver the contents to a cell. Such systems have been shown to be functional using systems in which, for example, epidermal growth factor (EGF) is used in the receptor-mediated delivery of a nucleic acid to cells that exhibit upregulation of the EGF receptor. In certain embodiments, a receptor-mediated delivery and/or targeting vehicles comprise a cell receptor-specific ligand and a ZFQR-binding agent. Others comprise a cell receptor-specific ligand to which ZFQR to be delivered has been operatively attached. For example, several ligands have been used for receptor-mediated gene transfer (Wu and Wu, 1987; Wagner et al, 1990;

Perales et al, 1994; Myers, EPO 0273085), which establishes the operability of the technique. In another example, specific delivery in the context of another mammalian cell type has been described (Wu and Wu, 1993; incoφorated herein by reference). In still further embodiments, the specific binding ligand may comprise one or more lipids or glycoproteins that direct cell-specific binding. For example, lactosyl-ceramide, a galactose-terminal asialganglioside, have been incoφorated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes (Nicolau et al, 1987). The asialoglycoprotein, asialofetuin, which contains terminal galactosyl residues, also has been demonstrated to target liposomes to the liver (Spanjer and Scheφhof, 1983; Hara et al, 1996). The sugars mannosyl, fucosyl or N-acetyl glucosamine, when coupled to the backbone of a polypeptide, bind the high affinity manose receptor (U.S. Patent No. 5,432,260, specifically incoφorated herein by reference in its entirety). It is contemplated that the cell or tissue-specific transforming constructs of the present invention can be specifically delivered into a target cell or tissue in a similar manner.

In another example, lactosyl ceramide, and peptides that target the LDL receptor related proteins, such as apolipoprotein E3 ("Apo E") have been useful in targeting liposomes to the liver (Spanjer and Scheφhof, 1983; WO 98/0748).

Folate and the folate receptor have also been described as useful for cellular targeting (U.S. Patent No. 5,871,727). In this example, the vitamin folate is coupled to the complex. The folate receptor has high affinity for its ligand and is overexpressed on the surface of several malignant cell lines, including lung, breast and brain tumors. Anti-folate such as methotrexate may also be used as targeting ligands. Transfeπin mediated delivery systems target a wide range of replicating cells that express the transferrin receptor (Gilliland et al, 1980).

3. Liposome/Nucleic Acid Combinations In certain embodiments, a liposome/ZFQR may comprise a nucleic acid, such as, for example, an oligonucleotide, a polynucleotide or a nucleic acid construct (e.g., an expression vector). Where a bacterial promoter is employed in the DNA construct that is to be transfected into eukaryotic cells, it also will be desirable to include within the liposome an appropriate bacterial polymerase. It is contemplated that when the liposome/ZFQR composition comprises a cell or tissue specific nucleic acid, this technique may have applicability in the present invention. In certain embodiments, lipid-based non-viral formulations provide an alternative to viral gene therapies. Although many cell culture studies have documented lipid-based non-viral gene transfer, systemic gene delivery via lipid-based formulations has been limited. A major limitation of non- viral lipid- based gene delivery is the toxicity of the cationic lipids that comprise the non- viral delivery vehicle. The in vivo toxicity of liposomes partially explains the discrepancy between in vitro and in vivo gene transfer results. Another factor contributing to this contradictory data is the difference in liposome stability in the presence and absence of serum proteins. The interaction between liposomes and serum proteins has a dramatic impact on the stability characteristics of liposomes (Yang and Huang, 1997). Cationic liposomes attract and bind negatively charged serum proteins. Liposomes coated by serum proteins are either dissolved or taken up by macrophages leading to their removal from circulation. Cuπent in vivo liposomal delivery methods use aerosolization, subcutaneous, intradermal, intratumoral, or intracranial injection to avoid the toxicity and stability problems associated with cationic lipids in the circulation. The interaction of liposomes and plasma proteins is largely responsible for the disparity between the efficiency of in vitro (Feigner et al, 1987) and in vivo gene transfer (Zhu et al, 1993; Philip et al, 1993; Solodin et al, 1995; Liu et al, 1995; Thierry et al, 1995; Tsukamoto et al, 1995; Aksentijevich et al, 1996). An exemplary method for targeting viral particles to cells that lack a single cell-specific marker has been described (U.S. Patent 5,849,718). In this method, for example, antibody A may have specificity for tumor, but also for normal heart and lung tissue, while antibody B has specificity for tumor but also normal liver cells. The use of antibody A or antibody B alone to deliver an anti-proliferative nucleic acid to the tumor would possibly result in unwanted damage to heart and lung or liver cells. However, antibody A and antibody B can be used together for improved cell targeting. Thus, antibody A is coupled to a gene encoding an anti- proliferative nucleic acid and is delivered, via a receptor mediated uptake system, to tumor as well as heart and lung tissue. However, the gene is not transcribed in these cells as they lack a necessary transcription factor. Antibody B is coupled to a universally active gene encoding the transcription factor necessary for the transcription of the anti-proliferative nucleic acid and is delivered to tumor and liver cells. Therefore, in heart and lung cells only the inactive anti-proliferative nucleic acid is delivered, where it is not transcribed, leading to no adverse effects.

In liver cells, the gene encoding the transcription factor is delivered and transcribed, but has no effect because no an anti-proliferative nucleic acid gene is present. In tumor cells, however, both genes are delivered and the transcription factor can activate transcription of the anti-proliferative nucleic acid, leading to tumor-specific toxic effects.

The addition of targeting ligands for gene delivery for the treatment of hypeφroliferative diseases permits the delivery of genes whose gene products are more toxic than do non-targeted systems. Examples of the more toxic genes that can be delivered includes pro-apoptotic genes such as Bax and Bak plus genes derived from viruses and other pathogens such as the adenoviral E4orf4 and the

E.coli purine nucleoside phosphorylase, a so-called "suicide gene" which converts the prodrug 6-methylpurine deoxyriboside to toxic purine 6-methylpurine. Other examples of suicide genes used with prodrug therapy are the E. coli cytosine deaminase gene and the HSV thymidine kinase gene. It is also possible to utilize untargeted or targeted lipid complexes to generate recombinant or modified viruses in vivo. For example, two or more plasmids could be used to introduce retroviral sequences plus a therapeutic gene into a hypeφroliferative cell. Retroviral proteins provided in trans from one of the plasmids would permit packaging of the second, therapeutic gene-carrying plasmid. Transduced cells, therefore, would become a site for production of non- replicative retroviruses carrying the therapeutic gene. These retroviruses would then be capable of infecting nearby cells. The promoter for the therapeutic gene may or may not be inducible or tissue specific.

Similarly, the transfeπed nucleic acid may represent the DNA for a replication competent or conditionally replicating viral genome, such as an adenoviral genome that lacks all or part of the adenoviral El a or E2b region or that has one or more tissue-specific or inducible promoters driving transcription from the Ela and/or Elb regions. This replicating or conditional replicating nucleic acid may or may not contain an additional therapeutic gene such as a tumor suppressor gene or anti-oncogene.

4. Lipid Administration

The actual dosage amount of a lipid composition (e.g., a liposome-ZFQR) administered to a patient can be determined by physical and physiological factors such as body weight, severity of condition, idiopathy of the patient and on the route of administration. With these considerations in mind, the dosage of a lipid composition for a particular subject and/or course of treatment can readily be determined.

The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, rectally,topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, intravesicularlly, mucosally, intrapericardially, orally, topically, locally and/or using aerosol, injection, infusion, continuous infusion, localized perfusion bathing target cells directly or via a catheter and/or lavage. XI. Screening For Modulators Of the Protein Function

The present invention further comprises methods for identifying modulators of the function of ZFQR. These assays may comprise random screening of large libraries of candidate substances; alternatively, the assays may be used to focus on particular classes of compounds selected with an eye towards structural attributes that are believed to make them more likely to modulate the function of ZFQR.

By function, it is meant that one may assay for DNA binding, changing the structure of the chromatin, inhibiting transcription or regulating gene expression

To identify a ZFQR modulator, one generally will determine the function of ZFQR in the presence and absence of the candidate substance, a modulator defined as any substance that alters function. For example, a method generally comprises:

(a) providing a candidate modulator;

(b) admixing the candidate modulator with an isolated compound or cell, or a suitable experimental animal;

(c) measuring one or more characteristics of the compound, cell or animal in step (c); and

(d) comparing the characteristic measured in step (c) with the characteristic of the compound, cell or animal in the absence of said candidate modulator,

wherein a difference between the measured characteristics indicates that said candidate modulator is, indeed, a modulator of the compound, cell or animal.

Assays may be conducted in cell free systems, in isolated cells, or in organisms including transgenic animals. It will, of course, be understood that all the screening methods of the present invention are useful in themselves notwithstanding the fact that effective candidates may not be found. The invention provides methods for screening for such candidates, not solely methods of finding them.

A. Modulators

As used herein the term "candidate substance" refers to any molecule that may potentially inhibit or enhance ZFQR activity. The candidate substance may be a protein or fragment thereof, a small molecule, or even a nucleic acid molecule. It may prove to be the case that the most useful pharmacological compounds will be compounds that are structurally related to zinc finger- containing molecules. Using lead compounds to help develop improved compounds is know as "rational drug design" and includes not only comparisons with know inhibitors and activators, but predictions relating to the structure of target molecules.

The goal of rational drug design is to produce structural analogs of biologically active polypeptides or target compounds. By creating such analogs, it is possible to fashion drugs, which are more active or stable than the natural molecules, which have different susceptibility to alteration or which may affect the function of various other molecules. In one approach, one would generate a three-dimensional structure for a target molecule, or a fragment thereof. This could be accomplished by x-ray crystallography, computer modeling or by a combination of both approaches.

It also is possible to use antibodies to ascertain the structure of a target compound activator or inhibitor. In principle, this approach yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies to a functional, pharmacologically active antibody. As a minor image of a minor image, the binding site of anti-idiotype would be expected to be an analog of the original antigen. The anti-idiotype could then be used to identify and isolate peptides from banks of chemically- or biologically-produced peptides. Selected peptides would then serve as the pharmacore. Anti-idiotypes may be generated using the methods described herein for producing antibodies, using an antibody as the antigen.

On the other hand, one may simply acquire, from various commercial sources, small molecule libraries that are believed to meet the basic criteria for useful drugs in an effort to "brute force" the identification of useful compounds. Screening of such libraries, including combinatorially generated libraries (e.g., peptide libraries), is a rapid and efficient way to screen large number of related (and unrelated) compounds for activity. Combinatorial approaches also lend themselves to rapid evolution of potential drugs by the creation of second, third and fourth generation compounds modeled of active, but otherwise undesirable compounds.

Candidate compounds may include fragments or parts of naturally- occuning compounds, or may be found as active combinations of known compounds, which are otherwise inactive. It is proposed that compounds isolated from natural sources, such as animals, bacteria, fungi, plant sources, including leaves and bark, and marine samples may be assayed as candidates for the presence of potentially useful pharmaceutical agents. It will be understood that the pharmaceutical agents to be screened could also be derived or synthesized from chemical compositions or man-made compounds. Thus, it is understood that the candidate substance identified by the present invention may be peptide, polypeptide, polynucleotide, small molecule inhibitors or any other compounds that may be designed through rational drug design starting from known inhibitors or stimulators. Other suitable modulators include antisense molecules, ribozymes, and antibodies (including single chain antibodies), each of which would be specific for the target molecule. Such compounds are described in greater detail elsewhere in this document. For example, an antisense molecule that bound to a translational or transcriptional start site, or splice junctions, would be ideal candidate inhibitors.

In addition to the modulating compounds initially identified, the inventors also contemplate that other sterically similar compounds may be formulated to mimic the key portions of the structure of the modulators. Such compounds, which may include peptidomimetics of peptide modulators, may be used in the same manner as the initial modulators. An inhibitor according to the present invention may be one which exerts its inhibitory or activating effect upstream, downstream or directly on ZFQR. Regardless of the type of inhibitor or activator identified by the present screening methods, the effect of the inhibition or activator by such a compound results in ZFQR as compared to that observed in the absence of the added candidate substance.

B. In vitro Assays

A quick, inexpensive and easy assay to run is an in vitro assay. Such assays generally use isolated molecules, can be run quickly and in large numbers, thereby increasing the amount of information obtainable in a short period of time.

A variety of vessels may be used to run the assays, including test tubes, plates, dishes and other surfaces such as dipsticks or beads.

One example of a cell free assay is a binding assay. While not directly addressing function, the ability of a modulator to bind to a target molecule in a specific fashion is strong evidence of a related biological effect. For example, binding of a molecule to a target may, in and of itself, be inhibitory, due to steric, allosteric or charge-charge interactions. The target may be either free in solution, fixed to a support, expressed in or on the surface of a cell. Either the target or the compound may be labeled, thereby permitting determining of binding. Usually, the target will be the labeled species, decreasing the chance that the labeling will interfere with or enhance binding. Competitive binding formats can be performed in which one of the agents is labeled, and the amount of free label versus bound label is measured to determine the effect on binding.

A technique for high throughput screening of compounds is described in WO 84/03564. Large numbers of small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. Bound polypeptide is detected by various methods.

C. In cyto Assays The present invention also contemplates the screening of compounds for their ability to modulate ZFQR in cells. Various cell lines can be utilized for such screening assays, including cells specifically engineered for this puφose.

Depending on the assay, culture may be required. The cell is examined using any of a number of different physiologic assays. Alternatively, molecular analysis may be performed, for example, looking at protein expression, mRNA expression (including differential display of whole cell or polyA RNA) and others.

D. In vivo Assays In vivo assays involve the use of various animal models, including transgenic animals that have been engineered to have specific defects, or carry markers that can be used to measure the ability of a candidate substance to reach and effect different cells within the organism. Due to their size, ease of handling, and information on their physiology and genetic make-up, mice are a prefened embodiment, especially for transgenics. However, other animals are suitable as well, including rats, rabbits, hamsters, guinea pigs, gerbils, woodchucks, cats, dogs, sheep, goats, pigs, cows, horses and monkeys (including chimps, gibbons and baboons). Assays for modulators may be conducted using an animal model derived from any of these species. In such assays, one or more candidate substances are administered to an animal, and the ability of the candidate substance(s) to alter one or more characteristics, as compared to a similar animal not treated with the candidate substance(s), identifies a modulator. The characteristics may be any of those discussed above with regard to the function of a particular compound (e.g., enzyme, receptor, hormone) or cell (e.g., growth, tumorigenicity, survival), or instead a broader indication such as behavior, anemia, immune response, etc. The present invention provides methods of screening for a candidate substance that affects ZFQR activity. In these embodiments, the present invention is directed to a method for determining the ability of a candidate substance to affect ZFQR function in gene regulation, generally including the steps of: administering a candidate substance to the animal; and determining the ability of the candidate substance to reduce one or more characteristics of ZFQR activity.

Treatment of these animals with test compounds will involve the administration of the compound, in an appropriate form, to the animal. Administration will be by any route that could be utilized for clinical or non- clinical puφoses, including but not limited to oral, nasal, buccal, or even topical. Alternatively, administration may be by intratracheal instillation, bronchial instillation, intradermal, subcutaneous, intramuscular, intraperitoneal or intravenous injection. Specifically contemplated routes are systemic intravenous injection, regional administration via blood or lymph supply, or directly to an affected site.

Determining the effectiveness of a compound in vivo may involve a variety of different criteria. Also, measuring toxicity and dose response can be performed in animals in a more meaningful fashion than in in vitro or in cyto assays.

XII. Non-Protein-Expressing Sequences

In certain embodiments, the ZFQR nucleic acid sequence may express messages that are not translated. DNA may be introduced into organisms for the puφose of expressing RNA transcripts that function to affect phenotype yet are not translated into protein. Two examples are antisense RNA and RNA with ribozyme activity. Both may serve possible functions in reducing or eliminating expression of native or introduced genes. However, as detailed below, DNA need not be expressed to effect the phenotype of an organism. A. Antisense RNA

In certain aspects, a ZFQR sequence may express an antisense message. Nucleic acids, particularly those from genes may be constructed or isolated, which when transcribed, produce antisense RNA that is complementary to all or part(s) of a targeted messenger RNA(s). The antisense RNA reduces production of the polypeptide product of the messenger RNA. The polypeptide product may be any protein encoded by the cell's genome. The aforementioned genes will be refened to as antisense genes. An antisense gene may thus be introduced into a cell by transformation methods to produce a novel transgenic cell or organism with reduced expression of a selected protein of interest. For example, the protein may be an enzyme that catalyzes a reaction in the cell or organism. Reduction of the enzyme activity may reduce or eliminate products of the reaction which include any enzymatically synthesized compound in the cell or organism such as fatty acids, amino acids, carbohydrates, nucleic acids and the like. Alternatively, in a non-limiting example such as the transformation of a plant cell, the protein may be a storage protein, such as a zein, or a structural protein, the decreased expression of which may lead to changes in seed amino acid composition or plant moφhological changes respectively. The possibilities cited above are provided only by way of example and do not represent the full range of applications.

B. Ribozymes

In other aspects, the ZFQR may produce a ribozyme. Nucleic acids may be constructed or isolated which, when transcribed, produce RNA enzymes (ribozymes) that can act as endoribonucleases and catalyze the cleavage of RNA molecules with selected sequences. The cleavage of selected messenger RNAs can result in the reduced production of their encoded polypeptide products. These genes may be used to prepare novel one or more cells, tissues and organisms which possess them. The transgenic cells, tissues or organisms may possess reduced levels of polypeptides including, but not limited to, the polypeptides cited above.

Ribozymes are RNA-protein complexes that cleave nucleic acids in a site-specific fashion. Ribozymes have specific catalytic domains that possess endonuclease activity (Kim and Cech, 1987; Gerlach et al, 1987; Forster and

Symons, 1987). For example, a large number of ribozymes accelerate phosphoester transfer reactions with a high degree of specificity, often cleaving only one of several phosphoesters in an oligonucleotide substrate (Cech et al, 1981; Michel and Westhof, 1990; Reinhold-Hurek and Shub, 1992). This specificity has been attributed to the requirement that the substrate bind via specific base-pairing interactions to the internal guide sequence ("IGS") of the ribozyme prior to chemical reaction.

Ribozyme catalysis has primarily been observed as part of sequence-specific cleavage/ligation reactions involving nucleic acids (Joyce, 1989; Cech et al, 1981). For example, U.S. Patent No. 5,354,855 reports that certain ribozymes can act as endonucleases with a sequence specificity greater than that of known ribonucleases and approaching that of the DNA restriction enzymes.

Several different ribozyme motifs have been described with RNA cleavage activity (Symons, 1992). Examples include sequences from the Group I self splicing introns including Tobacco Ringspot Virus (Prody et al, 1986), Avocado Sunblotch Viroid (Palukaitis et al, 1979), and Lucerne Transient Streak Virus (Forster and Symons, 1987). Sequences from these and related viruses are refened to as hammerhead ribozyme based on a predicted folded secondary structure.

Other suitable ribozymes include sequences from RNase P with RNA cleavage activity (Yuan et al, 1992, Yuan and Airman, 1994, U.S. Patent Nos. 5,168,053 and 5,624,824), haiφin ribozyme structures (Berzal-Henanz et al, 1992; Chowrira et al, 1993) and Hepatitis Delta virus based ribozymes (U.S. Patent No. 5,625,047). The general design and optimization of ribozyme directed RNA cleavage activity has been discussed in detail (Haseloff and Gerlach, 1988, Symons, 1992, Chowrira et al, 1994; Thompson et al, 1995).

The other variable on ribozyme design is the selection of a cleavage site on a given target RNA. Ribozymes are targeted to a given sequence by virtue of annealing to a site by complimentary base pair interactions. Two stretches of homology are required for this targeting. These stretches of homologous sequences flank the catalytic ribozyme structure defined above. Each stretch of homologous sequence can vary in length from 7 to 15 nucleotides. The only requirement for defining the homologous sequences is that, on the target RNA, they are separated by a specific sequence which is the cleavage site. For hammerhead ribozyme, the cleavage site is a dinucleotide sequence on the target RNA is a uracil (U) followed by either an adenine, cytosine or uracil (A,C or U) (Peniman et al, 1992; Thompson et al, 1995). The frequency of this dinucleotide occurring in any given RNA is statistically 3 out of 16. Therefore, for a given target messenger RNA of 1000 bases, 187 dinucleotide cleavage sites are statistically possible.

Designing and testing ribozymes for efficient cleavage of a target RNA is a process well known to those skilled in the art. Examples of scientific methods for designing and testing ribozymes are described by Chowrira et al, (1994) and Lieber and Strauss (1995), each incoφorated by reference. The identification of operative and prefeπed sequences for use in down regulating a given gene is simply a matter of preparing and testing a given sequence, and is a routinely practiced "screening" method known to those of skill in the art.

C. Induction of Gene Silencing

In additional aspects, the ZFQR nucleic acid sequence may be transcribed to promote gene silencing. It also is possible that nucleic acids derived from genes may be introduced to produce novel cells, tissues and organisms which have reduced expression of a native gene product by the mechanism of co-suppression. It has been demonstrated in tobacco, tomato, and petunia (Goring et al, 1991 ; Smith et al, 1990; Napoli et al, 1990; van der Krol et al, 1990) that expression of the sense transcript of a native gene will reduce or eliminate expression of the native gene in a manner similar to that observed for antisense genes. The introduced gene may encode all or part of the targeted native protein but its translation may not be required for reduction of levels of that native protein.

D. Non-RNA-Expressing Sequences

In further embodiments, ZFQR may be used to tag a cell, tissue or organism, or mutate a gene. DNA elements including those of transposable elements such as Ds, Ac, or Mu, may be inserted into a gene to cause mutations. These DNA elements may be inserted in order to inactivate (or activate) a gene and thereby "tag" a particular trait. In this instance the transposable element does not cause instability of the tagged mutation, because the utility of the element does not depend on its ability to move in the genome. Once a desired trait is tagged, the introduced DNA sequence may be used to clone the coπesponding gene, e.g., using the introduced DNA sequence as a PCR primer together with PCR gene cloning techniques (Shapiro, 1983; Dellaporta et al, 1988). Once identified, the entire gene(s) for the particular trait, including control or regulatory regions where desired, may be isolated, cloned and manipulated as desired. The utility of DNA elements introduced into an organism for puφoses of gene tagging is independent of the DNA sequence and does not depend on any biological activity of the DNA sequence, i.e., transcription into RNA or translation into protein. The sole function of the DNA element is to disrupt the DNA sequence of a gene.

It is contemplated that unexpressed DNA sequences, including novel synthetic sequences, could be introduced into cells, tissues and organisms as proprietary "labels" of those cells, tissues and organisms, particularly plants and seeds thereof. It would not be necessary for a label DNA element to disrupt the function of a gene endogenous to the host organism, as the sole function of this DNA would be to identify the origin of the cell, tissue or organism. For example, one could introduce a unique DNA sequence into a plant and this DNA element would identify all cells, plants, and progeny of these cells as having arisen from that labeled source. It is proposed that inclusion of label DNAs would enable one to distinguish proprietary germplasm or germplasm derived from such, from unlabelled germplasm.

Another possible element which may be introduced is a matrix attachment region element (MAR), such as the chicken lysozyme A element (Stief, 1989), which can be positioned around an expressible gene of interest to effect an increase in overall expression of the gene and diminish position dependent effects upon incoφoration into the genome, particularly a plant genome (Stief et al, 1989; Phi-Van et al, 1990).

XIII. Pharmaceutical Preparations

Pharmaceutical compositions of the present invention comprise an effective amount of one or more ZFQRs or additional agent dissolved or dispersed in a pharmaceutically acceptable canier. The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one ZFQR or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incoφorated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.

As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absoφtion delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incoφorated herein by reference).

Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

The ZFQR may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. The present invention can be administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, rectally, topically, intratumorally, intramuscularly, intraperitoneally, subcutaneously, intravesicularlly, mucosally, intrapericardially, orally, topically, locally, using aerosol, injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's

Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incoφorated herein by reference).

The actual dosage amount of a composition of the present invention administered to an animal patient can be determined by physical and physiological factors such as body weight, severity of condition, the type of disease being treated, previous or concuπent therapeutic interventions, idiopathy of the patient and on the route of administration. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1 %> of an active compound. In other embodiments, the an active compound may comprise between about 2%> to about 75%> of the weight of the unit, or between about 25% to about 60%>, for example, and any range derivable therein. In other non-limiting examples, a dose may also comprise from about 1 microgram kg/body weight, about 5 microgram kg/body weight, about 10 microgram/kg/body weight, about 50 microgram kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligrarn/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.

In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.

The ZFQR may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine. In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof.

In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in prefened embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.

In certain embodiments the ZFQR is prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules

(e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incoφorated directly with the food of the diet. Prefeπed earners for oral administration comprise inert diluents, assimilable edible caniers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.

In certain prefened embodiments an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. Additional formulations which are suitable for other modes of administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.

Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.

Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and/or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions or emulsion, the prefened methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.

The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.

In particular embodiments, prolonged absoφtion of an injectable composition can be brought about by the use in the compositions of agents delaying absoφtion, such as, for example, aluminum monostearate, gelatin or combinations thereof.

XIV. Kits

Any of the compositions described herein may be comprised in a kit. In a non-limiting example, a ZFQR, lipid, and/or additional agent, may be comprised in a kit. The kits will thus comprise, in suitable container means, a ZFQR and a lipid, and/or an additional agent of the present invention.

The kits may comprise a suitably aliquoted ZFQR, lipid and/or additional agent compositions of the present invention, whether labeled or unlabeled, as may be used to prepare a standard curve for a detection assay. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there are more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the ZFQR, lipid, additional agent, and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow-molded plastic containers into which the desired vials are retained. Therapeutic kits of the present invention are kits comprising ZFQR protein, polypeptide, peptide, inhibitor, gene, vector and/or other ZFQR effector. Such kits will generally contain, in suitable container means, a pharmaceutically acceptable formulation of ZFQR protein, polypeptide, peptide, domain, inhibitor, and/or a gene and/or vector expressing any of the foregoing in a pharmaceutically acceptable formulation. The kit may have a single container means, and/or it may have distinct container means for each compound.

When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly prefeπed. The ZFQR compositions may also be formulated into a syringeable composition. In which case, the container means may itself be a syringe, pipette, and/or other such like apparatus, from which the formulation may be applied to an infected area of the body, injected into an animal, and/or even applied to and/or mixed with the other components of the kit.

However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.

The container means will generally include at least one vial, test tube, flask, bottle, syringe and/or other container means, into which the ZFQR protein, gene and/or inhibitory formulation are placed, preferably, suitably allocated. The kits may also comprise a second container means for containing a sterile, pharmaceutically acceptable buffer and/or other diluent.

The kits of the present invention will also typically include a means for containing the vials in close confinement for commercial sale, such as, e.g., injection and/or blow-molded plastic containers into which the desired vials are retained.

Inespective of the number and/or type of containers, the kits of the invention may also comprise, and/or be packaged with, an instrument for assisting with the injection/administration and/or placement of the ultimate ZFQR protein and/or gene composition within the body of an animal. Such an instrument may be a syringe, pipette, forceps, and/or any such medically approved delivery vehicle.

XV. Two Hybrid Screen The term "two hybrid screen" as used herein refers to a screen to elucidate or characterize the function of a protein by identifying other proteins with which it interacts. The protein of unknown function, herein refened to as the "bait" is produced as a chimeric protein additionally containing the DNA binding domain of GAL4. Plasmids containing nucleotide sequences which express this chimeric protein are transformed into yeast cells, which also contain a representative plasmid from a library containing the GAL4 activation domain fused to different nucleotide sequences encoding different potential target proteins. If the bait protein physically interacts with a target protein, the GAL4 activation domain and GAL4 DNA binding domain are tethered and are thereby able to act conjunctively to promote transcription of a reporter gene. If no interaction occurs between the bait protein and the potential target protein in a particular cell, the GAL4 components remain separate and unable to promote reporter gene transcription on their own. One skilled in the art is aware that different reporter genes can be utilized, including β-galactosidase, HIS3, ADE2, or URA3. Furthermore, multiple reporter sequences, each under the control of a different inducible promoter, can be utilized within the same cell to indicate interaction of the GAL4 components (and thus a specific bait and target protein). A skilled artisan is aware that use of multiple reporter sequences decreases the chances of obtaining false positive candidates. Also, alternative DNA-binding domain/activation domain components may be used, such as LexA. One skilled in the art is aware that any activation domain may be paired with any DNA binding domain so long as they are able to generate transactivation of a reporter gene. Furthermore, a skilled artisan is aware that either of the two components may be of prokaryotic origin, as long as the other component is present and they jointly allow transactivation of the reporter gene, as with the LexA system.

Two hybrid experimental reagents and design are well known to those skilled in the art (see The Yeast Two-Hybrid System by P. L. Bartel and S. Fields (eds.) (Oxford University Press, 1997), including the most updated improvements of the system (Fashena et al, 2000). A skilled artisan is aware of commercially available vectors, such as the Matchmaker™ Systems from Clontech (Palo Alto, CA) or the HybriZAP® 2.1 Two Hybrid System (Stratagene; La Jolla, CA), or vectors available through the research community (Yang et al, 1995; James et al, 1996). In alternative embodiments, organisms other than yeast are used for two- hybrid analysis, such as mammals (Mammalian Two Hybrid Assay Kit from Stratagene (La Jolla, CA)) or E. coli (Hu et al, 2000).

In an alternative embodiment, a two-hybrid system is utilized wherein protein-protein interactions are detected in a cytoplasmic-based assay. In this embodiment, proteins are expressed in the cytoplasm, which allows posttranslational modifications to occur and permits transcriptional activators and inhibitors to be used as bait in the screen. An example of such a system is the Cyto Trap® Two-Hybrid System from Stratagene™ (La Jolla, CA), in which a target protein becomes anchored to a cell membrane of a yeast which contains a temperature sensitive mutation in the cdc25 gene, the yeast homolog for hSos (a guanyl nucleotide exchange factor). Upon binding of a bait protein to the target, hSos is localized to the membrane, which allos activation of RAS by promoting GDP/GTP exchange. RAS then activates a signaling cascade which allows growth at 37°C of a mutant yeast cdc25H. Vectors (such as pMyr and pSos) and other experimental details are available for this system to a skilled artisan through Stratagene (La Jolla, CA). (See also, for example, U.S. Patent No. 5,776,689, herein incoφorated by reference).

Thus, in accordance with an embodiment of the present invention, there is a method of screening for a peptide which interacts with ZFQR comprising introducing into a cell a first nucleic acid comprising a DNA segment encoding a test peptide, wherein the test peptide is fused to a DNA binding domain, and a second nucleic acid comprising a DNA segment encoding at least part of ZFQR, respectively, wherein the at least part of ZFQR, respectively, is fused to a DNA activation domain. Subsequently, there is an assay for interaction between the test peptide and the ZFQR polypeptide or fragment thereof by assaying for interaction between the DNA binding domain and the DNA activation domain. In a prefened embodiment, the assay for interaction between the DNA binding and activation domains is activation of expression of β-galactosidase.

XVI. Methods of Making Transgenic Mice

A particular embodiment of the present invention provides transgenic animals that contain ZFQR -related constructs. Transgenic animals expressing CAP, recombinant cell lines derived from such animals, and transgenic embryos may be useful in methods for screening for and identifying agents that interact with ZFQR. The use of constitutively expressed ZFQR provides a model for over- or unregulated expression, compared to normal basal expression levels. Also, transgenic animals which are "knocked out" for ZFQR are utilized, such as for screening methods or as models for therapeutic assays for candidate compounds.

In a general aspect, a transgenic animal is produced by the integration of a given transgene into the genome in a manner that permits the expression of the transgene. Methods for producing transgenic animals are generally described by Wagner and Hoppe (U.S. Patent 4,873,191; which is incoφorated herein by reference), Brinster et al. 1985; which is incoφorated herein by reference in its entirety) and in "Manipulating the Mouse Embryo; A Laboratory Manual" 2nd edition (eds., Hogan, Beddington, Costantimi and Long, Cold Spring Harbor Laboratory Press, 1994; which is incoφorated herein by reference in its entirety).

Typically, a gene flanked by genomic sequences is transfeπed by microinj ection into a fertilized egg. The microinj ected eggs are implanted into a host female, and the progeny are screened for the expression of the transgene. Transgenic animals may be produced from the fertilized eggs from a number of animals including, but not limited to reptiles, amphibians, birds, mammals, and fish.

DNA clones for microinj ection can be prepared by any means known in the art. For example, DNA clones for microinj ection can be cleaved with enzymes appropriate for removing the bacterial plasmid sequences, and the DNA fragments electrophoresed on 1%> agarose gels in TBE buffer, using standard techniques. The DNA bands are visualized by staining with ethidium bromide, and the band containing the expression sequences is excised. The excised band is then placed in dialysis bags containing 0.3 M sodium acetate, pH 7.0. DNA is electroeluted into the dialysis bags, extracted with a 1 :1 phenokchloroform solution and precipitated by two volumes of ethanol. The DNA is redissolved in 1 ml of low salt buffer (0.2 M NaCl, 20 mM Tris,pH 7.4, and 1 mM EDTA) and purified on an Elutip-D™column. The column is first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 ml of low salt buffer. The DNA solutions are passed through the column three times to bind DNA to the column matrix. After one wash with 3 ml of low salt buffer, the DNA is eluted with 0.4 ml high salt buffer and precipitated by two volumes of ethanol. DNA concentrations are measured by absoφtion at 260 nm in a UV spectrophotometer. For microinj ection, DNA concentrations are adjusted to 3 μg/ml in 5 mM Tris, pH 7.4 and 0.1 mM EDTA. Other methods for purification of DNA for microinj ection are described in Hogan et al. Manipulating the Mouse Embryo (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1986), in Palmiter et al. Nature 300:611 (1982); in The Qiagenologist, Application Protocols, 3rd edition, published by Qiagen, Inc., Chatsworth, CA.; and in Sambrook et al. Molecular Cloning: A Laboratory

Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989), all of which are incoφorated by reference herein.

In an exemplary microinj ection procedure, female mice six weeks of age are induced to superovulate with a 5 IU injection (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; Sigma) followed 48 hours later by a 5 IU injection

(0.1 cc, ip) of human chorionic gonadotropin (hCG; Sigma). Females are placed with males immediately after hCG injection. Twenty-one hours after hCG injection, the mated females are sacrificed by CO2 asphyxiation or cervical dislocation and embryos are recovered from excised oviducts and placed in Dulbecco's phosphate buffered saline with 0.5% bovine serum albumin (BSA;

Sigma). Suπounding cumulus cells are removed with hyaluronidase (1 mg/ml). Pronuclear embryos are then washed and placed in Earle's balanced salt solution containing 0.5 % BSA (EBSS) in a 37.5°C incubator with a humidified atmosphere at 5%> CO2, 95% air until the time of injection. Embryos can be implanted at the two-cell stage.

Randomly cycling adult female mice are paired with vasectomized males. C57BL/6 or Swiss mice or other comparable strains can be used for this puφose. Recipient females are mated at the same time as donor females. At the time of embryo transfer, the recipient females are anesthetized with an intraperitoneal injection of 0.015 ml of 2.5 %> avertin per gram of body weight. The oviducts are exposed by a single midline dorsal incision. An incision is then made through the body wall directly over the oviduct. The ovarian bursa is then torn with watchmakers forceps. Embryos to be transfened are placed in DPBS (Dulbecco's phosphate buffered saline) and in the tip of a transfer pipet (about 10 to 12 embryos). The pipet tip is inserted into the infundibulum and the embryos transfened. After the transfer, the incision is closed by two sutures.

The following examples are offered by way of example, and are not intended to limit the scope of the invention in any manner.

EXAMPLE 1

Yeast Two Hybrid Analysis with Mortalin Identifies

Interaction with a Novel Zinc Finger Protein

To determine the molecular basis for the different immunostaining patterns of mortalin observed in immortal human cell lines in different complementation groups, a yeast two hybrid screen was initiated using as bait the mouse mortalin cDNA (mot-2), which differs from that found in normal mouse cells (mot-1) (Wadhwa et al, 1995; Wadhwa et al, 1993; Wadhwa et al, 1993). The full-length mortalin coding sequence of mot-2.1 (Kaul et al, 1998) was cloned into the pG1694A vector (James et al, 1996), downstream of the GAL4 DNA binding domain and was subsequently used to screen a yeast two hybrid library from EBV transformed human B lymphocytes in the yeast host strain PJ- 69-4A (James et al, 1996). Two of three clones that demonstrated interaction with mortalin were identical and were designated 16zf. 16zf contained the partial sequence of an open reading frame encoding amino acid residues that were in- frame to the Gal-activation domain of the pACT vector. The partial open reading frame in 16zf had three tandemly repeated zinc fingers, but the sequence had no identity with any known genes in the database. The interaction with mortalin was determined to be a false positive in yeast cells, since mortalin is a cytoplasmic protein and ZFQR localizes entirely to the nucleus in human cells. EXAMPLE 2

The sequence of ZFQR

The sequence of the full-length ZFQR cDNA had an open reading frame of 1596bp coding for a predicted protein of 532 amino acids (FIG. 1A). There are eight tandemly-repeated zinc fingers in the middle of the protein. The zinc finger sequences match that of the C₂H₂ classic zinc fmger motif, CX₂CX₃FXsLX₂HX H, in which X indicates the presence of any amino acid between the conserved residues. The N-terminal region of the protein has a complete KRAB box, including box-A and box-B, and the consensus region of the KRAB box in ZFQR and other members of the KRAB zinc finger gene family is shown in FIG. IB. However, ZFQR has a long and unique C-terminus that has no similarity to the other known KRAB zinc finger gene family members, indicating it is a new member of this gene family (Witzgall et al, 1994).

EXAMPLE 3

Cloning of ZFQR

The clone 16zf was 1.5 kilobase pairs in length and contained part of the coding sequence including two zinc fingers and the 3 '-untranslated region of the novel gene. A BLAST search of the dEST data base yielded several EST clones:

771053, 704434, 302462. 771053 was the largest EST with an insert size of 1.6 kilobase pairs. The 5' sequence of this cDNA clone was again used to search the dEST database, and this yielded two additional overlapping dESTs: AA343440 and AA558513. By combining these together, a 1.78 kilobase pair EST contig was constructed. Though this contig extended the open reading frame found in

16zf further into the 5' end, a start codon could not be identified. To obtain a full length cDNA, 5' RACE (Rapid Amplification of cDNA Ends) was performed on a human heart marathon-ready cDNA library (Clontech, Palo Alto, CA) using primer ZF 11 (5'-ATTTTGCCCTAACAGAAACTGACTTTTG-3'; SEQ ID NO:3) and primer API

(5'-CCATCCAATACGACTCACTATAGGGC-3' (Clontech, Palo Alto, CA); SEQ ID NO:4), according to the recommended protocol. Four fragments from the 5' RACE (0.5 kilobase pairs, 0.6 kilobase pairs, 0.65 kilobase pairs, 0.75 kilobase pairs) were cloned into the PCR-TOPO vector using the TA cloning method (Invitrogen) and sequenced. These fragments were identical except that some had additional sequence at the 5' end. When the sequence from the 5' RACE was aligned with the EST contig, a complete open reading frame was obtained. PCR primers ZF 15

(5'-GTTGAGGCCCTTCTTGYGTATCYGGAG-3'; SEQ ID NO:5) and ZF18

(5'-TCCTCCACACTGGTCTAAGGA-3' ; SEQ ID NO:6) were than used to amplify the full length ZFQR cDNA from the human heart marathon-ready cDNA library. The cDNA was then sequenced to confirm the cloning.

EXAMPLE 4

Localization of Expression of ZFQR

Human multi-tissue Northern blots were obtained from Clontech (Palo Alto, CA). Normal human foreskin derived fibroblasts, HCA2, were serially subcultured to senescence (Pereira-Smith and Smith, 1988). Briefly, immortal cell lines are fused with each other which, in particular cases, result in hybrid clones which ceased to divide. From young HCA2 cells at population doubling (PD) 20, which are made quiescent by maintaining them in medium with 0.5%) fetal bovine serum (FBS) for at least two weeks, total RNA from young (PD20), quiescent and senescent (PD87) cells is isolated. Ten μg of total RNA of each was run on a 1.2% formaldehyde denaturing gel, transfened to positively charged nylon membrane, and UV cross-linked. The clonelόzf was PCR amplified from the pACT vector with primers flanking the insert. The amplified 16zf was then gel purified and used as a ZFQR specific probe.

The human multi-tissue Northern blots were probed with the ZFQR probe, and a single transcript of 2.6 kilobase pairs was expressed in all tissues, with the highest level of expression observed in prostate, testis, heart, pancreas and spleen

(FIG. 2). Densitometer (Molecular Dynamics) analysis with ImageQuant vl.2 (Molecular Dynamics) was then performed. GAPDH specific probe also labeled with 32P, and hybridized to the filter served as a loading control.

Ribonuclease protection assay was then performed to confirm the results of Northern analysis. A 0.3 kb fragment (containing most of the C-terminal coding region of ZFQR) was cut out from pcDNA-ZFQR-HA (see below) with

Pst I and Xba I, and cloned into the pBluescript vector (Stratagene). The construct pBS-ZFQR was used to generate 32P labeled riboprobe using the

Riboprobe in Vitro Transcription System (Promega). Total RNAs from young (PD20), senescent (PD87), quiescent and serum stimulated (24h) quiescent human fibroblasts (HCA2) were used in the ribonuclease protection assay with a RPA III

Ribonuclease Protection Assay system from Ambion. pTRI-Actin-Human provided was used to generate riboprobe to beta-actin, and was used as control.

After running the denaturing acrylamide gel, the gel was exposed to a phospho-imager screen, and the screen scanned and analyzed with ImageQuant vl.2 (Molecular Dynamics).

In FIG. 3A the ZFQR mRNA levels were up-regulated about 5 fold in senescent HCA2 cells, and over 10 fold in quiescent HCA2 cells (FIG. 3b). More interestingly, when the quiescent cells were stimulated with 10%o FBS, ZFQR mRNA level decreased 24 hours after stimulation. Similar results were obtained in Northern blot analysis using GAPDH as control.

EXAMPLE 5

Characterization of ZFQR Genomic Localization and Interspecies Expression

The original clone 16zf contained the C-terminal coding sequence, including two zinc fingers, and the 3' untranslated region (3* UTR) which is unique to ZFQR. It was therefore used as a probe to isolate a human genomic

BAC clone using high density human BAC filters (Genome Systems, Inc.). BAC 356k21 showed strong hybridization with 16zf. PCR with primers specific to the ZFQR cDNA was done using the BAC and cDNA as template, and the same product was obtained from both DNAs. This confirmed BAC356K21 contained the ZFQR genomic DNA. Subsequently the BAC was used as a probe to determine the human chromosomal locus of the gene by FISH analysis, by methods well known in the art, and ZFQR mapped to chromosome 19ql3.4. This is very close to localization of a zinc finger gene cluster in the human chromosome 19q 13.2 region (Shannon et al, 1996).

The 16zf clone was used to probe a genomic multiple-species zoo blot

(Clontech, Palo Alto, CA). Cross-hybridization was observed in many species including human, monkey, rat, mouse, dog, rabbit and yeast. However, when the human ZFQR sequence was analyzed in the yeast database we obtained a match to the 3'UTR of a yeast gene. Therefore, it is more likely that a ZFQR gene is present only in human and monkey DNA.

EXAMPLE 6

Preparing Cells for Analysis of Cellular Localization of ZFQR

To prepare cells for characterization of the localization of a ZFQR-HA protein, the ZFQR coding sequence was first PCR amplified from the full length

ZFQR cDNA using the primers 5'-

GTAGGATCCACCATGCTGYCTTCCAAGAACAGA-3'; SEQ ID NO:7 and 5'-

TCATCTAGACTACAGGCTAGCGTAGTCTGGGACGTCGTATGGGT

AACATGGGGTTTTTCTGTAACATAAAA-3'; SEQ ID NO:8. Restriction enzyme sites Bam HI and Xba I were introduced at the 5' and 3' end of the ZFQR by PCR primers, together with a HA epitope coding sequence at the 3' end. The PCR fragment was then cloned into the pcDNA3.1 vector (Invitrogen) to generate pcDNA-ZFQR-HA.

A mutant of ZFQR in which the KRAB domain had been deleted was PCR amplified from the full length ZFQR cDNA using the primers

(5'-GTAGGATCCACCATGGAGCGCTTGCAGAGTGAAAGC-3'; SEQ ID NO:9, and 5'-

TCATCTAGACTACAGGCTAGCGTAGTCTGGGACGTCGTAT

GGGTAACATGGGGTTTTTCTGTAACATAAAA-3'; SEQ ID NO: 10).

Restriction enzyme sites Bam HI and Xba 1 were introduced at the 5'and 3' end of the ZFQR(-KRAB minus) by PCR primers, together with a Kozak sequence at 5' end, and a HA epitope coding sequence at the 3' end. The PCR fragment was then cloned into the pcDNA3.1 vector (Invitrogen) to obtain ZFQR-KRAB minus-HA. These two constructs were transfected into HeLa cells using the Lipofectamine reagent (Gibco-BRL). Two days post- transfection the cells were submitted to immuno staining with an anti-HA monoclonal antibody 16B12 (BabCO, Inc.) and Alexa-labeled secondary anti-mouse antibody (Molecular Probes), and observed under the fluorescence microscope.

Following this, two 100 mm dishes of HeLa cells (2.5xl0⁶ cells/dish) were transfected with the pcDNA-ZFQR-HA construct. Forty-eight hours after transfection, various fractionations were prepared as described (Grondin et al, 1996). Briefly, the cells were trypsinized and washed in PBS, subjected to hypotonic lysis by resuspending in 400 μl RSB buffer (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl₂, 0.5 mM PMSF), and incubated on ice for 10 minutes.

The cells were passed through 1 ml syringe (with needle) 5-8 times to break the cytoplasmic membrane, and centrifuged at 8000 φm in a bench top centrifuge for 3 min. The supernatant conesponding to the cytoplasmic protein-containing fraction was designated fraction number 1. The nuclei were washed twice in RSB buffer and resuspended in 150 ul of DNase I digestion buffer (supplemented with 4 mM vanadyl riboside complex, 0.5%o Triton X-100 and lx protease inhibitors (Calbiochem)), and digested with 50 units of DNase I (Life Tech) at 300°C for 50 min. 50 ul of ammonium sulfate (1M) were added to the digestion mixture (final concentration 0.25 M) mixed and centrifuged. The supernatant was designated fraction number 2. The pellet was resuspended in 100 ul of digestion buffer. 100 ul of 4M NaCl was added (final concentration 2 M) mixed and centrifuged. The supernatant was designated fraction number 3. The pellet was re-suspended in 200 ul of digestion buffer (without vanadyl riboside complex) and digested with

RNase A (lOOug/ml) and RNase T (40units/ml) for 1 hour at room temperature. The supernatant and pellet after centrifugation were designated fraction number 4 and 5. Equal volume of samples from each fraction were subjected to Western analysis with anti-HA 16B12 antibody. Anti-lamin antibody (Santa Cruz), which recognizes lamin A and C, proteins known to be associated with the nuclear matrix, was used to probe the same Western blot to use as control. Anti-beta tubulin antibody (Santa Cruz) was also used to probe the blot as a control. HeLa cells were also transfected with pcDNA-ZFQR(KRAB minus)-HA, and fractionated similar to HeLa cells transfected with pcDNA-ZFQR-HA.

EXAMPLE 7

CAT (chloramphenicol acetyltranferase) Assays

to Identify Subcellular Localization of ZFQR

ZFQR and the KRAB deletion mutant were PCR amplified from the full length ZFQR cDNA with ZF3+ZF4 and ZF5+ZF4 (ZF3 ,

5'-TAGGGATCCAGATGATCCAGGCCCAGGAATCC-3' (SEQ ID NO: 11); ZF4, 5'-AGCGTCGACTGGGTTTTCTGTAACATAAAA-3'; (SEQ ID NO:12); ZF5, 5'-TAGGGATCCAGGAGCGCTTGCAGATGTAAAGC-3'; SEQ ID NO: 13), respectively. The PCR amplified fragments were cut with Sail and Bam HI and cloned into the pM vector (Clontech), downstream of the Gal4 binding domain. The reporter plasmid pTK-C AT has a CAT gene under the control of the TK promoter and four Gal4 binding sites up-stream. 1.5 μg of pTK-CAT, 0.1 ug of pCMV-βgal, and 1.5 μg of one of the following constructs: pM, pM-ZFQR, pM-ZFQR(KRAB minus), were used to transfect 3.5x105 HeLa cells in a 35 mm tissue culture dish. Twenty-four hours after transfection CAT enzyme activity and β-Galactosidase enzyme activity were determined using the CAT and β-Galactosidase Enzyme Assay Systems (Promega). CAT enzyme activity was normalized against the β-galactosidase enzyme activity. Significance of the difference of CAT enzyme activity between each group of transfections was analyzed by the Student's t test.

EXAMPLE 8

ZFQR Is a Nuclear Protein Tightly Associated with the Nuclear Matrix

In order to study the potential function of ZFQR protein in cells, the ZFQR coding sequence with an HA tag was expressed from a mammalian expression vector which had been transfected into HeLa cells as described in Example 6. Forty-eight hours posttransfection, the cells were fixed and stained.

The expressed ZFQR protein was found in the nucleus, and had a speckled pattern. ZFQR protein was completely excluded from the nucleoli (FIG. 4a). Subcellular fractionation of the transfected HeLa cells and analysis of the fractions were performed by Western blot as described in Example 6. ZFQR protein was found to be present primarily in the pellet fraction of the nuclear lysate after DNase I treatment, high salt extraction and RNase I treatment. This fraction is mainly comprised of proteins associated with the nuclear matrix of cells, indicating that the ZFQR protein localizes in the nucleus by tight association with the nuclear matrix. (FIG. 4c). Lamin A and C were used as nuclear matrix indicators, and β-tubulin was used as an indicator of cytosolic protein. EXAMPLE 9

ZFQR Possesses Transcription Repression Activity

It has been shown that the KRAB domain found in KRAB zinc finger genes is a potent transcription inhibitor (Witzgall et al, 1994; Margolin et al,

1994). In order to determine whether ZFQR protein had the ability to inhibit transcription, the ZFQR coding region was cloned into the pM vector, downstream of the Gal4 binding domain coding sequence as described in

Example 7. The resulting construct expresses a fusion protein of the Gal4 binding domain and ZFQR. This construct and a CAT reporter construct, pTK-CAT, were transfected into HeLa cells. Co-transfection of pTK-CAT with the vector pM served as the control. CAT activity in the cell lysates was determined as described in Example 7, and the activity in the control was designated as 100%>.

Cells transfected with ZFQR had about six fold less CAT activity than the control, and the difference was significant by the Student's t test (pO.Ol), indicating that

ZFQR does have transcription repression activity.

EXAMPLE 10

The KRAB Domain Cooperates to Maintain The Nuclear Matrix Association

of ZFQR Protein and Is Necessary for Transcriptional Repression

In order to study the role of the KRAB domain of ZFQR, a mutant ZFQR construct lacking this region was generated and cloned into pcDNA3.1 with an HA tag. The expressed mutant ZFQR protein localized primarily to the nucleoli (FIG. 4b), contrary to the wild type ZFQR protein, which was absent from nucleoli (FIG. 4a). When cells transfected with the mutant ZFQR expressing construct were fractionationed and analyzed as in Example 6, more than half of the mutant ZFQR protein no longer associated with the nuclear matrix, but rather was present in fraction number 2. This fraction contains proteins associated with chromatin. However, some mutant ZFQR protein remained associated with the nuclear matrix (FIG. 4d). The mutant ZFQR without the KRAB domain was also cloned into the pM vector (Clontech), and the construct transfected into cells along with the reporter pTK-CAT. No significant difference in CAT activity between control and cells transfected with pM-ZFQR(KRAB minus) was found, indicating that the mutant ZFQR does not have transcription repression activity (FIG. 5). Therefore, the KRAB domain is necessary for the observed transcriptional repression activity of ZFQR.

Of interest was that expression of this gene is up-regulated in non-dividing senescent and quiescent normal human fibroblasts. However, when normal or immortal cells were transiently transfected with a ZFQR expressing construct, no detectable DNA synthesis inhibition was observed indicating ZFQR does not cause cells to stop dividing. When proliferating cells enter a non-dividing stage, such as senescence or becoming quiescent because of serum deprivation, the expression patterns of many genes change with some being decreased or completely shut off, and others increasing (Friedman et al, 1996). Since, the ZFQR protein is associated with the nuclear matrix and has transcriptional repression activity it has the potential to play a role in maintaining cells in the non-dividing state.

EXAMPLE 11

Sodium Butyrate Does Not Reverse the Inhibition Effect of ZFQR

In vitro assays were performed in which the thymidine kinase (TK) promoter placed upstream of the CAT gene (pTKCAT) was incubated with ZFQR nucleic acid sequence in the vector pM (Clontech) (pM-ZFQR) or with vector control pM alone (FIG. 6). The pM vector contains multiple Gal4 binding domains upstream of a polylinker site which is used to clone in a gene of interest by means well known in the art. Using standard means in the art, HeLa cells were transfected utilizing a transfecting agent, Superfect (Qiagen) and kits were used to perform β-galactosidase and CAT assays (Promega). All of the CAT results were normalized against β-galactosidase activity to adjust for transfection efficiency, and all of the transfections had equal amounts of β-galactosidase expressing contructs. Data are shown as fold increase of CAT activity in this and the following FIG.s, which is known in the art to be illustrative of CAT nucleic acid expression levels. Enzyme activity in controls is assigned 1. Numbers on the X- axis indicate quantity of construct utilized in μg.

As was illustrated in FIG. 5, ZFQR is a potent inhibitor of the TK promoter. In FIG. 6, transcription was tested in the presence of sodium butyrate. Sodium butyrate is an inhibitor of histone deacetylases which have been shown to be involved in inhibition of gene transcription. In the presence of sodium butyrate, repression of transcription by ZFQR remained unaffected, which suggests sodium butyrate can not reverse the inhibition effect of ZFQR, and furthermore that the inhibition mechanism of ZFQR is not associated with histone deacetylases.

EXAMPLE 12

ZFQR Can Upregulate Transcription of a Reporter Construct

The affect on transcription of a CAT gene under the Elb promoter by ZFQR in the presence of a known transcription coactivator, VP16 was tested. VP16 is a viral transcription factor from Heφes simplex virus. As in Example 11 and by means standard in the art, a CAT nucleic acid sequence regulated by the

Elb promoter (a promoter from adenovirus standard in the art), both of which are downstream of multiple Gal4 binding sites (pG5CAT) was incubated in the presence of a fusion protein of the Gal4 DNA binding domain (DBD) with ZFQR (pM-ZFQR) and a plasmid expressing a fusion protein of the Gal4 DNA binding domain with VP16 (pM-VP16). The reporters have multiple gal4 binding sites and thus the gal4 DBD-ZFQR and gal4-VP16 fusion proteins can bind to the same region.

Although FIG. 7 shows slight activation with pM-VP16, significant enhancement of transcription is seen in the presence of pM-VP16 and pM-ZFQR, which is further enhanced by including even greater levels of pM-ZFQR. Therefore, ZFQR appears to be able to act as a transcriptional activator.

In a similar manner a reporter construct with the CAT gene driven by the TK promoter was placed downstream of four Gal4 binding sites. FIG. 8 shows that although an increase in transcription can be seen with the pM-VP16 construct alone, transcription is enhanced in the presence of pM-ZFQR.

EXAMPLE 13

Effects of ZFQR and Mutants on pG5CAT Reporter Construct Increasing amounts of various constructs were tested for effects on transcription of the reporter construct pG5CAT. As FIG. 9 illustrates, no significant differences in transcriptional activation were detected between wild- type ZFQR and mutants which contain no KRAB domain (KRAB-d), contain no zinc fmger regions (ZFs-d), or which lack the C-terminal region (C-d). This suggests that other regions of ZFQR are partly or fully responsible for the transcriptional activation capabilities of ZFQR. It is possible that the activation domain of ZFQR is located in a linker region between the KRAB domain and zinc finger region.

EXAMPLE 14

ZFQR has a Stimulatory Effect on the p21 Promoter

ZFQR was tested for having an effect on transcription of p21, a gene involved in cell cycle control (also called p2sdi/wafl/cipl). The p21 gene product is an inhibitor of CDK4 kinase and others, is involved in Gl/S phase control, and is upregulated in senescent and quiescent human fibroblast cells.

Experiments were performed with a reporter construct containing a short p21 promoter (up to the -240 bp region, with the transcription start site being +1) (FIG. 10) or a longer p21 promoter region (up to the -2400 bp region) (FIG. 11). In these experiments the construct pC3-ZFQR was used in which ZFQR with an HA epitope tag added by standard methods of PCR was cloned into the pcDNA3.1 vector (Clontech). Both FIG.s indicate that increasing amounts of pC3-ZFQR (0.25 μg, 0.75 μg, and 1.5μg) increased transcription of a p21 promoter construct, although 0.75μg of ZFQR construct gave a slight decrease in activation compared to 0.25μg in FIG. 10. The construct with the longer p21 promoter has a higher basal level of expression likely due to the presence of additional transcription factor binding sites, such as for p53.

This data suggests ZFQR upregulates transcription of the cell cycle control gene of p21. The ability of ZFQR to control expression of a cell cycle control gene such as p21, which is involved in Gl/S control and is upregulated in senescent and quiescent cells, suggests it is important for establishing or maintaining a cell in a nonproliferating state. Other candidate targets for ZFQR include, in addition to p21, other Cdk inhibitors, such as pl6.

EXAMPLE 15

MRG15 Enhances the Transcription Stimulation Effect of ZFQR

MRG15 is in a family genes which have transcription factor-like motifs, and it also contains a bipartite nuclear localization signal and a chromatin organization modifier (chromo) domain (which in other proteins acts as a negative or positive regulator of transcription). MRG15 may be responsible for global changes in gene expression within a cell because it contains a region homologous to the msl-3 protein in Drosophila, which is associated with regulation of dosage compensation by acting in a multimeric complex to bind many specific sites on the male X chromosome to induce hypertranscription. Other gene products known to associate with MRG15 are other MRG family members, such as MRGX, and MORF4.

To determine if MRG15 affects the transcription stimulation effect of ZFQR, reporter construct pG5CAT was incubated with pM-VP16, pM-ZFQR, or pM-MRG15. As shown in FIG. 12, although a slight fold increase in CAT activity was observed with pM-VP16 alone, a significantly greater upregulation of expression was seen with pM-ZFQR, which was further enhanced with the addition of pM-MRG15. This suggests MRG15 enhances the ability of ZFQR to stimulate transcription.

EXAMPLE 16

A Dominant Negative Mutant of ZFQR Allows Cell Cycle Progression

A mutant of ZFQR is generated by methods well known in the art in which the zinc finger region is deleted or altered to lose its function as a DNA binding domain. Retention of the KRAB domain permits binding of the mutant to other cofactors which are present in a complex. The presence of this dominant negative mutant in the cell titrates away factors necessary for the native ZFQR to function, thereby generating a state in which native ZFQR is downregulated. The loss of native function of ZFQR to act as a transcriptional repressor allows expression of a gene or genes necessary for cell cycle progression.

EXAMPLE 17

Two Hybrid Analysis with ZFQR

By methods described elsewhere herein, two hybrid analysis is performed with ZFQR. In certain embodiments, ZFQR is a natural transactivator, and therefore subregions of ZFQR are used in "bait" plasmids in lieu of the entire coding region, by methods well known in the art.

EXAMPLE 18

Immunoprecipitation with ZFQR Antibodies In another embodiment of the present invention, ZFQR antibodies, generated by methods well known in the art, are utilized during immunoprecipitation experiments to characterize factors which interact with ZFQR. In a specific embodiment, the antibodies are generated against the C- terminal portion of the protein. Methods to perform immunoprecipitation are well known in the art (Harlow, 1999; Ausubel et al, 1994). In immunoprecipitation, an antigen is isolated by binding to an antibody. A sample containing the antigen of interest is obtained by the following exemplary methods: utilizing nondenaturing detergents to release soluble and membrane-associated antigens from cells grown either in suspension culture or as a monolayer on tissue culture dishes; lysing cells with denaturing conditions; or releasing soluble antigens with mechanical disruption of cells. A specific antibody is attached either by noncovalent (protein A-agarose beads) or covalent (Sepharose) means to a solid- phase matrix which is capable of sedimenting with low-speed centrifugation. The antigen is then exposed to the immobilized antibody, followed by extensive washes to remove unbound factors. The complex is then analyzed, such as by electrophoresis or immunoblotting.

EXAMPLE 19

Microinj ection studies

To determine a role for the gene product in maintenance of the non- dividing state, the ZFQR construct was microinj ected into quiescent normal human cells and stimulated to enter the cell cycle by addition of growth factors. Entry into the cell cycle was inhibited in injected cells compared with un-injected controls. More importantly, cells injected with a KRAB minus ZFQR construct were not affected, indicating that this activity was mediated by the KRAB domain (Table 8).

Table 8: Microinjection Studies

Nuclear microinj ection of quiescent HCA2 cells was performed as described (Lumpkin et al, 1985). Briefly, 2.5xl0³ young HCA2 cells were plated onto etched grid coverslips (Bellco glass) in 35 mm tissue culture dishes, in medium containing 10%> serum. Twenty-four hours later the cells were switched to medium containing 0.2% serum and maintained for at least seven days before microinj ection was performed. The number of cells injected within a specific grid was noted. Twenty four hours after microinj ection the cells were stimulated to enter the cell cycle by the addition of 10%> serum. ³H-thymidine was also added to the cells at this time. Twenty four hours later they were fixed and processed for autoradiography. The fraction of labeled nuclei in the injected cells, located by the grid they were in, was compared to the fraction of labeled nuclei in uninjected cells on adjacent sections of the coverslip.

REFERENCES

All patents and publications mentioned in the specification are indicative of the level of those skilled in the art to which the invention pertains. All patents and publications are herein incoφorated by reference to the same extent as if each individual publication was specifically and individually indicated to be incoφorated by reference.

U.S. Patent No. 5,840,873, issued Nov. 24, 1998 U.S. Patent No. 5,843,650, issued Dec. 1. 1998 U.S. Patent No. 5,843,651, issued Dec. 1, 1998 U.S. Patent No. 5,843,663, issued Dec. 1, 1998 U.S. Patent No. 5,846,708, issued Dec. 8, 1998 U.S. Patent No. 5,846,709, issued Dec. 8, 1998 U.S. Patent No. 5,846,717, issued Dec. 8, 1998

U.S. Patent No.5,846,726, issued Dec. 8, 1998 U.S. Patent No. 5,846,729, issued Dec. 8, 1998 U.S. Patent No. 5,846,783, issued Dec. 8, 1998 U.S. Patent No. 5,849,481, issued Dec. 15, 1998 U.S. Patent No. 5,849,483, issued Dec. 15, 1998

U.S. Patent No. 5,849,486, issued Dec. 15, 1998 U.S. Patent No. 5,849,487, issued Dec. 15, 1998 U.S. Patent No. 5,849,497, issued Dec. 15, 1998 U.S. Patent No. 5,849,546, issued Dec. 15, 1998 U.S. Patent No. 5,849,547, issued Dec. 15, 1998

U.S. Patent No. 5,851,770, issued Dec. 22, 1998 U.S. Patent No. 5,851 ,772, issued Dec. 22, 1988 U.S. Patent No.5,853,990, issued Dec. 29, 1998 U.S. Patent No. 5,853, 993, issued Dec. 29, 1998 U.S. Patent No. 5,853,992, issued Dec. 29, 1998

U.S. Patent No. 5,856,092, issued Jan. 5, 1999 U.S. Patent No. 5,858,652, issued Jan. 12, 1999 U.S. Patent No. 5,861,244, issued Jan. 19, 1999 U.S. Patent No. 5,863,732, issued Jan. 26, 1999 U.S. Patent No. 5,863,753, issued Jan. 26, 1999

U.S. Patent No. 5,866,331, issued Feb. 2, 1999 U.S. Patent No. 5,866,337, issued Feb. 2, 1999 U.S. Patent No. 5,900,481, issued May 4, 1999 U.S. Patent No. 5,905,024, issued May 18, 1999 U.S. Patent No. 5,910,407, issued June 8, 1999

U.S. Patent No. 5,912,124, issued June 15, 1999 U.S. Patent No. 5,912,145, issued June 15, 1999 U.S. Patent No. 5,912,148, issued June 15, 1999 U.S. Patent No. 5,916,776, issued June 29, 1999 U.S. Patent No. 5,916,779, issued June 29, 1999 U.S. Patent No. 5,919,626, issued July 6, 1999

U.S. Patent No. 5,919,630, issued July 6, 1999 U.S. Patent No. 5,925,517, issued July 20, 1999 U.S. Patent No. 5,925,525, issued Jul. 20, 1999 U.S. Patent No. 5,928,862, issued July 27, 1999 U.S. Patent No. 5,928,869, issued July 27, 1999

U.S. Patent No. 5,928,870, issued, Jul. 27, 1999 U.S. Patent No. 5,928,905, issued July 27, 1999 U.S. Patent No. 5,928,906, issued July 27, 1999 U.S. Patent No. 5,929,227, issued July 27, 1999 U.S. Patent No. 5,932,413, issued Aug. 3, 1999

U.S. Patent No. 5,932,451, issued Aug. 3, 1999 U.S. Patent No. 5,935,791 , issued Aug. 10, 1999 U.S. Patent No. 5,935,825, issued Aug. 10, 1999 U.S. Patent No. 5,939,291, issued Aug. 17, 1999 U.S. Patent No. 5,942,391, issued Aug. 24, 1999

European Application No. 320 308 European Application No. 329 822 GB Application No. 2 202 328 PCT Application No. PCT/US87/00880 PCT Application No. PCT/US89/01025

PCT Application WO 88/10315 PCT Application WO 89/06700 PCT Application WO 90/07641 PUBLICATIONS

Bangham, et al, "Diffusion of univalent Ions across the Lamellae of Swollen Phospholipids" J. Mol. Biol, 13:238-252, 1965. Bardwell, V.J., and Treisman, R. The POZ domain: a conserved protein-protein interaction motif. Genes Dev. 1994 Jul 15;8(14):1664-77.

Bellefroid, E.J., Poncelet, D.A., Lecocq, D.J., Revelant, O., and Martial, J.A. The evolutionarily conserved Kruppel-associated box domain defines a subfamily of eukaryotic multifingered proteins. Proc Natl Acad Sci U S A. 1991 May 1;88(9):3608-12.

Deamer and P. Uster, "Liposome Preparation: Methods and Mechanisms," in Liposomes (M. Ostro, ed.), Marcel Dekker, Inc., New York (1983), pp. 27-52.

Elser, B., Kriz, W., Bonventre, J.V., Englert, C, and Witzgall, R. The Kruppel- associated box (KRAB)-zinc finger protein Kid-1 and the Wilms' tumor protein WT1, two transcriptional repressor proteins, bind to heteroduplex DNA. J Biol Chem. 1997 Oct 31;272(44):27908-12.

Fraley and Fornari Kaplan, "Entrapment of a bacterial plasmid in phospholipid vesicles:potential for gene transfer," Proc. Nat 'I. Acad. Sci. USA 76:3348-3352, 1979.

Friedman JR, Fredericks WJ, Jensen DE, Speicher DW, Huang XP, Neilson EG, Rauscher FJ 3^r KAP-1, a novel corepressor for the highly conserved KRAB repression domain Genes Dev. 1996 Aug 15;10(16):2067-78.

Ghosh and Bachhawat, "Targeting of liposomes to hepatocytes," In: Wu G. Wu C ed., Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, New York: Marel Dekker, pp. 87-104, 1991.

Gregoriadis G. and Davis C. "Stability of liposomes in vivo and in vitro is promoted by their cholesterol content and the presence of blood cells," Biochem Biophys Res Commun., 89(4):1287-1293, 1979. Gregoriadis, DRUG CARRIERS IN BIOLOGY AND MEDICINE, G. Gregoriadis

(ed.), 1979, pp. 287-341. Grondin, B., Cote, F., Bazinet, M., Aubry, M. Direct interaction of the

KRAB/Cys2-His2 zinc finger protein ZNF74 with a hypeφhosphorylated form of the RNA polymerase II largest subunit. J Biol Chem. 1997

Oct31 ;272(44):27877-85.

Grondin, B., Bazinet, M., and Aubry, M. The KRAB zinc finger gene ZNF74 encodes an RNA-binding protein tightly associated with the nuclear matrix. J Biol Chem. 1996 Jun 28;271 (26): 15458-67. James, P., Hallady, J., and Craig, E.A. Genetics. 1996 Dec. 144(4): 1425-1436.

Kaneda et al, "Increased expression of DNA cointroduced with nuclear protein in adult rat liver," Science, 243:375-378, 1989.

Kaneda et al, "Introduction and expression of the human insulin gene in adult rat liver," J Biol Chem., 264(21): 12126-12129, 1989. Kato et al, "Expression of hepatitis B virus surface antigen in adult rat liver. Co- introduction of DNA and nuclear protein by a simplified liposome method," J Biol Chem., 266(6):3361-3364, 1991.

Kaul, S.C, Duncan, E.L., Englezou, A., Takano, S., Reddel, R.R., Mitsui, Y., and Wadhwa, R. Malignant transformation of NIH 3T3 cells by overexpression of mot-2 protein. Oncogene. 1998 Aug. 20, 17 (7) 907-

911.

Klug, A. and Schwabe, J.W. Protein motifs 5. Zinc fingers. FASEB J. 1995 May;9(8):597-604.

Knochel, W., Poting, A., Koster, M. et Baradi, T., Nietfeld, W., Bonwmeester, T., and Pieler, T. Evolutionary conserved modules associated with zinc fingers in Xenopus laevis. Proc Natl Acad Sci U S A. 1989 Aug;86(16):6097-100.

Klocke, B., Koster, M., Hille, S., Bouwmeestre, T., Bohm, S., Pieler, T., and Knochel, W. The FAR domain defines a new Xenopus laevis zinc finger protein subfamily with specific RNA homopolymer binding activity. Biochim Biophys Acta. 1994 Jan 18;1217(l):81-9.

Margolin, J.F., Friedman, J.R., Meyer, W.K.H., and Vissing, H. Kruppel- associated boxes are potent transcriptional repression domains. Proc Natl Acad Sci U S A. 1994 May 10;91(10):4509-13.

Moosmarm P, Georgiev O, Le Douarin B, Bourquin JP, Schaffher W Transcriptional repression by RING finger protein TIF1 beta that interacts with the KRAB repressor domain of KOX1. Nucleic Acids Res. 1996 Dec 15;24(24):4859-67. Nicolau and Sene, "Liposome-mediated DNA transfer in eukaryotic cells: dependence of the transfer efficiency upon the type of liposomes used and the host cell cycle stage," Biochem. Biophys. Acta, 721 :185-190, 1982. Nicolau et al, "Liposomes as caniers for in vivo gene transfer and expression," Methods Enzymol, 149:157-176, 1987. Numoto, M., Niwa, O., Kaplan, J., Wong, K.K., Menell, K., Kamiya, K.,

Yanagihara, K., and Calame, K Transcriptional repressor ZF5 identifies a new conserved domain in zinc finger proteins. Nucleic Acids Res. 1993 Aug l l ;21(16):3767-75.

Perales et al, "Gene transfer in vivo: sustained expression and regulation of genes introduced into the liver by receptor-targeted uptake," Proc. Natl. Acad.

Sci. USA, 91:4086-4090, 1994. Pereira-Smith, O.M. and Smith, J.R. Genetic analysis of indefinite division in human cells: identification of four complementation groups. Proc Natl

Acad Sci U S A. 1988 Aug;85(16):6042-6. Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990.

Sambrook, Fritsch, Maniatis, In: Molecular Cloning: A Laboratory Manual, Vol. 1, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, Ch. 7,7.19-17.29, 1989. Schwarze, S.R., Ho, A., Vocero-Akbani, A. and Dowdy, S.F. In vivo protein transduction: delivery of a biological active protein into the mouse. Science 1999, 285: 1569-1572.

Shannon, M., Ashworth, L.K., Mucenski, M.L., Lamerdin, J.E., Branscomb, E., and Stubbs, L. Comparative analysis of a conserved zinc finger gene cluster on human chromosome 19q and mouse chromosome 7. Genomics.

1996 Apr 1;33(1): 112-20.

Smith, J.R., Pereira-Smith O.M. Replicative senescence: implication for in vivo aging and tumor suppression. Science 1996, 273:63-67.

Szoka and Papahadjopoulos, "Procedure for Preparation of Liposomes With Large Internal Aqueous Space . . . ", Proc. Natl. Acad. Sci., 75:4194-4198, 1978.

Wadhwa, R., Pereira-Smith, O.M., Reddel, R., Sugimoto, Y., Mitsui, Y., Kaul, S.C. Coπelation between complementation group for immortality and the cellular distribution of mortalin. Exp Cell Res. 1995 Jan;216(l):101-6.

Wadhwa, R., Kaul, S.C, Ikawa, Y. and Sugimoto, Y. Identification of a novel member of mouse hsp70 family. Its association with cellular mortal phenotype. J Biol Chem. 1993 Mar 25;268(9):6615-21.

Wadhwa R, Kaul SC, Mitsui Y, Sugimoto Y. Differential subcellular distribution of mortalin in mortal and immortal mouse and human fibroblasts. Exp Cell Res. 1993 Aug;207(20:442-8. Wagner et al, Science, 260:1510-1513, 1990.

Witzgall, R., Oileary, E., Leaf, A., Onaldi, D., and Bonvents, J. The Kruppel- associated box-A (KRAB-A) domain of zinc finger proteins mediates transcriptional repression. Proc Natl Acad Sci U S A. 1994 May 10;91(10):4514-8. Wong et al, "Appearance of beta-lactamase activity in animal cells upon liposome-mediated gene transfer," Gene., 10(2):87-94, 1980.

Wu and Wu, "Receptor-mediated in vitro gene transfections by a soluble DNA canier system," J. Biol Chem., 262:4429-4432, 1987.

Wu and Wu, Adv. Drug Delivery Rev., 12: 159-167, 1993. One skilled in the art readily appreciates that the present invention is well adapted to carry out the objectives and obtain the ends and advantages mentioned as well as those inherent therein. Sequences, methods, procedures and techniques described herein are presently representative of the prefened embodiments and are intended to be exemplary and are not intended as limitations of the scope. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention or defined by the scope of the pending claims.

Claims

We claim:

1. As a composition of matter, a nucleic acid sequence of SEQ ID NO: 1.

2. As a composition of matter, an amino acid sequence of SEQ ID NO:2.

3. A zinc finger protein comprising an amino acid sequence encoded by SEQ ID

NO:l.

4. A tumor suppressor comprising an amino acid sequence encoded by SEQ ID NO:l.

5. A method of regulating gene expression in a cell comprising the step of repressing transcription of a nucleic acid sequence by administering to said cell an amino acid sequence encoded by SEQ ID NO: 1.

6. A method of regulating gene expression in a cell comprising the step of repressing transcription of a nucleic acid sequence by administering to said cell an amino acid sequence of SEQ ID NO:2.

7. A method of identifying a transformed cell comprising the step of determining the expression level of the nucleotide sequence of SEQ ID NO:l in said cell, wherein when said level is downregulated, said cell is a transformed cell.

8. The method of Claim 7 wherein said expression level is determined by nucleic acid hybridization, polymerase chain reaction, or reporter sequence assay.

9. The reporter sequence of Claim 8 selected from the group consisting of ampicillin, neomycin, kanamycin, β-galactosidase, β-glucuronidase, chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), blue fluorescent protein (BFP), and luciferase.

10. A method of identifying a transformed cell, comprising the step of determining the level of an amino acid sequence of SEQ ID NO: 2 in said cell, wherein when said level is reduced, said cell is a transformed cell.

11. A method of identifying a transformed cell, comprising the step of determining the subcellular localization of an amino acid sequence of SEQ ID NO:2 in a cell, wherein when said sequence is located substantially other than to a nuclear matrix, said cell is a transformed cell.

12. The method of Claim 11 wherein the subcellular localization of said amino acid sequence is identified by a method selected from the group consisting of epitope tagging, subcellular fractionation, immunofluorescence, and immunoblot.

13. A method of generating a transformed cell, comprising the step of reducing the expression level of a nucleic acid sequence of SEQ ID NO:l in a cell to be transformed.

14. The method of Claim 13 wherein said expression level is reduced by inhibiting synthesis of a nucleic acid sequence of SEQ ID NO:l.

15. A method of generating a transformed cell, comprising the step of reducing the level of an amino acid sequence of SEQ ID NO: 2 in a cell to be transformed.

16. The method of Claim 15 wherein said level is reduced by inhibiting synthesis, increasing breakdown, administering antibodies to said sequence or administering an antagonist to said sequence.

17. The method of Claim 15 wherein said level is reduced by transfecting into said cell an antisense sequence of a nucleotide sequence of SEQ ID NO: l

18. A method of generating a transformed cell, comprising the step of administering to a cell a dominant negative form of an amino acid sequence of SEQ ID NO:2.

19. A method of inhibiting proliferation of cell growth comprising the step of increasing the level of nucleic acid sequence of SEQ ID NO:l in said cell.

20. The method of Claim 19 wherein said level is increased by selecting from the group consisting of upregulation of expression of SEQ ID NO:l and transfection of said cell with a nucleic acid sequence of SEQ ID NO:l.

21. A method of inhibiting proliferation of cell growth comprising the step of increasing the level of an amino acid sequence of SEQ ID NO:2 in said cell.

22. The method of Claim 21 wherein said level is increased by selecting from the group consisting of protein transduction and by decreasing protein degradation.

23. A method of inhibiting proliferation of cell growth comprising the step of altering the amino acid sequence of SEQ ID NO:2, wherein when said sequence is altered, said proliferation of cell growth is inhibited.

24. A nucleic acid sequence of SEQ ID NO:l, or fragments and derivatives thereof, wherein said fragments and derivatives encode a KRAB domain.

25. A nucleic acid sequence of SEQ ID NO:l, wherein said sequence comprises an alteration in a sequence which encodes a KRAB domain.

26. An amino acid sequence of SEQ ID NO:2, wherein said sequence comprises an alteration in a KRAB domain.

27. A method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in said cell by administering to said cell an amino acid sequence encoded by SEQ ID NO: l .

28. A method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in said cell by administering to said cell an amino acid sequence of SEQ ID NO:2.

29. The method of Claim 27 or 28 wherein said nucleic acid sequence is selected from the group consisting of p21 and pl6.

30. A method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in said cell by administering to said cell an amino acid sequence encoded by SEQ ID NO: l and a coactivator.

31. A method of regulating gene expression in a cell comprising the step of upregulating transcription of a nucleic acid sequence in said cell by administering to said cell an amino acid sequence of SEQ ID NO:2 and a coactivator.

32. The method of Claim 30 or 31 wherein said nucleic acid sequence is involved in cell cycle control.

33. The method of Claim 30 or 31 wherein said nucleic acid sequence is selected from the group consisting of p21 and pl6.

34. The method of Claim 30 or 31 wherein said coactivator is selected from the group consisting of VP16, MRG15, MRGX and MORF4.

35. A complex for upregulating transcription of a nucleic acid sequence wherein said complex comprises SEQ ID NO: 2 and an amino acid sequence selected from the group consisting of VP16, MRG15, MRGX, MORF4, and a combination thereof.

36. The complex of Claim 35 wherein said nucleic acid sequence is selected from the group consisting of p21 and pl6.

37. A non-human knockout animal comprising a defective allele of SEQ ID NO: l .

38. A non-human knockout animal comprising two defective alleles of SEQ ID NO:l .

39. The knockout animal of Claim 37 or 38, wherein said animal is a mouse.

40. A transgenic non-human animal comprising an expression cassette, wherein said cassette comprises a nucleic acid encoding SEQ ID NO: l, or a functionally active fragment thereof, under the control of a promoter active in eukaryotic cells.

41. The animal of claim 40, wherein said promoter is constitutive.

42. The animal of claim 40, wherein said promoter is tissue specific.

43. The animal of claim 40, wherein said promoter is inducible.

44. The animal of claim 40, wherein said animal is a mouse.

45. A monoclonal antibody that binds immunologically to a polypeptide comprising SEQ ID NO: 2, or an antigenic fragment thereof.

46. A polyclonal antisera, antibodies of which bind immunologically to a polypeptide comprising SEQ ID NO:2, or an antigenic fragment thereof.

47. A method of screening for a peptide which interacts with a polypeptide of SEQ ID NO:2, comprising the steps of: (a) introducing into a cell: a first nucleic acid comprising a DNA segment encoding a test peptide, wherein said test peptide is fused to a DNA binding domain; and

a second nucleic acid comprising a DNA segment encoding at least a part of said polypeptide of SEQ ID NO:2, wherein said at least part of said polypeptide of SEQ ID NO:2 is fused to a DNA activation domain; and

(b) assaying for an interaction between said test peptide and said at least part of said polypeptide of SEQ ID NO:2 by assaying for an interaction between said DNA binding domain and said DNA activation domain.

48. The method of claim 47, wherein said DNA binding domain and said DNA activation domain are selected from the group consisting of GAL4 and LexA.

49. A kit comprising primers for amplification of a nucleic acid sequence of SEQ ID NO:l .

50. The kit of Claim 49, wherein said primers are selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO: 10.

51. A pharmaceutical composition comprising a nucleic acid sequence of SEQ ID NO: 1 and a pharmaceutically acceptable caπier.

52. The composition of Claim 51, wherein said nucleic acid sequence is contained on a recombinant vector, wherein said vector is selected from the group consisting of a plasmid, an adenoviral vector, an adeno-associated viral vector, a retroviral vector, a liposome, a lipid, and a combination thereof.

53. A pharmaceutical composition comprising an amino acid sequence of SEQ ID

NO:2 and a pharmaceutically acceptable caπier.