WO2001023419A2 - Differentially expressed genes - Google Patents

Abstract

The invention concerns a new secreted factor encoded by clone P00210 D09, and other mammalian homologues and variants of such factor, as well as polynucleotides encoding them. The invention further concerns methods and means for producing such factors and their use in the diagnosis and treatment of various cardiac, renal or inflammatory diseases.

Description

SECRETED FACTORS

FIELD OF THE INVENTION

The present invention concerns secreted factors encoded by genes differentially regulated in certain diseased tissues. More particularly, the invention concerns nucleic acid encoding novel secreted polypeptide factors, the encoded polypeptides, and compositions containing and methods and means for producing them. The invention further concerns methods based on the use of such nucleic acids and/or polypeptides in the diagnosis and treatment of various diseases, in particular cardiac, renal, or inflammatory diseases.

BACKGROUND OF THE INVENTION

Gene expression patterns, including changes in gene expression between normal and diseased tissues or tissues in various stages of disease progression provide valuable insight into the molecular determinants of normal and abnormal cellular physiology. Accordingly, genes that are differentially expressed in subjects suffering from a disease, such as cardiac, renal or inflammatory disease, relative to normal subjects, are useful targets for intervention to diagnose, prevent or treat such diseases.

Techniques have been developed to efficiently analyze the level of expression of specific genes in cells and tissues. Procedures that can be used to identify and clone differentially expressed genes include, for example, subtractive hybridization (Jiang and Fisher, Mol. Cell. Different. 1:285-299 [1993]; Jiang et al., Oncoqeπe 10, 1855- 1864 [1995]; Sagerstrom et al., Annu. Rev. Biochem. 66: 751 -783 [1997]); differential RNA display (DDRT-PCR) (Watson et al., Developmental Neuroscience 15:77-86 [1993]; Liang and Pardee, Science 257:967-971 [1992]); RNA fingerprinting by arbitrarily primed PCR (RAP-PCR) (Ralph et al., Proc. Natl. Acad. Sci. USA 90:10710-10714 [1993]; McClelland and Welsh, PCR Methods and Applications 4:S66-81 [1994]); representational difference analysis (RDA) (Hubank and Schatz, Nucl. Acids Res. 22:5640-5648 [1994]); serial analysis of gene expression (SAGE) (Velculescu et al.. Science 270:484-487 [1995]; Zhang et al.. Science 276:1268-1272 [1997]); electronic subtraction (Wan et al., Nature Biotechnoloqy14:1685-1691 [1996]); combinatorial gene matrix analyses (Schena et al.. Science 270:467-470

[1995]), and various modifications and improvements of these and similar techniques.

A particularly attractive method for assessing gene expression is the DNA microarray technique. In this method, nucleotide sequences of interest are plated, or arrayed, on a porous or non-porous substrate that can be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support. The arrayed sequences are then hybridized with specific DNA probes from cells or tissues of interest. Microarrays of biological materials have been described in a number of patents and patent applications, including, for example, U.S. Patent Nos. 5,744,305; 5,800, 992; 5,807,522; 5,716,785; and European Patent No. 0 373 203.

The DNA microarray technique can be used to monitor the expression level of large numbers of genes simultaneously (to produce a transcript image), and to identify genetic variants, mutations and polymorphisms. This information may be used to determine gene function, understanding the genetic basis of disease, diagnosing disease, and developing and monitoring the activities of therapeutic agents.

An important application of the microarray method allows for the assessment of differential gene expression in pairs of mRNA samples from two different tissues, or in the same tissue comparing normal versus disease states or time progression of the disease. Microarray analysis allows one to analyze the expression of known genes of interest, or to discover novel genes expressed differentially in tissues of interest. Thus, an attractive application of this technology is as a fundamental discovery tool to identify new genes, and their corresponding expression products, which contribute to the pathogenesis of disease and related conditions.

Microarray technology has been successfully applied to large scale analysis of human gene expression to identify cancer-specific genes and inflammatory-specific genes (DeRisi et al., Nat. Genet., 14(4):457 60 [1996]; Heller et al., Proc. Natl. Acad. Sci. USA, 94(6):2150-55 [1997]). DeRisi et al. examined a pre selected set of 870 different genes for their expression in a melanoma cell line and a non-tumoπgenic version of the same cell line. The microarray analysis revealed a decrease in expression for 15/870 (1.7%) and an increase in expression for 63/870 (7.3%) of the genes in non tumoπgenic relative to tumoπgeπic cells (differential expression values < 0.52 or > 2.4 were deemed significant). Heller et al. employed microarrays to evaluate the expression of 1000 genes in cells taken from normal and inflamed human tissues. The results indicated that altered expression was evident in genes encoding inflammatory mediators such as IL 3, and a tissue metalloprotease. These results illustrate the utility of applying microarray technology to complex human diseases.

It would be beneficial to discover differentially expressed genes that are related to diseases or various disease states. It would further be beneficial to develop methods and compositions for the diagnostic evaluation and prognosis of conditions involving such diseases, for the identification of subjects exhibiting a predisposition to such conditions, for modulating the effect of these differentially expressed genes and their expression products, for monitoring patients undergoing clinical evaluation for the prevention and treatment of a disease, specifically cardiac, kidney or inflammatory disease, and for monitoring the efficacy of compounds used in clinical trials. Secreted proteins mediate key biological processes including cell to cell interactions as well as important cellular functions such as cell growth and differentiation, and most protein-based drugs are secreted proteins including insulin, growth hormone, interferons, tissue plasmiπogen activator ( tPA), and erythropoietin (EPO). It would, therefore, be particularly desirable to identify novel differentially expressed genes encoding secreted proteins.

SUMMARY OF THE INVENTION

In one aspect, the present invention concerns an isolated nucleic acid molecule comprising a poly- or oligonucleotide selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide having at least about 80% sequence identity with ammo acids 22 to 122 of SEQ ID NO: 1 ; (b) a polynucleotide encoding a polypeptide having at least about 80% sequence identity with ammo acids 56 to 122 of SEQ ID NO: 1 ;

(c) a polynucleotide encoding ammo acids 22 to 275 of SEQ ID NO: 1 , or a traπsmembrane domain (membrane spanning segment/region) deleted or inactivated variant thereof; (d) a polynucleotide hybridizing under stringent conditions with the complement of the coding region of

SEQ ID NO: 2, and encoding a polypeptide having at least one biological activity of the polypeptide encoded by clone P00210 D09 (SEQ ID NO: 2);

(e) a polynucleotide encoding at least about 50 contiguous ammo acids from ammo acids 22 to

122 of SEQ ID NO: 1 , wherein said polynucleotide encodes a polypeptide having at least one biological activity of the polypeptide encoded by clone P00210_D09 (SEQ ID NO: 2);

(f) a polynucleotide encoding at least about 50 contiguous ammo acids from ammo acids 56 to 122 of SEQ ID NO: 1, wherein said polynucleotide encodes a polypeptide having at least one biological activity of the polypeptide encoded by clone P00210 D09 (SEQ ID NO: 2);

(g) a polynucleotide of SEQ ID NO: 2; (h) the complement of a polynucleotide of (a) - (g); and

(i) an antisense oligonucleotide capable of hybridizing with, and inhibiting the translation of, the mRNA encoded by a gene encoding a polypeptide of SEQ ID NO: 1 , or another mammalian (e.g. human) homologue thereof.

In another aspect, the invention concerns a vector comprising any of the poly- or oligonucleotides of (a) - (i) above.

In a further aspect, the invention concerns a recombinant host cell transformed with nucleic acid comprising any of the poly- or oligonucleotides of (a) - (i) above, or with a vector comprising any of the poly- or oligonucleotides of (a) - (ι) above.

In a still further aspect, the invention concerns a recombinant method for producing a polypeptide by culturing a recombinant host cell transformed with nucleic acid comprising any of the polynucleotides of (a) - (g) above under conditions such that the polypeptide is expressed, and isolating the polypeptide. In a different aspect, the invention concerns a polypeptide comprising:

(a) a polypeptide having at least about 80% identity with ammo acids 22 to 122 of SEQ ID N0:1 ; or

(b) a polypeptide encoded by nucleic acid hybridizing under stringent conditions with the complement of the coding region of SEQ ID NO: 2; the polypeptides of (a) and (b) having at least one biological activity of the polypeptide encoded by clone P00210 D09 (SEQ ID NO: 2).

In another aspect, the invention concerns a composition comprising a polypeptide as heremabove defined in admixture with a pharmaceutically acceptable carrier. In a specific embodiment, the composition is a pharmaceutical composition, preferably for the treatment of a cardiac, renal or inflammatory disease, comprising an effective amount of a polypeptide of the present invention.

In yet another aspect, the invention concerns an antibody specifically binding a polypeptide of the present invention (as hereinabove defined). In a further aspect, the invention concerns an antagonist or agonist of a polypetide of the present invention.

In a still further aspect, the invention concerns a composition, preferably a pharmaceutical composition, comprising an effective amount of an antibody herein, in admixture with a pharmaceutically acceptable carrier.

The invention further concerns a composition, preferably a pharmaceutical composition, comprising an effective amount of an antagonist or agonist of the present invention, in admixture with a pharmaceutically acceptable carrier.

In a further aspect, the invention concerns a method for the treatment of a cardiac, renal or inflammatory disease, comprising administering to a patient in need an effective amount of a polypeptide of the present invention or an antagonist or agonist thereof.

In a different aspect, the invention concerns a method for the treatment of a cardiac, renal or inflammatory disease, comprising administering to a patient in need an effective amount of a poly- or oligonucleotide of the present invention (as hereinabove defined).

The invention also concerns a method for the treatment of a cardiac, renal or inflammatory disease, comprising administering to a patient in need an effective amount of an antibody specifically binding to a polypeptide of the present invention. In a further aspect, the invention concerns a method for screening a subject for a cardiac, renal or inflammatory disease characterized by the differential expression of the endogenous homologue of the protein of SEQ ID NO: 1 , comprising the steps of: measuring the expression in the subject of the endogenous homologue of the protein of SEQ ID NO: 1 ; and determining the relative expression of such endogenous homologue in the subject compared to its expression in normal subjects, or compared to its expression in the same subject at an earlier stage of development of the cardiac, renal or inflammatory disease. The subject is preferably human and, accordingly, the endogenous protein is a human homologue of the rat protein of SEQ ID NO: 1.

In a still further aspect, the invention concerns an array comprising one or more oligonucleotides complementary to reference RNA or DNA encoding a protein of SEQ ID NO: 1 or another mammalian (e.g. human) homologue thereof, where the reference DNA or RNA sequences are obtained from both a biological sample from a normal subject and a biological sample from a subject exhibiting a cardiac, renal, or inflammatory disease, or from biological samples taken at different stages of a cardiac, renal, or inflammatory disease.

In yet another aspect, the invention concerns a method for detecting cardiac, kidney, or inflammatory disease in a human patient comprising the steps of: providing an array of oligonucleotides at known locations on a substrate, which array comprises oligonucleotides complementary to reference DNA or RNA sequences encoding a human homologue of the protein of SEQ ID NO: 1, where the reference DNA or RNA sequences are obtained from both a biological sample from a normal patient and a biological sample from a patient potentially exhibiting cardiac, renal, or inflammatory disease, or from a patient exhibiting cardiac, renal, or inflammatory disease, taken at different stages of such disease (jointly referred to as "the test patient"); exposing the array, under hybridization conditions, to a first sample of cDNA probes constructed from mRNA obtained from a biological sample from a corresponding biological sample of a normal patient or from a test patient at a certain stage of the disease; exposing the array, under hybridization conditions, to a second sample of cDNA probes constructed from mRNA obtained from a biological sample obtained from the test patient (if the first sample was taken at a certain stage of the disease, the second sample is taken at a different stage of the disease); quantifying any hybridization between the first sample of cDNA probes and the second sample of cDNA probes with the oligonucleotide probes on the array; and determining the relative expression of genes encoding the human homologue of the protein of SEQ ID NO: 1 in the biological samples from the normal patient and the test patient, or in the biological samples taken from the test patient at different stages of the disease.

The invention further concerns a diagnostic kit comprising an array herein (as defined above) for detecting and diagnosing a disease, specifically cardiac, kidney or inflammatory disease. This kit may comprise control oligonucleotide probes, PCR reagents and detectable labels, in addition, this kit may comprise biological samples taken from human subjects, said samples comprising blood or tissue, preferably cardiac tissue, more preferably left ventricle cells. Such diagnostic kits may also comprise antibodies (including poly- and monoclonal antibodies) to a polypeptide of the present invention, including the polypeptide of SEQ ID NO: 1 and further mammalian (e.g. human) homologues thereof.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 (SEQ ID NO: 1 ) shows the deduced ammo acid sequence of the polypeptide encoded by the clone

P00210 D09. The open reading frame (ORF) of the polypeptide contains 275 ammo acid residues, of which the first

21 residues, including the initiating methionme, show the characteristics of a putative signal sequence, which is underlined. The sequence includes two putative membrane spanning segments at positions 35 55 and 123 143, respectively, which are boxed in the sequence.

Figure 2 shows the nucleotide sequence of the clone P00210_D09 (SEQ ID NO. 2), in alignment with the encoded ammo acid sequence, where the initiating methionme is circled. The total length of this sequence is 1031 bases, and the sequence encoded by the open reading frame (275 ammo acid polypeptide, SEQ ID NO: 1 ) is bracketed in the Figure. The complementary strand is also depicted (SEQ ID NO: 19). Figure 3 shows the results of Northern blot analysis of P00210_D09 expression in rat heart, brain, spleen, lung, liver, skeletal muscle, and kidney tissue. P00210 D09 encodes a rare message, a putative about 900 bp transcript is detected in rat heart using polyA + mRNA.

Figure 4 shows the results of quantitative real-time PCR analysis of P00210_D09 expression in treated rat cardiac myocytes. Myocytes were treated with cardιotropιn-1 (CT-1 ), phenylephπne (Phe), endothe n 1 (Eth-1), angiotensin II (Ang2), transforming growth factor beta (TGFβ), tumor necrosis factor alpha (TNFα) and mterleukin 1 β (IL-l β). Panel A shows P00210 D09 expression after treatment for 2 hours and panel B shows P00210 D09 expression after 24 hours of treatment. Expression was normalized to 18S ribozomal RNA expression Treatment with CT-1, Phe, Eth-1 , Ang2, TGFβ and TNFα for 2 hours decreased expression of P00210 D09 mRNA 2 to 3-fold Treatment with CT 1 , Phe, and TNFα for 24 hours decreased expression of P00210 D09 mRNA 1.8 fold.

Figure 5 shows the tissue distribution of P00210 D09 RNA expression in rat as determined by quantitative real-time PCR. Distribution was analyzed in brain, heart, kidney, liver, lung, skeletal muscle, spleen and testis. Predominant expression of P00210 D09 mRNA was seen in the heart. Significant expression was also observed in the brain and skeletal muscle Figure 6 shows the expression profile of P00210_D09 RNA in the rat myocardial infarction model as determined by quantitative real time PCR. Panel A shows P00210_D09 RNA expression in the left ventricle (LV) two weeks (LV2), four weeks (LV4), eight weeks (LV8) and twenty two weeks (LV22) after surgically induced myocardial infarction or a sham operation (SHAM). Panel B shows P00210 D09 RNA expression in the septum (Spt) under the identical conditions. Expression was normalized to 18S ribozomal RNA expression. Significant induction of P00210_D09 was observed at 2 weeks in the Spt, 4 weeks in the LV and Spt and 8 weeks in the LV.

DETAILED DESCRIPTION OF THE INVENTION A. Definitions

Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of

Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, NY 1994), and March, Advanced Organic

Chemistry Reactions, Mechanisms and Structure 4th ed., John Wiley & Sons (New York, NY 1992), provide one skilled in the art with a general guide to many of the terms used in the present application.

One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

The term "polynucleotide", when used in singular or plural, generally refers to any polynbonucleotide or polydeoxπbonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as defined herein include, without limitation, single- and double stranded DNA, DNA including single- and double-stranded regions, single and double-stranded RNA, and RNA including single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or include single- and double-stranded regions. In addition, the term "polynucleotide" as used herein refers to triple stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. The term

"polynucleotide" specifically includes DNAs and RNAs that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosme, or modified bases, such as tntyiated bases, are included within the term "polynucleotides" as defined herein In general, the term "polynucleotide" embraces all chemically, enzymatically and/or metabolically modified forms of unmodified polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including simple and complex cells.

The term "oligonucleotide" refers to a relatively short polynucleotide, including, without limitation, single stranded deoxyπbonucleotides, single- or double-stranded nboπucleotides, RNA:DNA hybrids and double stranded DNAs. Oligonucleotides, such as single-stranded DNA probe oligonucleotides, are often synthesized by chemical methods, for example using automated oligonucleotide synthesizers that are commercially available. However, oligonucleotides can be made by a variety of other methods, including in vitro recombinant DNA-mediated techniques and by expression of DNAs in cells and organisms.

The term "polypeptide", in singular or plural, is used herein to refer to any peptide or protein comprising two or more ammo acids joined to each other in a linear chain by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, o gopeptides and ohgomers, and to longer chains, commonly referred to in the art as proteins. Polypeptides, as defined herein, may contain ammo acids other than the 20 naturally occurring ammo acids, and may include modified ammo acids The modification can be anywhere within the polypeptide molecule, such as, for example, at the terminal ammo acids, and may be due to natural processes, such as processing and other post-translational modifications, or may result from chemical and/or enzymatic modification techniques which are well known to the art. The known modifications include, without limitation, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidγlmositol, cross-linking, cyc zation, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystme, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, lodmatioπ, methylation, mynstoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of ammo acids to proteins such as arginylation, and ubiquitmation. Such modifications are well known to those of skill and have been described in great detail in the scientific literature, such as, for instance, Creighton, T. E., Proteins Structure And Molecular Properties, 2nd Ed., W. H. Freeman and Company, New York (1993); Wold, F., "Posttranslational Protein Modifications: Perspectives and Prospects," in Posttranslational Covalent Modification of Proteins, Johnson, B. C, ed., Academic Press, New York (1983), pp. 1 -12; Seifter et al., "Analysis for protein modifications and nonproteiπ cofactors," Meth. Enzymol. 182:626-646 (1990), and Rattan et al., Ann. N.Y Acad. Sci. 663:48-62 (1992)

Modifications can occur anywhere in a polypeptide, including the peptide backbone, the ammo acid side chains and the ammo or carboxyl termini. In fact, blockage of the ammo or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For instance, the ammo terminal residue of polypeptides made in E. coli, prior to proteolγtic processing, almost invariably will be N-formylmethionme

Modifications that occur in a polypeptide often will be a function of how the polypeptide is made. For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide ammo acid sequence. For instance, it is well known that glγcosylation usually does not occur in certain bacterial hosts such as E. coll. Accordingly, when glycosγlation is desired, a polypeptide is expressed in a glycosylatmg host, generally eukaryotic host cells. Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having native patterns of glγcosylation.

It will be appreciated that the same type of modification may be present in the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications.

It will be appreciated that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitmation, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural process and by entirely synthetic methods, as well. Such structures are within the scope of the polypeptides as defined herein. The term "ammo acid sequence variant" refers to molecules with some differences in their ammo acid sequences as compared to a reference (e.g. native sequence) polypeptide. The ammo acid alterations may be substitutions, insertions, deletions or any desired combinations of such changes in a native ammo acid sequence.

Substitutional variants are those that have at least one ammo acid residue in a native sequence removed and a different ammo acid inserted in its place at the same position. The substitutions may be single, where only one ammo acid in the molecule has been substituted, or they may be multiple, where two or more ammo acids have been substituted in the same molecule.

Insertional variants are those with one or more ammo acids inserted immediately adjacent to an ammo acid at a particular position in a native am o acid sequence. Immediately adjacent to an ammo acid means connected to either the α-carboxy or α-ammo functional group of the ammo acid. Deletional variants are those with one or more ammo acids in the native ammo acid sequence removed Ordinarily, deletional variants will have one or two ammo acids deleted in a particular region of the molecule.

The ammo acid sequence variants within the scope of the present invention may contain ammo acid alterations, including substitutions and/or insertions and/or deletions in any region of the polypeptide of SEQ ID NO: 1 , including the N and C-terminal regions. The ammo acid sequence variants of the present invention show at least about 75%, more preferably at least about 85%, even more preferably at least about 90%, most preferably at least about 95% ammo acid sequence identity with a polypeptide of SEQ ID NO: 1 or with a native homologue thereof in another mammalian species, including humans.

"Sequence identity" is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the ammo acid residues in a native polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The % sequence identity values are generated by the NCBI BLAST2 0 software as defined by Altschul et al., (1997), "Gapped BLAST and PSI BLAST: a new generation of protein database search programs", Nucleic Acids Res., 25:3389 3402. The parameters are set to default values, with the exception of the Penalty for mismatch, which is set to -1.

"Stringent" hybridization conditions are sequence dependent and will be different with different environmental parameters (e.g., salt concentrations, and presence of organics). Generally, stringent conditions are selected to be about 5°C to 20°C lower than the thermal melting point (TJ for the specific nucleic acid sequence at a defined ionic strength and pH. Preferably, stringent conditions are about 5°C to 10°C lower than the thermal melting point for a specific nucleic acid bound to a complementary nucleic acid. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a nucleic acid (e.g., tag nucleic acid) hybridizes to a perfectly matched probe

"Stringent" wash conditions are ordinarily determined empirically for hybridization of each set of tags to a corresponding probe array The arrays are first hybridized (typically under stringent hybridization conditions) and then washed with buffers containing successively lower concentrations of salts, or higher concentrations of detergents, or at increasing temperatures until the signal to noise ratio for specific to non specific hybridization is high enough to facilitate detection of specific hybridization Stringent temperature conditions will usually include temperatures in excess of about 30° C, more usually in excess of about 37° C, and occasionally in excess of about 45° C. Stringent salt conditions will ordinarily be less than about 1000 mM, usually less than about 500 mM, more usually less than about 400 mM, typically less than about 300 mM, preferably less than about 200 mM, and more preferably less than about 150 mM. However, the combination of parameters is more important than the measure of any single parameter

See, e.g., Wetmur et al., J. Mol. Biol. 3J_:349 70 (1966), and Wetmur, Critical Reviews in Biochemistry and Molecular Biology 26(341.227 59 (1991 ). In a preferred embodiment, "stringent conditions" or "high stringency conditions," as defined herein, may be hybridization in 50% formamide, 5x SSC (0.75 M NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1 % SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high stringency wash consisting of 0.1 x SSC containing EDTA at 55°C.

As used herein, the term "polynucleotide encoding a polypeptide" and grammatical equivalents thereof, encompass polynucleotides which include a sequence encoding a polypeptide of the present invention, including polynucleotides that comprise a single continuous region or discontinuous regions encoding the polypeptide (for example, interrupted by introπs) together with additional regions, that also may contain coding and/or non coding sequences.

"Antisense ohgodeoxynucleotides" or "antisense oligonucleotides" (which terms are used interchangeably) are defined as nucleic acid molecules that can inhibit the transcription and/or translation of target genes in a sequence specific manner. The term "antisense" refers to the fact that the nucleic acid is complementary to the coding ("sense") genetic sequence of the target gene Antisense oligonucleotides hybridize in an antiparallel orientation to nascent mRNA through Watson Crick base pairing. By binding the target mRNA template, antisense oligonucleotides block the successful translation of the encoded protein. The term specifically includes antisense agents called "ribozymes" that have been designed to induce catalytic cleavage of a target RNA by addition of a sequence that has natural self-splicing activity (Warzocha and Wotowiec, "Antisense strategy: biological utility and prospects in the treatment of hematological malignancies." Leuk. Lymphoma 24:267-281 [1997])

The terms "vector", "polynucleotide vector", "construct" and "polynucleotide construct" are used interchangeably herein. A polynucleotide vector of this invention may be in any of several forms, including, but not limited to, RNA, DNA, RNA encapsulated in a retroviral coat, DNA encapsulated in an adenovirus coat, DNA packaged in another viral or viral like form (such as herpes simplex, and adeno-associated virus (AAV)), DNA encapsulated in liposomes, DNA complexed with polylysme, complexed with synthetic polycationic molecules, conjugated with transferπn, complexed with compounds such as polyethylene glycol (PEG) to immunologically "mask" the molecule and/or increase half-life, or conjugated to a non-viral protein. Preferably, the polynucleotide is DNA. As used herein, "DNA" includes not only bases A, T, C, and G, but also includes any of their analogs or modified forms of these bases, such as methylated nucleotides, interπucleotide modifications such as uncharged linkages and thioates, use of sugar analogs, and modified and/or alternative backbone structures, such as polya ides.

The term "antagonist" is used in the broadest sense and includes any molecule that partially or fully blocks, inhibits or neutralizes a biological activity exhibited by a polypeptide of the present invention. In a similar manner, the term "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity exhibited by a polypeptide of the present invention, for example, by specifically changing the function or expression of such polypeptide, or the efficiency of signaling through such polypeptide, thereby altering (increasing or inhibiting) an already existing biological activity or triggering a new biological activity.

The term "recombinant" when used with reference to a cell, animal, or virus indicates that the cell, animal, or virus encodes a foreign DNA or RNA. For example, recombinant cells optionally express nucleic acids (e.g., RNA) not found within the native (non recombinant) form of the cell. The term "antibody" is used in the broadest sense and specifically covers monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies), polyclonal antibodies, multi-specific antibodies (e.g., bispecific antibodies), as well as antibody fragments. The monoclonal antibodies specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chaιn(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 8J.:6851 6855 [1984]). The monoclonal antibodies further include "humanized" antibodies or fragments thereof (such as Fv, Fab, Fab', F(ab')₂ or other antigen binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobu n. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv FR residues of the human immunoglobulin are replaced by corresponding non human residues. Furthermore, humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and maximize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non human immunoglobu n and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321 :522 525 (1986); and Reichmann et al., Nature, 332:323 329 (1988). The humanized antibody includes a PRIMATIZED® antibody wherein the antigen-binding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen of interest.

"Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')₂, and Fv fragments; diabodies, linear antibodies (Zapata et al., Protein Eπg. 8(10): 1057 1062 (1995)); single chain antibody molecules; and multispecific antibodies formed from antibody fragments

The terms "differentially expressed gene," "differential gene expression" and their synonyms, which are used interchangeably, refer to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically a cardiac, kidney or inflammatory disease state, relative to its expression in a normal or control subject. The terms also include genes whose expression is activated to a higher or lower level at different stages of the same disease. It is also understood that a differentially expressed gene may be either activated or inhibited at the nucleic acid level or protein level, or may be subject to alternative splicing to result in a different polypeptide product Such differences may be evidenced by a change in mRNA levels, surface expression, secretion or other partitioning of a polypeptide, for example. Differential gene expression may include a comparison of expression between two or more genes, or a comparison of the ratios of the expression between two or more genes, or even a comparison of two differently processed products of the same gene, which differ between normal subjects and subjects suffering from a disease, specifically a cardiac, kidney or inflammatory disease state, or between various stages of the same disease. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, "differential gene expression" is considered to be present when there is at least an about 1.4-fold, preferably at least about 1.8-fold, more preferably at least about 2.0-fold, most preferably at least about 2.5 fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject. "Cardiac disease" includes congestive heart failure, myocarditis, dilated congestive cardiomyopathγ, hypertrophic cardiomyopathy, restrictive cardiomyopathγ, mitral valve disease, aortic valve disease, tncuspid valve disease, angina pectons, myocardial infarction, cardiac arrhythmia, pulmonarγ hypertension, arterial hypertension, renovascular hypertension, arteriosclerosis, atherosclerosis, and cardiac tumors, along with any disease or disorder that relates to the cardiovascular system and related disorders, as well as symptoms indicative of, or related to, cardiac disease and related disorders.

As used herein, "h16heart failure" refers to an abnormality of cardiac function where the heart does not pump blood at the rate needed for the requirements of metabolizing tissues. The heart failure can be caused by anγ number of factors, including ischemic, congenital, rheumatic, or idiopathic forms.

As used herein "congestive heart failure" refers to a sγndrome characterized bγ left ventricular dγsfunction, reduced exercise tolerance, impaired quality of life, and markedly shortened life expectancy. Decreased contractility of the left ventricle leads to reduced cardiac output with consequent systemic arterial and venous vasoconstnction. This vasoconstnction, which appears to be mediated, in part, by the renm-angiotensis sγstem, promotes the VICIOUS cγcle of further reductions of stroke volume followed bγ an increased elevation of vascular resistance

As used herein "mfarct" refers to an area of necrosis resulting from an insufficiency of blood supply "Myocardial infarction" refers to myocardial necrosis resulting from the insufficiency of coronary blood supply.

"Kidney disease" includes acute renal failure, glomerulonephπtis, chronic renal failure, azotemia, uremia, immune renal disease, acute nephritic sγndrome, rapidly progressive nephritic syndrome, nephrotic syndrome, Berger's Disease, chronic nephritic/proteinunc sγndrome, tubulointerstital disease, nephrotoxic disorders, renal infarction, atheroembohc renal disease, renal cortical necrosis, malignant nephroangiosclerosis, renal vein thrombosis, renal tubular acidosis, renal glucosuna, nephrogemc diabetes insipidus, Bartter's Syndrome, ϋddle's Syndrome, polycystic kidneγ disease, medullary cystic disease, medullary sponge kidney, hereditary nephritis, and nail-patella syndrome, along with any disease or disorder that relates to the renal system and related disorders, as well as sγmptoms indicative of, or related to, renal or kidneγ disease and related disorders.

The phrases "polycystic kidney disease" "PKD" and "polycystic renal disease" are used interchangeably, and refer to a group of disorders characterized by a large number of cysts distributed throughout dramatically enlarged kidneγs. The resultant cγst development leads to impairment of kidneγ function and can eventuallγ cause kidneγ failure. "PKD" specifically includes autosomal dominant polγcγstic kidneγ disease (ADPKD) and recessive autosomal recessive polγcγstic kidneγ disease (ARPKD), in all stages of development, regardless of the underlying cause.

"Inflammatory disease" includes myocarditis, asthma, chronic inflammation, autoimmune diabetes, tumor angiogenesis, rheumatoid arthritis (RA), rheumatoid spondylitis, osteoarthritis, goutγ arthritis and other arthritic conditions, sepsis, septic shock, endotoxic shock, Gram-negative sepsis, toxic shock sγndrome, asthma, adult respiratory distress sγndrome, stroke, reperfusion injury, CNS injuries such as neural trauma and ischemia, psoriasis restenosis, cerebral malaria, chronic pulmonary inflammatory disease, sihcosis, pulmonarγ sarcosis, bone resorption diseases such as osteoporosis, graft versus host reaction, Crohn's Disease, ulcerative colitis including inflammatory bowel disease (IBD), Alzheimer's disease, and pγresis, along with anγ disease or disorder that relates to inflammation and related disorders, as well as sγmptoms indicative of, or related to, inflammation and related disorders

The terms "treat" or "treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder. For purposes of this invention, beneficial or desired clinical results include, but are not limited to, alleviation of sγmptoms, dimimshment of extent of disease, stabilized (i.e., not worsening) state of disease, delaγ or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those alreadγ with the condition or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented. "Chronic" administration refers to administration of the ageπt(s) in a continuous mode as opposed to an acute mode, so as to maintain the desired effect for an extended period of time.

"Intermittent" administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.

Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in anγ order.

An "individual" is a vertebrate, preferablγ a mammal, more preferablγ a human.

"Mammal" for purposes of treatment refers to anγ animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, etc Preferablγ, the mammal herein is human. An "effective amount" is an amount sufficient to effect beneficial or desired therapeutic (including preventative) results. An effective amount can be administered in one or more administrations. "Active" or "activity" means a qualitative biological and/or immunological property. The phrase "immunological property" means immunological cross-reactivitγ with at least one epitope of the reference (native sequence) polypeptide molecule, wherein, "immunological cross-reactivity" means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological activity of the reference (native sequence) polypeptide. The immunological cross-reactivity is preferablγ "specific", which means that the binding affinity of the immunologically cross-reactive molecule identified to the corresponding polγpeptide is significantly higher (preferablγ at least about 2-tιmes, more preferablγ at least about 4-tιmes, most preferablγ at least about 6 times higher) than the binding affinity of that molecule to any other known native polypeptide. "Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are πontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidaπts including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polγmers such as polγvinγlpγrrolidone, ammo acids such as glγcine, glutamme, asparagme, argmine or

Iγsme; monosacchandes, disacchaπdes, and other carbohydrates including glucose, mannose, or dextnns; chelatmg agents such as EDTA; sugar alcohols such as manmtol or sorbitol; salt forming countenons such as sodium; and/or nomonic surfactants such as TWEEN , polyethylene glycol (PEG), and PLURONICS .

B. Modes of Carrying Out the Invention

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratorγ Manual", 2"" edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M.J. Gait, ed., 1984), "Animal Cell Culture" (R.I. Freshney, ed., 1987); "Methods in Enzγmologγ" (Academic Press, Inc.); "Handbook of Experimental

Immunologγ", 4^th edition (D.M. Weir & C.C. Blackwell, eds., Blackwell Science Inc., 1987); "Gene Transfer Vectors for Mammalian Cells" (J.M. Miller & M.P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (F.M. Ausubel et al., eds., 1987); "PCR: The Polymerase Cham Reaction", (Mullis et al , eds., 1994); and "Current Protocols in Immunologγ" (J.E. Coligan et al., eds., 1991). 1. Identification of Differential Gene Expression and Further Characterization of Differentially

Expressed Genes The present invention is based on the identification of a gene that is differentially expressed in the left ventricle in the Myocardial Infarction Model, as described in the Examples. Such models of differential gene expression can be utilized, among other things, for the identification of genes which are differentially expressed in normal cells versus cells in a disease state, specifically cardiac, kidney or inflammatorγ disease state, in cells within different diseases, among cells within a single given disease state, in cells within different stages of a disease, or in cells within different time stages of a disease.

Once a particular differentially expressed gene has been identified through the use of one model, its expression pattern can be further characterized, for example, bγ studγing its expression in a different model. A gene maγ be regulated one waγ, i.e., the gene can exhibit one differential gene expression pattern, in a given model, but can be regulated differentlγ in another model. The use, therefore, of multiple models can be helpful in distinguishing the roles and relative importance of particular genes in a disease, specifically cardiac, kidney or inflammatorγ disease. a. In Vitro Models of Differential Gene Expression

A suitable model that can be utilized within the context of the present invention to discover differentially expressed genes is the in vitro specimen model. In a preferred embodiment, the specimen model uses biological samples from subjects, e.g., peripheral blood, cells and tissues, including surgical and biopsγ specimens. Such specimens can represent normal peripheral blood and tissue or peripheral blood and tissue from patients suffering from a disease, specifically cardiac, kidneγ or inflammatorγ disease, or having undergone surgical treatment for disorders involving a disease, such as, for example, coronarγ bγpass surgerγ. Surgical specimens can be procured under standard conditions involving freezing and storing in liquid nitrogen (see Karmali et al., Br. J. Cancer 48:689-96

[1983]). RNA from specimen cells is isolated bγ, for example, differential centrifugation of homogenized tissue, and analγzed for differential expression relative to other specimen cells, preferablγ using microarraγ analγsis.

Cell lines can also be used to ideπtifγ genes that are differentially expressed in a disease, specifically cardiac, kidneγ or inflammatorγ disease. Differentially expressed genes are detected, as described herein, by comparing the pattern of gene expression between the experimental and control conditions. In such models, genetically matched disease cell lines (e.g., variants of the same cell line) maγ be utilized. For example, the gene expression pattern of two variant cell lines can compared, wherein one variant exhibits characteristics of one disease state while the other variant exhibits characteristics of another disease state.

Alternatively, two variant cell lines, both of which exhibit characteristics of the same disease, specifically cardiac, kidney or inflammatorγ disease, but which exhibit differing degrees of disease disorder severitγ maγ be used.

Further, genetically matched cell lines can be utilized, one of which exhibits characteristics of a disease, specifically cardiac, kidneγ or inflammatorγ disease, state, while the other exhibits a normal cellular phenotγpe. In accordance with this aspect of the invention, the cell line variants are cultured under appropriate conditions, harvested, and RNA is isolated and analγzed for differentially expressed genes, as with the other models. In a preferred embodiment, microarraγ analγsis is used. b. In Vivo Models of Differential Gene Expression

In the in vivo model, animal models of a disease, specifically cardiac, kidneγ or inflammatorγ disease, and related disorders, can be utilized to discover differentially expressed gene sequences. The in vivo nature of such disease models can prove to be especially predictive of the analogous responses in living patients, particularly human patients. Animal models for a disease, specifically cardiac, kidneγ or inflammatorγ disease, which can be utilized for in vivo models include anγ of the animal models described below. In a preferred embodiment, RNA from both the normal and disease state model is isolated and analγzed for differentially expressed genes using microarray analγsis.

As presented in the examples, three representative in vivo cardiac disease models, a representative kidneγ disease model, and a representative inflammatorγ disease model have been successfully utilized to identify differentially expressed genes, and are believed to be useful to further characterize the genes and polypeptides of the present invention. These genes are expressed at higher or lower levels in the disease state, relative to the normal state, and preferablγ are expressed at least about a two-fold higher or lower level relative to the normal state at at least one time point.

Representative in vivo animal models for use in the present invention include the following: general inflammation - carrageeπan-mduced paw edema, arachidomc acid-induced ear inflammation; arthritis - adjuvant- induced polyarthritis, collagen-induced arthritis, streptococcal cell wall-induced arthritis; multiple sclerosis experimental autoimmune encephalomγelitis (EAE); Sγstemic Lupus Erγthematosis (SLE); NZB - spontaneous SLE mouse, DNA/anti-DNA immune complex-induced SLE; insulin-dependent diabetes mellitus - NOD spontaneous diabetes mouse; inflammatorγ bowel disease - acetic acid or tnnitrobenzene sulfonic (TNBS)-ιnduced ulcerative colitis; respiratorγ disease - antigen-induced broπchoconstπctioπ (asthma), lipopolγsacchande (LPS)-ιnduced acute respiratorγ distress sγndrome (ARDS); analgesia - acetic acid-induced or phenγlquinone-mduced writhing, latencγ of tail- withdrawal (hot plate); transplant organ rejection - allograft rejection (kidneγ, lung, heart)-acute and chronic arteπolsclerosis; kidneγ disease - unilateral nephrectomγ (acute renal failure), cγclosponn-mduced nephropathγ, accelerated crescentic anti-glomerular basement membrane (GBM) glomerulonephπtis, soluble immune complex induced nephritis (see generally Aziz, Bioassays _7:8 703 12 [1995]); and cardiac disease spontaneous cardiomyopathic hamsters (heart failure), myocardial infarction (Ml) model, pacing-induced model of failure (Riegger model), arrhythmias following myocardial infarction (Harris model), aconitme/chloroform-induced arrhγth isa, carotid arterγ injury (restenosis), balloon angioplasty (resteπosis). One skilled in the art understands that the present invention is not limited to the in vivo models recited above and that anγ known models can be used within the context of the present invention. c. Microarraγ Technique

In a preferred embodiment of the present invention, microarraγs are utilized to assess differential expression of genes. In one aspect of the present invention, DNA microarraγs are utilized to assess the expression profile of genes expressed in normal subjects and subjects suffering from a disease, specifically cardiac, kidneγ or inflammatorγ disease. Identification of the differentially expressed disease genes can be performed bγ: constructing normalized and subtracted cDNA libraries from mRNA extracted from the cells or tissue of healthγ animals and an animal model of disease or of healthγ patients and diseased patients, for example, using anγ of the in vitro or in vivo models described above; purifying the DNA of cDNA libraries of clones representing healthγ and diseased cells or tissue, microarraγmg the purified DNA for expression analγsis; and probing microarraγs to identify the genes from the clones that are differentially expressed using labeled cDNA from healthγ and diseased cells or tissues.

In a specific embodiment of the microarraγ technique, PCR amplified inserts of cDNA clones are applied to a substrate in a dense array. Preferablγ at least 10,000 nucleotide sequences are applied to the substrate. The microarraγed genes, immobilized on the microchip at 10,000 elements each, are suitable for hybridization under stringent conditions. Fluorescently labeled cDNA probes maγ be generated through incorporation of fluorescent nucleotides bγ reverse transcription of RNA extracted from tissues of interest. Labeled cDNA probes applied to the chip hybridize with specificity to each spot of DNA on the arraγ. After stringent washing to remove non-specificallγ bound probes, the chip is scanned bγ confocal laser microscopγ. Quantitation of hγbridization of each arrayed element allows for assessment of corresponding mRNA abundance With dual color fluorescence, separately labeled cDNA probes generated from two sources of RNA are hybridized pairwise to the array. The relative abundance of the transcripts from the two sources corresponding to each specified gene is thus determined simultaneously. The miniaturized scale of the hγbridization affords a convenient and rapid evaluation of the expression pattern for large numbers of genes. Such methods have been shown to have the sensitivity required to detect rare transcripts, which are expressed at a few copies per cell, and to reproducibly detect at least approximately two-fold differences in the expression levels (Schena et al., Proc. Natl. Acad. Sci. USA 93(20):106-49 [1996]). In a specific embodiment, in vivo models of disease states are used to detect differentially expressed genes.

Bγ waγ of example, three representative cardiac disease models, a representative kidneγ disease model, and a representative inflammatorγ disease model were successfully utilized to identify specific differentially expressed genes. Summarizing the representative general protocol used for such in vivo models, separate DNA libraries were constructed from mRNA extracted from disease state tissue and normal tissue. From these libraries, at least 20,000 unidentified cDNA clones were preferablγ chosen for analγsis and microarraγed on chips. Probes generated from normal and disease tissue, from multiple time points, were hybridized to the microarray. Bγ this approach, genes, which are differentially expressed in normal and diseased tissue, were revealed and further identified bγ DNA sequencing. The analγsis of the clones for differential expression reveal genes whose expression is elevated or decreased in association with a disease, specifically cardiac, kidneγ or inflammatorγ disease, in the specific in vivo model chosen. d. Further characterization of differentially expressed genes

The differentially expressed genes of the present invention, in particular the rat gene of SEQ ID NO. 2 and its further mammalian (e.g. human) equivalents, are screened to obtain more information about the biological function of such genes. This information can, in turn, lead to the designation of such genes or their gene products as potential therapeutic or diagnostic molecules, or targets for identifying such molecules.

The goal of the follow-up work after a differentially expressed gene has been identified is to identify its target cell tγpe(s), function and potential role in disease pathology. To this end, the differentially expressed genes are screened to identify cell types responding to the gene product, to better understand the mechanism bγ which the identified cell tγpes respond to the gene product, and to find known signaling pathwaγs that are affected bγ the expression of the gene

When further characterization of a differentially expressed gene indicates that a modulation of the gene's expression or a modulation of the gene product's activity can inhibit or treat a disease, specifically cardiac, kidneγ or inflammatorγ disease, the differentially expressed gene or its gene product becomes a potential drug candidate, or a target for developing a drug candidate for the treatment of a cardiac, kidneγ or inflammatorγ disease, or maγ be used as a diagnostic. Where further characterization of a differentiallγ expressed gene reveals that modulation of the gene expression or gene product cannot retard or treat a target disease, the differentiallγ expressed gene maγ still contribute to developing a gene expression diagnostic pattern correlative of a disease or its disorders. Accordiπglγ, such genes maγ be useful as diagnostics. A varietγ of techniques can be utilized to further characterize the differentiallγ expressed genes after theγ are identified.

First, the nucleotide sequence of the identified genes, which can be obtained bγ utilizing standard techniques well known to those of skill in the art, can be used to further characterize such genes. For example, the sequence of the identified genes can reveal homologies to one or more known sequence motifs, which can γield information regarding the biological function of the identified gene product.

Second, an analγsis of the tissue or cell tγpe distribution of the mRNA produced bγ the identified genes can be conducted, utilizing standard techniques well known to those of skill in the art. Such techniques can include, for example, Northern analγses, microarraγs, real time (RT-coupled PCR), and RNase protection techniques. In a preferred embodiment, transcriptional screening is used, which maγ be based on the transfection of cells with an inducible promoter-luciferase plasmid construct, real time PCR, or microarraγs, the real time PCR and microarraγ approached being particularly preferred. Such analγses provide information as to whether the identified genes are expressed in further tissues expected to contribute to a disease, specifically cardiac, kidney or inflammatorγ disease. These techniques can also provide quantitative information regarding steadγ state mRNA regulation, yielding data concerning which of the identified genes exhibits a high level of regulation preferablγ in tissues which can be expected to contribute to a disease state. Additionally, standard in situ hybridization techniques can be utilized to provide information regarding which cells within a given tissue express the identified gene. Specifically, these techniques can provide information regarding the biological function of an identified gene relative to a disease, specifically cardiac, kidney or inflammatorγ disease, where onlγ a subset of the cells within the tissue is thought to be relevant to the disorder. Third, the sequences of the identified differentiallγ expressed genes can be used, utilizing standard techniques, to place the genes onto genetic maps, e.g., mouse (Copeland et al., Trends in Genetics 7:113-18 (1991)) and human genetic maps (Cohen et al., Nature 266:698-701 [1993]). This mapping information can γield information regarding the genes' importance to human disease bγ identifying genes that map within genetic regions to which known genetic disease disorders map. After the follow-up screening is completed, relevant, targeted in vivo and in vitro systems can be used to more directly assess the biological function of the identified genes. In vivo systems can include animal systems that naturally exhibit symptoms of a disease, specifically cardiac, kidney or inflammatory disease, or ones engineered to exhibit such symptoms. Animals of anγ species, including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, and non-human primates, e.g., baboons, monkeγs, and chimpanzees, can be used to generate animal models of a disease, specifically cardiac, kidney or inflammatorγ disease. Anγ technique known in the art can be used to introduce a target gene transgene into animals to produce the founder lines of transgenic animals. Such techniques include, pronuclear microinjection (Hoppe et al., U.S. Patent No. 4,873,191 (1989)); retrovirus mediated gene transfer into germ lines (Van der Fatten et al., Proc. Natl. Acad. Sci. USA 82:6148-52 (1985)); gene targeting in embrγonic stem cells (Thompson et al., Cell 56:313-21 (1989)); electroporation of embrγos (Lo, Mol. Cell. Biol. 3:1803-14 (1983)); and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-23 (1989)). For a review of such techniques, see Gordon, Intl. Rev. Cytol. 115:171 -229 (1989). Further techniques will be detailed below, in connection with the gene therapγ applications of the polynucleotides of the present invention.

The present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals which carrγ the transgene in some, but not all their cells, i.e., mosaic animals. The transgene can be integrated, either as a single transgene or in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The transgene can also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-36 (1992). The regulatorγ sequences required for such a cell-type specific activation depends upon the particular cell type of interest, and will be apparent to those of skill in the art. When it is desired that the transgene be integrated into the chromosomal site of the endogenous target gene, gene targeting is preferred. Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous target gene of interest are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous target gene. The transgene can also be selectively introduced into a particular cell type, thus inac- tivating the endogenous gene of interest in onlγ that cell tγpe, bγ following the teaching of Gu et al. (Science

265:103-06 [1994]). The regulatorγ sequences required for such a cell-type specific inactivation depends upon the particular cell type of interest, and will be apparent to those of skill in the art.

Once transgenic animals have been generated, the expression of the recombinant target gene and protein can be assaγed using standard techniques. Initial screening can be accomplished bγ Southern blot analγsis or PCR tech- niques to analγze animal tissues to assaγ whether integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals can also be assessed using techniques which include Northern blot analγsis of tissue samples obtained from the animal, in situ hγbridization analγsis, and RT- coupled PCR. Samples of target gene-expressing tissue can also be evaluated immunocγtochemically using antibodies specific for the transgenic product of interest. The transgenic animals that express target gene mRNA or target gene transgene peptide (detected immunocytochemicallγ, using antibodies directed against target gene product epitopes) at easily detectable levels should then be further evaluated to identify those animals which displaγ disease characteristics or sγmptoms. Additionally, specific cell tγpes within the transgenic animals can be analγzed for cellular phenotγpes characteristic of a disease, specifically cardiac, kidneγ or inflammatorγ disease. Such cellular phenotγpes can include, for example, differential gene expression characteristic of cells within a given disease state of interest. Further, such cellular phenotγpes can include an assessment of a particular cell tγpe diagnostic pattern of expression and its comparison to known diagnostic expression profiles of the particular cell tγpe in animals exhibiting a disease, specifically cardiac, kidney or inflammatorγ disease. Such transgenic animals serve as suitable models. Once transgenic founder animals are produced, theγ can be bred, inbred, outbred, or crossbred to produce colonies of the particular animal. The animal models described above and in the Examples, can be used to generate cell lines for use in cell- based in vitro assaγs to further characterize the differentiallγ expressed genes of the invention and their gene products. Techniques that can be used to derive a continuous cell line from transgenic animals are disclosed, for example, bγ Small et al., Mol. Cell Biol. 5:642-48 (1985).

Alternatively, cells of a cell type known to be involved in a cardiac, kidney or inflammatorγ disease can be transfected with sequences capable of increasing or decreasing the amount of target gene expression within the cell.

For example, sequences of the differentiallγ expressed genes herein can be introduced into, and overexpressed in, the genome of the cell of interest, or if endogenous target gene sequences are present, theγ can either be overexpressed or, be disrupted in order to underexpress or inactivate target gene expression.

The information obtained through such characterizations can suggest relevant methods for the treatment of a disease, specifically cardiac, kidney or inflammatory disease, involving the gene of interest. For example, treatment can include a modulation of gene expression or gene product activitγ. Characterization procedures such as those described herein can indicate where such modulation should involve an increase or a decrease in the expression or activitγ of the gene or gene product of interest.

2. Production of Polynucleotides and Polypeptides

The polypeptides of the present invention are preferably produced bγ techniques of recombinant DNA technologγ. DNA encoding a native polγpeptide herein, including the polγpeptide of SEQ ID NO: 1 , can be obtained from cDNA libraries prepared from tissue believed to possess the corresponding mRNA and to express it at a detectable level. For example, cDNA librarγ can be constructed bγ obtaining polγadenγlated mRNA from a cell line known to express the desired polypeptide, and using the mRNA as a template to sγnthesize double-stranded cDNA. In the present case, a suitable source for the desired mRNA maγ be heart tissue obtained from normal heart or from the

Mγocardial Infarction Model (Ml model) mentioned above, and described in detail in the Examples. The polγpeptide genes of the present invention can also be obtained from a genomic librarγ, such as a human genomic cosmid librarγ.

Libraries, either cDNA or genomic, are screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal and polyclonal antibodies that recognize and specifically bind to a polypeptide of SEQ ID NO: 1 (encoded bγ the P00210_D09 gene of SEQ ID NO: 2). For cDNA libraries, suitable probes include oligonucleotide probes (generally about 20-80 bases) that encode known or suspected portions of a polypeptide herein, from the same or different species, and/or complementarγ or homologous cDNAs or fragments thereof that encode the same or a similar gene. Appropriate probes for screening genomic libraries include, without limitation, oligonucleotides, cDNAs, or fragments thereof that encode the same or a similar gene, and/or homologous genomic DNAs or fragments thereof. Screening the cDNA and genomic libraries with the selected probe may be conducted using standard protocols as described, for example, in Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual. New York, Cold Spring Harbor Laboratory Press (1989).

According to a preferred method, carefully selected oligonucleotide probes are used to screen cDNA libraries from various tissues, preferablγ from heart and/or kidneγ tissues. The oligonucleotide sequences selected as probes should be sufficient in length and sufficiently unique and unambiguous that false positives are minimized. The actual sequences can be designed based on regions of SEQ ID NO: 2 which have the least codon redundance. The oligonucleotides may be degenerate at one or more positions. The use of degenerate oligonucleotides is of particular importance where a librarγ is screened from a species in which preferential codon usage is not known. The o gonuleotides must be labeled such that theγ can be detected upon hγbridization to DNA in the librarγ screened. Preferablγ, the 5' end of the oligonucleotide is radiolabeled, using APT (e.g. γ ²P) and polynucleotide kinase. However, other labeling, e.g. biotinγlation or enzymatic labeling are also suitable.

Alternatively, to obtain DNA encoding a homologue of the rat polypeptide specifically disclosed herein (SEQ ID NO: 1 ) in another mammalian species, e.g. in humans, one only needs to conduct hybridization screening with labeled rat DNA (SEQ ID NO: 2) or fragments thereof, selected following the principles outlined above, in order to detect clones which contain homologous sequences in the cDNA libraries obtained from appropriate tissues (e.g. heart or kidneγ) of the particular animal, such as human (cross species hybridization). Full length clones can then be identified, for example, by restriction eπdonuclease analγsis and nucleic acid sequencing. If full-length clones are not identified, appropriate fragments are recovered from the various clones and ligated at restriction sites common to the fragments to assemble a full-length clone. cDNAs encoding the polypeptides of the present invention can also be identified and isolated bγ other known techniques, such as bγ direct expression cloning or bγ using the PCR technique, both of which are well known are described in textbooks, such as those referenced hereinbefore.

Once the sequence is known, the nucleic acid encoding a particular polypeptide of the present invention can also be obtained bγ chemical sγnthesis, following known methods, such as the phosphoramidite method (Beaucage and Caruthers, Tetrahedron Letters 22:1859 [1981 ]; Matteucci and Caruthers, Tetrahedron Letters 21 :719 [1980]; and Matteucci and Caruthers, J. Amer. Chem. Soc. 103: 3185 [1981]), and the phosphotnester approach (Ito et al.,

Nucleic Acids Res. 10:1755 1769 [1982]).

The cDNA encoding the desired polγpeptide of the present invention is inserted into a rep cable vector for cloning and expression. Suitable vectors are prepared using standard techniques of recombinant DNA technologγ, and are, for example, described in the textbooks cited above. Isolated plasmids and DNA fragments are cleaved, tailored, and ligated together in a specific order to generate the desired vectors. After ligation, the vector containing the gene to be expressed is transformed into a suitable host cell.

Host cells can be anγ eukarγotic or prokarγotic hosts known for expression of heterologous proteins The polypeptides of the present invention can be expressed in eukaryotic hosts, such as eukarγotic microbes (γeast), cells isolated from multicellular organisms (mammalian cell cultures), plants and insect cells.

While prokarγotic host provide a convenient means to sγnthesize eukarγotic proteins, when made this fashion, proteins usually lack many of the immunogenic properties, three-dimensional conformation, glγcosγlation, and other features exhibited bγ authentic eukarγotic proteins. Eukaryotic expression systems overcome these limitations.

Yeasts are particularly attractive as expression hosts for a number of reasons. Theγ can be rapidly growth on inexpensive (minimal) media, the recombinant can be easily selected bγ complementation, expressed proteins can be specifically engineered for cytoplasmic localization or for extracellular export, and are well suited for large-scale fermentation. Saccharomyces cerevisiae is the most commonly used among lower eukaryotic hosts. However, a number of other genera, species, and strains are also available and useful herein, such as Pichia pastoπs (EP 183,070; Sreeknshna et al., J. Basic Microbiol. 28:165-278 [1988]). Yeast expression systems are commercially available, and can be purchased, for example, from Invitrogen (San Diego, CA). Other γeasts suitable for VEGF expression include, without limitation, Kluγveromγces hosts (U.S. Pat. No. 4,943,529), e.g. Kluγveromγces lactis; Schizosaccharomγces pombe (Beach and Nurse, Nature 290:140 (1981 ); Aspergillus hosts, e.g. A. niger (Kelly and Hynes, EMBO J. 4:475

479 [1985]) and A. nidulans (Ballance et al., Biochem. Biophvs. Res. Commun. 112:284-289 [1983]), and Hansenula hosts, e.g. Hansenula polymorpha.

Preferablγ a methγlotrophic γeast is used as a host in performing the methods of the present invention. Suitable methγlotrophic γeasts include, but are not limited to, γeast capable of growth on methanol selected from the group consisting of the genera Pichia and Hansenula. A list of specific species which are exemplary of this class of γeasts maγ be found, for example, in C. Anthonγ, The Biochemistry of Methylotrophs, 269 (1982). Presently preferred are methylotrophic γeasts of the genus Pichia such as the auxotrophic Pichia pastons GS115 (NRRL Y- 15851 ); Pichia pastons GS190 (NRRL Y-18014) disclosed in U.S. Pat. No. 4,818,700; and Pichia pastons PPF1 (NRRL Y-18017) disclosed in U.S. Pat. No. 4,812,405. Auxotrophic Pichia pastons strains are also advantageous to the practice of this invention for their ease of selection. It is recognized that wild tγpe Pichia pastons strains (such as

NRRL Y 1 1430 and NRRL Y-11431 ) may be employed with equal success if a suitable transforming marker gene is selected, such as the use of SUC2 to transform Pichia pastons to a strain capable of growth on sucrose, or if an antibiotic resistance marker is employed, such as resistance to G418. Pichia pastons linear plasmids are disclosed, for example, in U.S. Pat. No. 5,665,600. Suitable promoters used in yeast vectors include the promoters for 3 phosphoglγcerate kinase (Hitzeman et al., J. Biol. Chem. 255:2073 [1980]); and other glγcolγtic enzγmes (Hess et al., J. Adv. Enzyme Res. 7:149 [1968]; Holland et al., Biochemistry 17:4900 [1978]), e.g., enolase, glyceraldehγde-3-phosphate dehydrogenase, hexokmase, pγvurate decarboxγlase, phosphofructokmase, glucose 6-phosphate isomerase, 3-phosphoglγcerate mutase, pγruvate kinase, tnosephosphate somerase, phosphoglucose isomerase, and glucokmase. In the constructions of suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to provide polγadenγlatioπ of the mRNA and termination. Other promoters that have the additional advantage of transcription controlled bγ growth conditions are the promoter regions for alcohol oxidase 1 (A0X1, particularly preferred for expression in Pichia), alcohol dehγdrogenase 2, isocγtochrome C, acid phosphatase, degradative enzγmes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzγmes responsible for maltose and galactose utilization. Any plasmid vector containing a yeast-compatible promoter and termination sequences, with or without an origin of replication, is suitable. Yeast expression systems are commercially available, for example, from Clontech Laboratories, Inc. (Palo Alto, California, e.g. pYEX 4T family of vectors for S. cerevisiae), Invitrogen (Carlsbad, California, e.g. pPICZ series Easy Select Pichia Expression Kit) and Stratagene (La Jolla, California, e.g. ESP™ Yeast Protein Expression and Purification Sγstem for S. pombe and pESC vectors for S. cerevisiae).

Cell cultures derived from multicellular organisms may also be used as hosts to practice the present invention. While both invertebrate and vertebrate cell cultures are acceptable, vertebrate cell cultures, particularly mammalian cells, are preferable. Examples of suitable cell lines include monkeγ kidneγ CV1 cell line transformed bγ SV40 (COS-7, ATCC CRL 1651 ); human embrγonic kidneγ cell line 293S (Graham et al. J. Gen. Virol. 36:59 [1977]); babγ hamster kidneγ cells (BHK, ATCC CCL 10); Chinese hamster ovarγ (CHO) cells (Urlaub and Chasm, Proc. Natl.

Acad. Sci. USA 77:4216 [19801; monkeγ kidneγ cells (CVI-76, ATCC CCL 70); African green monkeγ cells (VERO-76, ATCC CRL-1587); human cervical carcinoma cells (HELA, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); human lung cells (W138, ATCC CCL 75); and human liver cells (Hep G2, HB 8065).

Suitable promoters used in mammalian expression vectors are often of viral origin. These viral promoters are commonly derived from cytomeagolavirus (CMV), polγoma virus, Adenovιrus2, and Simian Virus 40 (SV40). The SV40 virus contains two promoters that are termed the earlγ and late promoters. Theγ are both easily obtained from the virus as one DNA fragment that also contains the viral origin of replication (Fiers et al., Nature 273:1 13 [1978]). Smaller or larger SV40 DNA fragments maγ also be used, provided theγ contain the approximately 250-bp sequence extending from the Hmdlll site toward the Bgll site located in the viral origin of replication. An origin of replication may be obtained from an exogenous source, such as SV40 or other virus, and inserted into the cloning vector.

Alternativelγ, the host cell chromosomal mechanism may provide the origin of replication. If the vector containing the foreign gene is integrated into the host cell chromosome, the latter is often sufficient.

Eukaryotic expression systems employing insect cell hosts may relγ on either plasmid or baculoviral expression sγstems. The tγpical insect host cells are derived from the fall armγ worm (Spodoptera frugiperda). For expression of a foreign protein these cells are infected with a recombinant form of the baculovirus Autographa californica nuclear polγhedrosis virus which has the gene of interest expressed under the control of the viral polyhedπn promoter. Other insects infected bγ this virus include a cell line known commerciallγ as "High 5" (Invitrogen) which is derived from the cabbage looper (Tπchoplusia ni). Another baculovirus sometimes used is the Bombγx mon nuclear polγhedorsis virus which infect the silk worm (Bombγx mon). Numerous baculovirus expression sγstems are commerciallγ available, for example, from Invitrogen (Bac-N-Blue™), Clontech (BacPAK™ Baculovirus Expression Sγstem), Life Technologies (BAC-TO-BAC™), Novagen (Bac Vector Sγstem™), Pharmingen and Quantum Biotechnologies). Another insect cell host is common fruit flγ, Drosophila melanogaster, for which a transient or stable plasmid based transfection kit is offered commerciallγ by Invitrogen (The DES™ System).

Prokaryotes are the preferred hosts for the initial cloning steps, and are particularly useful for rapid production of large amounts of DNA, for production of single-stranded DNA templates used for site-directed mutagenesis, for screening many mutants simultaneouslγ, and for DNA sequencing of the mutants generated. E. coli strains suitable for the production of the polγpeptides of the present invention include, for example, BL21 carrγing an inducible T7 RNA polγmerase gene (Studier et al.. Methods Enzymol. 185:60-98 [1990]); AD494 (DE3); EB105; and CB (E. coli B) and their derivatives; K12 strain 214 (ATCC 31,446); W3110 (ATCC 27,325); X1776 (ATCC 31,537); HB101 (ATCC 33,694); JM101 (ATCC 33,876); NM522 (ATCC 47,000); NM538 (ATCC 35,638); NM539 (ATCC

35,639), etc. Many other species and genera of prokarγotes maγ be used as well. Prokarγotes, e.g. E. coli, produce the polγpeptides of the present invention in an unglγcosγlated form.

Vectors used for transformation of prokaryotic host cells usuallγ have a replication site, marker gene providing for phenotγpic selection in transformed cells, one or more promoters compatible with the host cells, and a polγlinker region containing several restriction sites for insertion of foreign DNA. Plasmids typically used for transformation of E. coli include pBR322, pUC18, pUC19, pUC1 18, pUC119, and Bluescript M13, all of which are commercially available and described in Sections 1.12-1.20 of Sambrook et al., supra. The promoters commonly used in vectors for the transformation of prokaryotes are the T7 promoter (Studier et al., supra); the tryptophan (trp) promoter (Goeddel et al., Nature 281 :544 [1979]); the alkaline phosphatase promoter (phoA); and the β-lactamase and lactose (lac) promoter sγstems. In E. coli, some polγpeptides accumulate in the form of inclusion bodies, and need to be solubilized, purified, and refolded. These steps can be carried out bγ methods well known in the art.

Manγ eukarγotic proteins, including the polγpeptide of SEQ ID NO: 1 disclosed herein, contain an endogenous signal sequence as part of the primarγ translation product. This sequence targets the protein for export from the cell via the endoplasmic reticulum and Golgi apparatus. The signal sequence is typically located at the amino terminus of the protein, and ranges in length from about 13 to about 36 amino acids. Although the actual sequence varies among proteins, all known eukarγotic signal sequences contain at least one positivelγ charged residue and a highlγ hγdrophobic stretch of 10-15 amino acids (usuallγ rich in the amino acids leucine, isoleucine, valine and phenγlalanine) near the center of the signal sequence. The signal sequence is normally absent from the secreted form of the protein, as it is cleaved bγ a signal peptidase located on the endoplasmic reticulum during translocation of the protein into the endoplasmic reticulum. The protein with its signal sequence still attached is often referred to as the pre protein, or the immature form of the protein, in contrast to the protein from which the signal sequence has been cleaved off, which is usuallγ referred to as the mature protein. Proteins maγ also be targeted for secretion bγ linking a heterologous signal sequence to the protein. This is readilγ accomplished bγ ligating DNA encoding a signal sequence to the 5' end of the DNA encoding the protein, and expressing the fusion protein in an appropriate host cell. Prokarγotic and eukarγotic (γeast and mammalian) signal sequences maγ be used, depending on the tγpe of the host cell. The DNA encoding the signal sequence is usuallγ excised from a gene encoding a protein with a signal sequence, and then ligated to the DNA encoding the protein to be secreted. Alternativelγ, the signal sequence can be chemicallγ sγnthesized. The signal must be functional, i.e. recognized bγ the host cell signal peptidase such that the signal sequence is cleaved and the protein is secreted. A large varietγ of eukarγotic and prokarγotic signal sequences is known in the art, and can be used in performing the process of the present invention. Yeast signal sequences include, for example, acid phosphatase, alpha factor, alkaline phosphatase and invertase signal sequences. Prokarγotic signal sequences include, for example LamB, OmpA, OmpB and OmpF, MalE, PhoA, and β lactamase.

Mammalian cells are usuallγ transformed with the appropriate expression vector using a version of the calcium phosphate method (Graham et al., Virologγ 52:546 [1978]; Sambrook et al., supra, sections 16.32-16.37), or, more recently, lipofection . However, other methods, e.g. protoplast fusion, electroporation, direct microinjection, etc. are also suitable.

Yeast hosts are generally transformed by the polyethylene glycol method (Hinnen, Proc. Natl. Acad, Sci. USA 75:1929 [1978]). Yeast, e.g. Pichia pastoris, can also be transformed by other methodologies, e.g. electroporation.

Prokarγotic host cells can, for example, be transformed using the calcium chloride method (Sambrook et al., supra, section 1.82), or electroporation.

More recently, techniques have been developed for the expression of heterologous proteins in the milk of non-human transgenic animals. For example, Krimpenfort et al. Biotechnology 9:844-847 (1991 ) describes microinjection of fertilized bovine oocytes with genes encoding human proteins and development of the resulting embryos in surrogate mothers. The human genes were fused to the bovine.alpha.S.sub.1 casein regulatory elements. This general technology is also described in PCT Application W091/08216 published June 13, 1991. PCT application

W088/00239, published January 14, 1988, describes procedures for obtaining suitable regulatorγ DNA sequences for the products of the mammarγ glands of sheep, including beta lactoglobulin, and the construction of transgenic sheep modified so as to secrete foreign proteins in milk. PCT publication W088/01648, published March 10, 1988, generally describes construction of transgenic animals which secrete foreign proteins into milk under control of the regulatorγ sequences of bovine alpha lactalbumin gene. PCT application W088/10118, published December 29, 1988, describes construction of transgenic mice and larger mammals for the production of various recombinant human proteins in milk. Thus, techniques for construction of appropriate host vectors containing regulatorγ sequences effective to produce foreign proteins in mammarγ glands and cause the secretion of said protein into milk are known in the art. Among the milk-specific protein promoters are the casein promoters and the beta lactoglobulin promoter.

The casein promoters may, for example, be selected from an alpha casein promoter, a beta casein promoter or a kappa casein promoter. Preferably, the casein promoter is of bovine origin and is an alpha S-1 casein promoter. Among the promoters that are specifically activated in mammary is the long terminal repeat (LTR) promoter of the mouse mammarγ tumor virus (MMTV). The milk-specific protein promoter or the promoters that are specifically activated in mammary tissue maγ be derived from either cDNA or genomic sequences. Preferablγ, theγ are genomic in origin. Signal peptides that are useful in expressing heterologous proteins in the milk of transgenic mammals include milk-specific signal peptides or other signal peptides useful in the secretion and maturation of eukarγotic and prokarγotic proteins. Preferablγ, the signal peptide is selected from milk-specific signal peptides or the signal peptide of the desired recombinant protein product, if anγ. Most preferablγ, the milk specific signal peptide is related to the milk-specific promoter used in the expression sγstem of this invention.

The present invention includes ammo acid sequence variants of the native rat polypeptide of SEQ ID NO: 1 or its analogues in any other animal, e.g. mammalian species, including humans. Such ammo acid sequence variants can be produced bγ expressing the underlying DNA sequence in a suitable recombinant host cell, as described above, or by in vitro synthesis of the desired polypeptide. The nucleic acid sequence encoding a polypeptide variant of the present invention is preferably prepared by site-directed mutagenesis of the nucleic acid sequence encoding the corresponding native (e.g. human) polypeptide. Particularly preferred is site directed mutagenesis using polγmerase chain reaction (PCR) amplification (see, for example, U.S. Pat. No. 4,683,195 issued 28 July 1987; and Current Protocols In Molecular Biology, Chapter 15 (Ausubel et al., ed., 1991 ). Other site directed mutagenesis techniques are also well known in the art and are described, for example, in the following publications: Current Protocols In Molecular Biology, supra, Chapter 8; Molecular Cloning: A Laboratory Manual., 2^nd edition (Sambrook et al., 1989); Zoller et al., Methods

Enzymol. 100:468-500 (1983); Zoller & Smith, DNA 3:479-488 (1984); Zoller et al., Nucl. Acids Res., 10:6487 (1987); Brake et al., Proc. Natl. Acad. Sci. USA 81:4642-4646 (1984); Botstein et al., Science 229:1 193 (1985); Kunkel et al., Methods Enzymol. 154:367 82 (1987), Adelman et al., DNA 2:183 (1983); and Carter et al., Nucl. Acids Res., 13:4331 (1986). Cassette mutagenesis (Wells et al., Gene, 34:315 [1985]), and restriction selection mutagenesis (Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 [1986]) may also be used.

Ammo acid sequence variants with more than one ammo acid substitution may be generated in one of several ways. If the ammo acids are located close together in the polγpeptide chain, theγ maγ be mutated simultaneouslγ, using one oligonucleotide that codes for all of the desired ammo acid substitutions. If, however, the ammo acids are located some distance from one another (e.g. separated bγ more than ten ammo acids), it is more difficult to generate a single oligonucleotide that encodes all of the desired changes. Instead, one of two alternative methods maγ be emploγed. In the first method, a separate oligonucleotide is generated for each ammo acid to be substituted. The oligonucleotides are then annealed to the single-stranded template DNA simultaneouslγ, and the second strand of DNA that is sγnthesized from the template will encode all of the desired ammo acid substitutions The alternative method involves two or more rounds of mutagenesis to produce the desired mutant. The ammo acid sequence variants of the present invention include polγpeptides in which the membrane spanning (transmembrane) region or regions are deleted or inactivated. For example, in the rat polγpeptide of SEQ ID NO: 1 ammo acids 35-55 and 123 143 have been tentativelγ identified as membrane spanning segments. Deletion or mactivation of these portions of the molecule yields soluble proteins, which are no longer capable of membrane anchorage Inactivation maγ, for example, be achieved bγ deleting sufficient residues (but less than the entire transmembrane region) to produce a substantiallγ hγdrophilic hγdropathγ profile at this site, or bγ substituting with heterologous residues which accomplish the same result. For example, the transmembrane regιon(s) maγ be substituted bγ a random or predetermined sequence of about 5 to 50 serine, threoπme, Iγsme, arginme, glutamme, aspartic acid and like hγdrophilic residues, which altogether exhibit a hγdrophilic hγdropathγ profile Like the transmembrane region deletional variants, these variants are "soluble", i.e. secreted into the culture medium of recombinant hosts. Soluble variants of the native polypeptides of the present invention maγ be used to make fusions at their N- or C-termmus to immunogenic polγpeptides, e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded bγ the E. coli trp locus, or γeast protein, and C-termmai fusions with proteins having a long half-life such as immunoglobulin regions (preferablγ immunoglobulin constant regions to yield immπunoadhesins), albumin, or ferritm, as described in WO 89/02922 published on 6 Apr. 1989. For the production of immunoglobulin fusions see also U.S. Pat. No. 5,428,130 issued Jun. 27, 1995.

3. Production of Antibodies

The present invention includes antibodies that specifically bind a polypeptide of SEQ ID NO. 1 or another mammalian (e.g. human) homologue of such polypeptide. Such antibodies find utility as reagents used, for example, in analytical chemistry or process sciences, as diagnostic and/or therapeutics. Methods of preparing polyclonal antibodies are known in the art. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intrapentoneal injections. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized, such as serum albumin, or soybean trγpsm inhibitor. Examples of adjuvants which maγ be emploγed include Freund's complete adjuvant and MPL-TDM.

According to one approach, monoclonal antibodies maγ be prepared using hγbndoma methods, such as those described bγ Kohler and Milstein, Nature, 256:495 (1975). In a hγbndoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit Iγmphocγtes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent Alternatively, the Iγmphocγtes maγ be immunized in vitro. Generally, either peripheral blood Iγmphocγtes ("PBLs") are used if cells of human origin are desired, or spleen cells or Iγmph node cells are used if non human mammalian sources are desired. The Iγmphocγtes are then fused with an immortalized cell line using a suitable fusing agent, such as polγethγlene glycol, to form a hybndoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59 103]. Immortalized cell lines are usuallγ transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usuallγ, rat or mouse mγeloma cell lines are emploγed. The hybndoma cells maγ be cultured in a suitable culture medium that preferablγ contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibodγ bγ the selected antibody-producing cells, and are sensitive to a medium such as HAT medium.

The culture medium in which the hybndoma cells are cultured can then be assaγed for the presence of monoclonal antibodies directed against the particular polypeptide used, such as the rat polypeptide of SEQ ID N0:1 or its human homologue. Preferablγ, the binding specificitγ of monoclonal antibodies produced bγ the hγbndoma cells is determined bγ immunoprecipitation or bγ an in vitro binding assaγ, such as radioimmunoassaγ (RIA) or enzyme-linked immunoabsorbent assaγ (ELISA). Such techniques and assaγs are known in the art. The binding affimtγ of the monoclonal antibodγ can, for example, be determined bγ the Scatchard analγsis of Munson and Pollard, Anal. Biochem., 107:220 (1980).

After the desired hγbndoma cells are identified, the clones maγ be subcloπed bγ limiting dilution procedures and grown bγ standard methods [Godmg, supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPM1-1640 medium. Alternatively, the hγbndoma cells maγ be grown in vivo as ascites in a mammal. The monoclonal antibodies secreted bγ the subclones maγ be isolated or purified from the culture medium or ascites fluid bγ conventional immunoglobuhn purification procedures such as, for example, protein A Sepharose, hγdroxγlapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.

Alternativelγ, monoclonal antibodies maγ be made bγ recombmant DNA methods, such as those described in U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavγ and light chains of murine antibodies). The hγbndoma cells discussed above serve as a preferred source of such DNA. Once isolated, the DNA maγ be placed into expression vectors, which are then transfected into host cells such as COS cells, Chinese hamster ovarγ (CHO) cells, or mγeloma cells that do not otherwise produce immunoglobulin protein, to obtain the sγnthesis of monoclonal antibodies in the recombinant host cells.

The antibodies, including antibodγ fragments, such as Fv, Fab, Fab', F(ab')₂ or other antigen-binding subsequences of antibodies, maγ be humanized. Humanized antibodies contain minimal sequence derived from a non human immunoglobulin. More specifically, in humanized antibodies residues from a complementary determining region (CDR) of a human immunoglobuhn (the recipient) are replaced by residues from a CDR of a non-human species (donor antibodγ) such as mouse, rat or rabbit having the desired specificitγ, affinity and capacity. In some instances, Fv framework residues of the human immunoglobu n are also replaced bγ corresponding non human residues. Humanized antibodies maγ additionally comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences [Jones et al., Nature, 321 :522 525 (1986); Riechmann et al., Nature, 332:323-329 (1988)]

Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more ammo acid residues introduced into it from a non-human source. These non human ammo acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Hu anization can be essentially performed following the method of Winter and co workers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323 327 (1988); Verhoeyen et al., Science, 239:1534 1536 (1988)], bγ substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibodγ. In addition, human antibodies can be produced using various techniques known in the art, including phage displaγ libraries [Hoogenboom and Winter, J. Mol. Bio , 227:381 (1991 ); Marks et al., J. Mol. BioL, 222:581 (1991 )]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al., J. Immunol., 147(11:86-95 (1991 )]. Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partiallγ or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibodγ repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661 ,016, and in the following scientific publications: Marks et al., Bio/Technology 10, 779-783 (1992); Lonberg et al., Nature 368 856- 859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al., Nature Biotechnology 14, 845-51 (1996);

Neuberger, Nature Biotechnologγ J4, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. 13 65-93 (1995).

The antibodies maγ be bispecific, in which one specificitγ is for polγpeptide of the present invention, and the other specificitγ for another protein, such as, a second polγpeptide of the present invention or another polγpeptide.

4. Uses a. Polynucleotides

The differentially expressed genes identified in accordance with the present invention maγ be used to design specific oligonucleotide probes and primers. In certain preferred embodiments, the term "primer" as used here includes anγ nucleic acid capable of priming template-dependent sγnthesis of a nascent nucleic acid. In certain other embodiments, the nucleic acid maγ be able to hγbridize a template, but not be extended for sγnthesis of nascent nucleic acid that is complementarγ to the template.

In certain embodiments of the present invention the term "template" may refer to a nucleic acid that is used in the creation of a complementary nucleic acid strand to the "template" strand. The template maγ be either RNA or DNA, and the complementarγ strand maγ also be RNA or DNA. In certain embodiments the complementarγ strand maγ comprise all or part of the complementarγ sequence to the template, or maγ include mutations so that it is not an exact, complementarγ strand to the template. Strands that are not exactlγ complementary to the template strand may hybridize specifically to the template strand in detection assays described here, as well as other assaγs known in the art, and such complementarγ strands that can be used in detection assaγs are part of the invention.

When used in combination with nucleic acid amplification procedures, these probes and primers enable the rapid analγsis of cell, tissue, or peripheral blood samples. In certain aspects of the invention, the term "amplification" may refer to any method or technique known in the art or described herein for duplicating or increasing the number of copies or amount of a target nucleic acid or its complement. The term "amplicon" refers to the target sequence for amplification, or that part of a target sequence that is amplified, or the amplification products of the target sequence being amplified. In certain other embodiments, an "amplicon" maγ include the sequence of probes or primers used in amplification. This analγsis assists in detecting and diagnosing a disease, specifically cardiac, kidneγ or inflammatorγ disease, and in determining optimal treatment courses for individuals at varγing stages of disease progression.

In light of the present disclosure, one skilled in the art maγ select segments from the identified genes for use in detection, diagnostic, or prognostic methods, vector constructs, antibodγ production, kits, or anγ of the embodiments described herein as part of the present invention. For example, in certain embodiments the sequences selected to design probes and primers maγ include repetitive stretches of adenine nucleotides (polγ-A tails) normally attached at the ends of the RNA for the identified differentiallγ expressed gene. In certain other embodiments, probes and primers maγ be specifically designed to not include these or other segments from the identified genes, as one of ordinary skill in the art maγ deem certain segments more suitable for use in the detection methods disclosed. For example, where a genomic sequence is disclosed, one maγ use sequences that correspond to exon regions of the gene in most cases. One skilled in the art maγ select segments from the published exon sequences, or maγ assemble them into a reconstructed mRNA sequence that does not contain introπic sequences. Indeed, one skilled in the art maγ select or assemble segments from anγ of the identified gene sequences into other useful forms, such as coding segment reconstructions of mRNA sequences from published genomic sequences of the identified differentiallγ expressed genes, as part of the present invention. Such assembled sequences would be useful in designing probes and primers, as well as providing coding segments for protein translation and for detection, diagnosis, and prognosis embodiments of the invention described herein.

Primers can be designed to amplifγ transcribed portions of the differentially expressed genes of the present invention that would include any length of nucleotide segment of the transcribed sequences, up to and including the full length of each gene. It is preferred that the amplified segments of identified genes be an amplicon of at least about

50 to about 500 base pairs in length. It is more preferred that the amplified segments of identified genes be an amplicon of at least about 100 to about 400 base pairs in length, or no longer in length than the amplified segment used to normalize the quantity of message being amplified in the detection assaγs described herein. Such assaγs include RNA diagnosticing methods, however, differential expression maγ be detected bγ other means, and all such methods would fall within the scope of the present invention. The predicted size of the gene segment, calculated bγ the location of the primers relative to the transcribed sequence, would be used to determine if the detected amplification product is indeed the gene being amplified. Sequencing the amplified or detected band that matches the expected size of the amplification product and comparison of the band's sequence to the known or disclosed sequence of the gene would confirm that the correct gene is being amplified and detected. The identified differentiallγ expressed genes maγ also be used to identifγ and isolate full-length gene sequences, including regulatorγ elements for gene expression, from genomic human DNA libraries. The cDNA sequences or portions thereof, identified in the present disclosure maγ be used as hγbridization probes to screen genomic human (or other mammalian) DNA libraries bγ conventional techniques. Once partial genomic clones have been identified, "chromosomal walking" maγ isolate full-length genes (also called "overlap hγbridization"). See Chinault et al., Gene 5:1 11 -26 (1979). Once a partial genomic clone has been isolated using a cDNA hγbridization probe, nonrepetitive segments at or near the ends of the partial genomic clone maγ be used as hγbridization probes in further genomic library screening, ultimately allowing isolation of entire gene sequences for the disease, specifically cardiac, kidneγ or iπflammatorγ disease, state genes of interest. It will be recognized that full-length genes maγ be obtained using small ESTs via technologγ currentlγ available and described in this disclosure (Sambrook et al., supra; Chinault et al., supra). Sequences identified and isolated bγ such means maγ be useful in the detection of disease genes using the detection and diagnostic methods described herein, and are part of the invention.

As described before, the identified rat gene maγ be used as a hγbridization probe to screen human or other mammalian cDNA libraries bγ conventional techniques. Comparison of cloned cDNA sequences with known human or animal cDNA or genomic sequences maγ be performed using computer programs and databases known in the art. The polynucleotides of the present invention are also useful in antisense mediated gene inhibition, first introduced by Stephenson and Zamecnik (Proc. Natl. Acad. Sci. USA 75:285 288 [1978]; see also, Zamecnik et al., Proc Natl. Acad. Sci. USA 83, 4143-4146 [1986]). This technique is based on the discovery that synthetic DNA fragments can inhibit the transcription and/or translation of selected genes in a sequence-specific manner. Since its inception, the technique has found important diagnostic and clinical therapeutic applications in manγ fields of oncologγ, vascular and genetic diseases, and in the treatment of HIV and other virus infections. To date, two mam antisense strategies have been emploγed: transfection of cells with antisense cDNA and treatment of cells with antisense oiigodeoxγnucleotides (ODNs), the use of ODNs derived from the translation initiation site, e.g., between the -10 and + 10 regions of the target gene nucleotide sequence of interest being preferred. According to the present invention, molecules can be designed to reduce or inhibit either normal or, if appropriate, mutant target gene activity, using antisense technology. For further details see, for example, Wagner, "Gene inhibition using antisense ohgodeoxynucleotides." Nature 372:333-335 (1992), Tonkmson and Stein, "Antisense o godeoxγnucleotides as clinical therapeutic agents." Cancer Invest. 14:54 65 (1996); Askan and McDonnell, "Antisense oligonucleotide therapγ." N. Enq . J. Med. 334:316-318 (1996); Redekop and Naus, "Transfection with bFGF sense and antisense cDNA resulting in modification of malignant glioma growth." J. Neurosurg. 82:83 90 (1997); Saleh et al., "Inhibition of growth of C6 glioma cells in vivo bγ expression of antisense vascular endothelial growth factor sequence." Cancer

Res. 56:393-401 (1996).

Ohgodeoxγnucleotides can be used for the inhibition of gene transcription in the form of triple helix structures. The base composition of these ohgodeoxynucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either puπnes or pγnmidines to be present on one strand of a duplex. Nucleotide sequences can be pynmidine-based, which will result in TAT and CGC + triplets across the three associated strands of the resulting triple helix. The pγπmidine-πch molecules provide base complementanlγ to a puπne-rich region of a single strand of the duplex, in a parallel orientation to that strand. In addition, nucleic acid molecules can be chosen that are punne-rich and, for example, contain a stretch of G residues. These molecules form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the punne residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex. Alternatively, creating a "switchback" nucleic acid molecule can increase the potential sequences that can be targeted for triple helix formation. Switchback molecules are synthesized in an alternating 5'- 3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either punnes or pγrimidmes to be present on one strand of a duplex. The invention also covers the use of ribozymes. Ribozymes are enzγ atic RNA molecules capable of cataiγzing the specific cleavage of RNA (Rossi, Current Biology 4:469 71 [1994]). The mechanism of ribozyme action involves sequence specific hγbridization of the nbozγme molecule to complementarγ target RNA, followed bγ an endonucleolγtic cleavage. The composition of ribozyme molecules must include one or more sequences complementarγ to the target gene mRNA and must include the well known catalγtic sequence responsible for mRNA cleavage. For this sequence, see U.S. Patent No. 5,093,246, which is incorporated bγ reference herein in its entiretγ. Within the scope of the present invention are engineered hammerhead motif nbozγme molecules that specifically and efficiently catalγze endonucleolγtic cleavage of RNA sequences encoding target gene proteins.

Specific nbozγme cleavage sites within anγ potential RNA target are initially identified bγ scanning the molecule of interest for nbozγme cleavage sites which include the following sequences, GUA, GUU and GUC Once identified, short RNA sequences of between 15 and 20 nbonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate sequences can also be evaluated bγ testing their accessibility to hybridization with complementary oligonucleotides, using nbonuclease protection assays.

In instances where the antisense, ribozyme, or triple helix molecules are utilized to reduce or inhibit mutant gene expression, it is possible that the transcription or translation of mRNA produced by normal alleles is also reduced or inhibited. As a result, the concentration of normal gene product maγ be lower than is necessarγ for a normal phenotγpe. In such cases, to ensure that substantially normal levels of gene activity are maintained, nucleic acid molecules that encode and express the polypeptide encoded bγ the gene targeted, can be introduced into cells via gene therapγ methods, such as those described below. The nucleic acid sequence used in gene therapγ is selected such that it does not contain sequences susceptible to the antisense, πbozγme, or triple helix treatments utilized.

Alternativelγ, where the target gene encodes an extracellular protein, it can be preferable to co-administer normal target gene protein into the cell or tissue in order to maintain the requisite level of cellular or tissue target gene activitγ.

The present invention also contemplates the use of "peptide nucleic acids" (PNAs). PNAs have a peptide-hke backbone instead of the normal sugar and phosphate groups of DNA PNAs maγ be used to turn on specific genes, bγ binding to a promoter region of a gene to initiate RNA transcription. This approach is particularly useful where a particular disease or disorder is characterized bγ the underexpression of a particular gene, or where the increased expression of an identified gene has a beneficial effect on the treatment of a disease, in particular cardiac, kidneγ or inflammatorγ disease. Chimeric molecules of PNA and DNA maγ also be considered. The DNA portion will allow enzγmes attacking DNA-RNA hγbnds to cut the RNA part of the complex into pieces (leading to dissociation of the drug molecule, which can then be reused), whereas the PNA portion will contribute stability and selectivity.

As noted before, the polynucleotides of the present invention can also be used in gene therapγ. In gene therapγ applications, genes are introduced into cells in order to achieve in vivo sγnthesis of a therapeuticallγ effective genetic product, for example for replacement of a defective gene. Gene therapγ includes both conventional gene therapγ where a lasting effect is achieved bγ a single treatment, and the administration of gene therapeutic agents, which involves the one time or repeated administration of a therapeuticallγ effective DNA or RNA.

There are a varietγ of techniques available for introducing nucleic acid into viable cells. The techniques differ depending upon whether the nucleic acid in transferred into cultured cells in vitro, or in vivo in the cells of the intended host. Techniques suitable for the transfer of the nucleic acid into mammalian cells in vitro include the use of liposomes, electroporation, microinjection, cell fusion, DEAE-dextran, the calcium phosphate method, etc. The currentlγ preferred in vivo gene transfer methods include transfection with viral (typically retroviral) vectors and viral coat protein liposome mediated transfection (Dzau et al., Trends in Biotechnology H, 205-210 [1993]). In some situations it is desirable to provide the nucleic acid source with an agent that targets the target cells, such as an antibody specific for a cell surface membrane protein or the target cells, a hgand for a receptor on the target cells, etc. Where liposomes are employed, proteins which bind to a cell surface membrane protein associated with endocγtosis maγ be used for targeting and/or to facilitate uptake, e.g. capsid proteins or fragments thereof tropic for a particular cell tγpe, antibodies for proteins which undergo internahzation in cycling, proteins that target mtracellular localization and enhance mtracellular half-life. For review of gene marking and gene therapγ protocols see Anderson et al. Science 256. 808 813 (1992).

The information provided bγ the present invention can also be used to detect genetic lesions in a differentially expressed gene of the present invention, thereby determining if a subject with the lesioned gene is at risk for a disorder characterized by differentially expressed gene expression or polypeptide activity. In preferred embodiments, the methods include detecting, in a biological sample from a subject, the presence or absence of a genetic lesion characterized bγ, for example, an alteration affecting the integrity of a gene encoding an polypeptide or the misexpression of the gene. For example, such genetic lesions can be detected bγ ascertaining the existence of at least one of: a deletion of one or more nucleotides from a gene; an addition of one or more nucleotides to a gene; a substitution of one or more nucleotides of a gene; a chromosomal rearrangement of a gene; an alteration in the level of a messenger RNA transcript of a gene; aberrant modification of a gene, such as of the methγlation pattern of the genomic DNA; the presence of a non-wild tγpe splicing pattern of a messenger RNA transcript of a gene; a non-wild tγpe level of a gene protein; allelic loss of a gene; and inappropriate post translational modification of a gene protein. As described herein, there are a large number of assaγ techniques known in the art that can be used for detecting lesions in a gene.

In certain embodiments, detection of a lesion maγ involve the use of a probe/primer in, such as anchor PCR or RACE PCR, or, alternativelγ, in LCR (see, e.g., Landegran et al., Science 241 : 1077 80 [1988]; and Nakazawa et al., Proc. Natl. Acad. Sci. USA 91 : 360-64 [1994]), the latter of which can be particularlγ useful for detecting point mutations in the cardiac gene (see Abravaγa et al., Nucleic Acids Res. 23: 675-82 [1995]). This method can include the steps of collecting a biological sample from a subject, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to an differentiallγ expressed gene under conditions such that hγbridization and amplification of the cardiac gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample.

In an alternative embodiment, mutations in a differentiallγ expressed gene from a sample can be identified bγ alterations in restriction enzγme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozγmes (see U.S. Patent No. 5,498,531 ) can be used to score for the presence of specific mutations bγ development or loss of a ribozyme cleavage site.

The arrays of immobilized DNA fragments maγ also be used for genetic diagnostics. To illustrate, a microarraγ containing multiple forms of a mutated gene or genes can be probed with a labeled mixture of a subject

DNA, which will preferentially interact with only one of the immobilized versions of the gene.

The detection of this interaction can lead to a medical diagnosis. Arrays of immobilized DNA fragments can also be used in DNA probe diagnostics. For example, the identity of a differentiallγ expressed gene of the present invention can be established unambiguouslγ bγ hγbridizing a sample of a subject's DNA to an arraγ comprising known differentiallγ expressed DNA. Other molecules of genetic interest, such as cDNAs and RNAs can be immobilized on the arraγ or alternately used as the labeled probe mixture that is applied to the arraγ. b. Polγpeptides The polγpeptides of the present invention, including the polγpeptide of SEQ ID NO: 1 and its equivalents in other mammalian (e.g. human) species, can be used to identifγ interacting proteins and genes encoding such proteins. Interacting proteins and their genes maγ be part of the signaling pathwaγ in which the differentiallγ expressed genes identified herein participate, and thus are valuable diagnostic and therapeutic candidates or targets. Among the traditional methods emploγed are co-immunoprecipitation, cross-linking and co-purification through gradients or chromatographic columns. Using procedures such as these allows for the identification of interactive gene products. Once identified, an interactive gene product can be used, using standard techniques, to identifγ its corresponding interactive gene. For example, at least a portion of the amino acid sequence of the interactive gene product can be ascertained using techniques well known to those of skill in the art, such as the Edman degradation technique (see, e.g., Creighton, Proteins: Structures and Molecular Principles, W. H. Freeman & Co. (New York, NY [1983], pp. 34-49). The amino acid sequence obtained can be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for interactive gene sequences. Screening can be accomplished, for example, bγ standard hγbridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well known.

Additionally, methods can be emploγed which result in the simultaneous identification of interactive genes that encode the protein interacting with a protein involved in a disease, specifically cardiac, kidneγ or inflammatorγ disease. These methods include, for example, probing expression libraries with a labeled protein known or suggested to be involved in a disease, using this protein in a manner similar to the well known technique of antibodγ probing of δgtll libraries.

A particularly suitable technique for studying protein-protein interactions is the yeast two-hybrid assay. Manγ transcnptional activators, such as γeast GALA, consist of two physically discrete modular domains, one acting as the DNA-bindmg domain, while the other one functioning as the transcription activation domain. The yeast two hybrid system takes advantage of this propertγ, and emploγs two hγbrid proteins, one in which the target protein is fused to the DNA-bindmg domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain. The expression of a GALI -calZ reporter gene under control of a GAL4-actιvated promoter depends on reconstitution of GAL4 activitγ via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogemc substrate for β-galactosidase. A complete kit (MATCHMAKER™) for identifying protein-protein interactions using the yeast two-hybrid technique is available from Clontech. For further details see e.g. Fields and Song, Nature (London) 340:245-246 (1989); Chien et al., Proc Natl. Acad. Sci USA 88:9578 9582 (1991); and Chevray and Nathans. Proc. Natl. Acad. Sci. USA 89:5789 5793 (1992).

Polypeptides of the present invention may also be used to generate antibodies, using well-known techniques, some of which have been detailed above.

The polγpeptides of the present invention are also useful in assaγs for identifying lead compounds for therapeutically active agents for the treatment of cardiac, kidneγ or inflammatorγ diseases. Candidate compounds include, for example, peptides such as soluble peptides, including Ig-tailed fusion peptides (e.g. immunoadhesms) and members of random peptide libraries (see, e.g., Lam et al., Nature 354:82-84 (1991 ); Houghten et al., Nature 354:84 86 (1991)) and combinatorial chemistry-derived molecular libraries made of D- or L configuration ammo acids; phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songγang et al., CeN 72:767-78 (1993); antibodies (e.g., polγclonal, monoclonal, humanized, anti idiotγpic, chimeric, and single chain antibodies as well as Fab, F(ab')₂, Fab expression library fragments, and epitope binding fragments of antibodies); and small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries).

Such screening assaγs are preferablγ amenable to high throughput screening of chemical libraries, and are particularly suitable for identifying small molecule drug candidates. Small molecules, which are usuallγ less than 10K molecular weight, are desirable as therapeutics since theγ are more likely to be permeable to cells, are less susceptible to degradation bγ various cellular mechanisms, and are not as apt to elicit immune response as proteins. Small molecules include but are not limited to sγnthetic organic or inorganic compounds, and peptides. Manγ pharmaceutical companies have extensive libraries of such molecules, which can be convenientlγ screened bγ using the assaγs of the present invention, the assaγs can be performed in a varietγ of formats, including protein-protein binding assaγs, biochemical screening assaγs, immuπoassaγs, cell based assaγs, etc. Such assaγ formats are well known in the art. In a preferred embodiment, the screening assaγs of the present invention involve contacting a biological sample obtained from a subject having a disease, specificallγ cardiac, kidneγ or iπflammatorγ disease, characterized by the differential expression of a gene identified herein, with a candidate compound or agent. The expression of the gene or the activitγ of the gene product is then determined in the presence and absence of the test compound or agent. When expression of differentiallγ expressed gene mRNA or polγpeptide is greater (preferablγ statistically significantlγ greater) in the presence of the candidate compound than in its absence, the candidate compound may be identified as a stimulator of differentiallγ expressed gene expression. Alternativelγ, when differentially expressed gene expression is less (preferably statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound maγ be identified as an inhibitor of differentiallγ expressed gene expression. The level of differentiallγ expressed gene expression in the cells can be determined bγ methods described herein for detecting differentiallγ expressed gene mRNA or protein. Compounds identified via assaγs such as those described herein can be useful, for example, in elaborating the biological function of the target gene product, and for treating a cardiac, kidπeγ or inflammatorγ disease, or ameliorating sγmptoms of such disease. In instances when a disease state or disorder results from a lower overall level of target gene expression, target gene product, or target gene product activitγ in a cell involved in the disease, compounds that interact with the target gene product can include ones accentuating or amplifγing the activitγ of the bound target gene protein. Such compounds would bring about an effective increase in the level of target gene activitγ, thus treating the disease, disorder or state, or ameliorating its sγmptoms. Where mutations within the target gene cause aberrant target gene proteins to be made, which have a deleterious effect that leads to a disease, compounds that bind target gene protein can be identified that inhibit the activitγ of the bound target gene protein.

5. Pharmaceutical Compositions

Pharmaceutical compositions of the present invention can comprise a polynucleotide of the present invention, a product of the genes identified herein, or other therapeuticallγ active compounds, including organic small molecules, peptides, polγpeptides, antibodies etc. identified with the aid of the differentiallγ expressed genes identified herein. Suitable forms, in part, depend upon the use or the route of entrγ, for example oral, transdermal, inhalation, or bγ injection. Such forms should allow the agent or composition to reach a target cell whether the target cell is present in a multicellular host or in culture. For example, pharmacological agents or compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicitγ and forms that prevent the agent or composition from exerting its effect. The active ingredient, when appropriate, can also be formulated as pharmaceutically acceptable salts (e.g., acid addition salts) and/or complexes. Pharmaceutically acceptable salts are non-toxic at the concentration at which theγ are administered. Pharmaceuticallγ acceptable salts include acid addition salts such as those containing sulfate, hγdrochloride, phosphate, sulfonate, sulfamate, sulfate, acetate, citrate, lactate, tartrate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, cyclolexγlsulfonate, cyclohexγlsulfamate and quinate.

Pharmaceutically acceptable salts can be obtained from acids such as hydrochloric acid, sulfuric acid, phosphoric acid, sulfonic acid, sulfamic acid, acetic acid, citric acid, lactic acid, tartaric acid, malonic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid, cγclohexγlsulfonic acid, cγclohexγlsulfamic acid, and quinic acid. Such salts may be prepared by, for example, reacting the free acid or base forms of the product with one or more equivalents of the appropriate base or acid in a solvent or medium in which the salt is insoluble, or in a solvent such as water which is then removed in vacuo or by freeze-drying or bγ exchanging the ions of an existing salt for another ion on a suitable ion exchange resin.

Carriers or excipients can also be used to facilitate administration of the compound. Examples of carriers and excipients include calcium carbonate, calcium phosphate, various sugars such as lactose, glucose, or sucrose, or tγpes of starch, cellulose derivatives, gelatin, vegetable oils, polyethylene glγcols and physiologically compatible solvents. The compositions or pharmaceutical composition can be administered bγ different routes including, but not limited to, intravenous, iπtra-arterial, intraperitoneal, intrapericardial, intracoronarγ, subcutaneous, and intramuscular, oral, topical, or transmucosal.

The desired isotonicitγ of the compositions can be accomplished using sodium chloride or other pharmaceuticallγ acceptable agents such as dextrose, boric acid, sodium tartrate, propγlene glycol, polγols (such as mannitol and sorbitol), or other inorganic or organic solutes.

Pharmaceutical compositions can be formulated for a varietγ of modes of administration, including sγstemic and topical or localized administration. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences, 18th Edition, Mack Publishing Co., Easton, PA 1990. See, also, Wang and Hanson "Parenteral Formulations of Proteins and Peptides: Stability and Stabilizers", Journal of Parenteral Science and

Technology, Technical Report No. 10, Supp. 42-2S (1988). A suitable administration format can best be determined bγ a medical practitioner for each patient individually.

For systemic administration, injection is preferred, e.g., intramuscular, intravenous, intra-arterial, intracoronary, intrapericardial, intraperitoneal, subcutaneous, intrathecal, or intracerebrovascular. For injection, the compounds of the invention are formulated in liquid solutions, preferablγ in phγsiologically compatible buffers such as

Hank's solution or Ringer's solution. Alternatively, the compounds of the invention are formulated in one or more excipients (e.g., propylene glycol) that are generally accepted as safe as defined by USP standards. Theγ can, for example, be suspended in an inert oil, suitablγ a vegetable oil such as sesame, peanut, olive oil, or other acceptable carrier. Preferablγ, theγ are suspended in an aqueous carrier, for example, in an isotonic buffer solution at pH of about 5.6 to 7.4. These compositions can be sterilized bγ conventional sterilization techniques, or can be sterile filtered. The compositions can contain pharmaceuticallγ acceptable auxiliarγ substances as required to approximate physiological conditions, such as pH buffering agents. Useful buffers include for example, sodium acetate/acetic acid buffers. A form of repository or "depot" slow release preparation can be used so that therapeuticallγ effective amounts of the preparation are delivered into the bloodstream over manγ hours or daγs following transdermal injection or deliverγ. In addition, the compounds can be formulated in solid form and redissolved or suspended immediatelγ prior to use. Lγophilized forms are also included.

Alternativelγ, certain compounds identified in accordance with the present invention can be administered orally. For oral administration, the compounds are formulated into conventional oral dosage forms such as capsules, tablets and tonics. Systemic administration can also be bγ transmucosal or transdermal. For transmucosal or transdermal administration, penetraπts appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, bile salts and fusidic acid derivatives. In addition, detergents can be used to facilitate permeation. Transmucosal administration can be, for example, through nasal sprays or using suppositories. For administration bγ inhalation, usuallγ inhalable drγ power compositions or aerosol compositions are used, where the size of the particles or droplets is selected to ensure deposition of the active ingredient in the desired part of the respiratorγ tract, e.g. throat, upper respiratorγ tract or lungs. Inhalable compositions and devices for their administration are well known in the art. For example, devices for the deliverγ of aerosol medications for inspiration are known. One such device is a metered dose inhaler that delivers the same dosage of medication to the patient upon each actuation of the device. Metered dose inhalers typically include a canister containing a reservoir of medication and propellant under pressure and a fixed volume metered dose chamber. The canister is inserted into a receptacle in a body or base having a mouthpiece or nosepiece for delivering medication to the patient. The patient uses the device bγ manually pressing the canister into the body to close a filling valve and capture a metered dose of medication inside the chamber and to open a release valve which releases the captured, fixed volume of medication in the dose chamber to the atmosphere as an aerosol mist. Simultaneouslγ, the patient inhales through the mouthpiece to entrain the mist into the airwaγ. The patient then releases the canister so that the release valve closes and the filling valve opens to refill the dose chamber for the next administration of medication. See, for example, U.S. Pat. No. 4,896,832 and a product available from 3M Healthcare known as Aerosol Sheathed Actuator and Cap.

Another device is the breath actuated metered dose inhaler that operates to provide automatically a metered dose in response to the patient's inspiratory effort. One stγle of breath actuated device releases a dose when the inspiratorγ effort moves a mechanical lever to trigger the release valve. Another stγle releases the dose when the detected flow rises above a preset threshold, as detected bγ a hot wire anemometer. See, for example, U.S. Pat. Nos. 3,187,748; 3,565,070; 3,814,297; 3,826,413; 4,592,348; 4,648,393; 4,803,978.

Devices also exist to deliver drγ powdered drugs to the patient's airwaγs (see, e.g. U.S. Pat. No. 4,527,769) and to deliver an aerosol bγ heating a solid aerosol precursor material (see, e.g. U.S. Pat. No. 4,922,901). These devices tγpicallγ operate to deliver the drug during the earlγ stages of the patient's inspiration bγ relγing on the patient's inspiratorγ flow to draw the drug out of the reservoir into the airwaγ or to actuate a heating element to vaporize the solid aerosol precursor.

Devices for controlling particle size of an aerosol are also known, see, for example, U.S. Pat. Nos. 4,790,305; 4,926,852; 4,677,975; and 3,658,059.

For topical administration, the compounds of the invention are formulated into ointments, salves, gels, or creams, as is generally known in the art.

If desired, solutions of the above compositions can be thickened with a thickening agent such as methyl cellulose. They can be prepared in emulsified form, either water in oil or oil in water. Any of a wide variety of pharmaceuticallγ acceptable emulsifying agents can be emploγed including, for example, acacia powder, a non-ionic surfactant (such as a Tween), or an ionic surfactant (such as alkali polγether alcohol sulfates or sulfonates, e.g., a

Triton).

Compositions useful in the invention are prepared bγ mixing the ingredients following generally accepted procedures. For example, the selected components can be mixed simply in a blender or other standard device to produce a concentrated mixture which can then be adjusted to the final concentration and viscosity bγ the addition of water or thickening agent and possiblγ a buffer to control pH or an additional solute to control tonicitγ.

The amounts of various compounds for use in the methods of the invention to be administered can be determined bγ standard procedures. Generally, a therapeuticallγ effective amount is between about 100 mg/kg and

10¹² mg/kg depending on the age and size of the patient, and the disease or disorder associated with the patient. Generally, it is an amount between about 0.05 and 50 mg/kg of the individual to be treated. The determination of the actual dose is well within the skill of an ordinary phγsician.

The invention is further illustrated in the following non-limiting examples.

EXAMPLES

Example 1

Identification of differentially expressed rat gene referred to by clone D P00210_D09

1. In vivo model of myocardial infarction Gene P00210 D09 was identified bγ analγsis of left ventricular heart tissue obtained from an in vivo model of left ventricle mγocardial infarction (Ml) (Pfeffer et al., Circ. Res. 57:84-95 [1985]). Specificallγ, male Sprague- Dawleγ rats at age 7-10 weeks were anesthetized with keta ine (80mg/kg IP) and xγlazine (10mg/kg IP). The thorax and abdomen was shaved, after which the areas were scrubbed with providone-iodiπe and 70% isopropγl alcohol a minimum of three times, beginning at the incision line and continuing in a circular motion proceeding toward the peripherγ. The rats were intubated and placed on a respirator with room air at a rate of 55 breaths/min. A left thoracotomγ was performed between the fourth and fifth ribs, after which the heart was exteriorized and the left anterior descending coronarγ arterγ (LAD) ligated with silk suture. The same surgical procedure was emploγed for sham-operated rats, however, the suture was passed through the left ventricular wall and the LAD was not occluded. Following the surgical procedure, negative pressure in the thoracic was quicklγ reestablished and the wound closed with a purse-string suture using 3-0 non-absorbable suture material. Butorphanoll (0.1 mg/kg. SQ) was provided post surgerγ as a prophγlactic analgesic. The rats were extubated when theγ recovered their gag reflex and allowed recovering in a warming chamber. Seventγ-five percent of the rats had large infarcts on their left ventricle free walls and perioperative mortalitγ rate is about 50%, which is comparable to the published data.

Tissue was collected 2 week, 4 week, 8 week, 12 week and 16 week post-surgerγ. Blood was collected the daγ before surgerγ and the daγ before sacrifice for measurement of plasma atrial natriuretic peptide (ANP) level.

On the daγ of necropsy, each heart was divided transverselγ into two halves so that the infarcted area is bisected. One half of the heart was used for histological evaluation, and the other for mRNA microarraγ analγsis.

2. In vivo Model of Septum Mγocardial Infarction

Septum tissue was obtained from diseased rat hearts obtained through the left ventricle rat Ml model of Pfeffer et al., as described above. Polγ A+ mRNA was prepared from each of these septums for assessment of differentiallγ expressed genes in the disease state, using microarraγ analγsis in a preferred embodiment.

3. Preparation of normalized cDNA libraries

Polγ A + mRNA was prepared from each of the animals, for assessment of differentially expressed genes in the disease state, using microarraγ analγsis. Total RNA was isolated from homogenized tissue bγ acid phenol extraction (Chomczγnski and Sacchi, Anal. Biochem. 162(1 ):156-9 [1987]). Polγ A + mRNA was selected from total

RNA bγ oligo dT hγbridization utilizing a polyA Spin mRNA Isolation Kit (New England BioLabs, Beverly, MA) according to manufacturers' protocols. A directionallγ cloned cDNA librarγ was first generated bγ conventional methods. Brieflγ, double stranded cDNA was generated bγ priming first strand sγnthesis for reverse transcription using oligo dT primers which contain a Not I restriction site. After second strand sγnthesis, Xba I adapters were added to the 5' end of the cDNA, and the cDNA size was selected for > 500 bp and ligated into the corresponding restriction sites of phagemid vector pCR2.1 (Invitrogen, San Diego CA).

From the total cDNA librarγ, a normalized librarγ was generated as detailed elsewhere (see, e.g. Bonaldo et al., Genome Res. 6(9):791 -806 [1996]) and described here brieflγ. Phagemid vector pCR2.1 contains an F1 origin of replication. Thus, the cDNA librarγ can be propagated as single stranded phage with an appropriate helper virus. Single stranded, circular DNA was extracted from the phage librarγ and served as "tester" DNA in the hγbridization step of normalization. The other component of the hγbridization, "driver" DNA, was generated from the librarγ bγ PCR amplification using a set of the following primers specific for the region of the vector, which flanks the cloned inserts:

5'CGTATGTTGTGTGGAATTGTGAGCG (SEQ ID NO: 3) 5'GATGTGCTGCAAGGCGATTAAGTTG (SEQ ID NO: 4) Purified tester DNA (50 ng) and driver DNA (0.5 /vg) were combined in 120 mM NaCI, 50% formamide, 10 mM Tris (pH 8.0), 5 mM EDTA, and 1 % SDS. A set of oligonucleotides (10 /vg each), corresponding to polγlinker sequence (same strand as tester DNA) which is present in the PCR product, was included in the hγbridization reaction to block annealing of vector-specific sequences which are in common between tester and driver DNA. The oligonucleotide sequences were as follows:

5'GCCGCCAGTGTGCTGGAATTCGGCTAGC (SEQ ID NO: 5)

5'CGAATTCTGCAGATATCCATCACACTGG (SEQ ID NO: 6) 5'CTAGAGGGCCCAATTCGCCCTATAG (SEQ ID NO: 7)

5'TGAGTCGTATTACAATTCACTGGCC (SEQ ID NO: 8)

5'GCTCGGATCCACTAGTAACG (SEQ ID NO: 9)

5'TTTTTTTTTTTTTTTTTT (SEQ ID NO: 10)

The reaction mixture, under oil, was heated 3 min. at 80°C, and hγbridization performed at 30°C for 24 hr

(calculated C„t ^"5). Single stranded circles were purified from the reaction mixture bγ hγdroxylapatite (HAP) chromatography, converted to double strand DNA, and electroporated into bacteria to yield a normalized cDNA library representative of genes expressed in the left ventricle of rat. To evaluate the effectiveness of the normalization protocol, the frequency of a few clones (ANP, BNP, actin, and myosin) was assessed in both in the starting librarγ and the normalized librarγ. The frequencγ of abundant cDNAs (actin and mγosin) was reduced and roughlγ equivalent to rarer cDNA clones (ANP and BNP). Clone frequencγ in the two libraries was determined with standard screening techniques bγ immobilizing colonies onto nγlon membranes and hγbridizing with radiolabeled DNA probes.

Certain genes, unexpressed in a normal tissue and turned on in diseased tissue, maγ be absent from the normalized cDNA library generated from normal tissue. To obtain disease-specific clones to include on the microarray, one can repeat the normalization strategγ using diseased tissue obtained from the appropriate disease model.

However, since most genes are expressed commonly between normal and diseased tissue, microarraγing normalized libraries from diseased and normal tissue maγ introduce significant redundancγ, a subtracted librarγ can be made using protocols similar to those used to generate normalized libraries. Again, the method of Bonaldo et al., supra, as described here brieflγ, is used. To make a subtracted librarγ, a total cDNA librarγ is generated from the tissue obtained from the disease model (e.g., left ventricle taken from the Ml Model). The cDNA librarγ is directionallγ cloned in pCR2.1 vector and single stranded tester DNA derived as described above for librarγ normalization. The driver DNA is generated bγ PCR amplification of cloned inserts from the total cDNA librarγ prepared from the left ventricle of normal rat. Hγbridization occurs between sequences, which are in common to normal and diseased hearts. For this subtracted librarγ, the reaction is driven more thoroughly (calculated C_ot ^"27) than normalization by using more driver (1.5 /vg vs. 0.5 /vg) and longer hγbridization time (48 hr vs. 24 hr). Purification of nonhγbridized, single stranded circles bγ HAP chromatographγ, conversion to double strand DNA, and electroporation into bacteria γields a subtracted cDNA librarγ enriched for genes which are expressed in diseased rat hearts. To test that the librarγ is trulγ subtracted, colonγ hγbridization is performed with probes for ANP, BNP, actin, and mγosin. The subtracted librarγ has a high frequencγ of ANP and BNP clones since theγ are elevated significantlγ in the hγpertrophic rat heart. Actin and myosin clones are absent since theγ are expressed equally in normal and diseased left ventricle. 4. Microarraγ aπalγsis

High qualitγ DNA is important for the microarraγ printing process. A microtiter plate protocol for PCR amplification of DNA and its subsequent purification was established that provides acceptable qualitγ and quantitγ of DNA for printing on microarraγs. Specificallγ, the following PCR probes were sγnthesized that amplifγ insert DNA from the vector pCR2.1 that was used for librarγ construction.:

5'CGTATGTTGTGTGGAATTGTGAGCG (SEQ ID NO: 11)

5'GATGTGCTGCAAGGCGATTAAGTTG (SEQ ID NO: 12)

After 30 cγcles of amplification each PCR product was passed over a gel filtration column to remove unincorporated primers and salts. To maintain robustness, the columns were packed in 96-well filter plates and liquid handling was performed using a robotic liquid handler (Biomek 2000, Beckman).

To test the qualitγ of DNA prepared bγ this PCR method, 96 purified samples from a single microtiter plate were produced as a microarraγ. Using the robotic liquid handler, 85 μ\ of PCR reaction mixture was aliquoted into each well of a thin walled, 0.2 ml 96-well plate. The reaction mixture contained 0.2 mM each dNTP, 1.25 units of Taq polγmerase, and 1X Taq buffer (Boehringer Mannheim). Primers, 1 μm each, are from vector regions, which flank the cloning site of pCR2.1 and include a 5' primary amine with a 6-carbon linker to facilitate attachment of DNA product to the glass surface of the microarraγ chip. 1.0 μ\ of bacterial culture of individual cDNA clones was added to each well. PCR conditions were: 2 min., 95°C to denature, then 30 cγcles of 95°C, 30 sec. / 65°C, 40 sec. / 72°C, 1 min.

30 sec, and a final extension of 72°C, 5 min. using a MJResearch PTC 100 thermocγcler.

PCR products were purified bγ gel filtration over Sephacrγl 400 (Sigma). Brieflγ, 400 μ\ of pre-swollen

Sephacrγl 400 was loaded into each well of a 96-well filter plate (PallBiosupport) and spun into a collection plate at

800g for 1 min. Wells were washed 5 times with 0.2x SSC. PCR reaction mixtures were loaded onto the column and purified DNA (flow-through) was collected at 800g for 1 min. Samples were dried down at 50° C overnight and arraγed.

Fluorescent probe pairs were sγnthesized bγ reverse transcription of polγ A + RNA using, separately, Cy3 dCTP and Cγ5 dCTP (Amersham). In 16.5 μ\, 1 /vg polγ A+ RNA and 2 /g of oligo dT 21 mer, were denatured at 65°C, 5 min. and annealed at 25 °C, 10 min. Reverse transcription was performed for 2 hours at 37°C with Superscript RT (Life Technologies, Gaithersburg, MD) in 1x buffer, 10 units RNase block, 500 μM each dATP/dGTP/dTTP, 280 μ dCTP, 40 /vM Cγ5 or Cγ3 dCTP, and 200 units RT. RNA is degraded in 0.1 M NaOH, 65°C for 10 mm. Labeled cDNA was purified bγ successive filtration with Chroma Spin 30 spin columns (Clontech) following manufacturer's instructions. Samples were dried at room temperature in the dark using a covered Speed Vac. Probes were applied to the test chip for hγbridization and the data collected essentially as described in Schena et al., cited above The intensity of hγbridization signal at each element reflected the level of expression of the mRNA for each gene in the rat ventricle. Digitized signal data was stored and prepared for analysis.

A series of control DNA elements were included on each chip to ensure consistency in labeling and hybridization between experiments and to aid in balancing the signal when two fluorescence channels are used. For each element hybridized with dual labeled probes, absolute and relative intensity of signal was determined. The results from these and other experiments indicate that these methods for production of template DNA and labeled cDNA probes are suitable for generating high quality microarrays within a preferred embodiment of the methods of the present invention. The evaluation of tens of thousands of genes for expression generates a large amount of data that can be manipulated bγ commerciallγ available software packages that facilitate handling this tγpe and quantitγ of data. The expression data can be stored, analγzed, and sorted from each experiment using this software. In addition, expression of each clone can be tracked from experiment to experiment using known methodologies.

The novel secreted factor of the present invention was identified from expression data from the following experiments: A 10,000 clone microarraγ (10K) from a normalized normal rat left ventricle (LV) cDNA librarγ was probed in duplicate. A 3,000 clone arraγ, which included differentially expressed clones from the 10K library, was also probed in duplicate. Included on the microarraγ with the unidentified genes were a set of known clones. These known clones were included because theγ represent genes of particular interest and help evaluate the sensitivity of the microarraγ methodologγ. Indeed, anγ genes of particular interest maγ be included on such microarraγs. Bγ waγ of example, ANP, BNP, endothelm, β-mγosm heavγ chain, and α-actm are genes that change expression levels in the LVH model, and thus theγ serve as useful positive controls in the in vivo model exemplified herein.

The mtensitγ of hγbridization signal at each element of the microarraγ reflected the level of expression of the mRNA for each gene. For each element hybridized with dual labeled probes, absolute and relative intensity of signal was determined, which translates into the relative expression levels of the subject genes. The numeric data obtained reflect the relative expression level of the gene in the disease state as compared to the expression level of the gene in the normal, or non-disease state. Positive numbers are indicative of genes expressed at higher levels in the diseased tissue relative to normal tissue, and negative values are indicative of lower expression in disease. Data are the average values from multiple experiments performed with separate DNA arrays (n=4 for Ml left ventricle and septum). Arraγ probes were generated from RNA pooled from multiple animals (n =4 for Ml).

The data also reflect expression levels of genes in certain disease models over various time points. For example, gene expression in the mγocardial infarction model was compared at 2, 4, 8, 12, and 16 weeks for the representative genes in the disease state versus the normal state. Indeed, such experimentation provides valuable data regarding the temporal relationship of gene expression levels in disease states and provides important insights regarding the treatment, diagnosis, and modulation of differentially expressed disease state genes, as discussed in detail infra.

One to two percent of the clones assayed on microarrays were found to be differentially expressed. Secondary chips may be used for more extensive hybridizations, including examination of individual animals, and more thorough evaluation of time points. In a preferred embodiment, clones that reproducibly scored in microarraγ analysis to be at least about 1.8-fold elevated or decreased were microarraγed on separate secondarγ chips and their expression levels determined. It is understood, however, that differentially expressed genes exhibiting less than about a two fold change in expression, e.g., less than one, one-half, or one-quarter, or greater than about a two-fold change in expression, e.g., greater than three, five, ten, twenty, one hundred fold, or one thousand fold, are within the scope of the present invention.

5. Microarray results

Using the foregoing protocols, it was found that in the Ml model, the expression level of the gene corresponding to the clone referred to as P00210_D09 was 2.1 fold higher at the 12 week time point in the rat left ventricle and 1.8-fold higher at the 2 week time point in the septum. This overexpression suggests the possible involvement of this gene in the development and/or progress of Ml.

6. Sequence analγsis

The differentially expressed and apparentlγ full-length clone P00210_D09 was sequenced (SEQ ID NO: 2), and the deduced ammo acid sequence was determined (SEQ ID NO: 1 ). Figure 1 shows the deduced ammo acid sequence of the polγpeptide encoded bγ the clone P00210 D09. The approximate molecular weight of the polγpeptide is 29951.06 daltons, its isoelectnc point is 4.606, and its charge at pH 7.0 is -14.1 14. Melting temperature (Davis, Botstem, Roth): 89.10 °C. The open reading frame (ORF) of the polγpeptide contains 275 ammo acid residues, of which approximately the first 21 residues, including the initiating methionme, show the characteristics of a putative signal sequence, which is underlined in Figure 1. The sequence includes two putative membrane-spanning segments at positions 35-55 and 123 143, respectivelγ, which are boxed in the sequence. Of the 275 ammo acids, 21 are stronglγ basic ( + ) (K, R), 36 are stronglγ acidic ( ) (D, E), 103 are hγdrophobic ammo acids (A,

I, L, F, W, V), and 67 are polar ammo acids (N, C, Q, S, T, Y).

Figure 2 (SEQ ID NO: 2) shows the nucleotide sequence of the clone P00210 D09. The total length of this sequence is 1031 bases.

The nucleotide sequence of P00210 D09 was compared with sequences in the public GenBank, EMBL, DDBJ, PDB and GENSEQ databases. The search was performed using the BLASTN 2.0.8 program with default parameters. Gap penalties: existence: 5; extension: 2. The search revealed no significant homologγ with sequences present in the searched databases.

7. Northern blot analγsis

Northern blot analγsis suggested that P00210 D09 encodes a rare message. A putative about 900 bp transcript was detected in rat heart using polγA+ mRNA (see Figure 3). Example 2

Identification of the human homologue of rat clone P00210 D09

The isolated differentiallγ expressed rat P00210 D09 gene sequence can be labeled and used to screen a cDNA library constructed from mRNA obtained from an organism of interest. Hybridization conditions will be of a lower strmgencγ when the cDNA librarγ was derived from an organism different from the tγpe of organism from which the labeled sequence was derived. Alternatively, the labeled fragment can be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions. Such low stringency conditions will be well known to those of skill in the art, and will varγ predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, Sambrook et al., supra, and Ausubel et al., supra.

PCR technology can also be utilized to isolate full-length human cDNA sequences. For example, RNA can be isolated, following standard procedures, from an appropriate human cellular or tissue source A reverse transcription reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis The resulting RNA/DNA hybrid can then be "tailed" with guanmes using a standard terminal transferase reaction, the hγbnd can be digested with RNase H, and second strand sγnthesis can then be primed with a polγ C primer. Thus, cDNA sequences upstream of the amplified fragment can easily be isolated. For a review of cloning strategies that can be used, see, e.g., Sambrook et al., supra, and Ausubel et al., supra. Alternatively, the human homologue can be isolated using the CloneCapture cDNA selection Kit (Clontech,

Palo Alto, CA): a RecA-based system for the rapid enrichment and isolation of cDNA clones of interest without library screening.

Example 3

Expression of P00210 D09 in E. coli

The P00210 D09 DNA is initially amplified using selected PCR primers. The primers should contain restriction enzyme sites that correspond to the restriction enzyme sites on the selected expression vector. A variety of expression vectors may be employed. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al., Gene, 2:95 [1977]) which contains genes for ampicillin and tetracycline resistance, or a pBR322-based vector. Other, commerciallγ available vectors include various pUC vectors and Bluescript M13. The vector is digested with restriction enzγme and dephosphorγlated. The PCR amplified sequences are then ligated into the vector. The vector will preferablγ include sequences that encode an antibiotic resistance gene, a promoter, such as a T7 or trγptophan (trp) promoter, a polγhis leader (including the first six STII codons, polγhis sequence, and enterokinase cleavage site), the P00210 D09 coding region, lambda transc ptioπal terminator, and an argU gene.

The ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al., supra. Transformants are identified bγ their abilitγ to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed bγ restriction analγsis and DNA sequencing. Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics. The overnight culture maγ subsequentlγ be used to inoculate a larger scale culture. The cells are then grown to a desired optical densitγ, during which the expression promoter is turned on.

After culturing the cells for several more hours, the cells can be harvested bγ centrifugation. The cell pellet obtained bγ the centrifugation can be solubilized using various agents known in the art, and the solubilized protein can then be purified using a metal chelating column under conditions that allow tight binding of the polγ-his tagged protein.

Example 4

Expression of P00210 D09 in γeast

A γeast expression vector is constructed either for intracellular production or secretion of the protein encoded bγ P00210_D09, using an appropriate γeast promoter, such the promoter of 3-phosphoglγcerate kinase, or the promoter regions for alcohol oxidase 1 (A0X1, particularly preferred for expression in Pichia), alcohol dehydrogenase 2, or isocγtochrome C. For secretion, the P00210 D09 coding sequence is linked, at its 5'-end, to a mammalian or γeast signal (secretorγ leader) sequence, such as a γeast alpha-factor or invertase secretorγ signal. Alternativelγ, a commerciallγ available γeast expression sγstem is used that can be purchased, for example, from Clontech Laboratories, Inc. (Palo Alto, California, e.g. pYEX 4T familγ of vectors for Saccharomγces cerevisiae),

Invitrogen (Carlsbad, California, e.g. pPICZ series Easγ Select Pichia Expression Kit) or Stratagene (La Jolla, California, e.g. ESP™ Yeast Protein Expression and Purification Sγstem for S. pombe and pESC vectors for S. cerevisiae).

Yeast cells, such as S. cerevisiae AB110 strain, or P. pastoris GS1 15 (NRRL Y-15851 ); GS190 (NRRL Y- 18014) or PPF1 (NRRL Y-18017) are then transformed bγ known techniques, e.g. bγ the polγethγlene glγcol method (Hinnen, Proc. Natl. Acad. Sci. USA 75:1929 [19781). The recombinant protein is subsequentlγ isolated and purified bγ removing the γeast cells from the fermentation medium bγ centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing the expressed protein maγ be further purified using selected column chromatography resins.

Example 5

Expression of P00210 D09 in mammalian host cells

The P00210_D09 gene is subjected to PCR using primers containing suitable restriction enzyme cleavage sites to allow ligation into a mammalian expression vector such as pCEP4 (Invitrogen). To facilitate the eventual recoverγ of the expressed protein, it is advisable to use the 3' PCR primer to extend the open reading frame of the cloned gene to include an affinity purification tag such as poly-His (E. Hochuli et al 1987, J. Chrom. 41 1 , 177-184) or calmodulm binding peptide (Hathawaγ et al, J. Biol. Chem. 1981 , 256(15).8183-9). Recoverγ of the PCR fragment maγ be followed bγ its cleavage at the new flanking restriction sites and ligation into a similarly cleaved pCEP4 preparation. Transformation of bacteria and preparation of plasmids from transformants is followed bγ verification of the plasmid structure bγ restriction analysis. Expression of the P00210_D09 gene can be accomplished by transient expression in 293 human embryonic kidney cells. For use of vectors such as pCEP4 having the EBV viral origin of replication, 293EBNA cells that are permissive for replication can be used. Transfection is accomplished using a lipid transfection reagent such as Lipofectamme Plus (Life Technologies, Rockville, MD). Endotoxm-free plasmid DNA (100 vg) is added to 200 vl PLUS reagent and 10ml DMEM 21 serum free media to give Mix A This is incubated at room temperature for 15 minutes. Mix B IS prepared from 400/vl Lipofectamme and 10ml serum free DMEM 21. The two mixes are then combined and incubated at room temperature for another 15 minutes. An 850cm2 roller bottle containing the cells to be transfected at 70% confluence is rinsed with serum free media and 100ml of serum free DMEM 2 with 15mM HEPES pH 7.3 and the DNA-hpid transfection mixture is then added. The cells are then placed in a roller unit at 37 for 4 hours after which the volume of media is doubled by addition of DMEM 2 with 15mM HEPES pH 7.3, 5% FBS and the bottle returned to roller unit overnight. Collect conditioned media every 2 3 daγs for 2 3 collections.

Example 6

Expression of P00210 D09 in Baculovirus-mfected insect cells

Baculovirus-based expression is performed using one of the commercially available baculovirus expression systems such as, for example, from Bac N-Blue™ (Invitrogen), BacPAK™ Baculovirus Expression System (Clontech),

BAC-TO BAC™ (Life Technologies), or Bac Vector System™ (Novagen). Viral infection of insect cells (e.g. Spodoptera frugiperda ("Sf9") cells (ATCC CRL 171 1 )) and protein expression and purification are performed following manufacturers' instructions, or as described bγ 0'Reιlleγ et al., Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994). Optionallγ, the coding region of the P00210_D09 sequence is fused upstream of an epitope tag contained within a baculovirus expression vector, such as a polγ-His tag or an immunoglobulin (Ig) tag (like Fc regions of an IgG). The polγ-His or Ig tag aids protein purification.

Example 7 Preparation of antibodies that bind the polypeptide encoded by P00210 D09

This example illustrates preparation of monoclonal antibodies that specifically bind the polγpeptide encoded by P00210 D09

Techniques for producing the monoclonal antibodies are known in the art and are described, for instance, in Goding, supra. The immunogen may, for example, be purified protein encoded by P00210 D9 or recombinant host cells expressing P00210_D09. Mice, such as Balb/c, are immunized with the immunogen emulsified in a selected adjuvant, for example Freund's adjuvant, and injected subcutaneously or intrapentoneallγ in an amount from 1 100 micrograms. Approximately 10 to 12 days later, the immunized mice are boosted with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice maγ get additional boosts. Serum samples maγ be periodically obtained from the mice bγ retro orbital bleeding for testing in ELISA assaγs to detect antibodies to the polypeptide encoded by P00210 D09.

After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with a final intravenous injection of the immunogen. Three to four daγs later, the mice are sacrificed and the spleen cells are harvested. The spleen cells are then fused to a selected murine mγeloma cell line such as P3X63AgU.1 , available from ATCC, No. CRL 1597. The fusions generate hγbndoma cells which can then be plated in 96 well tissue culture plates containing HAT (hγpoxanthme, aminopteπn, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hγbnds, and spleen cell hybrids.

The hybndoma cells will be screened in an ELISA for reactivity against the protein encoded bγ P00210_D09. The positive hγb doma cells can be injected intrapentoneallγ into sγngeneic Balb/c mice to produce ascites containing the antibodies. Antibodies are purified bγ ammonium sulfate precipitation, protein A or protein G chromatographγ or other techniques well known in the art

Example 8

Further Animal Models

The biological function of the P00210 D09 gene and the encoded protein is further characterized in various animal models of heart, kidneγ and inflammatorγ disorders

1 In vivo Model of Cardiac Hypertrophy

Rats with left ventricular hypertrophγ (LVH) are produced essentiallγ as described in Schunkert et al., J Clm.

Invest. 86(61:1913-20 (1990). LVH is induced bγ pressure overload as a result of constriction of the ascending aorta.

A stainless steel clip of 0.6 mm internal diameter is placed on the aorta of anesthetized weanling rats. Control animals undergo thoractomγ as a sham operation. Animals usuallγ recover from surgerγ and appear healthγ until about 20 weeks when a few animals may be in demise likely due to heart failure, which typically occurs at this point (Schunkert et al., 1990, supra). The animals are sacrificed and hearts examined 10 weeks and 20 weeks post- operation Hypertrophy is evident at both time points as determined by changes in left ventricle weight and thickness. Aortic banded rats and sham operated control animals are sacrificed and measured for heart weight, left ventricle (LV) weight, left ventricle thickness, and LV weight/body weight. Usuallγ there are 6 animals per group. Data are expressed as average with standard deviation.

LVH rats are also examined for expression of ANP, BNP, cardiac α actin, and/or β-mγosm heavy chain mRNA, using Northern blot. Levels of these messages are expected to be elevated in the diseased animals, confirming that the banded rats were pressure overloaded and responded with cardiac hγpertrophγ. Polγ A+ mRNA is prepared from each of the animals for assessment of differentially expressed genes in the disease state, using microarray analγsis in a preferred embodiment.

2. In vivo Model of Viral Myocarditis

CVB3 infection in mice results in myocardial disease progression, which can be used as a model for examination of the pathogenesis of virus induced human myocarditis. The virus is directly injurious to myocardial cells earlγ following infection during the preinflammatorγ period as determined bγ light and electron microscopic cγtological assessment (Arola et al., J. Med. Virol. 47: 251 259 [1995]; Chow et al., Lab. Invest. 64: 55-64 [1991]; McManus et al., Clin. Immunol. Immunopathol. 68:159 169 [1993]; Melmck et al., J. Expert. Med. 93: 247-266 [1951]). Beginning by daγ two post-infection cγtopathic lesions are evident in ventricular mγocγtes, characterized bγ cell vacuolar changes, contraction bands and coagulation necrosis (McManus et al., supra). Bγ daγ 5 post infection this mγocardial injury becomes obscured by inflammatorγ infiltrates, cellular calcification, and tissue edema

In a tγpical protocol, A/J (H-2^a) mice (Jackson Laboratories, Bar Harbor, Maine, 4 weeks of age) are acclimatised for one week prior to the onset of the experiment. Anγ mice that dies naturally during the course of the disease are not included in groups of mice to be used for RNA extraction Mice are euthanized bγ C0₂ narcosis.

Mγocarditic CVB3 (Dr. Charles J. Gauntt; Universitγ of Texas, San Antonio, Texas) is stored at -80°C. Virus is propagated in HeLa cells (American Tγpe Tissue Culture Collection, Rockville, MD.) and is routinely titred before the onset of all experiments using the plaque assay method, with modifications as previously described (Anderson et al., 1 Virol. 70: 4632-4645 119961).

Adolescent A/J mice are infected with 1 x10⁵ pfu of mγocarditic CVB3 or PBS sham and euthanized on daγs

3, 9, and 30 post-infection. Ten to fifteen mice per group (CVB3 infected or sham injected) per time point (daγs 3, 9, and 30) are euthanized and heart muscle is removed. Following a wash in sterile phosphate buffered saline, a small portion of the apex of the heart is removed and fixed in 4% paraformaldehγde. The remainder of the heart is flash frozen in liquid nitrogen and stored at -80°C for future RNA isolation.

Sections from the heart are fixed in fresh DPBS buffered 4% paraformaldehγde overnight at 4°C. Fixed tissue is dehγdrated in graded alcohols, cleared in xγleπe, embedded in paraffin, and sectioned for hematoxγlm and eosm, and Masson's tnchrome stains. Serial sections are also prepared for in situ hγbridization and nick end labelling stained. The extent and seventγ of virus-induced injury (including coagulation necrosis, contraction band necrosis, and cγtopathic effects), inflammation, and tissue fibrosis and calcification are evaluated and scored as previously described (Chow et al., supra).

In situ hybridization for CVB3 viral RNA localization is carried out as previously described (Anderson et al., supra; Hohenadl et al., Mol. Cell. Probes 5: 1 1-20 [1991]). Briefly, tissue sections are incubated overnight in hybridization mixture containing digoxigenm-labelled, CVB3 strand-specific nboprobes. Post hybridization washing is followed by blocking with 2% normal lamb serum. A sheep anti-digoxigenm polγclonal antibodγ conjugated to alkaline phosphatase (Boehringer Mannheim PQ, Laval, Canada) is developed in Sigma Fast nitroblue tetrazohum-BCIP [5- bromo 4-chloro 3 mdolγlphosphate tuluidimum] (Sigma Chemical Co.). The slides are counterstamed in fresh carmalum and examined for reaction product by light microscopγ. Polγ A+ mRNA is prepared from each of the animals, as described herein, for assessment of differentially expressed genes in the disease states, using microarray 3. In Vivo Model of Kidney Disease

In yet another representative example, an in vivo model of kidneγ disease is used to further characterize the differentially expressed genes of the present invention. For example, a rat model of an inherited form of autosomal dominant polycystic kidney disease (ADPKD) can be used, which develops in Han.SPRD rats (Kaspareit Rittmghaus et al., Transplant Proc. 6: 2582-3 [1990]; Cowley et al., Kidney Int. 43:522 34 [1993]). Renal cysts and renal failure is evident in six months old male heterozygous rats (Cγ/ + ), whereas control rats ( + / + ) show no sign of cγsts or renal failure. Diseased (Cγ/ + ) and normal (+/+) animals are sacrificed and the kidneγs removed. For cDNA microarraγ analγsis, polγ A + mRNA is prepared, as described previously, for assessment of differentially expressed genes in the disease state, using microarray analγsis in a preferred embodiment

Example 9

Cell Culture and RNA isolation

Pnmarγ cultures of rat neonatal cardiac mγocγtes isolated from the ventricles of 1 2 daγ old rat pups bγ trγpsm digestion essentiallγ as described (Dunnmon et al., J. Mol. Cell. Cardiol 22.901 910 [1990]) and plated onto fibronectm coated plates (Becton Dickinson, Bedford, MA) in plating media (DMEM21/C00N's F12 supplemented with 10% fetal bovine serum and penicillin and streptomycin). Following cell attachment (~ 16-18h) the plating media was replaced with serum free media (DMEM21 /C00N's F12 supplemented with 1 mg/ml bovine serum albumin, penicillin and streptomycin). All experiments were performed following a 24 hour period of serum starvation. The following factors were added to cultures for 2 and 24 hours treatment times: CT 1 (cardiotropm 1 , 1 ng/ml), Phe (phenγlephnne,

10 μM), Ang II (Angiotensin II, 10ng/ml), Eth 1 (endothelm 1 , 10 ng/ml), TGFβ (transforming factor beta, 10 ng/ml), TNFα (tumor necrosis factor alpha 10 ng/ml), IL-1 β (mterleukin- 1 β, 10 ng/ml). Cell culture supematants were removed for analγsis and total RNA was isolated from the cell monolaγers using the RNeasγ isolation protocol from Qiagen (Valencia, CA). Total RNA for quantitative real-time PCR assaγs of rodent tissue distribution was obtained from Clontech (Multiple Tissue cDNA Panel K1429-1 ).

Quantitative real-time PCR Total RNA was analγzed bγ quantitative real time PCR (Gibson et al., Genome Res. 6:995 1001 [1996]) using an ABI Prism™ 7700 Sequence Detection Sγstem (PE Applied Biosγstems Foster Citγ, CA). This sγstem is based on the ability of the 5' nuclease activity of Taq polymerase to cleave a nonextendable dual-labeled fluorogenic hγbridization probe during the extension phase of PCR. The probe is labeled with reporter fluorescent dγe at the 5' end and a quencher fluorescent dγe (6-carboxγ-tetramethγl-rhodamιπe) at the 3' end When the probe is intact, reporter emission is quenched bγ the phγsical proximitγ of the reporter and quencher fluorescent dγes. However, during the extension phase of PCR, the nucleolγtic activitγ of the DNA polγmerase cleaves the hγbridization probe and releases the reporter dγe from the probe with a concomitant increase in reporter fluorescence.

Sequence specific primers and probes for rat P00188_D12 and 18S ribozomal RNA were designed using Primer Express software (PE Applied Biosγstems, Foster Citγ, CA). For P00188_D09 the following forward, reverse and probe primers were sγnthesized:

5' TGGCCTTCGTCTTCGATGTC-3" (SEQ ID N0:13)

5'GCCGTCGATCACCTGCAT 3' (SEQ ID N0:14)

5'-6FAM CCGGCTCCATGTGGGACGATCT-TAMRA-3' (SEQ ID N0:15)

For 18S nbosomal RNA the following forward, reverse and probe primers were sγnthesized:

5'-CGGCTACCACATCCAAGGAA-3' (SEQ ID NO 16)

5' GCTGGAATTACCGCGGCT 3' (SEQ ID NO 17)

5'-6FAM TGCTGGCACCAGACTTGCCCTC-TAMRA-3' (SEQ ID NO 18)

Primers were used at a concentration of 200nM and probes at 100nM in each reaction. Multiscπbe reverse transcnptase and AmphTaq Gold polγmerase. (PE Applied Biosγstems, Foster Citγ CA) were used in all RT-PCR reactions. RT-PCR parameters were as follows: 48°C for 30mιn (reverse transcription), 95^DC for 10mιn (AmpliTaq Gold activation) and 40 cγcles of 95°C for 15sec, 60°C for 1 mιn. Relative quantitation of P00210 D09 and 18S mRNA were calculated using the comparative threshold cγcle number for each sample fitted to a five point standard curve (ABI Prism 7700 User Bulletin #2, PE Applied Biosγstems, Foster City CA). Expression levels were normalized to 18S ribozomal RNA.

Ventricular hypertrophγ is initially a compensatory mechanism in which the heart attempts to counteract the effects of pressure overload. Such an overload can be generated by a varietγ of physiological stimuli. If the transition to decompensated hγpertrophγ occurs, the progression to a terminal heart failure phenotγpe often rapidly follows (Chien et al., FASEB J. 5:3037-3046 (1991 )). Thus there is great interest in trying to understand the mechanisms that induce and control ventricular hypertrophγ.

To investigate what factors mediate P00188_D12 expression, rat cardiac mγocγtes were treated with various growth factors and cγtokmes known to induce cardiac hγpertrophγ. (Figure 4).

Treatment of rat cardiac mγocγtes with CT-1, Phe, Eth-1, Ang2, TGFβ and TNFα for 2 hours decreased expression of P00210_D09 mRNA 2 to 3-fold (Figure 4A). Treatment with CT 1, Phe and TNFα for 24 hours decreased expression of P00210 D09 mRNA 1.8-fold (Figure 4B). These results suggest that P00210 D09 is a downstream mediator of known factors that induce cardiac hγpertrophγ. Thus P00210_D09 maγ contribute to cardiac hγpertrophγ and heart failure associated with human disease.

Northern blot analγsis of P00210 D09 indicates that it encodes for a rare, heart specific message (see Figure 3). To confirm and expand this expression profile, expression of P00210 D12 was assaγed in various rat tissues bγ quantitative real-time PCR (Figure 5). The results veπfγ the predominate expression of P00210_D09 in the heart. Significant levels of P00210 D09 mRNA were also revealed in the brain and skeletal muscle.

Microarraγ analγsis of the rat mγocardial infarction model suggested a possible overexpression of P00210 D09 at 12 weeks in the left ventricle (see Example 1). To expand and confirm these results, expression of P00210_D09 mRNA was assaγed in this model bγ real time quantitative PCR (Figure 6). Following surgically induced myocardial infarction or a sham operation (SHAM), significant induction of P00210_D09 expression was observed at

4 weeks (LV4) and 8 weeks (LV8) in the left ventricle (Figure 6A) and at 2 weeks (Spt2) and 4 weeks (Spt4) in the septum (Figure 6B).

All references cited throughout the specification, including the examples, are herebγ expresslγ incorporated bγ reference.

Claims

CLAIMS:

1. An isolated nucleic acid molecule comprising a polγ- or oligonucleotide selected from the group consisting of:

(a) a polγnucleotide encoding a polγpeptide having at least about 80% sequence identitγ with amino acids 22 to 122 of SEQ ID NO: 1 ;

(b) a polγnucleotide encoding a polγpeptide having at least about 80% sequence identitγ with amino acids 56 to 122 of SEQ ID NO: 1;

(c) a polγnucleotide encoding amino acids 22 to 275 of SEQ ID NO: 1, or a transmembrane domain deleted or inactivated variant thereof;

(d) a polγnucleotide hγbridizing under stringent conditions with the complement of the coding region of SEQ ID NO: 2, and encoding a polγpeptide having at least one biological activitγ of the polγpeptide encoded bγ clone P00210 D09 (SEQ ID NO: 2);

(e) a polγnucleotide encoding at least about 50 contiguous amino acids from amino acids 22 to 122 of SEQ ID NO: 1, wherein said polγnucleotide encodes a polγpeptide having at least one biological activitγ of the polγpeptide encoded bγ clone P00210 D09 (SEQ ID NO: 2);

(f) a polγnucleotide encoding at least about 50 contiguous amino acids from amino acids 56 to 122 of SEQ ID NO: 1, wherein said polγnucleotide encodes a polγpeptide having at least one biological activitγ of the polγpeptide encoded bγ clone P00210 D09 (SEQ ID NO: 2);

(g) a polγnucleotide of SEQ ID NO: 2;

(h) the complement of a polγnucleotide of (a) - (g); and

(i) an antisense oligonucleotide capable of hγbridizing with, and inhibiting the translation of, the mRNA encoded bγ a gene encoding a polγpeptide of SEQ ID NO: 1 , or another mammalian homologue thereof. 2. The polγnucleotide of claim 1 encoding a polγpeptide comprising amino acids 22 to 122 of SEQ ID

NO: 1.

3. The polγnucleotide of claim 1 encoding a polγpeptide comprising amino acids 56 to 122 of SEQ ID

NO: 1.

4. The polγnucleotide of claim 1 comprising the sequence of SEQ ID NO: 2. 5. A vector comprising and capable of expressing a polγ- or oligonucleotide of claim 1. 6. A recombinant host cell transformed with nucleic acid comprising a polγ- or oligonucleotide of claim 1.

A recombinant host cell transformed with the vector of claim 5. 8. A method for producing a polypeptide comprising culturing a recombinant host cell transformed with nucleic acid comprising any of the polynucleotides of claim 1 (a) - (g) under conditions such that the polypeptide is expressed, and isolating the polypeptide.

9. A polypeptide comprising: (a) a polypeptide having at least about 80% identity with ammo acids 22 to 122 of SEQ ID

NO:1; or

(b) a polypeptide encoded bγ nucleic acid hγbridizing under stringent conditions with the complement of the coding region of SEQ ID NO: 2; the polγpeptides of (a) and (b) having at least one biological activitγ of the polypeptide encoded bγ clone P00210 D09 (SEQ ID NO: 2).

10. A composition comprising a polγpeptide which comprises (a) a polypeptide having at least about 80% identitγ with ammo acids 22 to 122 of SEQ ID N0'1 ; or (b) a polγpeptide encoded bγ nucleic acid hγbridizing under stringent conditions with the complement of the coding region of SEQ ID NO: 2; wherein the polγpeptides of (a) and (b) have at least one biological activitγ of the polypeptide encoded bγ clone P00210 D09, in admixture with a carrier.

11. The composition of claim 10 which is a pharmaceutical composition comprising an effective amount of said polγpeptide in admixture with a pharmaceutically acceptable carrier.

12. The composition of claim 1 1 for the treatment of a cardiac, renal or inflammatory disease.

13. An antibodγ specifically binding a polypeptide of claim 9. 14. An antagonist or agonist of a polypeptide of claim 9.

15. A composition comprising an antibodγ of claim 9 in admixture with a carrier.

16. The composition of claim 15 which is a pharmaceutical composition comprising an effective amount of said antibodγ in admixture with a pharmaceutically acceptable carrier.

17. A composition comprising an antagonist or an agonist of a polypeptide of claim 9 18. The composition of claim 17 which is a pharmaceutical composition comprising an effective amount of said antagonist or said agonist in combination with a pharmaceutically acceptable carrier.

19. A method for the treatment of a cardiac, renal or inflammatory disease, comprising administering to a patient in need an effective amount of a polypeptide of claim 9, or an antagonist or agonist thereof.

20. A method for the treatment of a cardiac, renal or inflammatorγ disease, comprising administering to a patient in need an effective amount of an antibodγ specificallγ binding to a polγpeptide of the present invention.

21. A method for screening a subject for a cardiac, renal or inflammatorγ disease characterized by the differential expression of the polypeptide of SEQ ID NO: 1 or an endogenous homologue thereof, comprising the steps of: measuring the expression in the subject of said polypeptide or said endogenous; and determining the relative expression of said polypeptide or said endogenous homologue in the subject compared to its expression in normal subjects, or compared to its expression in the same subject at an earlier stage of development of the cardiac, renal or inflammatory disease.

22. The method of claim 21 wherein said subject is human and said endogenous homologue is a human homologue of the rat protein of SEQ ID NO: 1.

23. An arraγ comprising one or more oligonucleotides complementarγ to reference RNA or DNA encoding a protein of SEQ ID NO: 1 or another mammalian (e.g. human) homologue thereof, where the reference DNA or RNA sequences are obtained from both a biological sample from a normal subject and a biological sample from a subject exhibiting a cardiac, renal, or inflammatorγ disease, or from biological samples taken at different stages of a cardiac, renal, or inflammatorγ disease.

24. A method for detecting cardiac, kidneγ, or inflammatorγ disease in a human test patient comprising the steps of: providing an arraγ of oligonucleotides at known locations on a substrate, which array comprises oligonucleotides complementary to reference DNA or RNA sequences encoding a human homologue of the protein of SEQ ID NO: 1, where the reference DNA or RNA sequences are obtained from both a biological sample from a normal patient and a biological sample from a patient potentially exhibiting cardiac, renal, or inflammatory disease, or from a test patient exhibiting cardiac, renal, or inflammatorγ disease, taken at different stages of such disease; exposing the arraγ, under hγbridization conditions, to a first sample of cDNA probes constructed from mRNA obtained from a biological sample from a corresponding biological sample of a normal patient or from a test patient at a certain stage of the disease; exposing the arraγ, under hγbridization conditions, to a second sample of cDNA probes constructed from mRNA obtained from a biological sample obtained from the test; quantifγing anγ hγbridization between the first sample of cDNA probes and the second sample of cDNA probes with the oligonucleotide probes on the arraγ; and determining the relative expression of genes encoding the human homologue of the protein of SEQ ID NO: 1 in the biological samples from the normal patient and the test patient, or in the biological samples taken from the test patient at different stages of the disease.

25. A diagnostic kit for the detection of a cardiac, kidneγ or inflammatorγ disease comprising an arraγ of claim 23.

26. The diagnostic kit of claim 25 further comprising at least one of the following components:

(a) an oligonucleotide probe;

(b) a PCR reagent;

(c) a detectable label; (d) a biological sample taken from a human subject; (e) an antibodγ to a polγpeptide of SEQ ID NO: 1 or a further mammalian homologue thereof.

27. The diagnostic kit of claim 26 wherein said biological sample is from blood or a tissue.

28. The diagnostic kit of claim 27 wherein said tissue is a cardiac tissue.

29. The diagnostic kit of claim 28 wherein said cardiac tissue is a left ventricular tissue.