WO2001023568A2 - Members of the iap gene family - Google Patents

Abstract

DNA and protein sequences are disclosed for several new members of the IAP gene family, namely ILP-2 and ILP-3 homologs which modulate TGFβ receptor activity. The ILP-2 sequence modulates apoptosis and activates JNK activity. ILP-3 inhibits ILP-1-mediated JNK activation. The disclosure also includes specific binding agents (such as antibodies) that recognize ILP-2 and ILP-3, methods of decreasing apoptosis by increasing ILP-2 expression, methods of increasing apoptosis by decreasing ILP-2 expression, methods of treating disease caused by mutations, therapeutic compositions that include ILP-2 and/or ILP-3, recombinant DNA molecules, probes, and transformed cells that incorporate the DNA sequence to express ILP-2 and/or ILP-3. The disclosure also includes methods of diagnosis and treatment of diseases caused by an increased expression of ILP-2 and/or ILP-3, such as neurodegenerative diseases, and methods of treatment of diseases caused by unwanted apoptosis, such as occurs in autoimmune diseases and neurodegenerative disorders. The disclosure also includes methods of diagnosis and treatment of diseases caused by an underexpression of ILP-2 and/or ILP-3, such as cancer.

Description

NOVEL MEMBERS OF THE IAP GENE FAMILY

FIELD

This disclosure relates to nucleic acid sequences and proteins of novel members of the iap gene family, which are involved in apoptosis.

BACKGROUND

Apoptosis is a genetically determined, biochemically ordered process in which cells are induced to initiate a cellular suicide program in response to physiologic signals, cellular damage or virus infection (Clem and Miller. 1994, Induction and inhibition of apoptosis by insect viruses, p. 89- 110. In L. D. T. a. F. O. Cope (ed.), Apoptosis II: The Molecular Basis of Apoptosis in Disease. Cold Spring Harbor Laboratory Press; Kerr et al. 1972, Br. J. Cancer 26:239-57; Vaux et αl. 1994, Cell 76:777-9; White, E. 1993, Genes Dev. 7:2277-84). The principal executors are a family of cysteine proteases known as caspases (Salvesen and Dixit, 1997, Cell 91:443-6; Thornberry and Lazebnik, 1998, Science 281:1312-6). These proteases, which cleave with a high degree of specificity after aspartate residues, are initially produced in the cell as inactive precursors, the activation of which controlled by a variety of regulatory factors and events. Numerous regulators of apoptosis have been identified, and have been shown to exert their effects ultimately by effecting levels of caspase activity. For example, the Bcl-2 family of proteins regulate apoptosis through the control of mitochondrial integrity. Pro-apoptotic signals result in the release of cytochrome c from the mitochondria into the cytosol (Chen-Levy and Cleary, 1990, J. Biol. Chem. 265:4929-33; Krajewski et al, 1993., Cancer Res. 53:4701-14; Lithgow et al, 1994, Cell. Growth. Diff. 5:411-7; Nguyen et al, 1993, J. Biol. Chem. 268:25265-8).

In contrast to the mechanisms employed by Bcl-2-related proteins, several members of the inhibitor of apoptosis (IAP) family of proteins are thought to bind directly to caspases and inhibit their enzymatic activity (Manji et al, 1997, J. Virol 71:4509-16). The first IAP protein was discovered in insect viruses, but human genomes are known to contain several of these genes. Three IAP's, X-linked LAP (XIAP; also known as human IAP-like protein-1 [hILP-1]), cIAP-1 (also known as hiap2), and cIAP-2 (also known as hiapl), are widely expressed in mammalian tissues and are broad inhibitors of apoptosis (Duckett et al, 1996, EMBO J. 15:2685-94; Liston et al, 1996, Nature 379:349-53 ; Rothe et al. , 1995, Cell 83 : 1243-52). Their predicted open reading frames share several common features: all three IAPs have three tandem repeats of an approximately 70 residue domain known as the BIR (baculovirus iap repeat), followed by an amphipathic 'spacer' region of unknown function, and a single carboxy-terminal RING finger domain (Duckett et al, 1996, EMBO J. 15:2685-94; Liston et al, 1996, Nature 379:349-53). Both the BIR and RING finger domains are thought to be involved in protein-protein interactions, although their precise functions are currently unknown. Two other iap's include neuronal apoptosis inhibitor protein (NAIP) and survivin.

In vitro evidence indicates that cIAP-1, cIAP-2, and ILP-1 /XIAP inhibit cell death by interacting with and inhibiting specific caspases, namely Caspases -3, -7 and -9 (Devereaux et al, 1997, Nature 388:300-4; Roy et al., 1997, EMBO J. 16:6914-25). These IAPs may have widely divergent signaling functions as well. cIAP-1 and cIAP-2 modulate tumor necrosis factor (TNF) receptor signaling through their interaction with TRAFl and TRAF2, critical interactors with several TNF receptors. hlLP has been shown not to interact with any of the TRAFs, but has recently been implicated in the bone morphogenetic protein (BMP) receptor signaling pathway. Additionally, hlLP specifically activates c-Jun N-terminal kinase (JNK), a kinase critical to the MAP kinase cascade.

SUMMARY OF THE DISCLOSURE

The present disclosure describes the cloning and analysis of ILP-2 and ILP-3, two novel members of the iap gene family. Despite their sequence homology to hlLP, ILP-2 and ILP-3 have different structures based on their predicted open reading frames. ILP-2 encodes a single amino- terminal BIR followed by a spacer region and a carboxy-terminal RING finger domain while ILP-3 encodes a spacer region and a ring domain. ILP-2 and ILP-3 are expressed at low levels in several different tissues. Both ILP-2 and ILP-3 interact with the TGFβ receptor (TGFβR), and modulate TGFβR activity. ILP-2 potently inhibits apoptosis induced by overexpression of Bax or by Caspase- 9 and Apaf-1, but without substantial protective effect on apoptosis mediated by Fas/ CD95. ILP-2 blocks activation of the Apaf-1 :Caspase-9 holoenzyme complex, but without substantially inhibiting holoenzyme activity once the extracts had been activated. ILP-2 co-precipitates a processed form of Caspase-9. indicating a direct physical interaction between ILP-2 and Caspase-9 and cleavage of Caspase-9 at Asp-315 is necessary for the ability of processed Caspase-9 to interact with ILP-2. ILP- 2 activates JNK activity, while ILP-3 moderately inhibits ILP-1 -mediated JNK activation when co- transfected with ILP-1.

The cDNA and protein sequences of ILP-2 and ILP-3 for several primates are also disclosed. Disclosed herein are purified proteins having ILP-2 biological activity, which modulates apoptosis, or ILP-3 biological activity, which decreases JNK activation when co-administered (such as co-transfected) with ILP- 1. In some disclosed embodiments, the ILP-2 protein has the amino acid sequence shown in either SEQ ID NOS 14, 16. or 18 or amino acid sequences that differ from those specified in SEQ ID NOS 14, 16, or 18 by one or more conservative amino acid substitutions, or amino acid sequences having at least 80% sequence identity to those sequences, for example sequences that are at least 85%, 90%, 92%, 95%, 98% or 99% identical. In other embodiments, the ILP-3 protein has the amino acid sequence shown in either SEQ ID NOS 2, 4, 6, 8, 10, or 12 or amino acid sequences that differ from those specified in SEQ ID NOS 2, 4, 6, 8, 10, or 12 by one or more conservative amino acid substitutions, or amino acid sequences having at least 85% sequence identity to those sequences, for example sequences that are at least 87%, 90%, 92%, 95%, 98% or 99% identical.

In particular embodiments, the ILP-2 amino acid sequence contains at least 10, 15, 20, 25, 30 , 40 or 50 contiguous amino acid residues of SEQ ID NOS 14, 16, or 18 and the ILP-3 amino acid sequence contains at least 10. 15, 20, 25, 30 , 40 or 50 contiguous amino acid residues of SEQ ID NOS 2, 4, 6, 8, 10, or 12. Also included is an isolated nucleic acid molecule encoding a biologically active ILP-2 or ILP-3 protein, particularly such molecules that include a promoter sequence operably linked to the nucleic acid molecule for expression of the ILP-2 or ILP-3 protein, respectively, as well as transgenic cells containing these molecules. In addition to such variants that retain biological activity of the ILP-2 or ILP-3 protein, fragments of the sequences that have or retain such activity may be used. Such fragments may, for example, include at least 50%, 75%, 80%, 90%, 92%, 95%, 98% or 99% of the amino acid residues of the native peptide sequence. Also disclosed are pruified proteins having ILP-2 and/or ILP-3 biological activity. Fusion proteins of ILP-2 or ILP-3, or variants, fragments, polymorphisms, or mutants thereof, with other amino acid sequences are also disclosed.

In particular embodiments, the isolated nucleic acid molecule includes at least 20, 30, 40 or 50 contiguous nucleotides of a sequence selected from SEQ ID NOS 3, 5, 9, 11, 15 or 17, or its complementary strand. In other embodiments, the isolated nucleic acid molecule includes at least 62, 65, or 70 contiguous nucleotides of a sequence selected from SEQ ID NO 1 or its complementary strand. In yet other embodiments, the isolated nucleic acid molecule includes at least 62, 65, or 70 contiguous nucleotides of a sequence selected from SEQ ID NO 1 or its complementary strand. Also disclosed are isolated nucleic acid molecules including at least 50, 55 or 60 contiguous nucleotides of a sequence selected from nucleotides 1-580, 847-1197 or 846-1200 of SEQ ID NO 1, or its, complementary strand and isolated nucleic acid molecules including at least 21, 25, 30 or 50 contiguous nucleotides of a sequence selected from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13, or its, complementary strand

Alternatively, the isolated nucleic acid molecule includes a nucleic acid molecule that is at least 80% homologous to SEQ ID NOS 13, 15, or 17, and encodes a protein having ILP-2 biological activity. Alternatively, the isolated nucleic acid molecule includes a nucleic acid molecule that is at least 85% homologous to SEQ ID NOS 1, 3, 5, 7, 9, or 11, and encodes a protein having ILP-3 biological activity. In another embodiment, the nucleic acid molecule has a sequence which hybridizes under stringent conditions to the sequences defined in SEQ ID NOS 1, 3, 5, 7, 9, 11, 13, 15, or 17 or which has the full length sequence of SEQ ID NOS 1, 3, 5, 7, 9, 11, 13, 15, or 17 or its complementary strand. In other embodiments, the nucleic acid molecule has a sequence which hybridizes under conditions of at least 75% or 90% stringency to the sequences defined in SEQ ID

NO NOS 1, 3, 5, 7, 9, 11, 13, 15, or 17 or which has the full length sequence of SEQ ID NOS 1, 3, 5, 7, 9, 11, 13, 15, or 17 or its complementary strand. In yet another embodiment, the nucleic acid molecule has a sequence depicted as bases 2074-2784 of SEQ ID NO 13, and encodes a protein having ILP-2 biological activity, for example the amino acid sequence shown in SEQ ID NO 14. In other embodiments, the nucleic acid molecule has a sequence depicted as bases 847- 1197 of SEQ ID NO 1, and encodes a protein having ILP-3 biological activity, for example the amino acid sequence shown in SEQ ID NO 2.

Another embodiment includes isolated nucleic acid molecules (such as oligonucleotides) which are capable of specifically hybridizing to an ILP-2 and/or ILP-3 gene, for example a nucleic acid molecule having at least 20 or 30 consecutive nucleotides of the sequences shown in SEQ ID NOS 3, 5, 7, 9, 1 1 , 13, 15 or 17. Alternatively, the nucleic acid molecules have at least 62, 65, or 70 contiguous nucleotides of the sequences shown in SEQ ID NO 1 ; at least 50, 55 or 60 contiguous nucleotides of a sequence selected from nucleotides 1-580, 847-1197 or 846-1200 of SEQ ID NO 1 ; or at least 21, 25, 30 or 50 contiguous nucleotides of a sequence selected from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13. In yet another embodiment, antisense oligonucleotides are disclosed which hybridize to RNA or a plus strand of the nucleic acids disclosed herein and inhibits ILP-2 and/or ILP-3 biological activity are provided.

Also disclosed herein are recombinant vectors that include any of the nucleic acid molecules, and transgenic hosts into which the recombinant vector is incorporated. Also disclosed are the purified peptides encoded by any of these nucleic acid molecules, such as proteins (including fusion proteins) having ILP-2 biological activity which can be used to modulate-apoptosis. In particular embodiments, the peptide has an amino acid sequence shown in SEQ ID NO 14, 16, or 18 or variants, mutants, polymorphisms, or fragments thereof. In addition, the purified peptides encoded by any of these nucleic acid molecules, such as proteins (including fusion proteins) having ILP-3 biological activity which can be used to decrease JNK activation, are disclosed. In particular embodiments, the peptide has an amino acid sequence shown in SEQ ID NO 2, 4, 6, 8, 10, or 12 or variants, mutants, polymorphisms, or fragments thereof.

Also disclosed are specific binding agents capable of specifically binding to an ILP-2 and/or ILP-3 protein, for example polyclonal antibodies, monoclonal antibodies, and fragments of monoclonal antibodies that specifically bind to the ILP-2 and/or ILP-3 protein. Such specific binding agents can be used in assays for quantitating amounts of purified ILP-2 and/or ILP-3, for example to diagnose diseases associated with abnormal ILP-2 and/or ILP-3 expression.

Other embodiments include a composition having a therapeutically effective amount of a protein with ILP-2 and/or ILP-3 biological activity, in combination with a pharmaceutically acceptable carrier, for treating conditions in which ILP-2 and/or ILP-3 activity is impaired or lost. In other embodiments (examples), the composition further includes one or more other anti-apoptotic compounds. The protein having ILP-2 and/or ILP-3 biological activity contained within such compositions includes any ILP-2 and/or ILP-3 protein or peptide disclosed herein, including fragments and variants. In other examples, the composition can include a therapeutically effective amount of a specific binding agent described above and a pharmaceutically acceptable carrier. In yet other examples, the composition can include a therapeutically effective amount of antisense oligonucleotides described above and a pharmaceutically acceptable carrier.

The disclosed compositions can be used to decrease apoptosis. In other embodiments, the compositions disclosed herein can be used to inhibit Bax-induced apoptosis, for example in amounts sufficient to inhibit Bax-induced apoptosis in a subject, such as a human, who suffers from unwanted apoptosis. The compositions can be used in subjects who suffer from a condition such as a cancer, autoimmune or neurodegenerative disease, for example diabetes, multiple sclerosis or retinal degeneration, which is characterized by unwanted apoptosis. Alternatively, the disclosed compositions can be used for promoting apoptosis in a subject, such as a human, in whom apoptosis is desired. The compositions can be used in subjects who suffer from a condition such as cancer.

Also disclosed herein are methods for detecting an enhanced susceptibility of a subject to disease associated with abnormal apoptosis, by detecting a deletion of or within an ILP-2 gene, detecting other mutations of an ILP-2 gene and/or the abnormal expression such as a decrease or absence of ILP-2 protein in cells of a subject, such as a human. For example, in an extreme case, a total absence of ILP-2 protein may be detected. The disease may be cancer in which apoptosis is abnormally decreased, or an autoimmune disease, or a neurodegenerative disease in which apoptosis is abnormally increased. In certain embodiments, a mutation (such as a substitution, insertion or deletion) of or in an ILP-2 gene can be detected by incubating a nucleic acid, such as an oligonucleotide, with the nucleic acid of the cell under conditions such that the oligonucleotide will specifically hybridize to an ILP-2 gene present in the nucleic acid to form an oligonucleotide: ILP-2 gene complex, and then detecting an increase or decrease of oligonucleotide:ILP-2 complexes, wherein the decrease of said complexes indicates a mutation (such as a deletion of or within) the ILP- 2 gene. In an extreme case, this mutation may be a total absence of the ILP-2 gene. The present invention also provides methods for detecting the presence of ILP-2 protein in a cell by incubating a specific binding agent of the present invention with proteins of the cell under conditions such that the specific binding agent will specifically bind to a ILP-2 protein present in the cell to form a specific binding agent:ILP-2 protein complex, and detecting an increase or decrease (or quantity) of specific binding agent:ILP-2 protein complexes, including a total absence of the ILP-2 protein.

In another embodiment, ILP-2 biological activity can be supplied to a cell which has lost its ILP-2 and/or ILP-3 biological activity, for example by a mutation of the ILP-2 and/or ILP-3 gene, for example by a deletion of all or a portion of an ILP-2 and/or ILP-3 gene, by introducing an ILP-2 and/or ILP-3 gene into the cell so that the ILP-2 and/or ILP-3 gene is expressed in the cell. In specific embodiments, the ILP-2 and/or ILP-3 biological activity is supplied to treat a disease of abnormal apoptosis.

Also disclosed herein are methods for decreasing apoptosis in a cell by increasing the level of ILP-2 biological activity, which prevents the cell from undergoing apoptosis. In one embodiment, the cell is a neuron which has decreased ILP-2 protein expression or the cell has decreased ILP-2 biological activity or expression, relative to ILP-2 biological activity or expression in a same tissue type that is undergoing apoptosis. In certain embodiments, increasing the level of ILP-2 biological activity can be achieved by exposing the cell to a therapeutically effective amount of any of the ILP- 2 proteins (including fragments, mutants, polymorphisms and variants) disclosed herein. In other embodiments, the methods for decreasing apoptosis can be used to treat a disease of abnormal apoptosis, for example, autoimmune and neurodegenerative diseases, such as diabetes, multiple sclerosis and retinal degeneration.

Methods are also provided for inducing apoptosis in a subject by administering a therapeutically effective amount of an antisense oligonucleotide disclosed herein sufficient to induce apoptosis (including increased apoptosis) in the subject, for example a human. In a particular embodi ent, inducing apoptosis treats a disease of insufficient apoptosis. In another embodiment, the antisense oligonucleotide specifically inhibits expression of ILP-2 protein, for example for diseases associted with excess apoptosis. The antisense molecule may include at least 20, 30, 40, 50, or even 100 contiguous nucleotides of a sequence that is complementary to at least a portion of an RNA transcript of a ILP-2 gene, and is hybridizable to the RNA transcript, such as SEQ ID NOS 13, 15, or 17.

In another embodiment, methods for treating a disease caused by a mutation in SEQ ID NOS 1, 3, 5, 7, 9, 1 1, 13, 15 or 17, or a complementary strand, by supplying a therapeutically effective amount of a polypeptide product or the nucleic acid, are disclosed. In yet another embodiment, a method is disclosed of inhibiting Bax-induced apoptosis in a subject by administering a therapeutically effective amount of a purified protein having ILP-2 biological activity, or a nucleic acid which can express a protein having ILP-2 biological activity. In particular embodiments, the purified protein is any protein disclosed herein, which has ILP-2 biological activity. Also included is a method for detecting an enhanced susceptibility of an individual to types of cancers in which the JNK pathway is abnormal, by detecting an abnormality in ILP-2 or ILP-3 expression or regulation. An enhanced susceptibility of an individual to tumors associated with ILP- 2 or ILP-3 dysfunction, can be detected by incubating an oligonucleotide with nucleic acid of the cell under conditions such that the oligonucleotide will specifically hybridize to an ILP-2 or ILP-3 gene present in the nucleic acid to form an oligonucleotide: gene complex, and detecting the presence or absence of the gene complex, wherein the absence of the complex indicates a mutation of the gene. Tumors in which TNFα or JNK expression or function is abnormal can be treated by administering to the subject a therapeutically effective amount of the ILP-2 or ILP-3 + ILP-1 protein, or an analogue, derivative or mimetic of ILP-2 or ILP-3. The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description of several embodiments which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1 is a schematic drawing showing the location of the BIR and RING finger domains in

XIAP, ILP-2 and ILP-3.

FIG. 2 shows the alignment of several primate ILP-2 amino acid sequences.

FIG. 3 shows the alignment of several primate ILP-3 amino acid sequences.

FIG. 4 is a digital image showing the Southern blot analysis of EcoRJ-digested genomic DNA from great apes (human, chimpanzee, and gorilla), old world monkeys (baboon, cynomolgus monkey, and rhesus monkey), and mouse, demonstrating that ILP-2 and ILP-3 are present in primates, but not mice.

FIG. 5 is a drawing showing a primate phylogenetic tree of primates, demonstrating the emergence of ILP homologs during the evolution of great apes. M Yr: Million years. FIG. 6 is a digital image showing the RT-PCR analysis of total RNA from several human tissues using ILP-2-specific oligonucleotide primers.

FIG. 7 is a digital image of a Western blot of protein lysates from human testis and placenta showing that hILP-2 is transcribed and translated in human testis. FIG. 8 is a digital image showing the RT-PCR analysis of total RNA from several human tissues using ILP-3-specific oligonucleotide primers.

FIG. 9 is a bar graph demonstrating that ILP-2 inhibits apoptosis induced by (A) Bax but not by (B) Fas/CD95.

FIG. 10 is a bar graph showing that co-transfection of Caspase-9 with Apaf-1, ILP- 1/XIAP and ILP-2 potently inhibited cell death induced by Caspase-9.

FIG. 1 1 is a graph showing the relative amount of caspase activity when recombinant ILP- 1/XIAP, ILP-2, or elution buffer (control) incubated with 293 extracts (A) before or (B) after the addition of ATP, demonstrating that ILP-2 selectively inhibits the Apaf-1 :Caspase-9 complex.

FIG. 12 is a digital image of a protein gel showing that a processed form of Caspase-9 co- precipitates with ILP-2 but not ILP-1 .

FIG. 13 is a digital image of a protein gel showing that cleavage of Caspase-9 at Asp-315 is necessary for the ability of processed Caspase-9 to interact with ILP-2.

FIG. 14 is a digital image of a protein gel showing that caspase-9 co-precipitated with Δ2BIR-ILP-1, as well as ILP-2, but not with ILP-1. FIG. 15 is a digital image of a protein gel showing that both ILP-2 and ILP-3 interact with

TGF-β receptor.

SEQUENCE LISTING

The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.

SEQ ID NO 1 shows a cDNA sequence for human ILP-3.

SEQ ID NO 2 shows a protein sequence for human ILP-3. SEQ ID NO 3 shows a cDNA sequence for Baboon ILP-3.

SEQ ID NO 4 shows a protein sequence for Baboon ILP-3.

SEQ ID NO 5 shows a cDNA sequence for Chimpanzee ILP-3.

SEQ ID NO 6 shows a protein sequence for Chimpanzee ILP-3.

SEQ ID NO 7 shows a cDNA sequence for Cynomolgus monkey ILP-3. SEQ ID NO 8 shows a protein sequence for Cynomolgus monkey ILP-3.

SEQ ID NO 9 shows a cDNA sequence for Gorilla ILP-3.

SEQ ID NO 10 shows a protein sequence for Gorilla ILP-3.

SEQ ID NO 1 1 shows a DNA sequence for Rhesus Monkey ILP-3.

SEQ ID NO 12 shows a protein sequence for Rhesus Monkey ILP-3. SEQ ID NO 13 shows a cDNA sequence for Human ILP-2, Genbank accession number AF 164682.

SEQ ID NO 14 shows a protein sequence for Human ILP-2.

SEQ ID NO 15 shows a cDNA sequence for Chimpanzee ILP-2. SEQ ID NO 16 shows a protein sequence for Chimpanzee ILP-2.

SEQ ID NO 17 shows a cDNA sequence for Gorilla ILP-2.

SEQ ID NO 18 shows a protein sequence for Gorilla ILP-2.

SEQ ID NOS 19-20 show nucleic acid sequences of PCR primers which can be used to amplify a fragment of a hILP-3 DNA. SEQ ID NOS 21-28 show nucleic acid sequences of PCR primers which can be used to amplify a hILP-3 DNA sequence.

SEQ ID NOS 29-32 show nucleic acid sequences of PCR primers which can be used to amplify a hILP-2 DNA sequence.

SEQ ID NOS 33-34 show nucleic acid sequences of PCR primers which can be used to clone an ILP-3 cDNA from other species.

SEQ ID NOS 35-36 show nucleic acid sequences of PCR primers which can be used to clone an ILP-2 cDNA from other species.

SEQ ID NOS 37-38 show nucleic acid sequences of PCR primers which can be used to clone a human ILP-2. SEQ ID NO 39 shows a nucleic acid sequences of a PCR primer which can be used to amplify ILP-2.

SEQ ID NOs 40-41 show nucleic acid sequences of PCR primers which can be used to amplify GAPDH.

DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS

Abbreviations and Definitions

The following definitions and methods are provided to better define the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. It must be noted that as used herein and in the appended claims, the singular forms "a" or "an" or "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a protein" includes a plurality of such proteins and reference to "the antibody" includes reference to one or more antibodies and equivalents thereof known to those skilled in the art, and so forth.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs.

RT room temperature

SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis

Antisense molecules or antisense oligonucleotides: Nucleic acid molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA (Weintraub, Scientific American 262:40, 1990). In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate a mRNA that is double stranded. In one embodiment, the antisense oligomer is about 15 nucleotides, which are easily synthesized. The use of antisense molecules to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem. 172:289, 1988).

Therapeutically effective antisense molecules are characterized by their ability to inhibit the expression of ILP-2 and/or ILP-3. Complete inhibition is not necessary for therapeutic effectiveness, some oligonucleotides will be capable of inhibiting the expression of ILP-2 and/or ILP-3 by at least 15%, 30%, 40%, 50%, 60%, or 70%.

Therapeutically effective antisense molecules are additionally characterized by being sufficiently complementary to ILP-2 and/or ILP-3 encoding nucleic acid sequences. As described below, sufficient complementary means that the therapeutically effective oligonucleotide or oligonucleotide analog can specifically disrupt the expression of ILP-2 and/or ILP-3, and not significantly alter the expression of genes other than ILP-2 and/or ILP-3.

Cancer: Malignant neoplasm that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis. cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences which determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.

Chemical synthesis: The artificial means by which one can make a protein or peptide, for example as described in EXAMPLE 23.

Deletion: The removal of a sequence of DNA, the regions on either side being joined together.

DNA: Deoxyribonucleic acid. DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid, RNA). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides, referred to as codons, in DNA molecules code for amino acid in a polypeptide. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

ILP-2 biological activity: Such biological activity includes the ability to modulate (and especially decrease) Bax-induced apoptosis. Alternatively (or in addition), the protein has the ability to inhibit Bax-induced apoptosis by more than a desired amount, for example by a factor of at least 2, for example at least 3, for example at least 5, (where the factor refers to at least approximately double (or triple, or quintuple) the cell viability using the assay described in EXAMPLE 5). Alternatively (or in addition), the protein has the ability to inhibit Bax-induced apoptosis by a desired amount, for example by an amount that is nearly identical to an amount obtained with ILP-1 , using the cell viability using the assay described in EXAMPLE 5. Alternatively (or in addition), the protein has the ability to bind to and interact with the TGFβR, and to modulate the activity of TGFβR, as determined by the assays described in EXAMPLE 8. In other embodiments, ILP-2 decreases Bax-induced apoptosis by inhibiting the Caspase-9: Apaf-1 complex, for example by about 3 fold, for example by about 5 fold (where the factor refers to the increase in cell viability using the assay described in EXAMPLE 5). In yet another embodiment, ILP-2 decreases activation of the Caspase-9: Apaf-1 holoenzyme, for example by about 1.5 fold after six minutes, for example by about 2 fold after six minutes (where the factor refers to the decrease in extract activation using the assay described in EXAMPLE 5) but without substantially inhibiting the holoenzyme complex or active Caspase-3. In other embodiments, ILP-2 co-precipitates a processed form of Caspase-9, using the methods described in EXAMPLE 6. In a further embodiment, cleavage of Caspase-9 at Asp-315 is necessary for the ability of processed Caspase-9 to interact with ILP-2. In yet another embodiment, the protein can activate JNK activity, for example by about 3 fold, for example by about 4.7 fold, (where the factor refers to the increase in JNK activity in an in vitro kinase assay using c-Jun protein as a substrate, as described in EXAMPLE 9). In yet another embodiment, the protein significantly blocks the ability of hlLP to prevent caspasel -induced cell death, as described in EXAMPLE 11.

In very particular embodiments, the biological activity includes any combination of the characteristics in this paragraph, or all of them. ILP-3 biological activity: Such biological activity includes the ability to bind, interact with and modulate the activity of TGFβR as determined by the assay described in EXAMPLE 8. Alternatively (or in addition), the protein has the ability to decrease JNK activation co-administered with ILP-1, for example, to moderately inhibit ILP-1 -mediated JNK activation when co-transfected with ILP-1, using the assay described in EXAMPLE 9. ILP-2 or ILP-3 cDNA: An ILP-2 or ILP-3 cDNA is functionally defined as cDNA molecule which encodes a protein having ILP-2 or ILP-3 biological activity, respectively. The ILP-2 or ILP-3 cDNA can be derived by reverse transcription from the mRNA encoded by the ILP-2 or ILP-3 gene, respectively and lacks internal non-coding segments and transcription regulatory sequences present in the ILP-2 or ILP-3 gene, respectively. ILP-2 or ILP-3 fusion protein: A fusion protein comprising an ILP-2 or ILP-3 protein (or variants, polymorphisms, mutants, or fragments thereof) linked to other amino acid sequences.

ILP-2 or ILP-3 gene: A gene which encodes a protein having ILP-2 or ILP-3 biological activity, respectively. The definition of an ILP-2 or ILP-3 gene includes the various sequence polymorphisms and allelic variations that may exist within a population, or in other species. ILP-2 protein: The protein encoded by an ILP-2 gene or cDNA. This protein may be functionally characterized by its biological ability as described above. ILP-2 proteins include the full-length ILP-2 transcript (SEQ ID NOS 14, 16, and 18), as well as shorter peptides which retain ILP-2 biological activity. ILP-2 or ILP-3 RNA: The RNA transcribed from an ILP-2 or ILP-3 gene, respectively. ILP-3 protein: The protein encoded by an ILP-3 gene or cDNA. This protein may be functionally characterized by its biological ability as described above. ILP-3 proteins include the full-length ILP-3 transcript (SEQ ID NOS 2, 4, 6, 8, 10, and 12), as well as shorter peptides which retain ILP-3 biological activity.

Isolated: An "isolated" biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been "isolated" thus include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

Malignant: Cells which have the properties of anaplasia invasion and metastasis. Mimetic: A molecule (such as an organic chemical compound) that mimics the activity of a protein, such as the biological activity of ILP-2 and/or ILP-3. Peptidomimetic and organomimetic embodiments are within the scope of this term, wherein the three-dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid sidechains in the peptide, resulting in such peptido- and organomimetics of the peptides having substantial specific inhibitory activity. For computer modeling applications, a pharmacophore is an idealized, three-dimensional definition of the structural requirements for biological activity. Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD). See Walters, "Computer-Assisted Modeling of Drugs", in Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, IL, pp. 165-174 and Principles of Pharmacology (ed. Munson, 1995), chapter 102 for a description of techniques used in computer assisted drug design. EXAMPLE 22 describes other methods which can be used to generate mimetics.

Mutant ILP-2 gene: A mutant form of the ILP-2 gene which in some embodiments is associated with disease, for example: cone-rod retinal dystrophy-2; leber congenitalamaurosis due to defect in CRX; retinitis pigmentosa (late-onset dominant); glutaricaciduria, type IIB; diabetes mellitus, noninsulin-dependent diabetes; colorectal cancer. T-cell acute lymphoblastic leukemia; hyperferritinemia-cataract syndrome; and hydatidiform moles.

Mutant ILP-3 gene: A mutant form of the ILP-3 gene which in some embodiments is associated with disease, for example: selective T-cell defect; osteoarthritis of distal interphalangeal joints; colorectal cancer with chromosomal instability; hypothyroidism, congentical due to thyroid dysgenesis or hypoplasia; juvenile nephronophthisis; thrombophilia due to protein C deficiency; and purpura fulminans, neonatal.

Mutant ILP-2 or ILP-3 protein: A protein encoded by a mutant ILP-2 or ILP-3 gene, respectively. Mutant ILP-2 or ILP-3 RNA: An RNA transcribed from a mutant ILP-2 or ILP-3 gene, respectively.

Neoplasm: Abnormal growth of cells. Normal cells: Non-tumor, non-malignant cells. Oligonucleotide: A linear polynucleotide sequence of up to about 200 nucleotide bases in length, for example a polynucleotide (such as DNA or RNA) which is at least 6 nucleotides, for example at least 15, 25, 50, 100 or even 200 nucleotides long.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

ORF (open reading frame): A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.

Ortholog: two nucleotide sequences are orthologs of each other if they share a common ancestral sequence, and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.

PCR (polymerase chain reaction): Describes a technique in which cycles of denaturation, annealing with primer, and then extension with DNA polymerase are used to amplify the number of copies of a target DNA sequence.

Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful herein are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the DNA, RNA, proteins, and antibodies herein disclosed. Embodiments of the disclosure comprising medicaments can be prepared with conventional pharmaceutically acceptable carriers, adjuvants and counterions as would be known to those of skill in the art.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol. ethanol, sesame oil, combinations thereof, or the like, as a vehicle. The medium may also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. The carrier and composition can be sterile, and the formulation suits the mode of administration. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, sodium saccharine, cellulose, magnesium carbonate, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.

Primate: Includes for example: humans, gorillas, chimpanzees, rhesus monkeys, cynomolgus monkeys and baboons. Great apes include gorillas and chimpanzees.

Probes and primers: Nucleic acid probes and primers may readily be prepared based on the amino acid sequences provided herein. A probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) and Ausubel et al, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences (1987). Primers are short nucleic acids, such as DNA oligonucleotides 15 nucleotides or more in length. Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e.g., by PCR or other nucleic-acid amplification methods known in the art.

Methods for preparing and using probes and primers are described, for example, in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989), Ausubel et al, 1987, and Innis et al., PCR Protocols, A Guide to Methods and Applications, 1990, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, © 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).

Polynucleotide: A linear nucleic acid sequence of any length. Therefore, a polynucleotide includes molecules which are 15, 50, 100, 200 (oligonucleotides) and also nucleotides as long as a full length cDNA.

Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as. in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.

Purified: The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified ILP-2 protein preparation is one in which the protein is more pure than the protein in its natural environment within a cell. In one embodiment, a preparation of an ILP-2 or ILP-3 protein is purified such that the protein represents at least 50% of the total protein content of the preparation.

Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.

Sample: Includes biological samples containing genomic DNA, RNA, or protein obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, amniocentesis samples and autopsy material.

Sequence identity: The similarity between two nucleic acid sequences, or two amino acid sequences, is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or orthologs of nucleic acid or amino acid sequences will possess a relatively high degree of sequence identity when aligned using standard methods. This homology will be more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (e.g., human and chimpanzee sequences), compared to species more distantly related (e.g., human and C. elegans sequences). Typically, ILP-2 and ILP-3 orthologs are at least 50% identical at the nucleotide level and at least 50% identical at the amino acid level when comparing orthologus sequences.

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, ./. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Co et et al_^ /Vwc. Λci-fc Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al , Meth. Mol Bio. 24:307-31 , 1994. Altschul et al,. J. Mol Biol 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations. The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al, J. Mol. Biol.

215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine. Building 38A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site. Homologs of the ILP-2 and ILP-3 proteins are typically characterized by possession of at least 70% sequence identity counted over full-length alignment with the amino acid sequence of ILP- 2 and ILP-3 using the NCBI Blast 2.0, gapped blastp set to default parameters. Queries searched with the blastn program are filtered with DUST (Hancock, and Armstrong, 1994, Comput. Appl Biosci. 10:67-70). Other programs use SEG. Alternatively, one may manually align the sequences and count the number of identical amino acids. This number divided by the total number of amino acids in the reference sequence multiplied by 100 results in the percent identity.

For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 1 1, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequence will show increasing percentage identities when assessed by this method, such as at least 80%, 85%, 90%, 95%, 98%, 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs will typically possess at least 75% sequence identity over short windows of 10-20 amino acids, and may possess sequence identities of at least 85%, 90%, 95%, 98% or 99% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI web site. One of ordinary skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided. Provided herein are the peptide homologs described above, as well as nucleic acid molecules that encode such homologs.

An alternative indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence- dependent and are different under different environmental parameters. Generally, stringent conditions are selected to be about 5°C to 20°C lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. The T_m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence remains hybridized to a perfectly matched probe or complementary strand. Conditions for nucleic acid hybridization and calculation of stringencies can be found in

Sambrook et al (In Molecular Cloning: A Laboratory Manual, CSHL, New York, 1988) and Tijssen (Laboratory Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Acid Probes Part I, Chapter 2, Elsevier, New York, 1993). Nucleic acid molecules that hybridize under stringent conditions to an ILP-2 or ILP-3 gene sequence will typically hybridize to a probe based on either an entire ILP-2 or ILP-3 gene or selected portions of the gene under wash conditions of 2x SSC at 50° C. A more detailed discussion of hybridization conditions is presented in EXAMPLE 13.

Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein.

Such homologous peptides may, for example, possess at least 85%, 90%, 95%, 98%, or 99% sequence identity determined by this method. When less than the entire sequence is being compared for sequence identity, homologs may, for example, possess at least 75%, 85% 90%), 95%, 98% or 99% sequence identity over short windows of 10-20 amino acids. Methods for determining sequence identity over such short windows can be found at the NCBI web site. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs or other variants could be obtained that fall outside of the ranges provided. The disclosure provides not only the peptide homologs that are described above, but also nucleic acid molecules that encode such homologs.

An alternative (and not necessarily cumulative) indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid. Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. It is understood that changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid sequences that all encode substantially the same protein.

Specific binding agent: An agent that binds substantially only to a defined target. As used herein, the terms "ILP-2 specific binding agent" and "ILP-2 specific binding agent" includes anti-

ILP-2 and anti-ILP-3 peptide antibodies and other agents that bind substantially only to the ILP-2 and ILP-3 peptide, respectively. The antibodies may be monoclonal or polyclonal antibodies that are specific for the ILP-2 and ILP-3 peptide, as well as immunologically effective portions ("fragments") thereof. In one embodiment, the antibodies used herein are monoclonal antibodies (or immunologically effective portions thereof) and may also be humanized monoclonal antibodies (or immunologically effective portions thereof). Immunologically effective portions of monoclonal antibodies include Fab, Fab', F(ab')₂, Fabc and Fv portions (for a review, see Better and Horowitz, Methods. Enzymol 178:476-96, 1989). Anti-inhibitory peptide antibodies may also be produced using standard procedures described in a number of texts, including Antibodies, A Laboratory Manual by Harlow and Lane, Cold Spring Harbor Laboratory (1988).

The determination that a particular agent binds substantially only to the ILP-2 and/or ILP-3 peptide may readily be made by using or adapting routine procedures. One suitable in vitro assay makes use of the Western blotting procedure (described in many standard texts, including Antibodies, A Laboratory Manual by Harlow and Lane). Western blotting may be used to determine that a given ILP-2 and or ILP-3 peptide binding agent, such as an anti-ILP-2 and/or ILP-3 peptide monoclonal antibody, binds substantially only to the ILP-2 and/or ILP-3 protein.

Specifically hybridizable and specifically complementary: Terms which indicate a sufficient degree of complementarity such that stable and specific binding occurs between the oligonucleotide (or its analog) and the DNA or RNA target. The oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions in which specific binding is desired, for example under physiological conditions in the case of in vivo assays. Such binding is referred to as "specific hybridization." See EXAMPLE 13 for hybridization conditions.

Subject: Living multicellular vertebrate organisms, a category which includes, both human and veterinary subjects for example, mammals, birds and primates. Sufficient complementarity: When used, indicates that a sufficient number of base pairs exist between the oligonucleotide and the target sequence to achieve detectable binding, and disrupt expression of gene products (such as ILP-2 and ILP-3). When expressed or measured by percentage of base pairs formed, the percentage complementarity that fulfills this goal can range from as little as about 50% complementarity to full, (100%) complementary. In general, sufficient complementarity is at least about 50%. In one embodiment, sufficient complementarity is at least about 75% complementarity. In another embodiment, sufficient complementarity is about 90% or about 95% complementarity. In yet another embodiment, sufficient complementarity is about 98% or 100% complementarity.

A thorough treatment of the qualitative and quantitative considerations involved in establishing binding conditions that allow one skilled in the art to design appropriate oligonucleotides for use under the desired conditions is provided by Beltz et al. Methods Enzymol 100:266-285, 1983, and by Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

Target sequence: A portion of single-stranded DNA (ssDNA), double-stranded DNA (dsDNA) or RNA that upon hybridization to an therapeutically effective oligonucleotide or oligonucleotide analog results in the inhibition of ILP-2 and/or ILP-3 expression. Either an antisense or a sense molecule can be used to target a portion of dsDNA, since both will interfere with the expression of that portion of the dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target sequences can be ssDNA, dsDNA, and RNA.

An oligonucleotide "binds" or "stably binds" to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by either physical or functional properties of the target: oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any procedure known to one skilled in the art, including both functional and physical binding assays. Binding may be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation and the like.

Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures. For example, one method that is widely used, because it is so simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate or melt.

The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (T_m) at which 50% of the oligomer is melted from its target. A higher (T_m) means a stronger or more stable complex relative to a complex with a lower (T_m).

Therapeutically Effective Amount: A concentration of ILP-2, for example an amount that is effecitve to modulate (for example decrease) apoptosis in a subject to whom it is administered. Alternatively, it is a concentration of ILP-3, for example an amount that is effective to modulate (for example decrease) JNK activation in a subject to whom it is administered. In particular detailed examples, it is an amount of ILP-2 required to inhibit Bax-induced apoptosis by more than a desired amount, for example by a factor of at least 2, for example at least 3, for example at least 5, (where the factor refers to at least approximately double (or triple, or quintuple) the cell viability using the assay described in EXAMPLE 5). In other examples, it is an amount required to inhibit Bax-induced apoptosis by a desired amount, for example by an amount that is nearly identical to an amount obtained with ILP-1, using cell viability determined by the assay described in EXAMPLE 5. In other examples, it is an amount required to decrease Bax-induced apoptosis by inhibiting the Caspase- 9: Apaf-1 complex, for example by about 3 fold, for example by about 5 fold (where the factor refers to the increase in cell viability using the assay described in EXAMPLE 5). In other examples, it is an amount required to decrease activation of the Caspase-9: Apaf-1 holoenzyme, for example by about 1.5 fold after six minutes, for example by about 2 fold after six minutes (where the factor refers to the decrease in extract activation using the assay described in EXAMPLE 5) but does not block the active holoenzyme or active Caspase-3. In other examples, it is an amount required to activate JNK activity, for example by about 3 fold, for example by about 4.7 fold, (where the factor refers to the increase in JNK activity in an in vitro kinase assay using c-Jun protein as a substrate, as described in EXAMPLE 9). In very particular embodiments, the biological activity includes any combination of the characteristics in this paragraph, or all of them. Such activity will decrease (including preventing) apoptosis in a cell, such as the cell of a patient.

In other particular detailed examples, it is an amount of ILP-3 required to modulate JNK activation. In other examples, is is an amount required to decrease JNK activation, for example to moderately inhibit ILP- 1 -mediated JNK activation when co-transfected with ILP- 1 , using the assay described in EXAMPLE 9. Such activity will decrease (including preventing) apoptosis in a cell, such as the cell of a patient.

The therapeutically effective amount also includes a quantity of ILP-2 and/or ILP-3 protein sufficient to achieve a desired effect in a subject being treated. For instance, this can be the amount necessary to improve signs and/or symptoms of a disease of abnormal apoptosis, such as cancer, for example by modulating apoptosis.

An effective amount of ILP-2 and/or ILP-3 may be administered in a single dose, or in several doses, for example daily, during a course of treatment. However, the effective amount of ILP-2 and or ILP-3 will be dependent on the source of ILP-2 and/or ILP-3 applied (i.e. ILP-2 and/or ILP-3 isolated from a cellular extract versus a chemically synthesized and purified ILP-2 and/or ILP- 3, or a variant or fragment that may not retain full ILP-2 and/or ILP-3 activity), the subject being treated, the severity and type of the condition being treated, and the manner of administration of ILP- 2 and/or ILP-3. For example, a therapeutically effective amount of ILP-2 and/or ILP-3 can vary from about 0.01 mg/kg body weight to about 1 g/kg body weight.

The ILP-2 and ILP-3 proteins disclosed herein have equal application in medical and veterinary settings. Therefore, the general term "subject being treated" is understood to include all animals (e.g. humans, apes, dogs, cats, horses, and cows) that require modulation of apoptosis that is susceptible to ILP-2 and/or ILP-3-mediated modulation. Therapeutically effective dose: A dose sufficient to modulate apoptosis, resulting in a regression of a pathological condition, or which is capable of relieving signs or symptoms caused by the condition, such as cancer; autoimmune diseases such as diabetes and multiple sclerosis; neurodegenerative diseases including retinal degeneration; cone-rod retinal dystrophy-2; leber congenitalamaurosis due to defect in CRX; retinitis pigmentosa (late-onset dominant); glutaricaciduria, type IIB; diabetes mellitus, noninsulin-dependent diabetes; colorectal cancer, T-cell acute lymphoblastic leukemia; hyperferritinemia-cataract syndrome; hydatidiform moles; selective T- cell defect; osteoarthritis of distal interphalangeal joints; colorectal cancer with chromosomal instability; hypothyroidism, congentical due to thyroid dysgenesis or hypoplasia; juvenile nephronophthisis; thrombophilia due to protein C deficiency; and purpura fulminans, neonatal. Transformed: A transformed cell is a cell into which has been introduced a nucleic acid molecule by molecular biology techniques. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration. TGFβR Modulating Activity: The ability of a protein to bind to and modulate the activity of the transforming growth factor beta receptor. In particular embodiments, the activity of the TGFβR is decreased by a desired amount. In yet other embodiments, TGFβR activity is increased by a desired amount.

Transgenic Cell: Transformed cells which contain foreign, non-native DNA. Tumor: A neoplasm

Variants or fragments: The production of ILP-2 and ILP-3 proteins can be accomplished in a variety of ways (for example see EXAMPLE 13). DNA sequences which encode for the protein, or a fragment or variant of the protein, can be engineered such that they allow the protein to be expressed in eukaryotic cells, bacteria, insects, and/or plants. In order to accomplish this expression, the DNA sequence can be altered and operably linked to other regulatory sequences. The final product, which contains the regulatory sequences and the therapeutic protein, is referred to as a vector. This vector can then be introduced into the eukaryotic cells, bacteria, insect, and/or plant. Once inside the cell the vector allows the protein to be produced. One of ordinary skill in the art will appreciate that the DNA can be altered in numerous ways without affecting the biological activity of the encoded protein. For example, PCR may be used to produce variations in the DNA sequence which encodes ILP-2 or ILP-3. Such variants may be variants that are optimized for codon preference in a host cell that is to be used to express the protein, or other sequence changes that facilitate expression.

Two types of cDNA sequence variant may be produced. In the first type, the variation in the cDNA sequence is not manifested as a change in the amino acid sequence of the encoded polypeptide. These silent variations are simply a reflection of the degeneracy of the genetic code. In the second type, the cDNA sequence variation does result in a change in the amino acid sequence of the encoded protein. In such cases, the variant cDNA sequence produces a variant polypeptide sequence. In order to optimize preservation of the functional and immunologic identity of the encoded polypeptide, any such amino acid substitutions may be conservative. Conservative substitutions replace one amino acid with another amino acid that is similar in size, hydrophobicity, etc. Variations in the cDNA sequence that result in amino acid changes, whether conservative or not, are minimized to enhance preservation of the functional and immunologic identity of the encoded protein. The immunologic identity of the protein may be assessed by determining whether it is recognized by an antibody to ILP-2 or ILP-3; a variant that is recognized by such an antibody is immunologically conserved. In particular embodiments, any cDNA sequence variant will introduce no more than 20, for example fewer than 10 amino acid substitutions into the encoded polypeptide. Variant amino acid sequences can, for example, be 80%, 90% or even 95% identical to the native amino acid sequence.

Conserved residues in the same or similar proteins from different species can also provide guidance about possible locations for making substitutions in the sequence. A residue which is highly conserved across several species is more likely to be important to the function of the protein than a residue that is less conserved across several species.

Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include one or more selectable marker genes and other genetic elements known in the art.

Additional definitions of terms commonly used in molecular genetics can be found in Benjamin Lewin, Genes V published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). EXAMPLE 1 Cloning of Human ILP-2 and ILP-3

This example describes methods used to clone a human ILP-2 (hILP-2) and ILP-3 (hILP-3) cDNAs. A degenerate PCR approach was used to identify homologs of hlLP. Several degenerate oligonucleotide primers (SEQ ID NOS: 19, 20, and 29) which collectively span the ILP- 1/XIAP gene were tested in PCR reactions using human genomic DNA and cDNA prepared from peripheral blood leukocyte RNA. PCR was conducted using the following conditions: 94°C for 5 minutes; followed by 30 cycles of 94°C for 45 seconds, 60°C for 45 seconds and 72°C for 2 minutes; followed by 72°C for 10 minutes and a 4°C hold, using Advantage cDNA polymerase (Clontech, Palo Alto, CA).

Sequencing of PCR products revealed several novel sequences, which were used to isolate cDNA and genomic clones for two previously undescribed human iaps, hILP-2 and hILP-3. Using this method, 4993 base pairs of a human ILP-2 sequence (SEQ ID NO 13) and 1752 base pairs of a human ILP-3 sequence (SEQ ID NO 1) were obtained. PCR was subsequently performed to screen a panel of cDNA libraries (Clontech) for the presence of hILP-2 and hILP-3.

Cloning of an hILP-2

A PCR product was obtained from genomic DNA with the following two primers: 5'- CCTGGCGCGAAAAGGTGGACAAGTC -3' (SEQ ID NO 37) and 5'- TGTTCACATCACACATTCAATCAGGG-3' (SEQ ID NO 38). This product was sequenced and found to encode a previously unidentified sequence (SEQ ID NO 13), which was designated hILP-2. PCR products were either sequenced directly or subcloned into pCR2.1 (Invitrogen, Carlsbad, CA) prior to sequencing.

The hILP-2 protein (SEQ ID NO 14) is 237 amino acids, with an approximate molecular weight of 30 kD. The predicted protein structure of hILP-2 lacks the first two BIR domains present in hILP-1 and is comprised of a single amino-terminal BIR followed by a spacer domain and a carboxy-terminal RING domain (FIG. 1). The BIR domain of hILP-2 is highly conserved, with a CX2CX16HX6C spacing characteristic of BIR domains of other IAPs. The carboxy-terminal domain of hILP-2 encodes a RING finger domain which has the conserved cysteine and histidine motif present in RING finger domains of hlLP and other proteins.

Cloning ofhILP-3

Primers which spanned a portion of the spacer and RING finger of the novel sequence were designed. The oligonucleotide primers 5'-ACTTGAGGAGTGTCTGGTAAGA-3' (SEQ ID NO 19) and 5'-AGTGACYRGATGTCCACAAGGAA-3' (SEQ ID NO 20) were used to amplify a 300 bp fragment of a hILP-3 cDNA. A unique Alwl restriction site was observed in this region of hILP-3, and therefore an Alwl digest was performed on the PCR products to demonstrate the presence of hILP-3. A fragment of hILP-3 was found in a λgt-10 human placenta cDNA library (Clontech). Using this library as a template and a nested PCR approach, a full length hILP-3 cDNA was isolated. An initial PCR reaction was performed for 30 cycles using the conditions described above to clone the 5' end of a hILP-3 cDNA using the hILP-3-specific primer 5'- CATAGGATTATGGAAGATGGTATCAATTTT-3' (SEQ ID NO 21 ) and the library-specific primer 5'-GCGTTCAGAAAGAGTTTGCATATCGCCTCC-3' (SEQ ID NO 22).

One μl from this PCR reaction was used as a template for a second 30 cycle PCR reaction (using the PCR conditions described above) with the hILP-3-specific nested primer 5'- GACACTCCTCAAGTGAATGGGA-3' (SEQ ID NO 23) and the library-specific nested primer 5'- AGAGGTGGCTTATGAGTATTTCTTCCAGGG-3' (SEQ ID NO 24). Another round of PCR reactions was performed to clone the 3' end of a hILP-3 cDNA, from the human placenta cDNA library. The initial PCR reaction was performed using a hILP-3-specific primer 5'- ACACGAAAATATATAAACAATATTCATTTATCC-3" (SEQ ID NO 25) and the library-specific primer 5'-AGCTGACGCAAGTTCTGGTAAAAAGCGTGG-3' (SEQ ID NO 26). One μl from this reaction was used as a template for a second 30 cycle PCR reaction (using the PCR conditions described above) with the hILP-3-specific nested primer 5'-

AACGCCATCACTAACTAGAAAAATTGAT-3' (SEQ ID NO 27) and the library-specific nested primer 5'-AGTCCCCACCTTTTGAGCAAGTTCAGCCTG-3' (SEQ ID NO 28). The resulting PCR products were subcloned into the vector pCR-2.1 (Invitrogen) and sequenced. One product encoded a highly conserved RING finger and spacer domain, which was termed hILP-3 (SEQ ID NO 1). The DNA sequence encodes a hILP-3 protein (SEQ ID NO 2) which contains 107 amino acids, with an approximate molecular weight of 14 kD.

The amino acid sequences of the hILP-2 and hILP-3 sequenced (SEQ ID NOs 13 and 1, respectively), are over 80% identical to hILP-1 (see FIGS 2 and 3). However, the predicted structures of hILP-2 and hILP-3 are unique. hILP-3 has two possible open reading frames in its cDNA sequence. The first encodes a domain which is most homologous to the third BIR domain of hlLP followed by a portion of the spacer domain. This open reading frame is followed by a TGA stop codon, and the second open reading frame continues in frame following this stop codon, which encodes the remainder of the spacer domain followed by a RING finger domain. Only the second open reading frame is conserved in other species, demonstrating that hILP-3 concodes a protein with a portion of the 'spacer' domain followed by a RING finger domain (FIG. 1).

EXAMPLE 2 Chromosomal Mapping

This example describes the methods used to map the chromosomal localization and intron- exon structures of hILP-2 and hILP-3. SEQ ID NOS 31 and 32 were used to isolate genomic hILP-2 with an EcoRI digest of the PCR product. The genomic clones contained no introns and were identical to the cDNA clones. To map the intron-exon structures of ILP-3, genomic hILP-3- containing clones were isolated using the primers shown in SEQ ID NOS 29 and 30 with an Alwl digest of the PCR product.

The chromosomal localization of a hILP-2 was determined by fluorescence in situ hydridization (FISH) and radiation hybrid analysis using the methods of DNA Biotech, Inc. hILP-2 and hILP-3 mapped to locations distinct to that of ILP-1/XIAP. hILP-2 mapped to 19ql3.3-ql3.4 and hILP-3 mapped to 2ql2-ql4, whereas ILP-1 XIAP localizes to Xq25 (Rajcan-Separovic et al, 1996, Genomics 37:404-6). Unlike ILP-1/XIAP, hILP-2 lacks introns.

Diseases associated with these chromosomal regions can be found at the National Center for Biological Information web site Online Mendelian Inheritance in Man (NCBI, National Library of

Medicine, Building 38A, Room 8N805, Bethesda, MD 20894). Examples of diseases associated with chromosomal region 19ql3.3-ql3.4 include: cone-rod retinal dystrophy-2; leber congenitalamaurosis due to defect in CRX; retinitis pigmentosa (late-onset dominant); glutaricaciduria, type IIB; diabetes mellitus, noninsulin-dependent; colorectal cancer, T-cell acute lymphoblastic leukemia; hyperferritinemia-cataract syndrome; and hydatidiform moles. Examples of diseases associated with region 2ql2-2ql4 include: selective T-cell defect; osteoarthritis of distal interphalangeal joints; colorectal cancer with chromosomal instability; congentical hypothyroidism due to thyroid dysgenesis or hypoplasia; juvenile nephronophthisis; thrombophilia due to protein C deficiency; and purpura fulminans, neonatal.

EXAMPLE 3 Cloning ILP-2 and ILP-3 in Other Primates This example describes the cloning of ILP-2 and ILP-3 in several non-human primates. Similar methods can be used to clone ILP-2 and ILP-3 from any organism in which ILP-2 and/or ILP-3 is present.

Genomic DNA was obtained from gorilla (gift from Paolo Vezzoni), chimpanzee (Lofstrand Labs Limited, Gaithersburg, MD), baboon (Lofstrand Labs Limited), rhesus monkey (Clontech), cynomolgus monkey (Lofstrand Labs Limited), humans (prepared from a transformed B cell line using the Wizard genomic DNA purification kit from Promega, Madison, WI), and mice (prepared from C57/b6 mice using a standard tail snip protocol). Using 1 μg of genomic DNA, and the following primers: ILP-2 primers 5'-TGAATCTGATGTTGCGAGTTCTG-3' (SEQ ID NO 35) and 5'-GTTGAGTCACATCACACATTTAATC-3' (SEQ ID NO 36); ILP-3 primers: 5'- TTGAGGAGTGTCTGGTAAGAACTG-3' (SEQ ID NO 33) and 5'- TCCTACTTGGTAGCAAATGCTAATG-3' (SEQ ID NO 34), ILP-2 and ILP-3 genomic DNAs were amplified using the following PCR conditions: 94°C for 5 minutes; then 30 cycles of: 94°C for 45 seconds, 58°C for 45 seconds and 72°C for 2 minutes; followed by 72°C for 10 minutes and a final 4°C hold.

An ILP-2 cDNA was cloned and sequenced, and the encoded protein sequence determined from an ILP-2 in chimpanzees (SEQ ID NOS 15 and 16) and gorillas (SEQ ID NOS 17 and 18). As shown in FIG. 2, the open reading frame of ILP-2 is conserved in both chimpanzee and gorilla. Interestingly, no ILP-2 sequences were observed from any species other than primates. ILP-2 was detected only in great apes (human, chimpanzee, and gorilla), and could not be isolated from genomic DNA prepared from old world monkeys (baboon, cynomolgus monkey, and rhesus monkey) by PCR. This observation was confirmed by performing Southern analysis of genomic DNA from primates as well as mouse using a radiolabeled probe prepared from ILP-2 but which identifies both ILP-1 and ILP-2. BAC and PAC vectors (5 ng) containing the hlLP homolog DNA and 10 μg of genomic DNA were subjected to overnight restriction cleavage with EcoRI (New England Biolabs, Inc., Beverly, MA). The restriction fragments were separated by 1% agarose gel electrophoresis at 40 V, transferred to a Hybond-N⁺ nylon membrane (Amersham Pharmacia Biotech, Piscataway NJ), and immobilized by UV crosslinking. The DNA probe was obtained by isolating a fragment of human ILP-2 from a cDNA expression vector using BamHI and Hindlll. The sequence of the probe is nucleotides 2074-2634 of SEQ ID NO 13. The probe was labeled with ³²P under standard conditions (oligo labeling kit purchased from Amersham Pharmacia Biotech) using Klenow enzyme (New England Biolabs, Inc., Beverly, MA) and the unincorporated nucleotides removed using a G-40 spin column (Amersham Pharmacia Biotech). Prehybridization and hybridization were performed with Hybrisol II (Intergen, Purchase, NY) according to the manufacturers' instructions. The probe was hybridized to the membrane at 65°C overnight.

As shown in FIG. 4, a similar pattern of bands present in genomic DNA from the old world monkeys. This pattern is more complex in genomic DNA from the great apes, indicating the presence of additional ILP-1 -related genes in great apes that are not present in old world monkeys. The human genomic clones of ILP- 1/XIAP and ILP-2 were included to identify bands seen in primate samples. Bands in genomic DNA from great apes, but not in old world monkeys, migrated closely with the two major bands representing the human genomic clone of ILP-2, indicating that ILP-2 emerged after their divergence. The gorilla ILP-2 gene does not contain an EcoRI site in its coding sequence, accounting for a profile that differs slightly to those of human and chimpanzee. The pattern of bands seen in genomic DNA from primates was not present in mouse genomic DNA. These data demonstrate that the retrotransposition event which gave rise to ILP-2 occurred during the evolution of great apes, within the last 20 million years (FIG. 5). ILP-3 DNAs were cloned and sequenced, and the encoded protein sequence determined from a variety of primates including: baboon (SEQ ID NOS 3 and 4), chimpanzee (SEQ ID NOS 5 and 6), cynomolgus monkey (SEQ ID NOS 7 and 8), gorilla (SEQ ID NOS 9 and 10), and rhesus monkey (SEQ ID NOS 1 1 and 12). As shown in FIG. 3, ILP-3 is conserved by at least 80% at the protein level.

EXAMPLE 4 RT-PCR Analysis of RNA Expression

This example describes methods used to analyze the RNA expression of an ILP-2 and an ILP-3. RT-PCR was performed on several panels of total RNA (Clontech). RNase-free DNase I (1 μl; Promega, Madison, WI) was added to 4 μl of total RNA, incubated at 37°C for 30 minutes, then at 75^CC for five minutes. RT-PCR was performed according to the manufacturers' instructions using a cDNA cycle kit (Invitrogen) and Advantage polymerase (Clontech). Controls without reverse transcriptase were included in every reaction. The hILP-2-specific primers 5'- ACTTGAGGGAGCTCTGGTACAAAC-3' (SEQ ID NO 29) and 5'-

AGTGACCAGATGTCCACAAGG-3' (SEQ ID NO 39) were used to amplify a 300 bp product. These primers were also used for PCR-mediated isolation of a BAC genomic clone (Genome Systems) and for radiation hybrid mapping. For internal controls, GAPDH-specific primers 5'- ACCACCATGGAGAAGGCTGG-3' (SEQ ID NO 40) and 5'-CTCAGTGTAGCCCAGGATGC-3' (SEQ ID NO 41) were used in parallel reactions, which produce a 500 bp product.

As shown in FIG. 6, hILP-2 transcripts were detected only in human testis. Immunoblot analysis was performed on protein lysates from human testis using an anti-hILP-1 antibody to determine whether endogenous hILP-2 protein could be detected. As a negative control, protein lysates from placenta were included because RT-PCR examination of human placenta consistently scored negative for ILP-2 transcripts by RT-PCR (FIG. 6). Protein lysates of human tissues (150 μg; Clontech) were prepared for immunoblot analysis according to the manufacturers' instructions. Lysates were resolved by 4-12% gradient SDS-polyacrylamide gel electrophoresis (Novex, Carlsbad, CA), transferred to nitrocellulose membranes (Novex), probed with an anti- ILP- 1/XIAP murine monoclonal antibody (H62120; Transduction Laboratories) followed by a horseradish peroxidase- conjugated anti-mouse antibody (Amersham Pharmacia Biotech), and visualized by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech). When anti-ILP-1 antibodies were used as a probe, a protein of approximately 30 kDa which is in close accord with the predicted molecular weight of ILP-2, was detected in protein lysates from human testis, but not from placenta (FIG. 7). These data demonstrate that ILP-2 is transcribed and translated. As shown in FIG. 8, hILP-3 is expressed at low levels in several different tissues, most noticably in tissues undergoing high rates of cellular proliferation and division, including the gastrointestinal tract, bone marrow, fetal liver and placenta. RT-PCR was also performed using Jurkat cells, and hILP-3 was constitutively expressed in resting and activated cells.

EXAMPLE 5

ILP-2 Inhibits BAX-Induced Apoptosis

This example describes methods that were used to investigate the role of ILP-2 and/or ILP-3 on apoptosis, specifically BAX-, Fas-, and TNF-induced apoptosis. The experiments described herein can be used to determine the effect of ILP-2 and ILP-3 from any species, or a sequence polymorphism, fragment or variant, such as a mutant, of ILP-2 and/or ILP-3, or a fusion protein that contains ILP-2 and/or ILP-3, on apoptosis. Viability assays

293 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin, and cultured at 37°C in 5% C0₂. Six- well plates were seeded with 2 x 10⁵ cells per well in 2 ml of medium. Cells were transfected the following day by the calcium phosphate procedure. For viability experiments, 293 cells were transfected with 0.5 μg of GFP plasmid (pEGFP-Nl ; Clontech) in combination with either a Bax expression plasmid (0.25 μg/well) or a Fas expression plasmid (2 μg/well). Cells were co-transfected with either a control plasmid, or plasmids expressing ILP- 1/XIAP, ILP-2, Apaf-1, or dominant negative Caspase-9 (C-9) as indicated (2 μg/well). Cells were stained with 4', 6'- diamidino-2-phenylindole (DAPI) 24 hours after transfection and examined for apoptosis by fluorescence microscopy, by examining the morphology of the stained chromosomes.

Extract preparation and caspase assays

To prepare extracts from 293 cells, cells were washed and centrifuged and the pellet resuspended in 10 volumes of extract preparation buffer (50 mM PIPES at pH 7.0, 50 mM KC1, 5 mM EGTA, 2 mM MgCl₂, 1 mM DTT) supplemented with 10 μg/ml of cytochalasin B and protease inhibitor cocktail (0.1 mM PMSF and 2 μg/ml each of chymostatin, pepstatin, leupeptin, and antipain). Cells were immediately pelleted and lysed by three cycles of freezing and thawing. The lysate was centrifuged at 100,000 x g for one hour to produce the cell extract.

Caspase activity was measured as follows. For initiating caspase activation, 1 mM ATP was added to extracts. Recombinant ILP-1/XIAP (15 μg), ILP-2 (5 μg) or ILP-3 was added to the extract either before or after extract activation, as indicated in the text. Following incubation at 37°C for 15 minutes, 2 μl of extract was incubated with 200 μl of assay buffer (50 mM PIPES at pH 7.0, 0.1 mM EDTA, 10% glycerol, 1 mM DTT) containing 20 μM DEVD-AFC (N-acetyl-Asp-Glu-Val-Asp-AFC (7-amino-4-trifluoromethylcoumarin); Biomol Research Laboratories, Plymouth Meeting, PA) for 10 minutes. The release of free AFC was measured with a Cytofluor 4000 fluorescence plate reader (Perseptive Biosystems).

Results

Since ILP-2 and ILP-3 are highly homologous to ILP- 1/XIAP, the proteins were compared for their ability to regulate apoptosis. Expression of ILP-2 had no inhibitory effect on apoptosis induced by Fas (FIG. 9B) or TNF in 293 cells or the MCF7 breast carcinoma line. However, apoptosis induced by ectopic expression of Bax, was profoundly inhibited by ILP-2, at levels nearly identical to those observed with ILP-1 (FIG. 9A).

Induction of apoptosis by Bax is thought to occur through the insertion of Bax into the mitochondrial outer membrane, an event which is followed by perturbation of integrity of the mitochondrial membrane, the release of cytochrome c and the activation of a complex which contains the apoptosis activating factor Apaf-1 and Caspase-9. In contrast, the induction of apoptosis by overexpression of Fas in 293 cells occurs through a Caspase-9-independent pathway, since it is not inhibited by dominant negative Caspase-9 (FIG. 9B).

These data indicated that ILP-2 inhibits Bax-induced death by blocking activation of the Apaf-1 :Caspase-9 holoenzyme. Therefore, the ability of ILP-2 to inhibit Caspase-9 induced death was assessed. When cotransfected with Caspase-9 and Apaf-1, ILP- 1/XIAP and ILP-2 potently inhibited cell death induced by Caspase-9 (FIG. 10) demonstrating that ILP-2 blocks Bax-induced death by inhibiting the Caspase-9: Apaf-1 complex.

Binding of Apaf-1 to cytochrome c in the presence of ATP or dATP results in the recruitment and activation of Caspase-9 (Li et al, 1997, Cell 91 :479-89). Caspase-9 activation can be reproduced in a cell-free system by incubating cytosolic extracts with ATP. The addition of ATP leads to the activation of Caspase-9 in extracts, which in turn processes and activates Caspase-3, an effector caspase. ILP- 1/XIAP inhibits both Caspase-9-dependent activation of extracts as well as Caspase-3 -dependent activity of extracts following activation by ATP (Deveraux et al, 1999, EMBO J. 18:5242-51). To determine whether ILP-2 inhibits activation of extracts, recombinant ILP- 1/XIAP or ILP-2 proteins were incubated with extracts from 293 cells, followed by addition of ATP and measurement of extract activation. Both ILP- 1/XIAP and ILP-2 significantly inhibited activation of the holoenzyme when incubated with the extract prior to addition of ATP (FIG. 11, left panel). However, ILP-2 had no effect on extract activity when added to active extract (after addition of ATP) while ILP-1/XIAP inhibited the activity of active extract (FIG. 11, right panel). These results demonstrate that ILP-2 inhibits the activation the Apaf-1: Caspase-9 complex, but cannot block an active holoenzyme or active Caspase-3.

ILP-3 did not inhibit Bax-induced apoptosis.

EXAMPLE 6

ILP-2 interacts with a Processed Caspase-9 Intermediate

To demonstrate that ILP-2 interacts with Caspase-9 in cells, co-immunopreciptation studies were conducted. The experiments described in this example can be used to determine if ILP-2 or ILP-3 from any species, or a sequence polymorphism, fragment or variant, such as a mutant, of ILP-2 and/or ILP-3, or a fusion protein containing either or both of them, interacts with Caspase-9 in cells.

The open reading frames of ILP- 1/XIAP and ILP-2 were subcloned into pEBB-FLAG and pEBG for expression in mammalian cells. Site-directed mutagenesis (QuickChange; Stratagene, LaJolla, CA) was performed on the Caspase-9 plasmid to generate two mutants: Asp315 to Ala and Asp315 to the TGA stop codon. The Δ2BIR-ILP-l-pEBG vector encodes residues 262-497 of ILP- 1/XIAP.

Mammalian expression vectors encoding ILP- 1/XIAP or ILP-2 fused to glutathione S- transferase (GST) were cotransfected with a Caspase-9 expression vector into 293 cells in six-well plates. After 15 hours, cells were washed once with PBS and lysed for 15 minutes in 0.3 ml of 1% Triton-X-100 buffer containing 25 mM Hepes (pH 7.9), 100 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM PMSF, 1 mM DTT, and one protease inhibitor cocktail tablet (Boehringer Mannheim) per 10 ml lysis buffer. For co-precipitation, 150 μl aliquots of lysates were incubated with 20 μl of glutathione -Sepharose beads (Amersham Pharmacia Biotech) at 4°C for one hour. Beads were washed four times with 1 ml of lysis buffer. The bead-associated proteins along with aliquots of total lysates were resolved by 4-12% gradient SDS-polyacrylamide gel electrophoresis (Novex) and transferred to nitrocellulose membranes (Novex). Membranes were incubated with either GST antibodies (Santa Cruz) or Caspase-9 antibodies (PharMingen, San Diego, CA) and visualized by enhanced chemiluminescence (ECL; Amersham Pharmacia Biotech). A processed form of Caspase-9 co-precipitated with ILP-2 but not with ILP-1 (FIG. 12). Activation of Procaspase-9 by Apaf-1 requires proteolytic processing to generate the active caspase. An early step in the processing of Procaspase-9 occurs at Asp-315. Therefore, mutation of the Asp-315 cleavage site is expected to block autocatalytic cleavage of Caspase-9 to its active form. ILP-2 was coexpressed in 293 cells with either unmodified Caspase-9 or each of the two mutants of Caspase-9 (Asp-315 mutated to an Ala or to a TGA stop codon), and the Caspase-9 species that were generated were examined by co-precipitation and immunoblot analysis. The truncated Caspase-9 mutant (Asp-315 to TGA) co-migrated with processed Caspase-9, while mutation of Asp-315 of Caspase-9 (Asp-315 to Ala) inhibited cleavage of Caspase-9 to its processed form (FIG. 13, right). However, neither Caspase-9 mutant interacted with ILP-2, demonstrating that cleavage of Caspase-9 at Asp-315 is involved in processing Caspase-9 to interact with ILP-2.

EXAMPLE 7 Cleaved ILP-1/XIAP interacts with Processed Caspase-9 in cells ILP- 1/XIAP is cleaved by Caspase-9 at Asp242. This cleavage event generates a form of ILP- 1/XIAP which lacks its first two BIR domains (Δ2BIR-ILP-1). To determine whether cleaved ILP-1 interacts with Caspase-9 in cells, a GST-tagged deletion construct of ILP-1 was generated which consists of the third BIR, spacer, and RING domains of ILP-1 (Δ2BIR-ILP-1). ILP-1/XIAP, Δ2BIR-ILP-1, or ILP-2 were cotransfected with Caspase-9 into 293 cells. Cell lysates were precipitated with glutathione-Sepharose beads, and analyzed with a Caspase-9 antibody. Processed Caspase-9 was co-precipitated with Δ2BIR-ILP-1, as well as ILP-2, but not with ILP-1 (FIG. 14). This demonstrates that cleaved, but not full length ILP- 1/XIAP, interacts with processed Caspase-9 in cells.

EXAMPLE 8 ILP-2 and ILP-3 Interact with the TGFβ Receptor This example describes experiments that were conducted to study the interaction of ILP-2 and ILP-3, using a human ILP-2 and ILP-3 sequence, with the TGFβ receptor (TGFβR). Similar experiments can be used to determine if ILP-2 and ILP-3 from any species, or a sequence variant, fragment, or polymorphism, for example a mutant ILP-2 or ILP-3, or a fusion protein, interacts with TGFβR. In addition, the methods described in this example can be used to test the interaction of ILP- 2 and ILP-3 with other proteins.

Transfection Protocol 293 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin, and maintained at 37°C in 5% C0₂. Six-well plates were seeded with 2 x 10⁵ cells per well in 2 ml of medium. Cells were transfected the following day by the calcium phosphate procedure as described (Duckett et al. 1997, Mol. Cell. Biol. 17: 1535-42). Human breast carcinoma MCF7 cells were cultured in RPMI 1640 medium with 10% fetal bovine serum, 2 M glutamine, 150 μg/ml G418, and 200 μg/ml hygromycin and maintained at 37°C in 5% C0₂. Six-well plates were seeded with 2 x 10⁵ cells per well in 2 ml of medium. Cells were transfected the following day by lipofectin (Life Technologies, Rockville, MD).

Immunoprecipitation assay

Cells were transiently co-transfected with mammalian expression vectors encoding GST- XI AP, GST-hILP-2, GST-hILP-3, or HA-TGFβRI as indicated in FIG 15. Cellular extracts were precipitated with glutathione-agarose beads. The precipitated complexes were washed, resolved by SDS-PAGE, transferred to nitrocellulose membranes and subjected to immunoblot analysis with an antibody recognizing the HA epitope.

Results

As shown in FIG. 15, all ILP homologs tested interact with the TGFβR in vitro. GST alone (control), did not immunoprecipitate TGFβR, demonstrating that the interaction between the hlLP homologs and TGFβR is not due to the presence of the GST or HA tags.

EXAMPLE 9 ILP-2 and ILP-3 have Different Effects on JNK Activation

This example describes experiments conducted to determine the effect of ILP-2 and ILP-3 on JNK activation, using a human ILP-2 and ILP-3 sequence. Similar experiments can be used to determine if ILP-2 and ILP-3 from any species, or a sequence variant, fragment, or polymorphism, for example a mutant ILP-2 or ILP-3 affect JNK activation.

Jun kinase assays Subconfluent 293 cells were transfected in six-well plates by the calcium phosphate method with 0.5 ug of pSRα-HA JNKl and 1 μg of each additional plasmid as indicated in FIG. 16. After 24 hours, growth media was replaced with serum-free DMEM and cells incubated overnight. Cells were subsequently incubated with or without TNFα (20 ng/ml) for 20 minutes. Treated and untreated cells were washed once with PBS, and then incubated or 30 minutes on ice in lysis buffer (20 mM Tris- HCI, pH 7.5, 0.5% NP-40, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 0.5 mM dithiothreitol, 1 mM PMSF, 20 mM β-glycerophosphate, 1 mM sodium vanadate). Epitope-tagged JNK was immunoprecipitated from the cleared lysates with the monoclonal antibody 12CA5 to the HA epitope tag (Boehringer Mannheim) for one hour at 4^CC. Immunocomplexes were recovered with Gamma- bind Sepharose (Amersham Pharmacia Biotech), washed twice with 1 ml of lysis buffer and twice with 1 ml of kinase reaction buffer (20 M Hepes, pH 7.5, 20 mM β-glycerophosphate, 20 mM p- nitrophenylphosphate, 10 mM MgCl₂, 1 mM DTT, 50 μM sodium vanadate).

Immunoprecipitates were resuspended in ice cold kinase reaction buffer supplemented with 20 μM ATP, 5 μM [γ ³²P] ATP, and 3.5 μg of recombinant GST-cJun as a substrate. The reactions were then incubated at 30°C for 20 minutes and stopped by the addition of 4x reducing SDS-sample buffer (Novex) and heat denatured at 95°C for five minutes. Proteins were separated by 4-12% gradient SDS-polyacrylamide gel electrophoresis (Novex). Dried gels were examined by autoradiography and Phosphorlmager analysis (Molecular Dynamics, Piscataway, NJ). Equal levels of transfection were confirmed by Western blot analysis with the 12CA5 anti-HA antibody and visualized by enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech).

Results

Both TNFα and hlLP activate the JNK mitogen-activated protein kinase (MAPK) cascades. The target of JNK is c-Jun, a transcription factor which mediates induction of cytokine and immunoregulatory genes. To determine if ILP-2 and ILP-3 function to inhibit JNK as well as NF-κB activation, expression vectors were co-transfected with an HA epitope-tagged JNKl vector into 293 cells. The JNKl protein was immunoprecipitated and its activation was measured in an in vitro kinase assay using c-Jun protein as a substrate. ILP-3 alone did not significantly activate JNK, and did not affect TNFα-mediated JNK activation. However, when co-transfected with hILP-1 , hILP-3 moderately inhibited hILP-1 -mediated JNK activation. In contrast, hILP-2 alone activated JNK, for example by at least 3-fold, for example by at least 5-fold. ILP-2 also activated JNK in the presence of TNF, for example by at least 5-fold, for example at least 8-fold, and in the presence of ILP, for example by at least 5-fold, for example at least 10-fold, for exampe at least 12-fold. A deletion mutant of hILP-1 in which the first 2 BIRs (the N-terminal 261 amino acids) were deleted was constucted to determine if the third BIR, spacer, and RING finger domains of hlLP- 1 were necessary and sufficient to activate JNK. This deletion mutant of hlLP failed to significantly activate JNK. This indicates that the few amino acid differences between hILP-2 and hILP-1 account for the ability of hILP-2 to activate JNK. EXAMPLE 10 hILP-2 and hILP-3 block NF-κB activation by TNFα

This example describes experiments conducted to determine the effects of ILP-2 and ILP-3 on TNFα-mediated NF-κB activation, using human ILP-2 and ILP-3 sequences. Similar experiments can be used to determine if ILP-2 and ILP-3 from any species, or a sequence variant, fragment, or polymorphism, for example a mutant ILP-2 or ILP-3, or a fusion protein, affect TNFα-mediated NF- KB activation.

Transcription factor NF-κB is important for the inducible expression of a wide variety of cellular genes, including cytokines and antiapoptotic proteins. Among the IAPs, C-IAP2 activates

NF-κB when transiently transfected, and C-IAP2 transcripts are upregulated by NF-κB during TNFα treatment. C-IAP1 and C-IAP2 also interact with the TRAFs, important mediators of TNF receptor signaling. Given the potential importance of the IAPs in regulating NF-κB, the effects of ILP-2 and ILP-3 on TNFα-mediated NF-κB activation were examined in 293 cells. Cells were transiently co-transfected with a κB-responsive luciferase reporter plasmid containing two canonical KB sites along with the construct of interest. Treatment of cells overexpressing a control GST protein with TNFα led to a significant increase in NF-κB-directed transcription relative to untreated cells. Overexpression of hILP-3 did not lead to NF-κB-directed transcription, and overexpression of hILP-2 led to a slight activation of NF-κB. However, treatment of cells overexpressing hILP-2 or hILP-3 with TNFα resulted in a drastic reduction in NF-κB- directed transcription. The same inhibitory effect was observed when a construct encoding the p50 subunit of NF-κB was transfected. Alone, p50 led to a strong increase in NF-κB-directed transcription, but when coexpressed with hILP-2 or hILP-3, this activation was inhibited.

The mechanism by which hILP-2 and hILP-3 block TNF-mediated NF- B activation was explored. The TNF receptor can transduce intracellular signals that stimulate the proteolytic breakdown of IκBα, a cytoplasmic inhibitor of NF-κB. Upon degradation of IκBα NF- B is released into the nucleus where it activates TNFα-responsive genes. The possibility that hILP-2 and hILP-3 block TNFα-mediated activation of NF-κB by preventing the degradation of IκBα was examined. 293 cells were transfected with vector alone, hILP-2 or hILP-3, and were incubated with

TNFα. To compare the levels of IκBα, cytoplasmic extracts from treated cells were immunoblotted with antisera specific to Ii Bα. IκBα degradation upon TNFα stimulation was unaffected by overexpression of hILP-2 or hILP-3, suggesting another mechanism of inhibition. EXAMPLE 11 Effect of ILP-2 and ILP-3 on Caspase 1-Induced Cell Death

This example describes experiments conducted to examine the effect of ILP-2 and ILP-3 on caspase- 1 induced cell death, using human ILP-2 and ILP-3. Similar experiments can be used to determine if ILP-2 and ILP-3 from any species, or a sequence variant, fragment, or polymorphism, for example a mutant ILP-2 or ILP-3, or a fusion protein containing any of these, affect caspase- 1 induced cell death. hlLP protects cells from apoptosis induced by a variety of stimuli. The ability of hILP-2 and hILP-3 to block cell death was examined, specifically, caspase 1 -induced cell death. Mammalian cells can be induced to undergo cell death in response to transient transfection of an expression plasmid containing pro-caspasel fused to the lacZ gene (Miura et al, 1993, Cell 75:653-60). 293 cells were transiently transfected with either the caspase 1/lacZ construct or a construct containing only the lacZ gene in combination with other control and test plasmids. Transient transfection with the caspasel/lacZ construct alone resulted in cell death of over 50% of 293 cells after 18 hours while transfection with the lacZ construct alone had no effect on cell death. As has been reported, cell death induced by caspase 1/lacZ was prevented by cotransfection with hlLP. hILP-2 and hILP-3 were individually cotransfected with caspase 1/lacZ to determine whether they block cell death. Unlike hlLP, hILP-2 and hILP-3 had no protective effect on caspase 1- mediated cell death. To test whether hILP-2 or hILP-3 could induce cell death alone, each was individually cotransfected with the lacZ construct. hILP-3 induced a slight increase of cell death over background, while hILP-2 induced a significant level of cell death on its own. To test the effect of hILP-2 and hILP-3 on hILP-mediated protection of death, hILP-2 and hILP-3 were cotransfected with caspase 1/lacZ and hlLP. hILP-3 had no effect on the ability of hlLP to prevent caspase 1- mediated death. However, hILP-2 significantly blocked the ability of hlLP to prevent caspase 1- induced cell death.

The effect of hILP-2 and hILP-3 on the ability of hlLP to block TNFα-mediated death was examined by transient transfection into MCF7 cells. These cells undergo apoptosis when treated with TNFα, which is prevented by transient transfection with hlLP. hlLP was transfected, together with a plasmid encoding green flourescence protein (GFP), into MCF7 cells, and cells were treated with TNFα. Viability of GFP-positive cells was determined by morphological examination under green flourescence. TNFα induced cell death in approximately 100% of cells transfected with vector alone. hlLP significantly blocked this death, decreasing the percentage of dead cells to approximately 40%. When cotransfected with hlLP, hILP-2 had no effect on the ability of hlLP to prevent death. In addition, hILP-2 had no toxic effect on MCF7 cells when transfected alone, in contrast to the caspase 1 experiment above. These data demonstrate that the ability of hILP-2 to block protection by hlLP may depend on the cell type and the method used to induce cell death. Caspases are the cysteine proteases crucial for the execution of cell death. These enzymes exist in their inactive form in virually all mammalian cells, and can be converted to their active forms with the appropriate signal within minutes. Therefore, precise regulation of the apoptotic machinery is essential. One way in which apoptosis is regulated is through the use of naturally occuring dominant negatives, proteins which inhibit the functions of other family members. Dominant negatives generally resemble the structures of other family members but lack domains crucial for function. In the bcl-2 family, bcl-xL resembles bcl-2 in its ability to block cell death. A truncated, alternatively spliced form of bcl-xL known as bcl-xS inhibits the ability of bcl-2 and bcl-xL to prevent apoptosis. In the TNF receptor family, several homologs of the fas and TNF receptors exist which are known as the DR receptors. DR 3 through DR 6 signal through cytoplasmic domains known as death domains which leads to cell death upon binding of Apo2 ligand. The functions of these receptors are blocked by decoy receptors which compete for the binding of Apo2 ligand but lack or have truncated death domains. Naturally occuring inhibitors of TNFα-mediated NF-κB activation exist as well. RIP is an adaptor protein involved in TNF receptor-mediated NF- B activation. RIP3, a homolog of RIP, blocks RIP-mediated activation of the transcription factor NF- KB.

Members of the iap gene family appear to function both as anti-apoptotic proteins and as signaling molecules. c-IAPl and c-IAP2 prevent cell death induced by a variety of stimuli. Through their interaction with the TRAFs, c-IAPl and C-IAP2 function as signaling molecules to mediate TNF-mediated NF-κB activation as well. hlLP is the most potent inhibitor of cell death known. Yet it also functions to activate JNK, a downstream kinase in the MAP kinase pathway. HlLP has also been implicated in BMP receptor signaling through its interaction with the adaptor protein TAB1.

ILP-2 and hILP-3 are the first examples of naturally occurring dominant negatives in the iap gene family. ILP-2 encodes BIR domain as well as a spacer and RING finger domain, while hILP-3 encodes a single domain most homologous to the third BIR of hlLP as well as a portion of the spacer domain.

ILP-3 functioned neither as an inducer nor an inhibitor of apoptosis when expressed in 293 cells in response to caspase 1 -mediated cell death. Previous deletion studies determined that the BIR domains of hlLP were necessary and sufficient to block cell death. These data indicate that the single domain encoded by the hILP-3 gene was not sufficient to confer protection. However, ILP-2 induced cell death of 293 cells when expressed alone, and ILP-2 was able to prevent hILP-mediated protection. Therefore, ILP-2 may play a dominant role to hlLP in the regulation of apoptotic cell death. Exposure to TNFα results in activation of two transcription factors, AP-1 and NF-κB, which mediate induction of other cytokine and immunoregulatory genes. NF-κB induces anti-apoptotic genes as well, including C-IAP2. Among the IAPs, c-IAPl and C-IAP2 activate NF-κB while hlLP leads to activation of JNK, which contributes to AP-1 induction. Neither ILP-2 nor ILP-3 significantly activated NF-κB when expressed in 293 cells. However, both drastically inhibited TNFα-mediated NF-κB activation. Given the potential importance of NF-κB in the induction of pro- survival genes, the ability of ILP-3 to block NF-KB activation was surprising since it exhibited no dominant effect on protection from apoptosis in 293 cells. Curiously, ILP-3 had no effect on TNFα- mediated JNK activation but moderately inhibited hILP-mediated JNK activation, which indicates that hlLP and TNFα activate JNK through different signaling pathways. ILP-2 had the ability to activate JNK on its own, and ILP-2-mediated JNK activation was additive to JNK activation by hlLP and TNFα.

ILP-2 and ILP-3 function as dominant inhibitors of multiple pathways involving the IAPs. One mechanism by which ILP-2 and ILP-3 may act as dominant inhibitors of hlLP function is by forming heteromeric di ers with hlLP. In addition, ILP-2 and ILP-3 may function by binding to the same downstream regulators which mediate the functions of other IAPs. There is specificity involved in the ability of ILP-2 and ILP-3 to function as dominant inhibitors, as ILP-3 has no effect on hlLP- mediated protection from apoptosis while ILP-2 retains the ability to activate JNK. These findings indicate that ILP-2 and ILP-3 may play important roles in the regulation of both the anti-apoptotic and signaling functions of the IAPs.

EXAMPLE 12 Cloning ILP-2 and ILP-3 in Other Species Having presented the nucleotide sequences of human and non-human primate ILP-2 (SEQ

ID NOS: 13, 15, 17) and ILP-3 cDNAs (SEQ ID NOS: 1, 3, 5, 7, 9, 11), and the amino acid sequence of the encoded proteins (SEQ ID NOS 14, 16, 18 and 2, 4, 6, 8, 10, 12, respectively), this disclosure also facilitates the identification of DNA molecules, and thereby proteins, which are the ILP-2 and ILP-3 homologs in other species. For example, polymorphisms in the same species or homologs in other species, such other primates. These other homologs can be derived from those sequences disclosed, but which vary in their precise nucleotide or amino acid sequence from those disclosed. Such variants may be obtained through a combination of standard molecular biology laboratory techniques and the nucleotide and amino acid sequence information disclosed herein.

ILP-2 and ILP-3 homologs in other organisms can be identified using the ILP-2 and ILP-3 sequences to design probes, for example an oligonucleotide or polynucleotide. Such probes can be used to screen a genomic or cDNA library from any organism using standard hybridization methods. In addition, primers or degenerate primers covering regions of ILP-2 and ILP-3 thought to be important for its function (for example the BIR domain of ILP-2 (amino acids 7-70 of SEQ ID NO: 14) and the RING finger domain of ILP-2 (amino acids 188-223 of SEQ ID NO: 14), can be designed for use in a PCR reaction to amplify ILP-2 and ILP-3 homologs from a genomic or cDNA library. EX AMPLE 13 Sequence Variants of ILP-2 and ILP-3

The amino acid sequence of ILP-3 (SEQ ID NOS 2, 4, 6, 8, 10, 12) and ILP-2 proteins (SEQ ID NOS 14, 16, 18) which are encoded by ILP-3 (SEQ ID NOS 1, 3, 5, 7, 9, 1 1) and ILP-2 (SEQ ID NOS 13, 15, 17) cDNAs, are shown in FIGS. 2 and 3. The distinctive functional characteristic of ILP-2 is its ability to decrease Bax-induced apoptosis. The distinctive functional characteristic of ILP-3 is its ability to interact with TGFβR. These activities of the ILP-2 and ILP-3 proteins may readily be determined using the assays described above, for examples those described in EXAMPLES 5-9.

Having presented the nucleotide sequence of the ILP-2 and ILP-3 cDNAs and the amino acid sequence of these proteins, this disclosure facilitates the creation of DNA molecules, and thereby proteins, which are derived from those disclosed but which vary in their precise nucleotide or amino acid sequence from those disclosed. Such variants may be obtained through a combination of standard molecular biology laboratory techniques and the nucleotide sequence information disclosed herein.

ILP-2 variants, polymorphisms, mutants, and fragments will retain the ability to modulate Bax-induced apoptosis, for example the ability to decrease Bax-induced apoptosis, for example by inhibiting the Caspase-9: Apaf-1 complex. In other embodiments, ILP-2 variants, polymorphisms, mutants, and fragments will retain the ability to decrease activation of the Caspase-9: Apaf-1 holoenzyme, but does not block the active holoenzyme or active Caspase-3. In other embodiments, ILP-2 variants, polymorphisms, mutants, and fragments will retain the ability to co-precipitate a processed form of Caspase-9. In other embodiments, ILP-2 variants, polymorphisms, mutants, and fragments will retain the ability to activate JNK activity. ILP-3 variants, polymorphisms, mutants, and fragments have the ability to moderately inhibit ILP-1 -mediated JNK activation when cotransfected with ILP-1. Both ILP-2 and ILP-3 variants and fragments will retain the ability to interact with TGFβR.

Since the region containing amino acids 18-30 of the ILP-2 sequence and amino acids 40-61 of the ILP-3 sequence is highly conserved between species (see FIGS. 2 and 3, respectively), in particular embodiments these residues of ILP-2 and ILP-3 ideally do not substantially diverge from the wild-type sequence shown in SEQ ID NOs 14, 16, 18 and 2, 4, 6, 8, 10, 12, respectively. Other important residues include those domains noted in FIG. 1. Such domains include, but are not limited to: the ILP-2 BIR domain (amino acids 7-70 of SEQ ID NO 14), and the RING domains of ILP-2 (amino acids 188-223 of SEQ ID NO 14) and ILP-3 (amino acids 68-104of SEQ ID NO 2. In these regions, conservative substitutions will be better tolerated than non-conservative substitutions.

Substitutions of ILP-2 or ILP-3 amino acid sequences can be made either in regions that are highly conserved between species, or regions that share less conservation between species. As an example, referring to FIG. 3, the region containing amino acids 101-102 of the human ILP-3 sequence is not strictly conserved among the species shown. Therefore, alterations in the sequence in this region are predicted to have less of an effect on the function of the ILP-3 protein, than for example mutations in the region containing amino acids 41-61 of the human ILP-3 sequence. However, conservative substitutions will be better tolerated than non-conservative substitutions. The indication of highly conserved regions in FIGS. 2 and 3 provides further guidance in helping select residues that may be substituted or deleted. For example, referring to FIG. 3, the region containing amino acid 62 of the ILP-3 sequence is not highly conserved among the six species shown. Therefore, alterations in the sequence in this region are predicted to have less of an effect on the function of the ILP-3 protein, than for example mutations in the region containing amino acids 40-60 of the ILP-3 sequence. Variants and fragments may retain at least 60%, 70%, 75% 80%, 85%, 90%, 95%, 98%, or greater sequence identity to the ILP-2 and ILP-3 amino acid sequences disclosed herein, and in particular embodiments at least this much identity to SEQ ID NOs 2, 4, 6, 8, 10, 12, 14, 16, and 18. Less identity is allowed, as long as the variant ILP-2 and ILP-3 sequence maintains the functional activity of the ILP-2 and ILP-3 protein as defined herein. Such activity can be readily determined using the assays disclosed herein.

The simplest modifications involve the substitution of one or more amino acid residues (for example 2, 5 or 10 residues) for amino acid residues having similar biochemical properties. These so-called conservative substitutions are likely to have minimal impact on the activity of the resultant protein. Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are conservative when it is desired to finely modulate the characteristics of the protein. Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gin or His for Asn; Glu for Asp; Ser for Cys; Asn for Gin; Asp for Glu; Pro for Gly; Asn or Gin for His; Leu or Val for He; He or Val for Leu; Arg or Gin for Lys; Leu or He for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and He or Leu for Val.

Amino acid substitutions are typically of single residues, for example 1, 2, 3, 4, 5, 10 or more substitutions; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.

Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those listed above, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine. Such ILP-2 variants can be readily selected for additional testing by performing an assay

(such as that shown in EXAMPLES 5-9) to determine if the ILP-2 variant decreases Bax-induced apoptosis by more than a desired amount, for example by a factor of at least 2, for example at least 3, for example at least 5, as described in EXAMPLE 5. The ability of the ILP-2 variant to decrease Bax-induced apoptosis by inhibiting the Caspase-9: Apaf-1 complex, for example by a factor of about 3 fold, for example about 5 fold, as described in EXAMPLE 5 can also be determined. The ability of the ILP-2 variant to decrease activation of the Caspase-9: Apaf-1 holoenzyme, for example by about 1.5 fold after six minutes, for example by about 2 fold after six minutes, but does not block the active holoenzyme or active Caspase-3, can be determined using the assay described in EXAMPLE 5. The ability of the ILP-2 variant to bind and interact with TGFβR and processed Caspase-9 can be determined by the assays described in EXAMPLE 6 and 8. The ability of the ILP-2 variant to activate JNK activity, for example by about 3 fold, for example by about 4.7 fold, can be determined using the methods described in EXAMPLE 9.

Such variants can be readily selected for additional testing by performing an assay (such as that shown in EXAMPLES 5-9) to determine if the ILP-3 variant can to bind and interact with TGFβR using the assay described in EXAMPLE 8 and to determine if the variant can moderately inhibit ILP-1 -mediated JNK activation when co-transfected with ILP-1, using the assay described in EXAMPLE 9.

Variant DNA molecules include those created by standard DNA mutagenesis techniques, for example, M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Chapter 15, herein incorporated by reference). By the use of such techniques, variants may be created which differ in minor ways from those disclosed. DNA molecules and nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of nucleotides while still encoding a protein which possesses the functional characteristics of the ILP-2 and ILP-3 proteins are comprehended by this disclosure.

Also disclosed are small DNA molecules which are derived from the disclosed DNA molecules. Such small DNA molecules include oligonucleotides suitable for use as hybridization probes or polymerase chain reaction (PCR) primers. As such, these small DNA molecules will comprise at least a segment of the ILP-2 and ILP-3 cDNA molecules or the ILP-2 and ILP-3 genes. For example, the sequences will comprise at least 20, 25, 30, 40, or 50 contiguous nucleotides of nucleotide sequence of ILP-2 (SEQ ID NOS 13, 15, 17, or their complementary strands) (i.e., at least 20-50 consecutive nucleotides of the ILP-2 cDNA/gene sequences). In other embodiments, the sequences will comprise at least 62, 65, 70, or 75 contiguous nucleotides of nucleotide sequence of the ILP-3 (SEQ ID NOS 1, 3, 5, 7, 9, 1 1, or their complementary strands) (l e , at least 62-70 consecutive nucleotides of the ILP-3 cDNA/gene sequences) It will be appreciated that such longer length nucleotide sequences will provide greater specificity in hybridization or PCR applications than shorter length sequences Accordingly, superior results may be obtained using these longer stretches of consecutive nucleotides

DNA molecules and nucleotide sequences which are derived from the disclosed DNA molecules as descπbed above may also be defined as DNA sequences which hybridize under stringent conditions to the DNA sequences disclosed, or fragments thereof Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used Generally, the temperature of hybridization and the ionic strength (especially the Na⁺ concentration) of the hybridization buffer will determine the stringency of hybridization Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al (In Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989 ch 9 and 11), herein incorporated by reference

Specific hybridization refers to the binding, duplexing, or hybridizmg of a molecule only or substantially only to a particular nucleotide sequence when that sequence is present in a complex mixture (e g total cellular DNA or RNA) Specific hybridization may also occur under conditions of varying stringency Hybridization conditions resulting in particular degrees of stringency will vary dependmg upon the nature of the hybridization method of choice and the composition and length of the hybridizmg DNA used Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Sprmg Harbor, New York, 1989 chapters 9 and 1 1) By way of illustration only, a hybridization experiment may be performed by hybridization of a DNA molecule to a target DNA molecule which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J Mol Biol 98 503, 1975), a technique well known m the art and described in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989)

By way of illustration only, a hybridization experiment may be performed by hybridization of a DNA molecule (for example, a variant of the ILP-2 or ILP-3 cDNA) to a target DNA molecule (for example, the ILP-2 or ILP-3 cDNA) which has been electrophoresed m an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J Mol Biol 98 503, 1975), a technique well known in the art and described in Sambrook et al (Molecular Cloning A Laboratory Manual, Cold Spring Harbor, New York, 1989)

Hybridization with a target probe labeled, for example, with [³²P]-dCTP is generally carried out in a solution of high ionic strength such as 6xSSC at a temperature that is 20-25°C below the meltmg temperature, T_m, described below For such Southern hybridization experiments where the target DNA molecule on the Southern blot contains 10 ng of DNA or more, hybridization is typically carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe (of specific activity equal to 10⁹ CPM/μg or greater). Following hybridization, the nitrocellulose filter is washed to remove background hybridization. The washing conditions should be as stringent as possible to remove background hybridization but to retain a specific hybridization signal.

The term T_m represents the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target sequence hybridize to the target sequence at equilibrium. Because the target sequences are generally present in excess, at T_m, 50% of the probes are occupied at equilibrium. The T_m of such a hybrid molecule may be estimated from the following equation (Bolton and McCarthy, Proc. Natl. Acad. Sci. USA 48:1390, 1962): T_m = 81.5°C - 16.6(log₁₀[Na⁺]) + 0.41(%G+C) - 0.63(% formamide) - (600/1); where 1 = the length of the hybrid in base pairs.

This equation is valid for concentrations of Na⁺ in the range of 0.01 M to 0.4 M, and it is less accurate for calculations of T_m in solutions of higher [Na⁺]. The equation is also primarily valid for DNAs whose G+C content is in the range of 30% to 75%, and it applies to hybrids greater than 100 nucleotides in length (the behavior of oligonucleotide probes is described in detail in Ch. 11 of Sambrook et al (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989). Thus, by way of example, for a 150 base pair DNA probe with a hypothetical GC content of 45%, a calculation of hybridization conditions required to give particular stringencies may be made as follows: For this example, it is assumed that the filter will be washed in 0.3 xSSC solution following hybridization, thereby: [Na⁺] = 0.045 M; %GC = 45%; Formamide concentration = 0; 1 = 150 base pairs; T_m=81.5 - 16.6(log₁₀[Na⁺]) + (0.41 x 45) - (600/150); and so T_m = 74.4°C.

The T_m of double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al, J. Mol. Biol. 81 :123, 1973). Therefore, for this given example, washing the filter in 0.3 xSSC at 59.4-64.4°C will produce a stringency of hybridization equivalent to 90%; that is, DNA molecules with more than 10% sequence variation relative to the target cDNA will not hybridize. Alternatively, washing the hybridized filter in 0.3 xSSC at a temperature of 65.4-68.4°C will yield a hybridization stringency of 94%; that is, DNA molecules with more than 6% sequence variation relative to the target cDNA molecule will not hybridize. The above example is given entirely by way of theoretical illustration. One skilled in the art will appreciate that other hybridization techniques may be utilized and that variations in experimental conditions will necessitate alternative calculations for stringency.

Examples of stringent conditions are those under which DNA molecules with more than 25%, 15%>, 10%, 6% or 2% sequence variation (also termed "mismatch") will not hybridize. Stringent conditions are sequence dependent and are different in different circumstances. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be no more than about 5°C lower than the thermal melting point T_m for the specific sequence at a defined ionic strength and pH. An example of stringent conditions is a salt concentration of at least about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and a temperature of at least about 30°C for short probes (e.g. 10 to 50 nucleotides). Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide. For example, conditions of 5X SSPE (750 mM NaCl, 50 mM Na Phosphate, 5 mM EDTA, pH 7.4) and a temperature of 25-30°C are suitable for allele-specific probe hybridizations. A perfectly matched probe has a sequence perfectly complementary to a particular target sequence. The test probe is typically perfectly complementary to a portion (subsequence) of the target sequence. The term "mismatch probe" refers to probes whose sequence is deliberately selected not to be perfectly complementary to a particular target sequence.

Transcription levels can be quantitated absolutely or relatively. Absolute quantitation can be accomplished by inclusion of known concentrations of one or more target nucleic acids (for example control nucleic acids such as Bio B or with a known amount the target nucleic acids themselves) and referencing the hybridization intensity of unknowns with the known target nucleic acids (for example by generation of a standard curve).

The degeneracy of the genetic code further widens the scope of the disclosure as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein. For example, the 31st amino acid residue of the human ILP-3 protein is alanine. This is encoded in the ILP-3 cDNA by the nucleotide codon triplet GCA. Because of the degeneracy of the genetic code, three other nucleotide codon triplets, GCT, GCG and GCC, also code for alanine. Thus, the nucleotide sequence of the ILP-3 cDNA could be changed at this position to any of these three codons without affecting the amino acid composition of the encoded protein or the characteristics of the protein. Based upon the degeneracy of the genetic code, variant DNA molecules may be derived from the cDNA molecules disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences which do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are herein also comprehended by this disclosure.

One skilled in the art will recognize that the DNA mutagenesis techniques described above may be used not only to produce variant DNA molecules, but will also facilitate the production of proteins which differ in certain structural aspects from the ILP-2 or ILP-3 proteins, yet which proteins are clearly derivative of this protein and which maintain the essential characteristics of the ILP-2 or ILP-3 protein as define above. Newly derived proteins may also be selected in order to obtain variations on the characteristic of the ILP-2 or ILP-3 protein, as will be more fully described below. Such derivatives include those with variations in amino acid sequence including minor deletions, additions and substitutions. While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for optimal activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.

The ILP-2 and ILP-3 genes, cDNA, DNA molecules derived therefrom and the protein encoded by these cDNAs and derivative DNA molecules may be utilized in aspects of both the study of ILP-2 and ILP-3 and for diagnostic and therapeutic applications related to ILP-2 and ILP-3. Those skilled in the art will recognize that the utilities herein described are not limited to the specific experimental modes and materials presented and will appreciate the wider potential utility of this disclosure.

EXAMPLE 14

Recombinant Expression of ILP-2 and ILP-3

With the provision of the ILP-2 (SEQ ID NOS 13, 15, 17) and ILP-3 cDNAs (SEQ ID NOS 1, 3, 5, 7, 9, 11) and amino acid sequences (SEQ ID NOS for ILP-3: 2, 4, 6, 8, 10, 12 and SEQ ID NOS for ILP-2: 14, 16, 18), the expression and purification of the corresponding proteins by standard laboratory techniques is now enabled. The purified protein may be used for functional analyses, antibody production and therapy in a subject. Furthermore, the DNA sequence of the ILP-2 and ILP- 3 cDNA and any variant or fragment thereof, can be manipulated in studies to understand the expression of the gene and the function of its product.

Partial or full-length cDNA sequences encoding the ILP-2 and ILP-3 protein, may be ligated into bacterial expression vectors. Methods for expressing large amounts of protein from a cloned gene introduced into E. coli may be utilized for the purification, localization and functional analysis of proteins. For example, fusion proteins consisting of amino terminal peptides encoded by a portion of the E. coli lacZ or trpE gene linked to ILP-2 and ILP-3 may be used to prepare polyclonal and monoclonal antibodies against ILP-2 and/or ILP-3. Thereafter, these antibodies may be used to purify proteins by immunoaffinity chromatography, in diagnostic assays to quantitate the levels of protein and to localize ILP-2 and ILP-3 in tissues and individual cells by immunofluorescence.

Intact native protein, or variants or fragments thereof, may also be produced in E. coli in large amounts for functional studies. Methods and plasmid vectors for producing fusion proteins and intact native proteins in bacteria are described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Chapter 17, herein incorporated by reference). Such fusion proteins may be made in large amounts, are easy to purify, and can be used to elicit antibody response. Native proteins can be produced in bacteria by placing a strong, regulated promoter and an efficient ribosome binding site upstream of the cloned gene. If low levels of protein are produced, additional steps may be taken to increase protein production; if high levels of protein are produced, purification is relatively easy. Suitable methods are presented in Sambrook et al. (Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989) and are well known in the art. Often, proteins expressed at high levels are found in insoluble inclusion bodies. Methods for extracting proteins from these aggregates are described by Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989, Chapter 17). Vector systems suitable for the expression of lacZ fusion genes include the pUR series of vectors (Ruther and Muller-Hill, 1983, EMBO J. 2: 1791), pEXl-3 (Stanley and Luzio, 1984, EMBO J. 3: 1429) and pMRlOO (Gray et al., 1982, Proc. Natl. Acad. Sci. USA 79:6598). Vectors suitable for the production of intact native proteins include pKC30 (Shimatake and Rosenberg, 1981, Nature 292: 128), pKKl 77-3 (Amann and Brosius, 1985, Gene 40: 183) and pET-3 (Studiar and Moffatt, 1986, J. Mol. Biol. 189: 113). ILP-2 and ILP-3 fusion proteins may be isolated from protein gels, lyophilized, ground into a powder and used as an antigen. The DNA sequence can also be transferred to other cloning vehicles, such as other plasmids, bacteriophages, cosmids, animal viruses and yeast artificial chromosomes (YACs) (Burke et al., 1987, Science 236:806-12). These vectors may then be introduced into a variety of hosts including somatic cells, and simple or complex organisms, such as bacteria, fungi (Timberlake and Marshall, 1989, Science 244:1313-7), invertebrates, plants (Gasser and Fraley, 1989, Science 244: 1293), and mammals (Pursel et al, 1989, Science 244: 1281-8), which cell or organisms are rendered transgenic by the introduction of the heterologous ILP-2 and/or ILP-3 cDNA. For expression in mammalian cells, the cDNA sequence may be ligated to heterologous promoters, such as the simian virus SV40, promoter in the pSV2 vector (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6), and introduced into cells, such as monkey COS-1 cells (Gluzman, 1981, Cell 23: 175-82), to achieve transient or long-term expression. The stable integration of the chimeric gene construct may be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, 1982, J. Mol. Appl. Genet. 1 :327-41) and mycophoenolic acid (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6).

DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with PCR.

The cDNA sequence (or portions derived from it) or a mini gene (a cDNA with an intron and its own promoter) may be introduced into eukaryotic expression vectors by conventional techniques. These vectors are designed to permit the transcription of the cDNA eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 are readily available (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6; Gorman et al, 1982, Proc. Natl. Acad. Sci USA 78:6777-81). The level of expression of the cDNA can be manipulated with this type of vector, either by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S.frugiperda cells (Summers and Smith, 1985, Genetically Altered Viruses and the Environment, Fields et al. (Eds.) 22:319-328, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.) or by using vectors that contain promoters amenable to modulation, for example, the glucocorticoid- responsive promoter from the mouse mammary tumor virus (Lee et al, 1982, Nature 294:228). The expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression).

In addition, some vectors contain selectable markers such as the gpt (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072-6) or neo (Southern and Berg, 1982, J. Mol Appl. Genet.

1:327-41) bacterial genes. These selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vectors (and therefore the cDNA). The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses such as papilloma (Sarver et al., 1981, Mot Cell Biol 1 :486) or Epstein-Barr (Sugden et al, 1985, Mol. Cell Biol 5:410). Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the gene product on a continuous basis. One can also produce cell lines that have amplified the number of copies of the vector (and therefore of the cDNA as well) to create cell lines that can produce high levels of the gene product (Alt et al, 1978, J Biol. Chem. 253:1357). The transfer of DNA into eukaryotic, in particular human or other mammalian cells, is now a conventional technique. The vectors are introduced into the recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, 1973, Virology 52:466) or strontium phosphate (Brash et al., 1987, Mol. Cell Biol. 7:2013), electroporation (Neumann et al, 1982, EMBO J. 1 :841), lipofection (Feigner et al, 1987, Proc. Natl. Acad. Sci USA 84:7413), DEAE dextran (McCuthan e/ α/., 1968, J. Natl. Cancer Inst. 41:351), microinjection

(Mueller et al, 1978, Cell 15:579), protoplast fusion (Schafher, 1980, Proc. Natl. Acad. Sci. USA 77:2163-7), or pellet guns (Klein et al, 1987, Nature 327:70). Alternatively, the cDNA can be introduced by infection with virus vectors. Systems are developed that use, for example, retroviruses (Bernstein et al, 1985, Gen. Engrg. 7:235), adenoviruses (Ahmad et al, 1986, J. Virol. 57:267), or Herpes virus (Spaete et al, 1982, Cell 30:295).

These eukaryotic expression systems can be used for studies of the ILP-2 and ILP-3 genes and mutant forms of this genes, the ILP-2 and ILP-3 proteins and mutant forms of these proteins. Such uses include, for example, the identification of regulatory elements located in the 5' region of the ILP-2 and ILP-3 genes on genomic clones that can be isolated from genomic DNA libraries, such as human or other non-human primate libraries, using the information contained in the present disclosure. The eukaryotic expression systems may also be used to study the function of the normal complete protein, specific portions of the protein, or of naturally occurring or artificially produced mutant proteins. Naturally occurring mutant proteins may exist in a variety of diseases in which apoptosis has become disregulated, while artificially produced mutant proteins can be designed by site directed mutagenesis as described above. These latter studies may probe the function of any desired amino acid residue in the protein by mutating the nucleotide coding for that amino acid.

Using the above techniques, the expression vectors containing the ILP-2 and/or ILP-3 genes or cDNA sequences or variants, fragments, or mutants thereof, can be introduced into human cells, mammalian cells from other species or non-mammalian cells as desired. The choice of cell is determined by the purpose of the treatment. For example, monkey COS cells (Gluzman, 1981, Cell 23: 175-82) that produce high levels of the SV40 T antigen and permit the replication of vectors containing the SV40 origin of replication may be used. Similarly, Chinese hamster ovary (CHO), mouse NIH 3T3 fibroblasts or human fibroblasts or lymphoblasts may be used. One method that can be used to express the ILP-2 and ILP-3 polypeptides from the cloned

ILP-2 and ILP-3 cDNA sequences in mammalian cells is to use the cloning vector, pXTI (Stratagene,), which contains the Long Terminal Repeats (LTRs) and a portion of the GAG gene from Moloney Murine Leukemia Virus. The position of the viral LTRs allows highly efficient, stable transfection of the region within the LTRs. The vector also contains the Herpes Simplex Thymidine Kinase promoter (TK), active in embryonal cells and in a wide variety of tissues in mice, and a selectable neomycin gene conferring G418 resistance. Two unique restriction sites Bglll and Xhol are directly downstream from the TK promoter. ILP-2 and/or ILP-3cDNA, including the entire open reading frame for the ILP-2 and/or ILP-3 proteins and the 3' untranslated region of the cDNAs are cloned into one of the two unique restriction sites downstream from the promoter. The ligated product is transfected into mouse NIH 3T3 cells using Lipofectin (Life

Technologies, Inc.) under conditions outlined in the product specification. Positive transfectants are selected after growing the transfected cells in 600 μg/ml G418 (Sigma, St. Louis, MO). The protein is released into the supernatant and may be purified by standard immunoaffinity chromatography techniques using antibodies raised against the ILP-2 and/or ILP-3 proteins (see EXAMPLE 15). Expression of ILP-2 and ILP-3 proteins, variants, polymorphisms, fragments of variants thereof, in eukaryotic cells can be used as a source of proteins to raise antibodies. The proteins may be extracted following release of the protein into the supernatant as described above, or, the cDNA sequence may be incorporated into a eukaryotic expression vector and expressed as a chimeric protein with, for example, β-globin. Antibody to β-globin is thereafter used to purify the chimeric protein. Corresponding protease cleavage sites engineered between the β-globin gene and the cDNA are then used to separate the two polypeptide fragments from one another after translation. One useful expression vector for generating β-globin chimeric proteins is pSG5 (Stratagene). This vector encodes rabbit β-globin.

The recombinant cloning vector then comprises the selected DNA of the DNA sequences disclosed herein for expression in a suitable host. The DNA is operatively linked in the vector to an expression control sequence in the recombinant DNA molecule so that the ILP-2 or ILP-3 polypeptide can be expressed. The expression control sequence may be selected from the group consisting of sequences that control the expression of genes of prokaryotic or eukaryotic cells and their viruses and combinations thereof. The expression control sequence may be specifically selected from the group consisting of the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors and combinations thereof.

The host cell, which may be transfected with the vector disclosed herein, may be selected from the group consisting of bacteria, yeast, fungi, plant, insect, mouse or other animal subject; or human tissue cells.

It is appreciated that for mutant or variant DNA sequences, similar systems are employed to express and produce the mutant or variant product.

EXAMPLE 15 Production and Use of Antibodies

Production of Antibodies

Monoclonal or polyclonal antibodies may be produced to either the normal ILP-2 and/or ILP-3 proteins, or variants, polymorphisms, fragments and mutant forms thereof. Optimally, antibodies raised against the protein will specifically detect the protein. That is, antibodies raised against the protein (e.g. ILP-2) would recognize and bind the protein and would not substantially recognize or bind to other cellular proteins (such as serum albumin). The determination that an antibody specifically detects an ILP-2 and/or ILP-3 protein is made by any one of a number of standard immunoassay methods; for instance, the Western blotting technique (Sambrook et al, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York).

To determine that a given antibody preparation (such as one produced in a mouse against the ILP-3 protein) specifically detects the ILP-3 protein by Western blotting, total cellular protein is extracted from cells (for example, lymphocytes) and electrophoresed on a sodium dodecyl sulfate- polyacrylamide gel. The proteins are then transferred to a membrane (for example, nitrocellulose) by Western blotting, and the antibody preparation is incubated with the membrane. After washing the membrane to remove non-specifically bound antibodies, the presence of specifically bound antibodies is detected by the use of an anti-mouse antibody conjugated to an enzyme such as alkaline phosphatase; application of the substrate 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium results in the production of a dense blue compound by immuno-localized alkaline phosphatase.

Antibodies which specifically detect the ILP-2 or ILP-3 protein will, by this technique, be shown to bind to the protein band, which will be localized at a given position on the gel determined by its molecular weight. For example, ILP-2 localizes around 30 kD (see FIG. 7), and ILP-3 localizes around 14 kD. Non-specific binding of the antibody to other proteins may occur and may be detectable as a weak signal on the Western blot. The non-specific nature of this binding will be recognized by one skilled in the art by the weak signal obtained on the Western blot relative to the strong primary signal arising from the specific antibody-ILP-2 or antibody-ILP-3 protein binding. Antibodies that specifically bind to an ILP-2 or ILP-3 protein (or any of the other novel proteins disclosed herein) belong to a class of molecules that are referred to herein as "specific binding agents." Specific binding agents that are capable of specifically binding to an ILP-2 or ILP-3 protein may include polyclonal antibodies, monoclonal antibodies (including humanized monoclonal antibodies) and fragments of monoclonal antibodies such as Fab, F(ab')2 and Fv fragments, as well as any other agent capable of specifically binding to an ILP-2 or ILP-3 protein (or the other disclosed proteins).

Substantially pure ILP-2 and/or ILP-3 protein suitable for use as an immunogen is isolated from the transfected or transformed cells as described. Concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few micrograms per milliliter. Monoclonal or polyclonal antibody to the protein can then be prepared as follows.

Monoclonal Antibody Production by Hybridoma Fusion

Monoclonal antibody to epitopes of the ILP-2 or ILP-3 protein, identified and isolated as described, can be prepared from murine hybridomas according to the classical method of Kohler and Milstein (Nature 256:495, 1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein (or epitope thereof) over a period of a few weeks. The mouse is then sacrificed, and the antibody-producing cells of the spleen isolated. The spleen cells are fused by means of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall (Enzymol. 70:419, 1980), and derivative methods thereof. Selected positive clones can be expanded and their monoclonal antibody product harvested for use. Detailed procedures for monoclonal antibody production are described in Harlow and Lane

(Antibodies: A Laboratory Manual 1988, Cold Spring Harbor Laboratory, New York). In addition, protocols for producing humanized forms of monoclonal antibodies (for therapeutic applications) and fragments of monoclonal antibodies are known in the art.

Polyclonal Antibody Production by Immunization

Polyclonal antiserum containing antibodies to heterogeneous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein, which can be unmodified or modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and may require the use of carriers and adjuvant. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis et al. (J. Clin. Endocrinol. Metab. 33:988-91, 1971). Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony et al. (In: Handbook of Experimental Immunology, Wier, D. (ed.). Chapter 19. Blackwell. 1973). Plateau concentration of antibody is usually in the range of 0.1 to 0.2 mg/ml of serum (about 12 μM).

Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher (Manual of Clinical Immunology, Chapter 42. 1980).

Synthetic Peptides Another approach to raising antibodies against the ILP-2 and ILP-3 proteins is to use synthetic peptides synthesized on a commercially available peptide synthesizer based upon the predicted amino acid sequence of the ILP-2 or ILP-3 protein.

Antibodies may be raised against the ILP-2 or ILP-3 protein by subcutaneous injection of a

DNA vector which expresses the ILP-2 or ILP-3 protein into laboratory animals, such as mice. Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the

Biolistic system (Sanford et al, 1987, Pariculate Sci. Technol. 5:27-37) as described by Tang et al.

(Nature, 356:152-4, 1992). Expression vectors suitable for this purpose may include those which express the ILP-2 or ILP-3 cDNA under the transcriptional control of either the human actin promoter or the cytomegalovirus (CMV) promoter. Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample.

Antibodies Raised by Injection of ILP-2 or ILP-3 cDNA

Antibodies may be raised against the ILP-2 and ILP-3 proteins by subcutaneous injection of a DNA vector which expresses the ILP-2 or ILP-3 protein (or variant, fragment, polymorphism, or mutant thereof) into laboratory animals, such as mice. Delivery of the recombinant vector into the animals may be achieved using a hand-held form of the Biolistic system (Sanford et al, Particulate Sci. Technol. 5:27-37, 1987) as described by Tang et al. (Nature 356: 152-4, 1992). Expression vectors suitable for this purpose may include those which express the ILP-2 or ILP-3 cDNA under the transcriptional control of either the human β-actin promoter or the CMV promoter.

Antibody preparations prepared according to these protocols are useful in quantitative immunoassays which determine concentrations of antigen-bearing substances in biological samples; they are also used semi-quantitatively or qualitatively to identify the presence of antigen in a biological sample. Labeled Antibodies

Antibodies disclosed herein can be conjugated with various labels for their direct detection (see Chapter 9, Harlow and Lane, Antibodies: A Laboratory Manual. 1988). The label, which may include, but is not limited to, a radiolabel, enzyme, fluorescent probe, or biotin, is chosen based on the method of detection available to the user.

Antibodies can be radiolabeled with iodine (¹²⁵I), which yields low-energy gamma and X- ray radiation. Briefly, 10 μg of protein in 25 μl of 0.5 M sodium phosphate (pH 7.50 is placed in a 1.5 ml conical tube. To this, 500 μC of Na¹²⁵I, and 25 μl of 2 mg/ml chloramine T is added and incubated for 60 seconds at room temperature. To stop the reaction, 50μl of chloramine T stop buffer is added (2.4 mg/ml sodium metabisulfite, 10 mg/ml tyrosine, 10% glycerol, 0.1% xylene cyanol in PBS). The iodinated antibody is separated from the iodotyrosine on a gel filtration column. Antibodies disclosed herein can also be labeled with biotin, with enzymes such as alkaline phosphatase (AP) or horseradish peroxidase (HRP) or with fluorescent dyes. The method of producing these conjugates is determined by the reactive group on the label added.

EXAMPLE 16 Diagnostic Methods

One embodiment disclosed herein is a method for screening a subject to determine if the subject carries a mutant or variant ILP-2 and/or ILP-3 gene, for example having a heterozygous or homozygous nucleotide change, or insertions or deletions of the ILP-2 and/or ILP-3 gene, including partial or complete deletion of the gene. One major application of the ILP-2 and ILP-3 sequence information presented herein is in the area of genetic testing for predisposition to disease, such as cone-rod retinal dystrophy-2; leber congenitalamaurosis due to defect in CRX; retinitis pigmentosa (late-onset dominant); glutaricaciduria, type IIB; diabetes mellitus, noninsulin-dependent diabetes; colorectal cancer; T-cell acute lymphoblastic leukemia; hyperferritinemia-cataract syndrome; and hydatidiform moles owing to an ILP-2 deletion or mutation, and selective T-cell defect; osteoarthritis of distal interphalangeal joints; colorectal cancer with chromosomal instability; hypothyroidism, congentical due to thyroid dysgenesis or hypoplasia; juvenile nephronophthisis; thrombophilia due to protein C deficiency; and neonatal purpura fulminans owing to an ILP-3 deletion or mutation.

Predisposition to other diseases, including, but not limited to diseases such as cancer; autoimmune diseases such as diabetes and multiple sclerosis; neurodegenerative diseases including retinal degeneration, owing to an ILP-2 and/or ILP-3 deletion or mutation, can also be determined using the methods disclosed herein. The gene sequence of the ILP-2 and/or ILP-3 genes, including intron-exon boundaries, is also useful in such diagnostic methods. The method consists of providing a biological sample obtained from the subject, in which sample includes DNA or RNA, and providing an assay for detecting in the biological sample the presence of a mutant ILP-2 and/or ILP-3 gene, a mutant ILP-2 and/or ILP-3 RNA, a homozygously or heterozygously deleted ILP-2 and/or ILP-3 gene, or the absence, through deletion, of the ILP-2 and or ILP-3 gene and corresponding RNA. Suitable biological samples include samples obtained from body cells, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, fine needle aspirate specimen, amniocentesis samples and autopsy material. The detection in the biological sample may be performed by a number of methodologies, as outlined below.

The foregoing assay may be assembled in the form of a diagnostic kit and may include, for example: hybridization with oligonucleotides; PCR amplification of the gene or a part thereof using oligonucleotide primers; RT-PCR amplification of the RNA or a part thereof using oligonucleotide primers; or direct sequencing of the ILP-2 and/or ILP-3 gene of the subject's genome using oligonucleotide primers. The efficiency of these molecular genetic methods should permit a rapid classification of patients affected by deletions, variants, or mutations of the ILP-2 and/or ILP-3 gene.

One embodiment of such detection techniques is the PCR amplification of reverse transcribed RNA (RT-PCR) of RNA isolated from cells (for example lymphocytes) followed by direct DNA sequence determination of the products. The presence of one or more nucleotide differences between the obtained sequence and the cDNA sequences, and especially, differences in the ORF portion of the nucleotide sequence are taken as indicative of a potential ILP-2 and or ILP-3 gene mutation.

Alternatively, DNA extracted from lymphocytes or other cells may be used directly for amplification. The direct amplification from genomic DNA would be appropriate for analysis of the entire ILP-2 and/or ILP-3 gene including regulatory sequences located upstream and downstream from the open reading frame. Reviews of direct DNA diagnosis have been presented by Caskey (Science 236: 1223-8, 1989) and by Landegren et al. (Science 242:229-37, 1989).

Further studies of the ILP-2 and ILP-3 genes isolated from subjects may reveal particular mutations, variants, polymorphisms, or deletions, which occur at a high frequency within this population of individuals. In this case, rather than sequencing the entire ILP-2 or ILP-3 gene, it is possible to design DNA diagnostic methods to specifically detect the most common ILP-2 and ILP-3 mutations, variants, polymorphisms, or deletions.

The detection of specific DNA mutations may be achieved by methods such as hybridization using specific oligonucleotides (Wallace et al, 1986, Cold Spring Harbor Symp. Quant. Biol. 51:257- 61), direct DNA sequencing (Church and Gilbert, 1984, Proc. Natl. Acad. Sci. USA. 81: 1991-5), the use of restriction enzymes (Flavell et al. 1978, Cell 15:25; Geever et al, 1981, Proc. Natl. Acad. Set USA 78:5081), discrimination on the basis of electrophoretic mobility in gels with denaturing reagent (Myers and Maniatis, 1986, Cold Spring Harbor Symp. Quant. Biol 51 :275-84), RNase protection (Myers et al, 1985, Science 230: 1242), chemical cleavage (Cotton et al, 1985, Proc. Natl. Acad. Sci. USA 85:4397-401), and the ligase-mediated detection procedure (Landegren et al, 1988, Science 241 :1077).

Oligonucleotides specific to normal, variant, or mutant sequences are chemically synthesized using commercially available machines, labeled radioactively with isotopes (such as ³²P) or non-radioactively, with tags such as biotin (Ward and Langer et al, 1981, Proc. Natl. Acad. Sci. USA 78:6633-57), and hybridized to individual DNA samples immobilized on membranes or other solid supports by dot-blot or transfer from gels after electrophoresis. The presence of these specific sequences are visualized by methods such as autoradiography or fluorometric (Landegren et al, 1989, Science 242:229-37) or colorimetric reactions (Gebeyehu et al, 1987, Nucleic Acids Res. 15:4513-34). The absence of hybridization would indicate a mutation in the particular region of the gene, or a deleted ILP-2 or ILP-3 gene.

Sequence differences between normal, variant, polymorphic, and mutant forms of the ILP-2 and ILP-3 genes may also be revealed by the direct DNA sequencing method of Church and Gilbert (Proc. Natl. Acad. Sci. USA 81:1991-5, 1988). Cloned DNA segments may be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR (Wrichnik ef α/., 19&7, Nucleic Acids Res. 15:529-42: Wong et al, 1987 ^', Nature 330:384- 6; Stoflet et al, 1988, Science 239:491-4). In this approach, a sequencing primer which lies within the amplified sequence is used with double-stranded PCR product or single-stranded template generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotides or by automatic sequencing procedures with fluorescent tags.

Sequence alterations may occasionally generate fortuitous restriction enzyme recognition sites or may eliminate existing restriction sites. Changes in restriction sites are revealed by the use of appropriate enzyme digestion followed by conventional gel-blot hybridization (Southern, 1975, J. Mol. Biol 98:503). DNA fragments carrying the site (either normal or mutant) are detected by their reduction in size or increase of corresponding restriction fragment numbers. Genomic DNA samples may also be amplified by PCR prior to treatment with the appropriate restriction enzyme; fragments of different sizes are then visualized under UV light in the presence of ethidium bromide after gel electrophoresis.

Genetic testing based on DNA sequence differences can be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing reagent. Small sequence deletions and insertions can be visualized by high-resolution gel electrophoresis. For example, a PCR product with small deletions is clearly distinguishable from a normal sequence on an 8%> non-denaturing polyacrylamide gel (WO 91/10734; Nagamine et al, 1989, Am. J. Hum. Genet. 45:337-9). DNA fragments of different sequence compositions may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific "partial-melting" temperatures (Myers et al, 1985, Science 230:1242). Alternatively, a method of detecting a mutation comprising a single base substitution or other small change could be based on differential primer length in a PCR. For example, an invariant primer could be used in addition to a primer specific for a mutation. The PCR products of the normal and mutant genes can then be differentially detected in acrylamide gels. In addition to conventional gel-electrophoresis and blot-hybridization methods, DNA fragments may also be visualized by methods where the individual DNA samples are not immobilized on membranes. The probe and target sequences may be both in solution, or the probe sequence may be immobilized (Saiki et al, 1989, Proc. Nat. Acad. Sci. USA 86:6230-4). A variety of detection methods, such as autoradiography involving radioisotopes, direct detection of radioactive decay (in the presence or absence of scintillant), spectrophotometry involving calorigenic reactions and fluorometry involved fluorogenic reactions, may be used to identify specific individual genotypes. If more than one mutation is frequently encountered in the ILP-2 and/or ILP-3 gene, a system capable of detecting such multiple mutations is desirable. For example, a PCR with multiple, specific oligonucleotide primers and hybridization probes may be used to identify all possible mutations at the same time (Chamberlain et al., 1988, Nucl Acids Res. 16:1141-55). The procedure may involve immobilized sequence-specific oligonucleotides probes (Saiki et al., 1989, Proc. Nat. Acad. Sci. USA 86:6230-4).

One method particularly suitable for detecting mutations in the ILP- and ILP-3 genes disclosed herein is the use of high density oligonucleotide arrays (also known as "DNA chips") as described by Hacia et al (Nat. Genet. 14:441-7, 1996).

EXAMPLE 17

Two Step Assay to Detect the Presence of ILP-2 and/or ILP-3 Gene in a Sample

A tissue sample from a subject can be processed according to the method disclosed by Antonarakis et al. (New Eng. J. Med. 313:842-848, 1985), separated through a 1% agarose gel and transferred to a nylon membrane for Southern blot analysis. Membranes are UV cross linked at 150 mJ using a GS Gene Linker (Bio-Rad, Hercules, CA). An ILP-2 or ILP-3 probe (for example SEQ

ID NOS 1, 3, 5, 7, 9, 11, 13, 15 or 17) is subcloned into pTZ18U. The phagemids can be transformed into E. coli MV 1 190 infected with M13K07 helper phage (Bio-Rad, Richmond, CA). Single stranded DNA is isolated according to standard procedures (Sambrook, et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989). Blots are prehybridized for 15-30 minutes at 65°C in 7% sodium dodecyl sulfate (SDS) in

0.5 M NaP0₄. The methods follow those described by Nguyen, et al. (BioTechniques 13:116-123, 1992). The blots are hybridized overnight at 65°C in 7% SDS, 0.5 M NaP0₄ with 25-50 ng/ml single stranded probe DNA. Post-hybridization washes consist of two 30 minute washes in 5% SDS, 40 mM NaP0₄ at 65°C, followed by two 30-minute washes in 1% SDS, 40 mM NaP0₄ at 65°C. The blots are subsequently rinsed with phosphate buffered saline (pH 6.8) for five minutes at room temperature (RT) and incubated with 0.2% casein in PBS for five minutes. The blots are then preincubated for 5-10 minutes in a shaking water bath at 45°C with hybridization buffer consisting of 6 M urea, 0.3 M NaCl, and 5X Denhardt' s solution (see Sambrook, et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989). The buffer is removed and replaced with 50-75 μl/cm² fresh hybridization buffer plus 2.5 nM of the covalently cross-linked oligonucleotide sequence complementary to the universal primer site (UP-AP, Bio-Rad). The blots are hybridized for 20-30 minutes at 45°C and post hybridization washes are incubated at 45°C as two 10 minute washes in 6 M urea, IX standard saline citrate (SSC), 0.1% SDS and one 10 minute wash in 1XSSC, 0.1%> Triton™X-100. The blots are rinsed for 10 minutes at RT with lXSSC. Blots are incubated for 10 minutes at RT with shaking in the substrate buffer consisting of 0.1 M diethanolarnine, 1 mM MgCl₂, 0.02% sodium azide, pH 10.0. Individual blots are placed in heat sealable bags with substrate buffer and 0.2 mM AMPPD (3-(2'-spiroadamantane)-4-methoxy-4- (3'-phosphoryloxy)phenyl-l,2-dioxetane, disodium salt, Bio-Rad). After a 20 minute incubation at RT with shaking, the excess AMPPD solution is removed. The blot is exposed to X-ray film overnight. Positive bands indicate the presence of the ILP-2 or ILP-3 gene. Patient samples which show no hybridizing bands lack the ILP-2 or ILP-3 gene, indicating the possibility of ongoing disease such as cancer, or an enhanced susceptibility to developing a disease, such as cancer, in the future.

EXAMPLE 18

Quantitation of ILP-2 and ILP-3 Proteins

An alternative method of diagnosing an ILP-2 and or ILP-3 gene deletion, variant, or other mutation is to quantitate the level of ILP-2 and/or ILP-3 protein in the cells of a subject. This diagnostic tool is useful for detecting reduced levels of the ILP-2 and/or ILP-3 protein which result from, for example, mutations in the promoter regions of the ILP-2 and/or ILP-3 gene or mutations within the coding region of the gene which produced truncated, non-functional polypeptides, as well as from deletions of the entire ILP-2 and/or ILP-3 gene. These diagnostic methods, in addition to those described in EXAMPLES 16 and 17, provide an enhanced ability to diagnose susceptibility to diseases caused by mutation or deletion of these genes. The determination of reduced ILP-2 and/or ILP-3 protein levels is an alternative or supplemental approach to the direct determination of ILP-2 and/or ILP-3 gene deletion or mutation status by the methods outlined above in EXAMPLE 16. The availability of antibodies specific to the ILP-2 and/or ILP-3 protein (for example those described in EXAMPLE 15) will facilitate the quantitation of cellular ILP-2 and or ILP-3 protein by one of a number of immunoassay methods which are well known in the art and are presented in Harlow and Lane (Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, New York. 1988).

Such assays permit both the detection of ILP-2 and/or ILP-3 proteins in a biological sample and the quantitation of such proteins. Typical methods involve providing a biological sample of the subject in which the sample contains cellular proteins, and providing an immunoassay for quantitating the level of ILP-2 and/or ILP-3 protein in the biological sample. This can be achieved by combining the biological sample with a ILP-2 and/or ILP-3 specific binding agent, such as an anti- ILP-2 and/or ILP-3 antibody (such as monoclonal or polyclonal antibodies), so that complexes form between the binding agent and the ILP-2 and/or ILP-3 protein present in the sample, and then detecting or quantitating such complexes. In particular forms, these assays may be performed with the ILP-2 and/or ILP-3 specific binding agent immobilized on a support surface, such as in the wells of a microtiter plate or on a column. The biological sample is then introduced onto the support surface and allowed to interact with the specific binding agent so as to form complexes. Excess biological sample is then removed by washing, and the complexes are detected with a reagent, such as a second anti-ILP-2 and/or ILP-3 protein antibody that is conjugated with a detectable marker.

In an alternative assay, the cellular proteins are isolated and subjected to SDS-PAGE followed by Western blotting, for example as described in EXAMPLE 4. After resolving the proteins, the proteins are transferred to a membrane, which is probed with specific binding agents that recognize ILP-2 and or ILP-3. The proteins are detected, for example with HRP-conjugated secondary antibodies, and quantitated.

In yet another assay, the level of ILP-2 and/or ILP-3 protein in cells is analyzed using microscopy. Using specific binding agents which recognize ILP-2 and/or ILP-3, samples can be analyzed for the presence of ILP-2 and/or ILP-3 proteins. For example, frozen biopsied tissue sections are thawed at room temperature and fixed with acetone at -200°C for five minutes. Slides are washed twice in cold PBS for five minutes each, then air-dried. Sections are covered with 20-30 μl of antibody solution (15-45 μg/ml) (diluted in PBS, 2% BSA at 15-50 μg/ml) and incubated at RT in a humidified chamber for 30 minutes. Slides are washed three times with cold PBS five minutes each, allowed to air-dry briefly (5 minutes) before applying 20-30 μl of the second antibody solution (diluted in PBS, 2% BSA at 15-50 μg/ml) and incubated at RT in humidified chamber for 30 minutes. The label on the second antibody may contain a fluorescent probe, enzyme, radiolabel, biotin, or other detectable marker. The slides are washed three times with cold PBS five minutes each then quickly dipped in distilled water, air-dried, and mounted with PBS containing 30% glycerol. Slides can be stored at 4°C prior to viewing.

For samples prepared for electron microscopy (versus light microscopy), the second antibody is conjugated to gold particles. Tissue is fixed and embedded with epoxy plastics, then cut into very thin sections (-1-2 μm). The specimen is then applied to a metal grid, which is then incubated in the primary anti-ILP-2 and or ILP-3 antibody, washed in a buffer containing BSA, then incubated in a secondary antibody conjugated to gold particles (usually 5-20 nm). These gold particles are visualized using electron microscopy methods.

For the purposes of quantitating ILP-2 and ILP-3 proteins, a biological sample of the subject, which sample includes cellular proteins, is required. Such a biological sample may be obtained from body cells, such as those present in which expression of the protein has been detected. As shown in FIGS. 6 and 8, for example, ILP-2 could be analyzed in cells isolated from the testis, and ILP-3 could be analyzed in cells isolated from the colon, lung or bone marrow. However, if ILP- 2 and ILP-3 is expressed in peripheral blood leukocytes at detectable levels, leukocytes are clearly the most accessible and convenient source from which specimens can be obtained. Specimens can be obtained from peripheral blood, urine, saliva, tissue biopsy, amniocentesis samples, surgical specimens, fine needle aspirates, and autopsy material, particularly cancer cells. Quantitation of ILP- 2 and/or ILP-3 proteins would be made by immunoassay and compared to levels of the protein found in non-ILP-2 and/or ILP-3 expressing cells (such as the placenta or heart, respectively) or to the level of ILP-2 and/or ILP-3 in healthy, normal cells (for example, cells of the same origin that are not neoplastic or are free of the disease of interest). A significant (for example 50% or greater) reduction in the amount of ILP-2 and/or ILP-3 protein in the cells of a subject compared to the amount of ILP-2 and/or ILP-3 protein found in non-ILP-2 and/or ILP-3 expressing cells or that found in normal cells, would be taken as an indication that the subject may have deletions or mutations in the ILP-2 and or ILP-3 gene locus.

EXAMPLE 19 Gene Therapy A new gene therapy approach for patients suffering from ILP-2 and/or ILP-3 gene deletions or mutations is now made possible by the present disclosure. Essentially, cells may be removed from a subject having deletions or mutations of the ILP-2 and/or ILP-3 gene, and then transfected with an expression vector containing the ILP-2 and/or ILP-3 cDNA. These transfected cells will thereby produce functional ILP-2 and/or ILP-3 protein and can be reintroduced into the subject.

The scientific and medical procedures required for human cell transfection are now routine procedures. The provision herein of ILP-2 and ILP-3 cDNAs now allows the development of human and non-human gene therapy based upon these procedures. Immunotherapy of melanoma patients using genetically engineered tumor-infiltrating lymphocytes (TILs) has been reported by Rosenberg et al. (N. Engl J. Med. 323:570-8, 1990). In that study, a retrovirus vector was used to introduce a gene for neomycin resistance into TILs. A similar approach may be used to introduce the ILP-2 and/or ILP-3 cDNA into patients affected by ILP-2 and/or ILP-3 deletions or mutations. In some embodiments, a method of treating tumors which underexpress ILP-2 and/or ILP-3, or in which greater ILP-2 and/or ILP-3 expression is desired, is disclosed. These methods can be accomplished by introducing a gene coding for ILP-2 and/or ILP-3 into the subject. A general strategy for transferring genes into donor cells is disclosed in U.S. Patent No. 5,529,774, incoφorated by reference. Generally, a gene encoding a protein having therapeutically desired effects is cloned into a viral expression vector, and that vector is then introduced into the target organism. The virus infects the cells, and produces the protein sequence in vivo, where it has its desired therapeutic effect. See, for example, Zabner et al. (Cell 75:207-16, 1993).

In some of the foregoing examples, it may only be necessary to introduce the genetic or protein elements into certain cells or tissues. For example, in the case of benign nevi and psoriasis, introducing them into only the skin may be sufficient. However, in some instances (i.e. tumors and diabetes), it may be more therapeutically effective and simple to treat all of the patients cells, or more broadly disseminate the vector, for example by intravascular administration.

The nucleic acid sequence encoding at least one therapeutic agent is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, the gene's native promoter, retroviral LTR promoter, or adenoviral promoters, such as the adenoviral major late promoter; the CMV promoter; the Rous Sarcoma Virus (RSV) promoter; inducible promoters, such as the MMTV promoter; the metallothionein promoter; heat shock promoters; the albumin promoter; the histone promoter; the α-actin promoter; TK promoters; B19 parvovirus promoters, and the ApoAI promoter However the scope of the present disclosure is not limited to specific foreign genes or promoters

The recombinant nucleic acid can be administered to the subject by any method which allows the recombinant nucleic acid to reach the appropriate cells These methods include injection, infusion, deposition, implantation, or topical administration Injections can be intradermal or subcutaneous The recombinant nucleic acid can be delivered as part of a viral vector, such as avipox viruses, recombinant vaccinia virus, replication-deficient adenovirus strains or pohovirus, or as a non-infectious form such as naked DNA or liposome encapsulated DNA

EXAMPLE 20

Viral Vectors for Gene Therapy

Adenoviral vectors may mclude essentially the complete adenoviral genome (Shenk et al , Curr Top Microbiol Immunol 111 1-39, 1984) Alternatively, the adenoviral vector may be a modified adenoviral vector in which at least a portion of the adenoviral genome has been deleted In one embodiment, the vector includes an adenoviral 5' ITR, an adenoviral 3' ITR, an adenoviral encapsidation signal, a DNA sequence encoding a therapeutic agent, and a promoter for expressing the DNA sequence encoding a therapeutic agent The vector is free of at least the majority of adenoviral El and E3 DNA sequences, but is not necessarily free of all of the E2 and E4 DNA sequences, and DNA sequences encoding adenoviral proteins transcribed by the adenoviral major late promoter In another embodiment, the vector may be an adeno-associated virus (AAV) such as described in U S Patent No 4,797,368 (Carter et al ) and in McLaughlin et al (J Virol 62 1963-73, 1988) and AAV type 4 (Chioπni et al J Virol 71 6823-33. 1997) and AAV type 5 (Chiormi et al J Virol 73 1309-19, 1999)

Such a vector may be constructed according to standard techniques, using a shuttle plasmid which contains, beginning at the 5' end, an adenoviral 5' ITR, an adenoviral encapsidation signal, and an El a enhancer sequence, a promoter (which may be an adenoviral promoter or a foreign promoter), a tripartite leader sequence, a multiple cloning site (which may be as herein described), a poly A signal, and a DNA segment which corresponds to a segment of the adenoviral genome The DNA segment serves as a substrate for homologous recombination with a modified or mutated adenovirus, and may encompass, for example, a segment of the adenovirus 5' genome no longer than from base 3329 to base 6246 The plasmid may also include a selectable marker and an origin of replication The origin of replication may be a bacterial origin of replication A desired DNA sequence encoding a therapeutic agent may be inserted into the multiple cloning site of the plasmid

The plasmid may be used to produce an adenoviral vector by homologous recombmation with a modified or mutated adenovirus in which at least the majority of the El and E3 adenoviral DNA sequences have been deleted Homologous recombination may be effected through co- transfection of the plasmid vector and the modified adenovirus into a helper cell line, such as 293 cells, by CaP0₄ precipitation The homologous recombmation produces a recombinant adenoviral vector which includes DNA sequences derived from the shuttle plasmid between the Not I site and the homologous recombination fragment, and DNA derived from the El and E3 deleted adenovirus between the homologous recombination fragment and the 3' ITR.

In one embodiment, the adenovirus may be constructed by using a yeast artificial chromosome (or YAC) containing an adenoviral genome according to the method described in Ketner et al. (Proc. Natl. Acad. Sci. USA, 91 :6186-90, 1994), in conjunction with the teachings contained herein. In this embodiment, the adenovirus yeast artificial chromosome is produced by homologous recombination in vivo between adenoviral DNA and yeast artificial chromosome plasmid vectors carrying segments of the adenoviral left and right genomic termini. A DNA sequence encoding a therapeutic agent then may be cloned into the adenoviral DNA. The modified adenoviral genome then is excised from the adenovirus yeast artificial chromosome in order to be used to generate adenoviral vector particles as hereinabove described.

The adenoviral particles are administered in an amount effective to produce a therapeutic effect in a subject. The exact dosage of adenoviral particles to be administered is dependent upon a variety of factors, including the age, weight, and sex of the subject to be treated, and the nature and extent of the disease or disorder to be treated. The adenoviral particles may be administered as part of a preparation having a titer of adenoviral particles of at least 1 x 10¹⁰pfu/ml, and in general not exceeding 2 x 10¹¹ pfu/ml. The adenoviral particles may be administered in combination with a pharmaceutically acceptable carrier in a volume up to 10 ml. The pharmaceutically acceptable carrier may be, for example, a liquid carrier such as a saline solution, protamine sulfate (Elkins-Sinn, Inc., Cherry Hill, NJ), or Polybrene (Sigma Chemical) as well as those described in EXAMPLE 24. In another embodiment, the viral vector is a retroviral vector. Retroviruses have been considered for experiments in gene therapy because they have a high efficiency of infection and stable integration and expression (Orkin et al, 1988, Prog. Med. Ge«e_.7: 130-42). Partial or full length ILP-2 and/or ILP-3 genes can be cloned into a retroviral vector and driven from either its endogenous promoter or from the retroviral LTR (long terminal repeat). Examples of retroviral vectors which may be employed include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus. The vector is generally a replication defective retrovirus particle. Retroviral vectors are useful as agents to effect retroviral-mediated gene transfer into eukaryotic cells. Retroviral vectors are generally constructed such that the majority of sequences coding for the structural genes of the virus are deleted and replaced by the gene(s) of interest. Most often, the structural genes (i.e., gag, pol, and env) are removed from the retroviral backbone using genetic engineering techniques known in the art. This may include digestion with the appropriate restriction endonuclease or, in some instances, with Bal 31 exonuclease to generate fragments containing appropriate portions of the packaging signal.

Other viral transfection systems may also be utilized for this type of approach, including Vaccinia virus (Moss et al, 1987, Annu. Rev. Immunol 5:305-24), Bovine Papilloma virus (Rasmussen et al, 1987, Methods Enzγmol. 139:642-54) or members of the heφes virus group such as Epstein-Barr virus (Margolskee et al, 1988. Mol. Cell. Biol 8:2837-47). Recent developments in gene therapy techniques include the use of RNA-DNA hybrid oligonucleotides, as described by Cole- Strauss et al. (Science 273: 1386-9, 1996). This technique can allow for site-specific integration of cloned sequences, permitting accurately targeted gene replacement. New genes may be incoφorated into proviral backbones in several general ways. In the most straightforward constructions, the structural genes of the retrovirus are replaced by a single gene which then is transcribed under the control of the viral regulatory sequences within the long terminal repeat (LTR). Retroviral vectors have also been constructed which can introduce more than one gene into target cells. Usually, in such vectors one gene is under the regulatory control of the viral LTR, while the second gene is expressed either off a spliced message or is under the regulation of its own, internal promoter. Alternatively, two genes may be expressed from a single promoter by the use of an Internal Ribosome Entry Site.

EXAMPLE 21 Peptide Modifications

The present disclosure includes biologically active molecules that mimic the action (mimetics) of the ILP-2 and ILP-3 proteins disclosed herein. The disclosure therefore includes synthetic embodiments of naturally-occurring peptides, as well as analogues (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained starting with the disclosed peptide sequences) and variants (homologs) of these peptides that specifically decrease BAX-induced apoptosis (ILP-2 mimetics) or moderately inhibit hILP-1 -mediated JNK activation when co-transfected with hILP-1 (ILP-3 mimetics). Each peptide ligand disclosed is comprised of a sequence of amino acids, which may be either L- and/or D- amino acids, naturally occurring and otherwise. Peptides may be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties. For example, carboxylic acid groups of the peptide, whether carboxyl-terminal or side chain, may be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a C1-C16 ester, or converted to an amide of formula NR1R2 wherein Rl and R2 are each independently H or C1-C16 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6- membered ring. Amino groups of the peptide, whether amino-terminal or side chain, may be in the form of a pharmaceutically-acceptable acid addition salt, such as the HC1, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or may be modified to C1-C16 alkyl or dialkyl amino or further converted to an amide. Hydroxyl groups of the peptide side chain may be converted to C1-C16 alkoxy or to a Cl-

C16 ester using well-recognized techniques. Phenyl and phenolic rings of the peptide side chain may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with C1-C16 alkyl, C1-C16 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids. Methylene groups of the peptide sidechains can be extended to homologous C2-C4 alkylenes. Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups. Those skilled in the art will also recognize methods for introducing cyclic structures into the peptides disclosed herein to select and provide conformational constraints to the structure that result in enhanced stability. For example, a carboxyl-terminal or amino-terminal cysteine residue can be added to the peptide, so that when oxidized the peptide will contain a disulfide bond, thereby generating a cyclic peptide. Other peptide cyclizing methods include the formation of thioethers and carboxyl- and amino-terminal amides and esters.

To maintain an optimally functional peptide, particular peptide variants will differ by only a small number of amino acids from the peptides disclosed herein. Such variants may have deletions (for example of 1-3 or more amino acid residues), insertions (for example of 1-3 or more residues), or substitutions that do not interfere with the desired activity of the peptides. Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. In particular embodiments, such variants will have amino acid substitutions of single residues, for example 1, 3, 5 or even 10 substitutions in the full-length ILP-2 (SEQ ID NOS 14, 16, and 18) and or ILP-3 (SEQ ID NOS 2, 4, 6, 8, 10, and 12) protein.

Peptidomimetic and organomimetic embodiments are also disclosed, whereby the three- dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid side chains in the peptide, resulting in such peptido- and organomimetics of the peptides having the ability to decrease Bax-induced apoptosis (ILP-2 mimetics) or to moderately inhibit hILP-1 -mediated JNK activation when co-transfected with hILP-1 (ILP-3 mimetics). For computer modeling applications, a pharmacophore is an idealized, three-dimensional definition of the structural requirements for biological activity. Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD). See Walters, "Computer-Assisted Modeling of Drugs", in Klegerman & Groves, eds., 1993, Pharmaceutical

Biotechnology, Inteφharm Press: Buffalo Grove, IL, pp. 165-174 and Principles of Pharmacology (ed. Munson, 1995), chapter 102 for a description of techniques used in CADD. Also disclosed are mimetics prepared using such techniques that produce either peptides or conventional organic pharmaceuticals that retain the biological activity of ILP-2 and/or ILP-3. The above described mimetics are examined for their ability to decrease Bax-induced apoptosis (ILP-2 mimetics) or moderately inhibit hILP-1 -mediated JNK activation when cotransfected with hILP-1 (ILP-3 mimetics). Such activities can be readily determined using the assays disclosed herein, for example using the methods described in EXAMPLES 5-9. Suitable mimetics would demonstrate ILP-2 and/or ILP-3 biological activity as defined above.

EXAMPLE 22 Methods for Generating Mimetics

Compounds or other molecules which mimic normal ILP-2 or ILP-3 function, such as compounds which decrease Bax-induced apoptosis (ILP-2 mimetics) or moderately inhibit hlLP- mediated JNK activation when co-transfected with hILP-1 (ILP-3 mimetics) can be identified and/or designed. These compounds or molecules are known as mimetics, because they mimic the biological activity of the normal protein.

Crystallography

To identify the amino acids that interact between ILP-2 or ILP-3 and TGFβR, ILP-2 or ILP- 3 is co-crystallized in the presence of TGFβR. One method that can be used is the hanging drop method. In this method, a concentrated salt, the ILP protein and TGFβR protein solution is applied to the underside of a lid of a multiwell dish. A range of concentrations may need to be tested. The lid is placed onto the dish, such that the droplet "hangs" from the lid. As the solvent evaporates, a protein crystal is formed, which can be visualized with a microscope. This crystallized structure is then subjected to X-ray diffraction or NMR analysis which allows for the identification of the amino acid residues that are in contact with one another. The amino acids that contact the transcription factors establish a pharmacophore that can then be used to identify drugs that interact at that same site.

Identification of drugs

Once these amino acids have been identified, one can screen synthetic drug databases (which can be licensed from several different drug companies), to identify drugs that interact with the same amino acids of the ILP protein that TGFβR interacts with. Moreover, structure activity relationships and computer assisted drug design can be performed as described in Remington, The Science and Practice of Pharmacy, Chapter 28.

Designing synthetic peptides

In addition, synthetic peptides can be designed from the sequence of TGFβR that interacts with ILP-2 and/or ILP-3. Several different peptides could be generated from this region(s). This could be done with or without the crystallography data. However, once crystallography data is available, peptides can also be designed that bind better than ILP-2 and ILP-3.

The chimeric peptides may be expressed recombinantly, for example in E. coli. One advantage of the synthetic peptides over the monoclonal antibodies is that they are smaller, and therefore diffuse easier, and are not as likely to be immunogenic. Standard mutagenesis of such peptides can also be performed to identify variant peptides having even greater ILP-2 and/or ILP-3 biological activity as defined herein.

After synthetic drugs or peptides that bind to ILP-2 and/or ILP-3 have been identified, their ability to modulate (and especially decrease) Bax-induced apoptosis and moderately inhibit ILP-1- mediated JNK activation when co-transfected with ILP-1, respectively, can be tested as described in EXAMPLES 5-9. Those that are positive would be good candidates for therapies, such as treatment of diseases wherein modulation of apoptosis is desired. EXAMPLE 23 Peptide Synthesis and Purification

The disclosed peptides (and variants and fragments thereof) can be chemically synthesized by any of a number of manual or automated methods of synthesis known in the art. For example, solid phase peptide synthesis (SPPS) is carried out on a 0.25 millimole (mmole) scale using an Applied Biosystems Model 431 A Peptide Synthesizer and using 9-fluorenylmethyloxycarbonyl (Fmoc) amino-terminus protection, coupling with dicyclohexylcarbodiimide/ hydroxybenzotriazole or 2-(lH-benzo-triazol-l-yl)-l,l,3,3-tetramethyluronium hexafluorophosphate/ hydroxybenzotriazole (HBTU/HOBT), and using p-hydroxymethylphenoxymethylpolystyrene (HMP) or Sasrin resin for carboxyl-terminus acids or Rink amide resin for carboxyl-terminus amides.

Fmoc-derivatized amino acids are prepared from the appropriate precursor amino acids by tritylation and triphenylmethanol in trifluoroacetic acid, followed by Fmoc derivitization as described by Atherton et al. (Solid Phase Peptide Synthesis, IRL Press: Oxford, 1989).

Sasrin resin-bound peptides are cleaved using a solution of 1% TFA in dichloromethane to yield the protected peptide. Where appropriate, protected peptide precursors are cyclized between the amino- and carboxyl-termini by reaction of the amino-terminal free amine and carboxyl-terminal free acid using diphenylphosphorylazide in nascent peptides wherein the amino acid sidechains are protected.

HMP or Rink amide resin-bound products are routinely cleaved and protected sidechain- containing cyclized peptides deprotected using a solution comprised of trifluoroacetic acid (TFA), optionally also comprising water, thioanisole, and ethanedithiol, in ratios of 100 : 5 : 5 : 2.5, for 0.5 - 3 hours at RT.

Crude peptides are purified by preparative high pressure liquid chromatography (HPLC), for example using a Waters Delta-Pak C18 column and gradient elution with 0.1 % TFA in water modified with acetonitrile. After column elution, acetonitrile is evaporated from the eluted fractions, which are then lyophilized. The identity of each product so produced and purified may be confirmed by fast atom bombardment mass spectroscopy (FABMS) or electrospray mass spectroscopy (ESMS).

EXAMPLE 24 Pharmaceutical Compositions and Modes of Administration

Various delivery systems for administering the combined therapy disclosed herein are known, and include e.g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis (see Wu and Wu, J. Biol. Chem. 1987, 262:4429- 32), and construction of a therapeutic nucleic acid as part of a retroviral or other vector. Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and oral routes. The compounds may be administered by any convenient route, for example by infusion or bolus injection, by absoφtion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, the pharmaceutical compositions may be introduced into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. In one embodiment, it may be desirable to administer the pharmaceutical compositions disclosed herein locally to the area in need of treatment, for example, by local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, through a catheter, by a suppository or an implant, such as a porous, non-porous, or gelatinous material, including membranes, such as silastic membranes, or fibers. In one embodiment, administration can be by direct injection at the site (or former site) of a malignant tumor or neoplastic or pre-neoplastic tissue.

The use of liposomes as a delivery vehicle is one delivery method of interest. The liposomes fuse with the target site and deliver the contents of the lumen intracellularly. The liposomes are maintained in contact with the target cells for a sufficient time for fusion to occur, using various means to maintain contact, such as isolation and binding agents. Liposomes may be prepared with purified proteins or peptides that mediate fusion of membranes, such as Sendai virus or influenza virus. The Iipids may be any useful combination of known liposome forming Iipids, including cationic Iipids, such as phosphatidylcholine. Other potential Iipids include neutral Iipids, such as cholesterol, phosphatidyl serine, phosphatidyl glycerol, and the like. For preparing the liposomes, the procedure described by Kato et al. (J. Biol. Chem. 1991, 266:3361) may be used. The present disclosure also provides pharmaceutical compositions which include a therapeutically effective amount of the ILP-2 and or ILP-3 protein, RNA, DNA, antisense molecule or specific binding agent (for example, antibodies), alone or with a pharmaceutically acceptable carrier. In one example, homogeneous compositions of the ILP-2 and/or ILP-3 therapeutic molecules includes compositions that are comprised of at least 90% of the peptide, variant, analog, derivative or mimetic in the composition.

Delivery systems

Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The carrier and composition can be sterile, and the formulation suits the mode of administration. The composition can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, and magnesium carbonate.

The amount of the inducing agent and disrupting agent that will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

The disclosure also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. Instructions for use of the composition can also be included.

The pharmaceutical compositions or methods of treatment may be administered in combination with other therapeutic treatments, such as other antineoplastic or antitumorigenic therapies.

Administration of Nucleic Acid Molecules

In an embodiment in which an ILP-2 and/or ILP-3 nucleic acid is employed for gene therapy, the analog is delivered intracellularly (e.g., by expression from a nucleic acid vector or by receptor-mediated mechanisms). In an embodiment where the therapeutic molecule is a nucleic acid or antisense molecule, administration may be achieved by an appropriate nucleic acid expression vector which is administered so that it becomes intracellular, e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with Iipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci. USA 1991, 88:1864-8). Alternatively, the nucleic acid can be introduced intracellularly and incoφorated within a cell's cellular DNA for expression, by homologous recombination.

The vector pcDNA, is an example of a method of introducing the foreign cDNA into a cell under the control of a strong viral promoter (CMV) to drive the expression. However, other vectors can be used (see EXAMPLES 14 and 20). Other retroviral vectors (such as pRETRO-ON, Clontech), also use this promoter but have the advantages of entering cells without any transfection aid, integrating into the genome of target cells only when the target cell is dividing (as cancer cells do, especially during first remissions after chemotherapy) and they are regulated. It is also possible to turn on the expression of the ILP-2 and or ILP-3 nucleic acid by administering tetracycline when these plasmids are used. Hence these plasmids can be allowed to transfect the cells, then administer a course of tetracycline with a course of chemotherapy to achieve better cytotoxicity.

Other plasmid vectors, such as pMAM-neo (Clontech) or pMSG (Amersham Pharmacia Biotech) use the MMTV-LTR promoter (which can be regulated with steroids) or the SV10 late promoter (pSVL, Amersham Pharmacia Biotech) or metallothionein - responsive promoter (pBPV, Amersham Pharmacia Biotech) and other viral vectors, including retroviruses. Examples of other viral vectors include adenovirus, AAV (adeno-associated virus), recombinant HSV, poxviruses (vaccinia) and recombinant lentivirus (such as HIV). These vectors achieve the basic goal of delivering into the target cell the cDNA sequence and control elements needed for transcription. The present disclosure includes all forms of nucleic acid delivery, including synthetic oligos, naked DNA, plasmid and viral, integrated into the genome or not.

Administration of Antibodies

In an embodiment where the therapeutic molecule is an antibody, specifically an antibody that recognizes ILP-2 and/or ILP-3 proteins, administration may be achieved by direct injection, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with Iipids or cell-surface receptors or transfecting agents. Similar methods can be used to administer ILP-2 and/or ILP-3 protein, of fragments thereof.

The present disclosure also provides pharmaceutical compositions which include a therapeutically effective amount of the antibody, and a pharmaceutically acceptable carrier or excipient.

EXAMPLE 25 Disruption of ILP-2 and/or ILP-3 Expression This example describes methods that can be used to disrupt ILP-2 and/or ILP-3 expression.

Such methods are useful when apoptosis is desired, for example in the pathogenesis of f proliferative disorders, for example neoplasms, such as cancer. One approach to disrupting ILP-2 and/or ILP-3 function or expression is to use antisense oligonucleotides.

To design an antisense oligonucleotide, the mRNA sequence from the desired molecule, such as human ILP-2 or ILP-3, is examined. Regions of the sequence containing multiple repeats, such as TTTTTTTT, are not as desirable because they will lack specificity. Several different regions can be chosen. Of those, oligos are selected by the following characteristics: ones having the best conformation in solution; ones optimized for hybridization characteristics; and one having less potential to form secondary structures. Antisense molecules having a propensity to generate secondary structures are less desirable.

Plasmids containing ILP-2 and/or ILP-3 antisense sequences can also be genereated. For example, cDNA fragments coding for human ILP-2 and or ILP-3 are PCR amplified. The nucleotides are then amplified using Pfu DNA polymerase (Stratagene) and cloned in antisense orientation a vector, such as pcDNA vectors (InVitrogen). The nucleotide sequence and orientation of the insert can be confirmed by dideoxy sequencing using a Sequenase kit (Amersham Pharmacia Biotech).

Generally, the term "antisense" refers to a nucleic acid capable of hybridizing to a portion of a ILP-2 and/or ILP-3 RNA (such as mRNA) by virtue of some sequence complementarity. The antisense nucleic acids disclosed herein can be oligonucleotides that are double-stranded or single- stranded, RNA or DNA or a modification or derivative thereof, which can be directly administered to a cell, or which can be produced intracellularly by transcription of exogenous, introduced sequences.

The ILP-2 and ILP-3 antisense nucleic acids are polynucleotides, and may be oligonucleotides (ranging from 6 to about 100 oligonucleotides). In specific aspects, the oligonucleotide is at least 10, 15, 20, 62, 65, or 100 nucleotides, or a polynucleotide of at least 200 nucleotides. The antisense nucleic acids may be much longer constructs. The nucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The nucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, and may include other appending groups such as peptides, or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., Proc. Natl. Acad. Sci. USA 1989, 86:6553-6;

Lemaitre et al., Proc. Natl. Acad. Sci. USA 1987, 84:648-52; PCT Publication No. WO 88/09810) or blood-brain barrier (see, e.g., PCT Publication No. WO 89/10134), hybridization triggered cleavage agents (see, e.g., Krol et al., BioTechniques 1988, 6:958-76) or intercalating agents (see, e.g., Zon, Pharm. Res. 1988, 5:539-49). In one embodiment disclosed herein, an ILP-2 and/or ILP-3 antisense polynucleotide

(including oligonucleotides) is provided, for example of single-stranded DNA. The ILP-2 and/or ILP-3 antisense polynucleotide may recognize any species of ILP-2 and/or ILP-3. The antisense polynucleotide may be modified at any position on its structure with substituents generally known in the art. For example, a modified base moiety may be 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta- D-galactosylqueosine, inosine, N~6-sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2- dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6- adenine, 7-methylguanine, 5-methylaminomethyluracil, methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2- thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-S- oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, and 2,6- diaminopurine. In another embodiment, the polynucleotide includes at least one modified sugar moiety such as arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, or a formacetal or analog thereof. In yet another embodiment, the polynucleotide is an α-anomeric oligonucleotide. An α- anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, the strands run parallel to each other (Gautier et al, Nucl. Acids Res. 1987, 15:6625-41). The oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent. Oligonucleotides may include a targeting moiety that enhances uptake of the molecule by tumor cells. The targeting moiety can be a specific binding molecule, such as an antibody or fragment thereof that recognizes a molecule present on the surface of a diseased cell, such as a tumor cell.

As an alternative to antisense inhibitors, catalytic nucleic acid compounds, such as ribozymes or anti-sense conjugates, can be used to inhibit gene expression. Ribozymes may be synthesized and administered to the subject, or may be encoded on an expression vector, from which the ribozyme is synthesized in the targeted cell (as in PCT publication WO 9523225, and Beigelman et al. Nucl. Acids Res. 1995, 23:4434-42). Examples of oligonucleotides with catalytic activity are described in WO 9506764. Conjugates of antisense with a metal complex, e.g. teφyridylCu (II), capable of mediating mRNA hydrolysis, are described in Bashkin et al, 1995, Appl. Biochem Biotechnol 54:43-56.

Polynucleotides disclosed herein can be synthesized by standard methods known in the art, for example by use of an automated DNA synthesizer (Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligos may be synthesized by the method of Stein et al. (Nucl Acids Res. 1998, 16:3209), methylphosphonate oligos can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. USA 85:7448-51). In a specific embodiment, the ILP-2 and ILP-3 antisense oligonucleotides comprise catalytic RNA, or a ribozyme (see PCT International Publication WO 90/11364, Sarver et al., Science 1990, 247: 1222-5). In another embodiment, the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., Nucl. Acids Res. 1987, 15:6131-48), or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett. 1987, 215:327-330).

The antisense polynucleic acids disclosed herein comprise a sequence complementary to at least a portion of an RNA transcript of an ILP-2 and/or ILP-3 gene, such as a human ILP-2 and or ILP-3 gene. However, absolute complementarity, although advantageous, is not required. A sequence can be complementary to at least a portion of an RNA, meaning a sequence having sufficient complementarily to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded ILP-2 and/or ILP-3 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with a ILP-2 and or ILP-3 RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. The relative ability of polynucleotides (such as oligonucleotides) to bind to complementary strands is compared by determining the melting temperature of a hybridization complex of the poly/ oligonucleotide and its complementary strand. Base stacking, which occurs during hybridization, is accompanied by a reduction in UV absoφtion (hypochromicity). A reduction in UV absoφtion indicates a higher T_ro. The higher the T_m the greater the strength of the binding of the hybridized strands. As close to optimal fidelity of base pairing as possible achieves optimal hybridization of a poly/oligonucleotide to its target RNA.

The amount of ILP-2 and/or ILP-3 antisense nucleic acid which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In one embodiment, pharmaceutical compositions comprising ILP-2 and/or ILP-3 antisense nucleic acids are administered via liposomes, microparticles, or microcapsules. In other embodiments, it may be useful to use such compositions to achieve sustained release of the ILP-2 and/or ILP-3 antisense nucleic acids. In yet other embodiments, it may be desirable to utilize liposomes targeted via antibodies to specific identifiable tumor antigens (Leonetti et al. Proc. Natl. Acad. Sci. USA 1990, 87 :2448-51 ; Renneisen et al J. Biol. Chem. 1990, 265: 16337-42).

EXAMPLE 26 Methods of Treatment using Antisense Molecules When ILP-2 and/or ILP-3 levels are prematurely downregulated by various antisense strategies, the cells maybe induced into entering an apoptotic pathway. ILP-2 and ILP-3 antisense oligonucleotides (EXAMPLE 25) can be used to disrupt cellular expression of ILP-2 and ILP-3 proteins, respectively.

The subject suffering from a disease in which apoptosis is desired can be treated with a therapeutically effective amount of ILP-2 and/or ILP-3 antisense oligonucleotides. After the ILP-2 and or ILP-3 antisense has taken affect (ILP-2 and or ILP-3 levels are downregulated), after 24-48 hours, the subject can be monitored for decreased apoptosis.

Prophylactic Treatments The treatments disclosed herein can also be used prophylactially, for example to inhibit or prevent progression to of a disease in which apoptosis is not desired. Such administration is indicated where the treatment is shown to have utility for treatment or prevention of the disorder. The prophylactic use is indicated in conditions known or suspected of preceding progression to diseases associated with an undesired amount of apoptosis, for example in diseases associated with ILP-2 and or ILP-3 expression. Such diseases may include cone-rod retinal dystrophy-2; leber congenitalamaurosis due to defect in CRX; retinitis pigmentosa (late-onset dominant); glutaricaciduria, type IIB; diabetes mellitus, noninsulin-dependent diabetes; colorectal cancer, T-cell acute lymphoblastic leukemia; hyperferritinemia-cataract syndrome; hydatidiform moles, selective T- cell defect; osteoarthritis of distal inteφhalangeal joints; colorectal cancer with chromosomal instability; hypothyroidism, congentical due to thyroid dysgenesis or hypoplasia; juvenile nephronophthisis; thrombophilia due to protein C deficiency; and puφura fulminans, neonatal. EXAMPLE 27 Cloning of ILP-2 and ILP-3 Genomic DNA

Methods for cloning ILP-2 and ILP-3 genomic DNA from any species are known to those skilled in the art, and are described in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York. 1989. Herein incoφorated by reference). Briefly, ILP-2 or ILP-3 cDNA (full length or fragments thereof, for example SEQ ID NOs 1, 3, 5, 7, 9, 11, 13, 15, and 17) is radiolabeled with Rediprime II (Amersham Pharmacia Biotech) as instructed by the manufacturer. The radiolabeled cDNA is used to screen a bacteriophage lamda gtl 1 genomic library. Genomic DNA of the resulting positive clones is isolated, purified and digested with appropriate restriction enzymes. Digested DNA is separated by agarose gel electrophoresis and blotted onto a nylon membrane. A Southern-Blot is performed using radioactive cDNA of ILP-2 and ILP-3 to identify the exons. Bands that hybridized with the cDNA are isolated from the gel and sequenced. The resulting DNA sequence is analyzed by specific computer programs to identify the promoter region and exon/intron donor/acceptor sites.

EXAMPLE 28 Transgenic Plants and Animals

The creation of transgenic plants and animals which express ILP-2 and/or ILP-3 can be made by techniques known in the art, for example those disclosed in U.S. Patent Nos. 5,574,206; 5,723,719; 5,175,383; 5,824,838; 5,811,633; 5,620,881; and 5,767,337, which are incoφorated by reference.

Methods for generating transgenic mice are described in Gene Targeting, A.L. Joyuner ed., Oxford University Press, 1995 and Watson, J. D. et al., Recombinant DNA 2nd Ed., W.H. Freeman and Co., New York, 1992, Chapter 14.

EXAMPLE 29 Generation and Expression of ILP-2 and ILP-3 Fusion Proteins

Methods for making fusion proteins are well known to those skilled in the art. For example U.S. Patent No. 6,057,133 to Bauer et al. (herein incoφorated by reference) discloses methods for making fusion molecules composed of human interleukin-3 (hIL-3) variant or mutant proteins functionally joined to a second colony stimulating factor, cytokine, lymphokine, interleukin, hematopoietic growth factor or IL-3 variant. U.S. Patent No. 6,072,041 to Davis et al. (herein incoφorated by reference) discloses the generation of fusion proteins comprising a single chain Fv molecule directed against a transcytotic receptor covalently linked to a therapeutic protein.

Similar methods can be used to generate fusion proteins comprising ILP-2 and/or ILP-3 (or variants, mutants, polymoφhisms, or fragments thereof) linked to other amino acid sequences. Linker regions can be used to space the two portions of the protein from each other and to provide flexibility between them. The linker region is generally a polypeptide of between 1 and 500 amino acids in length, for example less than 30 amino acid in length. The linker joining the two molecules can be designed to (1) allow the two molecules to fold and act independently of each other, (2) not have a propensity for developing an ordered secondary structure which could interfere with the functional domains of the two proteins, (3) have minimal hydrophobic or charged characteristic which could interact with the functional protein domains and (4) provide steric separation of the two regions. Typically surface amino acids in flexible protein regions include Gly, Asn and Ser. Other neutral amino acids, such as Thr and Ala, can also be used in the linker sequence. Additional amino acids may also be included in the linker due to the addition of unique restriction sites in the linker sequence to facilitate construction of the fusions. Other moieties may also be included, as desired. These may include a binding region, such as avidin or an epitope, such as a polyhistadine tag, which may be useful for purification and processing of the fusion protein. In addition, detectable markers can be attached to the fusion protein, so that the traffic of the fusion protein through a body or cell may be monitored conveniently. Such markers may include radionuclides, enzymes, fluors, and the like. Fusing of the nucleic acid sequences of ILP-2 and/or ILP-3 (or variants, mutants, polymoφhisms, or fragment thereof), with the nucleic acid sequence of another protein (or variants, mutants, polymoφhisms, or fragment thereof), can be accomplished by the use of intermediate vectors. Alternatively, one gene can be cloned directly into a vector containing the other gene. Linkers and adapters can be used for joining the nucleic acid sequences, as well as replacing lost sequences, where a restriction site was internal to the region of interest. Genetic material (DNA) encoding one polypeptide, peptide linker, and the other polypeptide is inserted into a suitable expression vector which is used to transform prokaryotic or eukaryotic cells, for example bacteria, yeast, insect cells or mammalian cells (see EXAMPLE 14). The transformed organism is grown and the protein isolated by standard techniques, for example by using a detectable marker such as nickel- chelate affinity chromatography, if a polyhistadine tag is used. The resulting product is therefore a new protein, a fusion protein, which has ILP-2 and/or ILP-3 joined by a linker region to a second protein. To confirm that the fusion protein was expressed, the purified protein is subjected to electrophoresis in SDS-polyacrylamide gels, and transferred onto nitrocellulose membrane filters using established methods. The protein products can be identified by Western blot analysis using antibodies directed against the individual components, i.e., polyhistadine tag and ILP-2 and/or ILP-3 (see EXAMPLE 15).

Having illustrated and described the principles of isolating several species of ILP-2 and ILP- 3 DNAs, the proteins they encode, antibodies which recognize the proteins and modes of use of these biological molecules, it should be apparent to one skilled in the art that the disclosure can be modified in arrangement and detail without departing from such principles. In view of the many possible embodiments to which the principles of our disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the disclosure and should not be taken as a limitation on the scope of the disclosure. Rather, the scope of the disclosure is in accord with the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:

1. A purified protein with TGFβR modulating activity, and comprising an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 2, 4, 6, 8, 10, 12, 14, 16, or 18; (b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain TGFβR modulating activity;

(c) fragments of the amino acid sequence of (a) or (b) that retain TGFβR modulating activity; and

(d) amino acid sequences having at least 80% sequence identity to the sequences specified in (a), (b) and (c) that retain TGFβR modulating activity.

2. The protein of claim 1 , wherein the amino acid sequence comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 2;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3 biological activity;

(c) fragments of the amino acid sequence s of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

3. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 4;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3 biological activity; (c) fragments of the amino acid sequence of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

4. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 6;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3 biological activity;

(c) fragments of the amino acid sequence of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

5. The protein of claim 1, wherein the amino acid sequence comprises an amino acid sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 8;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3 biological activity;

(c) fragments of the amino acid sequence s of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

6. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 10;

(d) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3biological activity; (e) fragments of the amino acid sequence of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

7. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 12;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-3 biological activity;

(c) fragments of the amino acid sequence of (a) or (b) that retain ILP-3 biological activity; and

(d) amino acid sequences having at least 85% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-3 biological activity.

8. The protein of claim 1, wherein the amino acid sequence comprises an amino acid sequence selected from the group consisting of: (a) the amino acid sequence shown in SEQ ID NO 14;

(b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-2 biological activity;

(c) fragments of the amino acid sequence s of (a) or (b) that retain ILP-2 biological activity; and (d) amino acid sequences having at least 80% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-2biological activity.

9. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 16; (f) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-2 biological activity;

(g) fragments of the amino acid sequence of (a) or (b) that retain ILP-2 biological activity; and (d) amino acid sequences having at least 80% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-2 biological activity.

10. The protein of claim 1, wherein the amino acid sequence comprises a sequence selected from the group consisting of:

(a) the amino acid sequence shown in SEQ ID NO 18; (b) amino acid sequences that differ from those specified in (a) by one or more conservative amino acid substitutions that retain ILP-2biological activity;

(c) fragments of the amino acid sequence of (a) or (b) that retain ILP-2 biological activity; and

(d) amino acid sequences having at least 80% sequence identity to the sequences specified in (a), (b) and (c) that retain ILP-2 biological activity.

11. The protein of claim 1(d), wherein the amino acid sequences have at least 85% sequence identity to the sequence specified in 1(a).

12. The protein of claim 1(d), wherein the amino acid sequences have at least 90% sequence identity to the sequence specified in 1(a).

13. The protein of claim 1(d)), wherein the amino acid sequences have at least 95% sequence identity to the sequence specified in 1(a).

14. The protein of claim 1(d), wherein the amino acid sequences have at least 98% sequence identity to the sequence specified in 1(a).

15. A purified protein having ILP-2 or ILP-3 biological activity.

16. An isolated nucleic acid molecule encoding a protein according to any of claims 1-15.

17. The isolated nucleic acid of claim 16, further comprising a promoter sequence operably linked to the nucleic acid of claim 16.

18. The isolated nucleic acid of claim 16, wherein the nucleic acid molecule includes the sequence selected from the group consisting of: (a) SEQ ID NO 1 or its complementary strand;

(b) SEQ ID NO 3 or its complementary strand;

(c) SEQ ID NO 5 or its complementary strand;

(d) SEQ ID NO 7 or its complementary strand;

(e) SEQ ID NO 9 or its complementary strand; (f) SEQ ID NO 11 or its complementary strand;

(g) SEQ ID NO 13 or its complementary strand; (h) SEQ ID NO 15 or its complementary strand; (i) SEQ ID NO 17 or its complementary strand; and (j) Sequences which hybridize under conditions of at least 75% stringency to the sequences defined in (a), (b), (c), (d), (e), (f), (g), (h), or (i).

19. The isolated nucleic acid molecule of claim 18, wherein the nucleic acid includes a sequence selected from the group consisting of: (a) at least 50 contiguous nucleotides from nucleotides 1-580, 847-1197, or 846-

1200 of SEQ ID NO 1, or its complementary strand;

(b) at least 55 contiguous nucleotides from nucleotides 1-580, 847-1197, or 846- 1200 of SEQ ID NO 1, or its complementary strand

(c) at least 60 contiguous nucleotides from nucleotides 1-580, 847-1197, or 846- 1200 of SEQ ID NO 1 , or its complementary strand;

(d) at least 62 contiguous nucleotides of SEQ ID NO 1 or its complementary strand;

(e) at least 65 contiguous nucleotides of SEQ ID NO 1 or its complementary strand;

(f) at least 70 contiguous nucleotides of SEQ ID NO 1 or its complementary strand;

(g) at least 20contiguous nucleotides of SEQ ID NO 3 or its complementary strand; (h) at least 30 contiguous nucleotides of SEQ ID NO 3 or its complementary strand;

(i) at least 50 contiguous nucleotides of SEQ ID NO 3 or its complementary strand;

(j) at least 20 contiguous nucleotides of SEQ ID NO 5 or its complementary strand;

(k) at least 30 contiguous nucleotides of SEQ ID NO 5 or its complementary strand;

(1) at least 50 contiguous nucleotides of SEQ ID NO 5 or its complementary strand. (m) at least 20contiguous nucleotides of SEQ ID NO 7 or its complementary strand;

(n) at least 30 contiguous nucleotides of SEQ ID NO 7 or its complementary strand;

(o) at least 50 contiguous nucleotides of SEQ ID NO 7 or its complementary strand;

(p) at least 20contiguous nucleotides of SEQ ID NO 9 or its complementary strand; (q) at least 30 contiguous nucleotides of SEQ ID NO 9 or its complementary strand;

(r) at least 50 contiguous nucleotides of SEQ ID NO 9 or its complementary strand;

(s) at least 20contiguous nucleotides of SEQ ID NO 11 or its complementary strand;

(t) at least 30 contiguous nucleotides of SEQ ID NO 11 or its complementary strand; (u) at least 50 contiguous nucleotides of SEQ ID NO 1 1 or its complementary strand;

(v) at least 21 contiguous nucleotides from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13, or its complementary strand; (w) at least 25 contiguous nucleotides from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13, or its complementary strand

(x) at least 30 contiguous nucleotides from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13, or its complementary strand; (y) at least 50 contiguous nucleotides from nucleotides 2073-2800 or 2074-2784 of SEQ ID NO 13, or its complementary strand;

(z) at least 20 contiguous nucleotides of SEQ ID NO 15 or its complementary strand; (aa) at least 30 contiguous nucleotides of SEQ ID NO 15 or its complementary strand;

(bb) at least 50 contiguous nucleotides of SEQ ID NO 15 or its complementary strand;

(cc) at least 20contiguous nucleotides of SEQ ID NO 17 or its complementary strand;

(dd) at least 30 contiguous nucleotides of SEQ ID NO 17 or its complementary strand; and

(ee) at least 50 contiguous nucleotides of SEQ ID NO 17 or its complementary strand.

20. An isolated nucleic acid molecule that:

(a) is at least 80% homologous to SEQ ID NOS 13, 15, 17; and

(b) encodes a protein having ILP-2 biological activity.

21. A recombinant vector including a nucleic acid molecule according to any of claims 16- 20.

22. A transgenic cell produced by introducing into a cell a recombinant vector according to claim 21.

23. A purified protein encoded by the nucleic acid molecule according to any of claims 16- 20.

24. The protein of claim 23, wherein the protein has an amino acid sequence as shown in SEQ ID NO 2, 4, 6, 8, 10, 12, 14, 16, or 18.

25. The isolated nucleic acid molecule of any of claims 16-20 wherein the nucleic acid molecule encodes a peptide having ILP-2 or ILP-3 biological activity.

26. The isolated nucleic acid molecule according to claim 18(j) wherein the nucleic acid molecule hybridizes under conditions of at least 90% stringency to the sequences defined in claim 18 (a), claim 18 (b), claim 18(c), claim 18(d), claim 18(e), claim 18(f), claim 18(g), claim 18(h), or claim 18 (i).

27. An antisense oligonucleotide which: hybridizes to an RNA or a plus strand of a nucleic acid any of claims 16-20; and inhibits ILP-2 or ILP-3 biological activity.

28. A specific binding agent capable of specifically binding to an ILP-2 or ILP-3 protein, but not an ILP-1 protein.

29. The specific binding agent of claim 28 wherein the specific binding agent is selected from the group consisting of: polyclonal antibodies; monoclonal antibodies; and fragments of monoclonal antibodies.

30. A composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of the protein of any of claims 1-15 or 23-24.

31. The composition of claim 30, further comprising one or more other TGFβR modulating compounds.

32. A composition comprising a therapeutically effective amount of the specific binding agent of claim 28, and a pharmaceutically acceptable carrier.

33. The compositions of any of claims 30-32, for use in decreasing apoptosis.

34. The composition of claim 33, for use in a subject suffering from unwanted apoptosis, in an amount sufficient to inhibit Bax-induced apoptosis in the subject.

35. The composition of claim 30, wherein the subject has a cancer, an autoimmune disease, or a neurodegenerative disease characterized by unwanted apoptosis.

36. A composition comprising a therapeutically effective amount of the antisense oligonucleotide of claim 27, and a pharmaceutically acceptable carrier.

37. The composition of claim 36, for use in a subject with a disease, in whom apoptosis is desired.

38. A method for detecting an enhanced susceptibility of a subject to a disease of abnormal apoptosis, the method comprising detecting a deletion of or within an ILP-2 or ILP-3 gene in cells of the subject, or detecting a decrease or absence of ILP-2 or ILP-3 protein in cells of the subject.

39. The method of claim 38 wherein the disease is selected from the group consisting of: cancers, autoimmune diseases, and neurodegenerative diseases.

40. The method of claim 39, wherein the method comprises detecting a deletion of or within an ILP-2 or ILP-3 gene in a cell, the method comprising: incubating the nucleic acid of claim 18 with a nucleic acid of the cell under conditions such that the nucleic acid will specifically hybridize to the ILP-2 or ILP-3 gene present in the nucleic acid to form an nucleic acid: ILP-2 or ILP-3 gene complex; detecting an increase or decrease of the nucleic acid:ILP-2 or ILP-3 complexes, wherein an absence of the complexes indicates deletion of or within the ILP-2 or ILP-3 gene.

41. The method of claim 40, wherein the method comprises: incubating the specific binding agent of claim 28 with proteins of the cell under conditions such that the specific binding agent will specifically bind to a ILP-2 or ILP-3 protein present in the cell to form a specific binding agent:ILP-2 or ILP-3 protein complex; and detecting an increase or decrease of specific binding agent: ILP-2 or ILP-3 protein complexes.

42. A method of treating a disease of abnormal apoptosis by supplying ILP-2 biological activity to a cell which has lost the ILP-2 biological activity by a deletion of all or a portion of an

ILP-2 gene, comprising introducing the nucleic acid of claim 16 into the cell such that the nucleic acid of claim 18 is expressed in the cell.

43. A method of decreasing apoptosis in a cell comprising increasing the level of ILP-2 biological activity, which prevents the cell from undergoing apoptosis.

44. The method of claim 43, whereby decreasing apoptosis inhibits Bax-induced apoptosis.

45. The method of claim 44, wherein the cell is characterized by:

(a) decreased expression of an ILP-2 protein; or

(b) decreased ILP-2 biological activity or expression, relative to ILP-2 biological activity or expression in a same tissue type that is undergoing apoptosis.

46. The method of claim 45, wherein increasing the level of ILP-2 biological activity comprises exposing the cell to a therapeutically effective amount of the protein of claim 1.

47. The method of claim 46, wherein increasing the level of ILP-2 biological activity comprises administering a therapeutically effective amount of a nucleic acid which can express a protein having ILP-2 biological activity.

48. The method of claim 50, wherein the nucleic acid is the nucleic acid of claim 19.

49. The method of claim 43 or the composition of claim 33, wherein decreasing apoptosis treats a disease caused by defects in apoptosis.

50. The method of claim 49 or the composition of claim 34 wherein the disease is selected from the group consisting of autoimmune and neurodegenerative diseases

51. The method and composition of claim 50, wherein the disease is selected from the group consisting of: diabetes, multiple sclerosis and retinal degeneration.

52. A method for inducing apoptosis by adding a therapeutically effective amount of the antisense oligonucleotide of claim 27 sufficient to induce apoptosis in a subject.

53. The method of claim 52 and the composition of claim 36, wherein apoptosis is induced to treat a disease caused by defects in apoptosis.

54. The method and composition of claim 53, wherein the disease is a cancer.

55. A method of treating a disease caused by a mutation in the nucleic acid of claim 18 by supplying therapeutically effective amounts of a polypeptide product or the nucleic acid.

56. The protein of claim 1, for use in modulating apoptosis.

57. The nucleic acid of claim 18, for use in modulating apoptosis.

58. The protein of claim 1, for use in inhibiting apoptosis.

59. The antisense oligonucleotide of claim 27, for use in increasing apoptosis.