WO2001021649A2

WO2001021649A2 - Nucleic acids encoding vitamin d response element binding proteins, products related thereto, and methods of using same

Info

Publication number: WO2001021649A2
Application number: PCT/US2000/025844
Authority: WO
Inventors: John S. Adams
Original assignee: Cedars-Sinai Medical Center
Priority date: 1999-09-22
Filing date: 2000-09-20
Publication date: 2001-03-29
Also published as: WO2001021649A3; AU3887601A

Abstract

The invention relates to the isolation of vitamin D response element binding proteins and the isolation of polynucleotide sequences encoding these proteins. Another aspect of the invention is to provide antibodies capables of binding to the vitamin D response element binding proteins of the invention and assays for the detection or screening of therapeutic compounds that interfere with the interaction between estrogen response element binding protein and estrogen response elements.

Description

NUCLEIC ACIDS ENCODING VITAMIN D RESPONSE ELEMENT BINDING PROTEINS, PRODUCTS RELATED THERETO, AND METHODS OF USING SAME

Portions of the invention described herein were made in the course of research supported in part by NIH grants DK33139 and DK09093. The Government may have certain rights in this invention.

Background

Most genera of new world primates exhibit vitamin D resistance, i.e., insensitivity that may be characterized biochemically by the maintenance of high circulating concentration of the active vitamin D metabolite 1,25 dihydroxy vitamin D, Gacad et al., J_^_ Bone Min. Res. 8:27-35 (1993). Humans and old world primates, on the other hand, do not exhibit vitamin D resistance. This vitamin D resistance phenomenon in new world primates is also correlated with high circulating levels of other steroid hormones including glucocorticoid (Chrousos et al., Endocrinology 115:25-32 (1984); Lipsett et al., Recent Pros. Hormone Res. 42:199-246 (1985); and Brandon et al., Cancer Res. 49:2203-2213 (1989)), mineral corticoid, progesterone, testosterone, 173-estradiol (Chrousos et al., J. Clin. Endocrinol . Metab. 58:516-920 (1984)), and l,25-(OH)₂D (Takahashi et al., Biochem S. 227:555-563 (1985) ) .

By gaining an understanding of the biochemical mechanisms behind vitamin D resistance and the high levels of circulating steroid hormones in new world primates, new opportunities for treating and diagnosing diseases related to either over-production or under-production of vitamin D and other steroidal hormones may be achieved. Such diseases include osteoporosis, hypercalcemia, and vitamin D intoxication, hypersecretion of steroid hormones, and the like.

Vitamin D receptors bind to the consensus vitamin D response element as described in Ozono et al., J. Biol. Chem. 265:21881-21888 (1990). By inhibiting the binding of the vitamin D receptor to vitamin D response elements, it is possible to modulate the expression of genes regulated by vitamin D via vitamin D receptors. Vitamin D and vitamin D receptors play a significant role in the etiology of many diseases such as osteoporosis and some cancers, e.g. tumors that include hypercalcemia.

Therefore, there is a need in the art to identify and characterize additional proteins, e.g., in New World primate cells, which interact with the transactivating potential of endogenous Vitamin D, and especially a need for information serving to specifically identify and characterize such proteins in terms of their amino acid sequence. Moreover, to the extent that such molecules might form the basis for the development of therapeutic and diagnostic agents, there is a need for the DNA encoding them to be elucidated. The present invention satisfies this need and provides related advantages as well.

Summary of the Invention

In accordance with the present invention, there are provided isolated mammalian Vitamin D Response Element-Binding Proteins (VDRE-BPs) . These VDRE-BP proteins, or fragments thereof, are useful as immunogens for producing anti-VDRE-BP antibodies, or in therapeutic compositions containing such proteins and/or antibodies. Invention VDRE-BP proteins are also useful in bioassays to identify agonists and antagonists thereto.

In accordance with the present invention, there are also provided isolated nucleic acids encoding novel VDRE-BP proteins. Further provided are vectors containing invention nucleic acids, probes that hybridize thereto, host cells transformed therewith, antisense oligonucleotides thereto and related compositions. The nucleic acid molecules described herein can be incorporated into a variety of recombinant expression systems known to those of skill in the art to readily produce isolated recombinant VDRE-BP proteins. In addition, the nucleic acid molecules of the present invention are useful as probes for assaying for the presence and/or amount of a VDRE-BP gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and oligonucleotide fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying nucleic acids encoding VDRE-BP proteins. Also provided are transgenic non-human mammals that express the invention protein.

Antibodies that are immunoreactive with invention VDRE-BP proteins are also provided. These antibodies are useful in diagnostic assays to determine levels of VDRE-BP proteins present in a given sample, e.g., tissue samples, Western blots, and the like. The antibodies can also be used to purify VDRE-BP proteins from crude cell extracts and the like. Moreover, these antibodies are considered therapeutically useful to modulate the biological effect of VDRE-BP proteins in vivo. Methods and diagnostic systems for determining the levels of VDRE-BP protein in various tissue samples are also provided. These diagnostic methods can be used for monitoring the level of therapeutically administered ERE-BP protein or fragments thereof to facilitate the maintenance of therapeutically effective amounts. These diagnostic methods can also be used to diagnose physiological disorders that result from abnormal levels or abnormal structures of the VDRE-BP protein.

Brief Description Of The Figures

Figure 1. VDRE-directed transactivation is squelched in the hormone-resistant New World primate cell line B95-8 relative to Old World primate Vero cells, either in the absence (A) or presence (B) of co-transfected human vitamin D receptor (hVDR) and in the absence (-) or presence of (+) of a VDR-saturating concentration (10 nM) of 1, 25-dihydroxyvitamin D₃ (D₃). Data are the mean ±SD of duplicate determinations of luciferase activity in three separate experiments.

Figure 2. The amino-terminal sequence of tryptic peptides derived from VDRE-BP1 (SEQ ID Nos: 13 to 15) and VDRE-BP2 (SEQ ID Nos: 16 to 19) and their sequence homology with human hnRNPAl and hnRNPA2, respectively.

Figure 3. Expression of a dominant-negative- acting VDRE-BP cDNA. A representative experiment demonstrating the ability of the 1788 bp VDRE-BP2 cDNA, transiently expressed in wild-type, vitamin D-responsive Vero cell line to squelch VDR-VDRE-directed transactivation in either the absence (-) or presence (+) of exogenously-administered 1, 25-dihydroxyvitamin D₃ (D₃, 10 nM) . Figure 4. Alignment of partial cDNA sequences for VDRE-BP1 and VDRE-BP2. Residues 18-958 of the cDNA sequence for VDRE-BP1 (SEQ ID NO:l) have 65.8% identity to residues 130-1076 of the cDNA sequence for VDRE-BP2 (SEQ ID NO:3). Vertical lines indicate base pair identity, gaps are denoted by dashes (-), translation start sites for both sequences are represented as underlined ATG sequences.

Figure 5. Alignment of amino acid sequences for VDRE-BP1 and VDRE-BP2. The amino acid sequence for VDRE-BP1 (SEQ ID NO:2) has 63.5% identity to the amino acid sequence for VDRE-BP2 (SEQ ID NO: 4), the alignment resulting in a Smith-Waterman score of 1396. Vertical solid lines indicate identical amino acids, vertical dotted lines represent similar amino acids, gaps are denoted by dashes (-) , and the "X" at the end of the sequence for VDRE-BP2 represents the stop codon.

Detailed Description of the Invention

In accordance with the present invention, there are provided isolated mammalian Vitamin D Response

Element-Binding Proteins (VDRE-BPs), polypeptides, and fragments thereof encoded by invention nucleic acids. As used herein, the phrase "VDRE-BP" refers to a mammalian family of isolated and/or substantially pure proteins that are able to bind to a single vitamin D response element half-site sequence motif. Invention VDRE-BP proteins include naturally occurring allelic variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, and further including active fragments thereof which retain at least one native biological activity, such as, for example, immunogenicity, nucleic acid binding activity, and the like. Invention VDRE-BP proteins further include proteins having a nucleic acid binding domain belonging to the family of hnRNPs that bind to a VDRE half site.

Invention vitamin D response element binding proteins are further characterized by having the ability to modulate the activity of vitamin D receptors. Vitamin D response element binding proteins are distinct from the vitamin D receptor. Vitamin D response element binding proteins can inhibit the activity of the vitamin D receptor by binding to the same DNA sequence, i.e., the vitamin D receptor binding element. Thus, by regulating the intracellular levels of the subject vitamin D response element binding proteins, and thereby modulating the transactivating activity of VDR, desired physiological effects are obtained. Such effects may be used to treat a variety of pathologies involving the signaling at intracellular receptors including osteoporosis, glucocorticoid mediated disorders, hypercalcemia, and granuloma forming diseases.

As discussed above, invention VDRE-BPs are distinct from endogenous vitamin D receptor (VDR) and, unlike the VDR, are not dependent upon the presence of the standard tandem half-site motif for DNA binding. Rather, the invention VDRE-BPs are bound avidly by the single VDRE half-site motif. As provided herein, the single VDRE half-site motif contains the sequence:

-RGK_XK₂SA- wherein R is either G or A, K is either T or G (but K_x need not be the same as K₂ in a specific sequence) , and S is either G or C. Preferably, the VDRE half-site contains either the sequence -RGGTSA- or the sequence of a naturally occurring VDRE half-site such as those from ocVDRE; more preferably, the VDRE half-site contains the sequence -GGGTSA-; most preferably, the VDRE half-site contains the sequence -GGTTCA- . Thus, invention vitamin D response element binding proteins are characterized by having the biological activity of specifically binding to the single consensus vitamin D response element half-site sequence: -RGK_jK_aSA-. For example, an affinity chromatography support bearing concatemers having multiple -GGTTCA- motifs was used to purify in a single chromatographic step a 34 kDa invention protein and a 38 kDa invention protein that bind to the VDRE.

As used herein, the phrase "binds to a single half-site" refers to the ability of a protein, for example a VDRE-BP, to site-specifically bind one of two flanking regions which are important for protein-DNA complex formation. For example, the osteopontin VDRE (opVDRE) has the sequence

CTAAGTGCTCGGGGTAGGGTTCACGAGGTTCACTCGT (SEQ ID NO: 5). The two sets of six underlined nucleotides are important for VDR-VDRE complex formation, whereas the sequence of the central three "CGA" nucleotides does not play an important role in complex formation. Each six-nucleotide GGTTCA sequence of opVDRE represents one flanking region, and therefore, one half-site of the response element. The ability of, for example, VDRE-BP to bind an opVDRE half-site, therefore, shall be understood mean that VDRE-BP site-specifically binds to the sequence GGTTCA.

Although VDRE-BP site-specifically binds a single VDRE half-site, it is understood that other portions of the DNA can also influence VDRE-BP binding to DNA. For example, the intervening sequence between the two half-sites can influence VDRE-BP binding to DNA. Therefore, in one embodiment of the present invention, it is contemplated herein that sequences immediately upstream or downstream of a VDRE half-site, or distally upstream or downstream of a VDRE half-site, influence VDRE-BP binding to DNA.

The invention VDRE-BPs are members of the large family of single-strand nucleic acid binding proteins whose most prominent members are in the subfamily of RNA binding proteins termed heterogeneous nuclear ribonucleoproteins (hnRNPs) . There are now at least twenty different hnRNPs, designated hnRNP A through hnRNP U, which are known to reside principally in the nucleus of vertebrate cells. In general, hnRNPs are considered RNA binding proteins designed specifically for the metabolism and transport of pre-mRNA. They are among the most abundant nuclear proteins, usually present in quantities several orders of magnitude greater than that of most DNA binding proteins including transcription factors. Recently, proteins in the hnRNP family have also been shown to exist outside the nuclear compartment of the cell, being capable of shuttling back and forth between the nucleus and the cytoplasm. hnRNPs have also been shown not to be specific for binding only RNA. It has also been found that hnRNPs are capable of binding single-strand DNA, which suggests that the cis-acting elements do not require uracil as a component of the nucleic acid binding motif. The invention VDRE-BPs are examples of hnRNP-related proteins that can sequence-specifically interact with either single- or double-strand DNA containing the -RGK₁K₂SA- concensus sequence.

As used herein, the phrase "bind to a single nucleic acid strand" refers to the ability of a protein to site specifically bind a single stranded nucleic acid. For example a VDRE-BP, site-specifically binds single stranded DNA which contains the opVDRE half-site sequence GGTTCA. "Single stranded nucleic acid" and "a single nucleic acid strand" shall be understood to refer to single stranded DNA and RNA, and chemical derivatives thereof.

The deduced amino acid sequences of the two invention VDRE-BPs set forth in SEQ ID NO: 2 and SEQ ID NO: 4 are respectively homologous to two sets of consensus nucleic acid binding motifs, hnRNPAl and hnRNPA2, which are characteristic of the hnRNP family of proteins. The central RNP-containing domain of the VDRE-BPs bears a high degree of sequence similarity to other hnRNPs. Regardless of the primary structural similarities among the hnRNPs and VDRE-BPs, there are at least two ways in which invention VDRE-BPs differ from the classical profile of an hnRNP. First, invention VDRE-BPs are not ubiquitously present in all vertebrate cells. VDRE-BPs are expressed at very low to non-detectable levels in cells from hormone-responsive primates, including man. Second, VDRE-BPs are versatile in their ability to bind nucleic acid. For example, VDRE-BPs can bind to single- or double-stranded DNA; and the presence of the conserved RNA binding motifs in VDRE-BP indicates that they will also interact with RNA.

The survival advantage conferred on primates of the New World by overexpression of the VDRE-BP and the development of relative vitamin D resistance remains an intriguing question. Part of the answer may lie in the fact that there is overexpression of another family of proteins in New World primate cells that also has the potential to alter cellular responsiveness to 1, 25-dihydroxyvitamin D. The hsp-70 family of chaperone proteins comprises a recently discovered intracellular vitamin D binding protein (IDBP) . IDBP is a high-capacity, relatively low-affinity (compared to the vitamin D receptor) , largely cytoplasmic 25-hydroxylated vitamin D sterol binding protein. Thus, it is contemplated herein that one or more of these non-receptor-related ligand binding proteins acts in concert with VDRE-BP to legislate vitamin D resistance, or acts to counter the dominant-negative actions of the VDRE-BP (whose DNA binding properties are not affected by ligand binding) by providing an easily available intracellular source of ligand for the VDR, so that VDR can compete more successfully with the VDRE-BP for VDRE binding. It is also contemplated herein that overexpression of non-receptor-related and non-receptor-associated proteins like the VDRE-BPs plays an important role in the dominant-negative regulation of steroid hormone-induced transactivation of hormone-responsive genes in almost all genera of New World primates.

As presented above, the VDRE-BPs can bind VDRE without binding any ligand, such as vitamin D. Therefore, as used herein, the ability of VDRE-BP to bind a VDRE without binding to a ligand refers to the ability of VDRE-BPs to bind VDRE in the absence of reversible interactions with hormones, signaling molecules, proteins, or any other reversible interaction with another molecule.

The vitamin D response element binding proteins of the invention may be isolated from a variety of mammalian animal species. Preferred mammalian species for isolation are primates, humans and new world primates being particularly preferred. Although humans and old world primates do not produce large enough quantities of vitamin D response element binding protein to manifest the elevated steroid hormone phenomenon seen in new world primates, humans and old world primates (as well as other mammals) are believed to produce vitamin D response element binding proteins. The invention also contemplates allelic variants of the vitamin D response element binding proteins. Vitamin D response element binding proteins may be prepared from a variety of mammalian tissues; however, leukocytes and cell lines established from blood leukocytes are preferred non-recombinant sources of vitamin D response element binding proteins.

Presently preferred VDRE-BPs of the invention include amino acid sequences that comprise substantially the same as the protein sequences set forth in SEQ ID NOS : 2 or , as well as biologically active, modified forms thereof. As discussed above, each of the invention VDRE-BP proteins bind to a single vitamin D response element half site sequence -RGK₁K₂SA-. Those of skill in the art will recognize that numerous residues of the above-described sequences can be substituted with other, chemically, sterically and/or electronically similar residues without substantially altering the biological activity of the resulting receptor species. In addition, larger polypeptide sequences containing substantially the same sequence as amino acids set forth in SEQ ID NO: 2 or 4 (e.g., splice variants) are contemplated.

As employed herein, the term "substantially the same amino acid sequence" refers to amino acid sequences having at least about 70% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence. Preferably, proteins having "substantially the same amino acid sequence" will have at least about 80%, more preferably 90% amino acid identity with respect to the reference amino acid sequence; with greater than about 95% amino acid sequence identity being especially preferred. It is recognized, however, that polypeptides (or nucleic acids referred to hereinbefore) containing less than the described levels of sequence identity arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention.

Preferably, vitamin D response element binding proteins are obtained from recombinant host cells genetically engineered to express significant quantities of vitamin D response element binding proteins. Vitamin D response element binding proteins may be isolated from non-recombinant cells in a variety of ways well known to a person of ordinary skill in the art. One example of such an isolation method is provided below in the examples section. Methods for purifying recombinant proteins from genetically engineered host cells vary with the host cell type and are well known to persons of ordinary skill in the art.

The term "vitamin D response element binding protein" as used herein refers not only to proteins having the amino acid residue sequence of naturally occurring vitamin D response element binding proteins, such as SEQ ID NO: 2 or 4, but also refers to functional derivatives and variants of naturally occurring vitamin D response element binding-protein. A "functional derivative" of a native polypeptide is a compound having a qualitative biological activity in common with the native polypeptide. Thus, a functional derivative of a native vitamin D response element binding protein is a compound that has a qualitative biological activity in common with a native vitamin D response element binding protein, e.g., binding to the VDRE -RGK^SA- half site. A functional derivative of VDRE-BP is also distinct and largely unrelated to VDR as evidenced by the fact that the functional derivative specifically binds the VDRE, and like VDRE-BP, does not specifically bind 1, 25-dihydroxyvitamin D as measured by a electromobility shift assays (EMSA) , and does not recognized by VDR-specific antisera.

"Functional derivatives" include, but are not limited to, functional fragments of native polypeptides from any animal species (including humans), and derivatives of native (human and non-human) polypeptides and their fragments, provided that they have a biological activity in common with a respective native polypeptide. "Functional fragments" comprise regions within the sequence of a mature native polypeptide. The term "derivative" is used to define amino acid sequence and glycosylated variants, and covalent modifications of a native polypeptide.

The amino acid length of functional fragments or derivatives of the present invention can range from about 5 amino acids up to the full-length protein sequence of an invention VDRE-BP. In certain embodiments, the amino acid lengths include, for example, at least about 5 amino acids, at least about 10 amino acids, at least about 20, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least about 250 or more amino acids in length up to the full-length VDRE-BP protein sequence.

Preferably, the functional derivatives are polypeptides which have at least about 65% amino acid sequence identity, more preferably about 75% amino acid sequence identify, even more preferably at least 85% amino acid sequence identity, most preferably at least about 95% amino acid sequence identity with the sequence of a corresponding native polypeptide. Most preferably, the functional derivatives of a native vitamin D response element binding protein retain or mimic the region or regions within the native polypeptide sequence that directly participate in nucleic acid binding. An additional feature of such functional derivatives is that they are not substantially bound or hindered by anti-VDR antibodies as demonstrated by EMSA. Functional derivatives of VDRE-BP also include chemically modified or derivatized molecules derived from VDRE-BP. The phrase "functional derivative" further and specifically includes peptides and small organic molecules having a qualitative biological activity in common with a native vitamin D response element binding protein.

"Identity" or "homology" with respect to a native polypeptide and its functional derivative is defined herein as the percentage of amino acid residues in the candidate sequence that are identical to the corresponding residues of a native polypeptide, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. Neither N- or C-terminal extensions nor insertions shall be construed as reducing identity or homology. Methods and computer programs for the alignment are well known in the art.

Amino acid sequence variants of native vitamin D response element binding proteins and vitamin D response element binding protein fragments are prepared by methods known in the art by introducing appropriate nucleotide changes into a native or variant vitamin D response element binding protein encoding DNA, or by in vi tro synthesis of the desired polypeptide. There are two principal variables in the construction of amino acid sequence variants: the location of the mutation site and the nature of the mutation. With the exception of naturally-occurring alleles, which do not require the manipulation of the DNA sequence encoding the vitamin D response element binding protein, the amino acid sequence variants of vitamin D response element binding protein are preferably constructed by mutating the VDRE-BP encoding DNA to generate corresponding VDRE-BP amino acid sequence variants that do not occur in nature.

Such mutants may be engineered, for example, as frame-shift mutations that result in an altered reading frame and early termination of translation to produce a truncated VDRE-BP molecule. Similarly, in-frame deletions may be made in the VDRE-BP gene that effectively result in the removal of discrete portions of VDRE-BP. Such amino acid sequence deletions generally range from about 1 to 30 residues, more preferably about 1 to 10 residues, and are typically, but not necessarily, contiguous. Deletions are generally introduced in regions that are not directly involved in nucleic acid (or other ligand) binding. Alternatively or in addition, amino acid alterations can be made at sites that differ in vitamin D response element binding proteins from various species, or in highly conserved regions, depending on the goal to be achieved. Sites at such locations will typically be modified in series, e.g. by (1) substituting first with conservative choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue or residues, or (3) inserting residues of the same or different class adjacent to the located site, or combinations of options 1-3. One helpful technique is called "alanine scanning" Cunningham and Wells, Science 244:1081-1085 (1989). Here, a residue or group of target resides is identified and substituted by alanine or polyalanine. Those domains demonstrating functional sensitivity to the alanine substitutions are then refined by introducing further or other substituents at or for the sites of alanine substitution. After identifying the desired mutation (s), the gene encoding a vitamin D response element binding protein variant can, for example, be obtained by chemical synthesis.

More preferably, DNA encoding a vitamin D response element binding protein amino acid sequence variant is prepared by site-directed mutagenesis of DNA, that encodes an earlier prepared variant or a nonvariant version of the vitamin D response element binding protein. Site-directed (site-specific) mutagenesis allows the production of vitamin D response element binding protein variants through the use of specific oligonucleotide sequences that encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed. Typically, a primer of about 20 to 50 nucleotides in length is preferred, with at least about 5 to 10 residues on both sides of the junction of the sequence being altered. In general, the techniques of site-specific mutagenesis are well known in the art, as exemplified by publications such as, Edelman et al., DNA 2:183 (1983). As will be appreciated, the site-specific mutagenesis technique typically employs a phage vector that exists in both a single-stranded and double-stranded form. Typical vectors useful in site-directed mutagenesis include vectors such as the M13 phage. This and other phage vectors are commercially available and their use is well known to those skilled in the art. A versatile and efficient procedure for the construction of oligodeoxyribonucleotide directed site-specific mutations in DNA fragments using M13-derived vectors was published by Zoller and Smith, Nucleic Acids Res. 10:6487-6500, (1982). Also, plasmid vectors that contain a single-stranded phage origin of replication, Vieira and Messing, Meth. Enzymol. 153:3-11 (1987) may be employed to obtain single-stranded DNA. Alternatively, nucleotide substitutions are introduced by synthesizing the appropriate DNA fragment in vi tro, and amplifying it by PCR procedures known in the art.

In general, site-specific mutagenesis may be performed by first obtaining a single-stranded vector that includes within its sequence a DNA sequence that encodes the relevant protein. An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically, for example, by the method of Crea et al., Proc. Natl. Acad. Sci. USA 75:5765-5769 (1978). This primer is then annealed with the single-stranded protein sequence-containing vector, and subjected to DNA-polymerizing enzymes such as, E. coli polymerase I Klenow fragment, to complete the synthesis of the mutation-bearing strand. Thus, a heteroduplex is formed wherein one strand encodes the original non-mutated sequence and the second strand bears the desires mutation. This heteroduplex vector is then used to transform appropriate host cells such as HB101 cells, and clones are selected that include recombinant vectors bearing the mutated sequence arrangement. Thereafter, the mutated region may be removed and placed in an appropriate expression vector for protein production.

The PCR technique may also be used in creating amino acid sequence variants of a Vitamin D response element binding protein. When small amounts of template DNA are used as starting material in a PCR, primers that differ slightly in sequence from the corresponding region in a template DNA can be used to generate relatively large quantities of a specific DNA fragment that differs from the template sequence only at the positions where the primers differ from the template. For introduction of a mutation into a plasmid DNA, one of the primers is designed to overlap the position of the mutation and to contain the mutation; the sequence of the other primer must be identical to a stretch of sequence of the opposite strand of the plasmid, but this sequence can be located anywhere along the plasmid DNA. It is preferred, however, that the sequence of the second primer is located within 200 nucleotides from that of the first, such that in the end the entire amplified region of DNA bounded by the primers can be easily sequenced. PCR amplification using a primer pair like the one just described results in a population of DNA fragments that differ at the position of the mutation specified by the primer, and possibly at other positions, as template copying is somewhat error-prone. Further details of the foregoing and similar mutagenesis techniques are found in general textbooks, such as, for example, Sambrook et al., Molecular Cloning: H Laboratory Manual 2nd edition. Cold Spring Harbor Press, Cold Spring Harbor (1989), and Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley and Sons (1999) .

Naturally-occurring amino acids may be divided into groups based on common side chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile;

(2) neutral hydrophobic: cys, ser, thr;

(3) acidic: asp, glu;

(4) basic: asn, gin, his, lys, arg;

(5) residues that influence chain orientation: gly, pro; and

(6) aromatic: trp, tyr, phe .

Conservative substitutions involve exchanging a member within one group for another member within the same group, whereas non-conservative substitutions will entail exchanging a member of one of these classes for another (see generally Orcutt, B.C. and Dayhoff, M.O., Scoring Matrices, PIN Report MAT-0285, February 1985) . Variants obtained by non-conservative substitutions are expected to result in significant changes in the biological properties/function of the obtained variant, and may result in vitamin D response element binding protein variants which block vitamin D response element binding protein biological activities, i.e., binding to vitamin D response elements. Amino acid positions that are conserved among various species are generally substituted in a relatively conservative manner if the goal is to retain biological function. Amino acid insertions include amino- and/or carboxyl-terminal fusions ranging in length from one residue to polypeptides containing a hundred or more residues, including fusions of entire protein domains, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions (i.e., insertions within the vitamin D response element binding protein amino acid sequence) may range generally from about 1 to 10 residues, more preferably 1 to 5 residues, more preferably 1 to 3 residues. Examples of terminal insertions include the vitamin D response element binding proteins with an N-terminal methionyl residue, an artifact of direct expression in bacterial recombinant cell culture, and fusion of a heterologous N-terminal signal sequence to the N-terminus of the vitamin D response element binding protein to facilitate the secretion of the mature vitamin D response element binding protein from recombinant host cells. Such signal sequences will generally be obtained from, and thus homologous to, the intended host cell species. Suitable sequences include STII or IPP for E. coli, alpha factor for yeast, and viral signals such as herpes gD for mammalian cells. Other insertional variants of the native vitamin D response element binding protein molecules include the fusion of the N- or C-terminus of a Vitamin D response element binding protein to immunogenic polypeptides, e.g. bacterial polypeptides such as beta-lactamase or an enzyme encoded by the E. coli trp locus, or yeast protein, and C-terminal fusions with proteins having a long half-life such as immunoglobulin regions (preferably immunoglobulin constant regions) , albumin, or ferritin, as described in PCT published application WO 89/02922. In accordance with another embodiment of the present invention, there are provided isolated nucleic acids, which encode novel mammalian Vitamin D Response Element-Binding Proteins (VDRE-BPs), and fragments thereof. The nucleic acid molecules described herein are useful for producing invention proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art. In addition, such nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of an invention VDRE-BP gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding invention proteins described herein.

The term "nucleic acid" (also referred to as polynucleotides) encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) , probes, oligonucleotides, and primers. DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding a VDRE-BP. One means of isolating a nucleic acid encoding a VDRE-BP polypeptide is to probe a mammalian genomic library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the VDRE-BP gene are particularly useful for this purpose. DNA and cDNA molecules that encode VDRE-BP polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from mammalian (e.g., primate, human, mouse, rat, rabbit, pig, and the like) , or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below. Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a VDRE-BP polypeptide. Such nucleic acids may include, but are not limited to, nucleic acids comprising substantially the same nucleotide sequence as set forth in SEQ ID NOS : 1 or 3.

Use of the terms "isolated" and/or "purified" in the present specification and claims as a modifier of DNA, RNA, polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so designated have been produced in such form by the hand of man, and thus are separated from their native in vivo cellular environment, and are substantially free of any other species of nucleic acid or protein. As a result of this human intervention, the recombinant DNAs, RNAs, polypeptides and proteins of the invention are useful in ways described herein that the DNAs, RNAs, polypeptides or proteins as they naturally occur are not.

As used herein, "mammalian" refers to the variety of species from which one or more invention VDRE-BPs are derived, e.g., primate, human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like. For example, an invention VDRE-BP described herein, is derived from the cotton-top tamarin { Saguinus oedipus) .

In one embodiment of the present invention, cDNAs encoding the invention VDRE-BPs disclosed herein comprise substantially the same nucleotide sequence as set forth in SEQ ID NOS : 1 or 3. Preferred cDNA molecules encoding the invention proteins comprise the same nucleotide sequence as the coding region set forth in SEQ ID NOS:l or 3. As employed herein, the term "substantially the same nucleotide sequence" refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions. In one embodiment, DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in any of SEQ ID NOS : 2 or 4. In another embodiment, DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with respect to the reference nucleotide sequence. DNA having at least 70%, more preferably at least 90%, yet more preferably at least 95%, at least 98% or at least 99% identity to the reference nucleotide sequence is preferred.

This invention also encompasses nucleic acids which differ from the nucleic acid shown in SEQ ID NOS : 1 or 3, but which have the same phenotype . Phenotypically similar nucleic acids are also referred to as

"functionally equivalent nucleic acids." As used herein, the phrase "functionally equivalent nucleic acids" encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode polypeptides that are the same as those encoded by the nucleic acids disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.

Further provided are nucleic acids encoding VDRE-BP polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions. Preferred nucleic acids encoding the invention VDRE-BPs are comprised of nucleotides that encode substantially the same amino acid sequence as set forth in SEQ ID NOS : 2 or 4.

Thus, an exemplary nucleic acid encoding an invention VDRE-BP may be selected from:

(a) DNA encoding the amino acid sequence set forth in SEQ ID NOS : 2 or 4,

(b) DNA that hybridizes to the DNA of (a) under moderately stringent conditions, wherein said DNA encodes biologically active VDRE-BP, or (c) DNA degenerate with respect to (b) above, wherein said DNA encodes biologically active VDRE-BP.

Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense: antisense strands or probe: target-DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target-DNA can be readily varied by those of skill in the art.

The phrase "stringent hybridization" is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T_m) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.

As used herein, the phrase "moderately stringent hybridization" refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the target DNA; with greater than about 90%, greater than about 95%, greater than about 98% or greater than about 99% identity to target-DNA being especially preferred. Preferably, moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhart ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 65°C.

The phrase "high stringency hybridization" refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) . High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhart ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0. IX SSPE, and 0.1% SDS at 65°C. The phrase "low stringency hybridization" refers to conditions equivalent to hybridization in 10% formamide, 5X Denhart ' s solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C. Denhart ' s solution and SSPE (see, e.g.,

Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) are well known to those of skill in the art as are other suitable hybridization buffers.

As used herein, the term "degenerate" refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NOS:l or 3, but encode the same amino acids as the reference nucleic acid. For example, codons specified by the triplets "UCU", "UCC", "UCA", and "UCG" are degenerate with respect to each other since all four of these codons encode the amino acid serine.

Preferred nucleic acids encoding the invention polypeptide (s) hybridize under moderately stringent, preferably high stringency, conditions to substantially the entire sequence, or substantial portions (i.e., typically at least 15-30 nucleotides) of the nucleic acid sequence set forth in SEQ ID NOS : 1 or 3.

The invention nucleic acids can be produced by a variety of methods well-known in the art, e.g., the methods described herein, employing PCR amplification using oligonucleotide primers from various regions of SEQ ID N0S:1 or 3, and the like.

In accordance with a further embodiment of the present invention, optionally labeled VDRE-BP-encoding cDNAs, or oligonucleotide fragments thereof, can be employed to probe library (ies) (e.g., cDNA, genomic, and the like) for additional nucleic acid sequences encoding novel mammalian VDRE-BPs. Construction of suitable mammalian cDNA libraries is well-known in the art. Screening of such a cDNA library is initially carried out under low-stringency conditions, which comprise a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.

Presently preferred probe-based screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 20X SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0). Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology. The phrase "substantial similarity" refers to sequences which share at least 50% homology. Preferably, hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe. As a result, nucleic acids having substantially the same nucleotide sequence as SEQ ID NOS : 1 or 3 are obtained.

As used herein, a nucleic acid "probe" is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are the same as (or the complement of) any contiguous bases set forth in SEQ ID NOS : 1 or 3. Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NOS : 1 or 3. In addition, the entire cDNA encoding region of an invention VDRE-BP, or the entire sequence corresponding to SEQ ID NOS : 1 or 3, may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.

As used herein, the terms "label" and "indicating means" in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.

Invention vitamin D response element binding protein genes can be obtained from a genomic library, such as a human genomic cosmid library. Libraries, either cDNA or genomic, are screened with probes designed to identify the gene of interest or the protein encoded by it. For cDNA expression libraries, suitable probes include monoclonal and polyclonal antibodies that recognize and specifically bind to a Vitamin D response element binding protein. For cDNA libraries, suitable probes include carefully selected oligonucleotide probes (usually of about 20-80 bases in length) that encode known or suspected portions of a Vitamin D response element binding protein from the same or different species, and/or complementary or homologous cDNAs or fragments thereof that encode the same or a similar gene, and/or homologous genomic DNAs or fragments thereof. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures as described in Chapters 10-12 of Sambrook et al., Molecular Cloning: A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989) .

The invention also provides a variety of polynucleotide expression vectors comprising the vitamin D response element binding proteins of the invention. The subject expression vectors comprise a polynucleotide sequence encoding a Vitamin D response element binding protein in functional combination with one or more promoter sequences so as to provide for the expression of the vitamin D response element binding protein (or an anti-sense copy of the sequence suitable for inhibition of expression of an endogenous gene) . The vectors may comprise additional polynucleotide sequences for gene expression, regulation, or the convenient manipulation of the vector, such additional sequences include terminators, enhancers, selective markers, packaging sites, and the like. Detailed description of polynucleotide expression vectors and their use can be found in, among other places Gene Expression Technology: Methods in Enzymology Volume 185 Goeddel ed, Academic Press Inc., San Diego, CA (1991), Protein Expression in Animal Cells Roth ed., Academic Press, San Diego, CA (1994) .

In accordance with another embodiment of the present invention, there are provided "recombinant cells" containing the nucleic acid molecules (i.e., DNA or mRNA) of the present invention. Methods of transforming suitable host cells, preferably bacterial cells, and more preferably E. coli cells, as well as methods applicable for culturing said cells containing a gene encoding a heterologous protein, are generally known in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA (1989) .

The polynucleotide expression vectors of the invention have a variety of uses. Such uses include the genetic engineering of host cells to express vitamin D response element binding proteins. The polynucleotide expression vectors of the invention may also be used for genetic therapy for diseases and conditions in which it may be desirable to express vitamin D response element binding proteins at levels greater than naturally occurring expression levels. Alternatively, it may be desirable to the subject vectors for anti-sense expression to reduce the naturally occurring levels of vitamin D response element binding protein.

In one embodiment of the invention, methods of preparing VDRE-BPs are provided. This method includes the step of culturing recombinant cells, which contain one or more nucleic acids encoding a VDRE-BP, under conditions suitable for VDRE-BP expression. Conditions suitable for protein expression are typically conditions for cell growth in combination with a factor which activates or enhances protein expression. Typical methods and conditions for protein expression are provided in standard references such as Current Protocols in Molecular Biology, supra, and Sambrook et al . , supra .

Several steroid hormone responsive diseases may be treated through either in vivo or in vitro genetic therapy. Protocols for genetic therapy through the use of viral vectors can be found, among other places, in Viral Vector Gene Therapy and Neuroscience Applications, Kaplit and Lowry, Academic Press, San Diego (1995). The genetic therapy methods of the invention comprise the step of introducing a vector for the expression of vitamin D response element binding protein (or inhibitory anti-sense RNA) into a patient cell. The patient cell may be either in the patient, i.e., in vivo genetic therapy, or external to the patient and subsequently reintroduced into the patient, i.e., in vitro genetic therapy. Diseases that may be treated by the subject genetic therapy methods include osteoporosis, vitamin D toxicity, hypercalcemia (attributable to vitamin D overexpression) , granuloma forming diseases, lymphoma, and the like.

A particular embodiment of the subject invention involves the delivery of VDRE-BPs by gene therapy. Such gene therapy may be effected by ex vivo somatic cell gene therapy whereby host cells have been removed from the body and transduced to express the deficient gene and reimplanted into the host. Alternatively, somatic cell gene therapy may be effected by directly injecting a vector bearing a gene encoding a VDRE-BP, or functional derivative thereof, into the individual, in vivo, whereby the gene will be delivered and expressed by host tissue.

Vectors/methods that may be used to deliver genes encoding VDRE-BP to an individual may include, but are not limited to, liposomal or lipid-associated delivery, direct injection of nucleotides encoding the desired products, viral mediated delivery, and the like.

Recombinant retroviruses have been widely used in gene transfer experiments (see generally, Mulligan, Chapter 8, In: Experimental Manipulation of Gene Expression, Academic Press, pp. 155-173 (1983); Coffin, In: RNA Tumor Viruses, Weiss et al. (eds.), Cold Spring Harbor Laboratory, Vol. 2, pp. 36-38 (1985). One of ordinary skill will realize that nucleotides encoding VDRE-BPs, or functional derivatives thereof, may be introduced using retroviral vectors; however, solely for purposes of illustration, the contemplated use of the VDRE-BPl gene will be described and should not be construed as limiting the invention in any way whatsoever.

Retroviral expression systems will typically insert the VDRE-BPl gene downstream from the LTR or other exogenous promotor element contained in a replication defective retroviral vector. Alternatively, the endogenous VDRE-BPl promoter element may be inserted into the vector. The VDRE-BPl-containing vector may be constructed such that the initiation codon of the VDRE-BPl gene functionally replaces the AUG initiation codon of the retroviral gag gene. This arrangement retains the retroviral mRNA splice donor and acceptor sequences as well as the normal viral regions that control the initiation of translation.

Typically, the above construct will be introduced into a suitable retroviral packaging cell line that will provide the viral proteins necessary to construct infectious virus which, preferably exclusively, contain the recombinant retroviral/VDRE-BPl genome. The packaging cell line will preferably provide viral envelope proteins that allow the infection, and hence delivery and expression of the VDRE-BPl gene. Other eukaryotic viruses that may be used as recombinant vectors for transducing mammalian cells include adenovirus, papilloma virus, herpes virus, adeno-associated virus, rabies virus, lentivirus, and the like (See generally, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, Vol. 3:16.1-16.89 (1989).

Alternatively, replication deficient cells expressing replication deficient viral vectors encoding VDRE-BP activity may be introduced to the body, preferably at or near the target tissue, where the VDRE-BP encoding virus shed by the cells infects the target tissue or cells. Such a therapeutic approach is described in U.S. Patent No. 5,529,774, issued June 25, 1996, herein incorporated by reference, and a conceptually similar approach may prove useful in the treatment of steroid or vitamin D responsive tumors (e.g., breast, ovarian, or prostate cancer) by essentially delivering steroid response element binding proteins, or particularly VDRE binding proteins, to the tumor cells in order to block the tumor cells' ability to respond to the targeted steroid hormone (s).

The present invention also provides compositions containing an acceptable carrier and any of an isolated, purified VDRE-BP mature protein or functional polypeptide fragments thereof, alone or in combination with each other. These polypeptides or proteins can be recombinantly derived, chemically synthesized or purified from native sources. As used herein, the term "acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents. The VDRE-BP compositions described herein can be used, for example, in methods for modulating the activity of vitamin D receptor, steroid/hormone receptor proteins, and the like. Thus, in accordance with another embodiment of the invention, there are provided methods for modulating the activity of an oncogenic protein, preferably vitamin D receptor, comprising contacting the oncogenic protein or vitamin D-response-element (VDRE, i.e., -RGKiKjSA-) with a substantially pure VDRE-BP, or an oncogenic protein-binding fragment or VDRE binding fragment thereof. As used herein the phrase "modulating the activity" or grammatical variations thereof, refers to either inhibition of vitamin D receptor activity (as with an antagonist) or the activation of vitamin D receptor activity (as with an agonist). Vitamin D receptor activities contemplated herein for modulation include, for example, mRNA transcription activity, cell proliferation activity, DNA-binding activity, and the like.

Also provided are antisense-nucleic acids having a sequence capable of binding specifically with full-length or any portion of an mRNA that encodes VDRE-BP polypeptides so as to prevent translation of the mRNA. The antisense-nucleic acid may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding VDRE-BP polypeptides. As used herein, the phrase "binding specifically" encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs. An example of an antisense-nucleic acid is an antisense-nucleic acid comprising chemical analogs of nucleotides. Compositions comprising an amount of the antisense-nucleic acid, described above, effective to reduce expression of VDRE-BP polypeptides by passing through a cell membrane and binding specifically with mRNA encoding VDRE-BP polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein .

Accordingly, methods are provided for the treatment of a variety of diseases characterized by undesirably high levels of vitamin D or other steroids that can bind to vitamin D response element binding proteins of the invention. One of ordinary skill will appreciate that, from a medical practitioner's or patient's perspective, virtually any alleviation or prevention of an undesirable symptom (e.g., symptoms related to disease, sensitivity to environmental or factors, normal aging, and the like) would be desirable. Thus, for the purposes of this Application, the terms "treatment", "therapeutic use", or "medicinal use" used herein shall refer to any and all uses of the claimed compositions which remedy a disease state or symptoms, or otherwise prevent, hinder, retard, or reverse the progression of disease or other undesirable symptoms in any way whatsoever.

When used in the therapeutic treatment of disease, an appropriate dosage of VDRE-BP, or a functional derivative thereof, may be determined by any of several well established methodologies. For instance, animal studies are commonly used to determine the maximal tolerable dose, or MTD, of bioactive agent per kilogram weight. In general, at least one of the animal species tested is mammalian. Those skilled in the art regularly extrapolate doses for efficacy and avoiding toxicity to other species, including human. Before human studies of efficacy are undertaken, Phase I clinical studies in normal subjects help establish safe doses.

Where diagnostic, therapeutic or medicinal use of VDRE-BPS, or derivatives thereof, is contemplated, the VDRE-BP may be prepared and maintained under sterile conditions and thus avoid microbial contamination. Compositions comprising VDRE-BPS may also be sterile filtered prior to use. In addition to the above-methods of sterile preparation and filter sterilization, antimicrobial agents may also be added. Antimicrobial agents which may be used, generally in amounts of up to about 3% w/v, preferably from about 0.5 to 2.5%, of the total formulation, include, but are not limited to, methylparaben, ethylparaben, propylparaben, butylparaben, phenol, dehydroacetic acid, phenylethyl alcohol, sodium benzoate, sorbic acid, thymol, thimerosal, sodium dehydroacetate, benzyl alcohol, cresol, p-chloro-m-cresol, chlorobutanol, phenylmercuric acetate, phenylmercuric borate, phenylmercuric nitrate and benzylalkonium chloride. Preferably, anti-microbial additives will either enhance the biochemical properties of VDRE-BP, or will be inert with respect VDRE-BP activity. To the extent that a given anti-microbial agent may prove deleterious to VDRE-BP activity, another agent may be substituted which effects VDRE-BP function to a lesser extent.

Pharmaceutical compositions comprising VDRE-BPS as active components may be introduced in vivo by any of a number of established methods. For instance, the agent may be administered by inhalation; by subcutaneous (sub-q) ; intravenous (I.V.), intraperitoneal (I.P.), or intramuscular (I.M.) injection; rectally, as a topically applied agent (transdermal patch, ointments, creams, salves, eye drops, and the like), or directly injected into tissue such as tumors or other organs, or in or around the viscera.

Thus, in accordance with still another embodiment of the present invention, there are provided methods for identifying compounds which bind to VDRE-BP polypeptides. The invention proteins may be employed, e.g., in a competitive binding assay with anti-VDRE-BP antibodies as controls. Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to VDRE-BPs. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention VDRE-BP proteins. Compounds that bind to and/or modulate invention VDRE-BPs can be used to treat a variety of pathologies described herein mediated by invention VDRE-BPs.

In another embodiment of the invention, there is provided a bioassay for identifying compounds which modulate the VDRE-binding activity of invention VDRE-BP polypeptides. According to this method, invention VDRE-BP polypeptides are contacted with an "unknown" or test substance (in the presence of a VDRE driven reporter gene construct) , the activity of the VDRE-BP polypeptide is monitored subsequent to the contact with the "unknown" or test substance, and those substances which cause the expression of the reporter gene construct to be increased or decreased are identified as functional ligands for VDRE-BP polypeptides. In accordance with another embodiment of the present invention, transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect (s) thereof can then be evaluated by comparing the VDRE-BP-mediated response (e.g., via reporter gene expression) in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express VDRE-BP polypeptides), to the presence of the compound.

As used herein, a compound or a signal that "modulates the activity" of invention polypeptides refers to a compound or a signal that alters the activity of VDRE-BP polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal. In particular, such compounds or signals include agonists and antagonists. An agonist encompasses a compound or a signal that activates the VDRE-BP activity of VDRE-binding. Alternatively, an antagonist includes a compound or signal that inhibits with VDRE-BP binding to VDRE.

The compounds which may be screened in accordance with the invention include but are not limited to peptides, antibodies and fragments thereof, and other organic compounds (e.g. , peptidomimetics) that bind to VDR (vitamin D receptor) , VDRE-BP or the VDRE (vitamin D response element) and either mimic the activity triggered by the natural ligand or inhibit the activity triggered by the natural ligand; as well as peptides, antibodies or fragments thereof, and other organic compounds that mimic the VDRE-BP or the VDRE (or a portion thereof) and effectively "neutralize" the VDR. Such compounds may include, but are not limited to, peptides such as, for example, soluble peptides, including but not limited to members of random peptide libraries; (see, e.g., Lam et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991)), and combinatorial chemistry-derived molecular libraries made of D- and/or L- configuration amino acids, phosphopeptides (including, but not limited to members of random or partially degenerate, directed phosphopeptide libraries; see, e.g., Songyang et al., Cell 72:767-778 (1993) ) ; antibodies (including, but not limited to, polyclonal, monoclonal, humanized, anti-idiotypic, chimeric or single chain antibodies, and Fab, F(ab')₂ and FAb expression library fragments, and epitope-binding fragments thereof) ; and small organic or inorganic molecules .

Other compounds which can be screened in accordance with the invention include but are not limited to small organic molecules that are preferably able to cross the blood-brain barrier, gain entry into an appropriate brain cell (e.g. pituitary cell, etc.) and affect the regulation of vitamin D production.

As understood by those of skill in the art, assay methods for identifying compounds that modulate VDRE-BP activity generally require comparison to a control. One type of a "control" is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound. Another type of "control" cell or culture may be a cell or culture that is identical to the transfected cells, with the exception that the "control" cell or culture do not express native proteins. Accordingly, the response of the transfected cell to compound is compared to the response (or lack thereof) of the "control" cell or culture to the same compound under the same reaction conditions.

In yet another embodiment of the present invention, the activation of VDRE-BP polypeptides can be modulated by contacting the polypeptides with an effective amount of at least one compound identified by the above-described bioassays.

In accordance with yet another embodiment of the present invention, there are provided anti-VDRE-BP antibodies having specific reactivity with a VDRE-BP polypeptides of the present invention. Active fragments of antibodies are encompassed within the definition of "antibody" . Invention antibodies can be produced by methods known in the art using invention polypeptides, proteins or portions thereof as antigens. For example, polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory (1988)), which is incorporated herein by reference. Invention polypeptides can be used as immunogens in generating such antibodies. Alternatively, synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens. Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide. Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al . , supra . , and Harlow and Lane, supra . Both anti-peptide and anti-fusion protein antibodies can be used, (see, for example, Bahouth et al., Trends Pharmacol. Sci. 12:338- 343 (1991); Ausubel et al., Current Protocols in

Molecular Biology John Wiley and Sons, NY (1989) which are incorporated herein by reference) .

Antibody so produced can be used, inter alia, in diagnostic methods and systems to detect the level of VDRE-BP present in a mammalian, preferably human, body sample, such as tissue or vascular fluid. Such antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention VDRE-BP. In addition, methods are contemplated herein for detecting the presence of an invention VDRE-BP protein either within a cell, or on the surface of a cell, comprising contacting the cell with an antibody that specifically binds to VDRE-BP polypeptides, under conditions permitting binding of the antibody to the VDRE-BP polypeptides, detecting the presence of the antibody bound to the VDRE-BP polypeptide, and thereby detecting the presence of invention polypeptides on the surface of the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vi tro diagnostic or in vivo imaging methods.

Immunological procedures useful for in vi tro detection of target VDRE-BP polypeptides in a sample include immunoassays that employ a detectable antibody. Such immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art. An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly or indirectly attached to the antibody. Useful markers include, for example, radionucleotides, enzymes, fluorogens, chromogens and chemiluminescent labels.

Invention anti-VDRE-BP antibodies are contemplated for use herein to modulate the activity of the VDRE-BP polypeptide in living animals, in humans, or in biological tissues or fluids isolated therefrom. The term "modulate" refers to a compound's ability to increase (e.g., via an agonist) or inhibit (e.g., via an antagonist) the biological activity of an invention VDRE-BP protein, such as the VDRE-binding activity of a VDRE-BP. Accordingly, compositions comprising a carrier and an amount of an antibody having specificity for VDRE-BP polypeptides effective to block VDRE or other VDRE-BP-binding proteins (e.g., anti-hnRNPA antibodies, and the like) from binding to invention VDRE-BP polypeptides are contemplated herein. For example, a monoclonal antibody directed to an epitope of an invention VDRE-BP polypeptide including an amino acid sequence set forth in SEQ ID NOS : 2 or 4, can be useful for this purpose.

The present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding VDRE-BP polypeptides. As employed herein, the phrase "exogenous nucleic acid" refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment (e.g., as part of a genetically engineered DNA construct) . In addition to naturally occurring levels of VDRE-BP, invention VDRE-BPs can either be overexpressed or underexpressed (such as in the well-known knock-out transgenics) in transgenic mammals .

Also provided are transgenic non-human mammals capable of expressing nucleic acids encoding VDRE-BP polypeptides so mutated as to be incapable of normal activity, i.e., do not express native VDRE-BP. The present invention also provides transgenic non-human mammals having a genome comprising antisense nucleic acids complementary to nucleic acids encoding VDRE-BP polypeptides, placed so as to be transcribed into antisense mRNA complementary to mRNA encoding VDRE-BP polypeptides, which hybridizes to the mRNA and, thereby, reduces the translation thereof. The nucleic acid may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types. Examples of nucleic acids are DNA or cDNA having a coding sequence substantially the same as the coding sequences shown in SEQ ID NOS : 1 or 3. An example of a non-human transgenic mammal is a transgenic mouse. Examples of tissue specificity-determining elements are the metallothionein promoter and the L7 promoter.

Animal model systems which elucidate the physiological and behavioral roles of VDRE-BP polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the VDRE-BP polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding a VDRE-BP polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. (See, for example, Hogan et al., Manipulating the Mouse Embryo: A Laboratory

Manual (Cold Spring Harbor Laboratory, (1986)).

In accordance with another embodiment of the present invention, there are provided diagnostic systems, preferably in kit form, comprising at least one invention nucleic acid in a suitable packaging material. The diagnostic nucleic acids are derived from the VDRE-BP-encoding nucleic acids described herein. In one embodiment, for example, the diagnostic nucleic acids are derived from any portion of SEQ ID NOS : 1 or 3. Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding VDRE-BP in either genomic DNA or in transcribed nucleic acid (such as mRNA or cDNA) encoding VDRE-BP.

A suitable diagnostic system includes at least one invention nucleic acid, preferably two or more invention nucleic acids, as a separately packaged chemical reagent (s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic acid probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.

All U.S. patents and all publications mentioned herein are incorporated in their entirety by reference thereto. The invention will now be described in greater detail by reference to the following non-limiting examples . Examples

Examples generally useful for making and using the claimed invention can be found in the article Arbelle et al., Endocrinology 137:786-789 (1996) which is incorporated herein by reference. This article is merely cited for purposes of guidance and any theories expressed in the article are merely theories and should not be construed as limitations of the invention described in the subject application.

Cell Culture and Preparation of Cellular Extracts

The B-lymphoblastoid cell lines B95-8 from New World Primates (NWP) and Vero from Old World Primates (OWP) were obtained from the American Type Culture Collection (ATCC, Manassas, VA) . Both cell lines were maintained in RPMI-1640 medium (Irvine Scientific,

Irvine, CA) routinely supplemented with 10% fetal calf serum (FCSI Gemini Bioproducts, Calabasas, CA) , 100 μg/ml streptomycin, 2 mM L-glutamine (both from GIBCO-BRL, Grand Island, NY) and in atmosphere of 95% air, 5% C0₂. In some experiments, confluent cultures were preincubated overnight in medium containing 100 nM 173-estradiol, 25-hydroxyvitamin D (25-OHD), and 1, 25-dihydroxyvitamin D (1, 25- (OH) ₂D) prior to harvest and extract preparation.

Nuclear extracts were prepared as described by Chen et al., J. Clin. Invest. 99:669-675 (1997), this reference will be hereinafter referred to as Chen I, which is a slight modification of the method of Zerivitz and Akusjarvi, Gene Anal. Tech. 6:101-109 (1989). Nuclear extract preparation was carried out prior to or after overnight incubation in the presence of 100 nM 1,25- (OH) ₂D (Leo Pharmaceuticals, Ballerup, Denmark). Electromobility Shift Assay (EMSA)

Transfected yeast extract enriched for the human VDR and for the human RXR and anti-VDR antibody 9A7γ were prepared by standard methods (Arbelle et al., supra). Anti-RXR antibody, 4RX-1D12, which recognizes the α, β, and γ forms of RXR was generously supplied by P. Chambon (Cedex, France). Synthetic oligonucleotides containing sequence of the mouse osteopontin vitamin D response element from (opVDRE; CTAAGTGCTCGGGGTAGGGTTCACGAGGTTCACTCGT (SEQ ID NO:5)); the human osteocalcin vitamin D response element (ocVDRE; TTGGTGACTCACCGGGTGAACGGGGGCAAATGCCCCCGTTCACCCGGTGAGTCAC- CAA (SEQ ID NO:6)); the estrogen response element (ERE; CTAGAAGTCAGGTCACAGTGACCTGATCAAT (SEQ ID NO:7)); the retinoid X response element (RXRE;

AGCTTCAGGTCAGAGGTCAGAGAGCT (SEQ ID NO:8)); the recognition sequence for the yin-yang 1 (YY1) nuclear factor (CGCTCCGCGGCCATCTTGGCGGGTGGT (SEQ ID NO: 9)); and a mutant recognition sequence for the YY1 nuclear factor (GCGTCCGCGATTATCTTGGCGGCTGGT (SEQ ID NO: 10)) were prepared in the Molecular Biology Core Facility, Cedars-Sinai Research Institute. A double stranded oligonucleotide of comparable length representing the human CTF/NF1 sequence CCTTGGCATGCTGCCAATATG (SEQ ID NO: 11) was purchased from Promega (Madison, WI). Double strand oligonucleotides were formed by annealing single strand oligonucleotides with their complementary sequences, and radiolabeled oligonucleotides were prepared with ³²P-γATP (DuPont NEN, Boston, MA) by T4 kinase reaction (specific activity of 10⁸ cpm/mg DNA) .

Yeast cell extract (enriched in human VDR , Allegretto et al., J. Biol. Chem. 270:23906-23909 (1995); or human RXRα, Zou et al. J. Biol. Chem. 272:19027-19034 (1997)), nuclear extracts from B95-8 NWP cells and from Vero OWP cells, and purified nuclear extracts from B95-8 cells (each comprising 8-18 μg protein) were incubated on ice in the presence of 20 mM Hepes (pH 7.9), 0.1 M KC1, 5 mM MgCl₂, 2 μg poly(dldC), and 10% glycerol for 15 minutes. Oligonucleotides, either as probes radiolabeled with ³²P-γATP or unlabeled, were added to a concentration of 50 fmol, and incubation continued at room temperature for 15 minutes. In some experiments nuclear extract was preincubated for 15 min on ice with either antibodies or excess unlabeled double stranded DNA prior to incubation with probe. The samples were then loaded onto a 0.5 x TBE-6% polyacrylamide gel and subjected to electrophoresis. Gels were dried for 1 hour at 80°C and exposed to Kodak X-OMAT AR film for 1 to 18 hours at 70°C with an enhancing screen, or for 1 hour to 3 days at 23°C. This procedure is described in Chen I, supra, and in Chen et al., J. Biol. Chem. 273:31352-31357 (1998), this reference will be hereinafter referred to as Chen II.

Interaction of the VDR-RXR heterodimer with VDRE is necessary for transcriptional control of vitamin D-regulated genes, including the osteopontin gene. When mixed with extract from yeast expressing VDR and RXR, radiolabeled mouse opVDRE forms a specific band representing the heterodimerized VDR-RXR bound to the probe. The identity of this band as comprising VDR-RXR-VDRE was corroborated by a decrease in intensity of the band upon addition of 100-fold excess unlabeled probe DNA. Further, addition of anti-RXR antibody caused a supershift in the band; whereas addition of anti-VDR antibody resulted in a disappearance of the band, implying the presence of RXR and VDR in complex with VDRE. A new, slower migrating band was visible upon addition of New World primate nuclear extract to the yeast extract and labeled probe mixture, implying the presence of one or more VDRE binding proteins (VDRE-BPs) which are different than VDR-RXR. This slower migrating band could also be competed away by addition of 100-fold excess of unlabeled probe. In contrast, this slower migrating band was not observed when the radiolabled opVDRE was combined with either Old World primate nuclear extract or Old World primate nuclear extract and yeast extract. The ability of the unlabeled probe to effectively compete away VDRE-BP probe binding was also observed when ocVDRE was used as the radiolabeled probe and when either ocVDRE or opVDRE, but not the consensus ERE or a nonspecific oligonucleotide (CTF/NF) of the same length, was used as competitor DNA (data not shown) , confirming the highly specific nature of the VDRE-BP-VDRE interaction.

A ubiquitous nuclear factor, ying-yang 1 (YY1) is known to be bound by recognition sequences within the 5' regulatory region of the osteocalcin gene, and is capable of decreasing the level of VDR-RXR mediated transcription. To distinguish YYl from the one or more VDRE-BPs present in B95-8 cells, radiolabeled ocVDRE probe was exposed to B95-8 nuclear extract, and the characteristic slow migrating band was observed. That characteristic band diminished when excess unlabeled opVDRE or ocVDRE probe was added. However, no change in VDRE-BP-VDRE binding was observed upon addition of anti-VDR antibody, or 100-fold excess of unlabeled oligonucleotides containing the sequences for RXRE, ERE, CTF/NF1, the YYl recognition sequence or the YYl mutant recognition sequence. Similarly, when an anti-YYl antibody is added, no change occurs in any band. Comparable results were observed when using opVDRE as the radiolabled probe. These results distinguish the one or more newly identified VDRE-BP proteins of the invention from the previously known YYl protein.

Transient Transfection Transcription Assay

An in vivo assay was conducted to determine whether addition of 1,25- (OH) ₂D to NWP B95-8 cells and to OWP Vero cells effected VDR-VDRE-directed transcriptional transactivation. This was carried out using a reporter plasmid, PVDRMLT-Luc, containing a single VDRE cloned upstream from the adenovirus major-late promoter sequence, as previously described by Allegretto et al., supra. About 5xl0⁵ cells of B95-8 and Vero were seeded into 6-well plates in phenol red-free medium containing 10% charcoal-stripped fetal calf serum and allowed to grow to 80-90% confluence. Transfections were performed in triplicate using 5.5 μg VDRE-luciferase reporter plasmid PVDRMLT-Luc and 5.0 μg β-galactosidase plasmid with pGEM-3z vector DNA (Promega, Madison, WI) to a final concentration of 20 μg DNA/ml in LipoTAXI solution (Stratagene, La Jolla, CA) . To a first group of wells (which included B95-8 containing wells and Vero containing wells), 0.5 μg of pRShVDR (Zou et al., supra) was added; and no VDR was added to a second group of wells (which also included B95-8 containing wells and Vero containing wells) . After 5 hours of transfection, equal volumes of 20% fetal calf serum-supplemented, antibiotic-free medium were added to each well; which was followed by addition of 10 nM 1,25- (OH) ₂D to each well (an example of this method is provided in Zou et al., supra) . After incubating at 37°C for 48 hours, the cells were lysed, and luciferase and β-galactosidase activities were measured. As expected, OWP cells demonstrated a 7-fold 1, 25- (OH) ₂D-induced increase in reporter

(luciferase) activity (Figure 1A and IB, two left columns). However, NWP cells demonstrated almost no 1, 25- (OH) ₂D-induced increase in reporter activity

(Figure 1A and IB, two right columns) . Additionally, NWP cells, prior to treatment with 1,25- (OH) ₂D, demonstrated more than 10-fold lower level of basal reporter activity compared to the OWP cells prior to treatment with 1,25- (OH) ₂D. The results thus indicate that one or more factors present in the B95-8 cells inhibit VDR transactivating activity in vi tro, and may therefore have a similar activity in vivo .

Affinity Purification of the NWP VDRE-BP

The DNA affinity column was prepared essentially as described by Kadonaga and Tijan, Proc. Natl. Acad. Sci. USA 83:5889-5893 (1986). Two gel-purified oligodeoxynucleotides of complementary opVDRE sequence were synthesized. Approximately 200 μg of each oligonucleotide were annealed, 5 ' -phosphorylated with ³²P-γATP to ascertain coupling efficiency, and concatemerized in reactions using DNA ligase. The resultant DNA oligomers were then coupled to cyanogen bromide (CNBr) -activated Sepharose 4B (Pharmacia, Piscataway, NJ) . After blocking the excess remaining active groups with ethanolamine, the DNA-coupled resin was placed in a 2 ml poly-prep column (BIO-Rad, Hercules, CA) for chromatography. The column was equilibrated in elution buffer (25 M Hepes (pH 7.6), 12.5 mM MgCl₂, 1 mM DTT, 20% glycerol, and 0.1% nonidet P-40) containing 0.1 M KC1. The DNA-coupled resin was used to purify VDRE-BP (s) as previously described (Chen I, supra, and Chen II, supra). Crude NWP nuclear extract (13-20 mg prepared as described above) was solubilized in the elution buffer containing nonspecific competitor poly(dldC) (4 mg/ml) and added to the column at a flow rate of about (12 ml/hour) . Protein was then eluted from the column using a gradient of elution buffer increasing from about 0.2 to about 1.0 M KC1. Fractions (2 ml) from each column eluate were concentrated and desalted using a Microcon-30 filter (30 kDa molecular mass cutoff; Amicon, Beverly, MA) and VDRE binding capacity assessed by EMSA. An aliquot of each fraction was used to determine total protein concentration. The constituent proteins in each fraction were resolved on a 10% SDS-PAGE and identified by staining with coomassie blue.

Several fractions that eluted from the affinity column were enriched for a protein that interacted with the VDRE in EMSA. The specific activity of the purified extract of this VDRE-BP activity was increased by over 100-fold (as measured by the ability to compete with VDR-RXR for binding to the VDRE) relative to crude extract. SDS-PAGE of the relevant fractions from DNA affinity chromatography revealed the presence of three bands with relative mobilities corresponding to proteins of about 34 kDa, 38 kDa, and 55 kDa. The 34 kDa and 38 kDa bands eluted in fractions of between 0.2 and 0.6 M KC1, while the 55 kDa band eluted later in the gradient (0.7 M to 0.8 M KC1) .

Characterization of the two VDRE-BPs

The 34 kDa and 38 kDa bands from the 0.4 M KC1 fraction described above were excised from the gel and subjected to proteolytic digest and amino acid sequence analysis at the Harvard Microchemistry Facility using the previously described method of Fernandez et al., Anal . Biochem. 201:255-264 (1992). As shown in Figure 2, three amino acid sequences were identified for the 34 kDa band: LFIGGLSFETTDESLR (SEQ ID NO: 12), GFAFVTFDDHDSVDK (SEQ ID NO: 13), and IEVIEIMTDR (SEQ ID NO: 14); and four amino acid sequences have been identified for the 38 kDa band LFIGGLSFQTTEESLR (SEQ ID NO: 15), GFGFVTFDDHDTVDK (SEQ ID NO: 16), IFVGGLSPDTPEEK (SEQ ID NO: 17), and YHTINGHNCEVK (SEQ ID NO:18). All seven tryptic fragments demonstrate sequence similarity to proteins in the hnRNPA family. The tryptic peptides from the 34 kDa protein demonstrate a high degree of sequence similarity to the hnRNPAl subfamily, while the tryptic peptides from the 38 kDa protein demonstrate the greatest sequence similarity to proteins in the hnRNPA2 subfamily.

Western blot analysis was used to confirm the sequence similarity of the 34 kDa and 38 kDa proteins to the hnRNPA family. Samples from the eluted fractions described above were subjected to electrophoresis in two 12% polyacrylamide gels. The proteins from the two gels were transferred onto two respective nitrocellulose membranes, followed by exposing the membranes to 5% nonfat dry milk for 1 hour, as previously described in Dreyfus et al., Cell 85:963-972 (1992). The first membrane was incubated with monoclonal mouse anti-human VDR antibody (Dr. J.W. Pike, Ligand Pharmaceuticals, Inc., San Diego, CA) , and the second membrane was incubated with mouse anti-human hnRNPAl antibody (Dr. G. Dreyfus, University of Pennsylvania). The two membranes were incubated with their respective antibody for two hours, and then the two membranes were incubated with horseradish peroxidase-conjugated anti-mouse IgG antibody for another hour. Detection of antibody-reactive proteins was carried out using a horse radish peroxidase chemiluminescence assay (ECL, Amersham Pharmacia Biotech) .

The anti-human hnRNPAl antibody, which is known to bind to proteins in both hnRNPAl and hnRNPA2 families, bound strongly to the 34 kDa protein (hereafter referred to as VDRE-BPl), and to a lesser extent to the 38 kDa protein (hereafter referred to as VDRE-BP2) , which both eluted in fractions <0.6 M KC1. The anti-hnRNPAl antibody did not, however, bind to the 55 kDa band. The anti-human VDR antibody bound to the 55 kDa band, confirming the identity of this band as VDR, but the antibody did not demonstrate specific recognition of either the 34 kDa or 38 kDa bands.

Further Analysis of DNA Binding

Ch,aracteristics of VDRE- -BP1 and VDRE- -BP2

A common characteristic of hnRNPs is the ability to bind single stranded nucleic acids. VDRE-BPs 1 and 2 were therefore examined for this ability. Double stranded opVDRE DNA, and a single stranded DNA having the sequence

CTAAGTGCTCGGGGTAGGGTTCACGAGGTTCACTCGT (SEQ ID NO :19; i.e., a single strand of opVDRE, hereafter referred to as the top opVDRE sequence) , and the complementary single strand containing the sequence ACGAGTGAACCTCGTGAACCCTACCCCGAGCACTTAG (SEQ ID NO: 20) (hereafter referred to as the bottom opVDRE sequence) were used in EMSA analysis, in the presence of the 0.4 M KC1 fraction from the above described purification, to demonstrate the site-specific binding of the VDRE-BPs to single stranded DNA. A complex was observed when a radiolabeled single stranded top opVDRE sequence was added to the 0.4 M KC1 fraction. Competition for labeled probe binding was observed when unlabeled top single stranded opVDRE or double stranded opVDRE sequence were added to the mixture of labelled probe and the 0.4 M KC1 fraction. Addition of anti-human hnRNP antibody blocked complex formation, but did not cause a supershift (data not shown) . No competition was observed when double stranded RXRE, double stranded ERE, double stranded CTF/NF1, single stranded top CTF/NF1, or single stranded opVDRE (not shown) were added to the above mixture. Interestingly, the top single strand of RXRE (AGCTTCAGGTCAGAGGTCAGAGAGCT , SEQ ID NO: 21) demonstrated some ability, albeit to a lesser extent, to compete with the top opVDRE-VDRE-BP complex, indicating that the RXRE harbors a recognition sequence for the VDRE-BP albeit less effective than the VDRE-op upper strand in competing for VDRE-BP binding. A similar pattern was observed using double stranded opVDRE as the labeled probe, in which competition for labeled probe binding was observed when unlabeled double stranded opVDRE, or the single stranded top opVDRE sequence were added.

Analysis of Transcription of VDRE-BPl and VDRE-BP2 in Primate Cells

Approximately 200 ng of total cellular RNA was extracted from B95-8, OMK, and Vero cells using RNA isolating reagent (Life Technologies, Grand Island, NY) and used as template for RT-PCR and Northern blots. A panel of degenerate oligonucleotides corresponding to internal sequences of four tryptic peptides (IGGLSFET, SEQ ID NO: 22 and FDDHDSV, SEQ ID NO: 23 from VDRE-BPl; and GGLSFET, SEQ ID NO: 24 and GFVTFDDHD, SEQ ID NO: 25 FROM VDRE-BP2) was mixed with B95-8 cell RNA, and 30 RT-PCR cycles were carried out using MMLV reverse transcriptase (Clontech Laboratories, Inc., Palo Alto, CA) . A 435 bp cDNA sequence was identified which demonstrated 94% sequence identity to the cDNA for human- -hnRNAPAl . This cDNA was ligated into the PCR 2.1 vector (Invitrogen, Carlsbad, CA) and its sequence verified.

The PCR product was then used as probe in Northern analysis, wherein 15 μg total cellular RNA extracted from B95-8 cells, OMK New World primate cells, and Vero cells, were subjected to electrophoresis in a 1% agarose 7% (v/v) formaldehyde gel, and then transferred to a nitrocellulose membrane. After blocking the membrane in a 50% formamide solution containing salmon sperm DNA for 1 hour, the membrane was exposed overnight to the above PCR product which had been radiolabeled with ³²P-γATP (DuPont NEN, Boston, MA) by T4 kinase reaction (specific activity of 10⁸ cpm/mg DNA). The probe identified a 1.8 kb mRNA species that was plentiful in hormone-resistant B95-8 New World primate cells, was less plentiful in New World primate cells with the intermediate phenotype of partial hormone-responsiveness (OMK cells), and expressed at a much lower level in Old World primate Vero cells with a hormone-responsive phenotype.

Molecular Cloning and Expression of VDRE-BP

B95-8 poly (A) + RNA (2.5μg) was used as template to generate the 5'- and 3'- ends of the VDRE-BP cDNA with the Marathon cDNA amplification kit (Clontech Laboratories, Inc., Palo Alto, CA) . Second-strand cDNA synthesis and adapter ligation were performed as instructed in the enclosed manual. The previously identified 435 bp cDNA (see above) was employed to develop 5'- and 3'- nested primers for use in cloning, by 5 ' - and 3'- RACE reactions, cDNAs for both VDRE-BPs that extended 5' through the translation start site and 3' through the UTR. The adapter-ligated cDNA was then used as a template in RACE reactions using adapter-specific primer plus VDRE-BP-specific primer 5 ' -CTTTGACGACCATGACTCCGTGGA-3 ' (SEQ ID NO: 26) for the 5 ' -RACE reaction and adapter-specific primer plus VDRE-BP-specific primer 5 ' -TCCACGGAGTCATGGTCGTCAAAG-3 ' (SEQ ID NO: 27) for the 3 ' -RACE reaction. Both VDRE-BPl and VDRE-BP2 cDNA were generated by end-to-end amplification using specific 5' and 3' primers. The amplified products were then separated by gel electrophoresis and individually subcloned into the PCR 3.1 (pCR3.1) expression vector and sequenced.

Sequencing the entire open reading frames of VDRE-BPl and VDRE-BP2 confirmed that the VDRE-BPs were members of the hnRNPA family. The 1751 nucleotide VDRE-BPl cDNA (SEQ ID NO:l) bore 61% sequence identity to the human hnRNPAl cDNA. The 1788 nucleotide VDRE-BP2 cDNA (SEQ ID NO: 3) possessed 71% sequence identity to the human hnRNPA2 cDNA. Sequence identity of VDRE-BPl and VDRE-BP2 with human hnRNPAl and hnRNPA2, respectively, was 96% for both sequences through the open reading frame portion of the two cDNAs (Figures 4 and 5) . Most sequence divergence was accounted for in the extensive 3' UTR of the two cDNAs.

The full length cDNAs for VDRE-BPl and VDRE-BP2 were cloned into pCR3.1 vector (Invitrogen, Carlsbad, CA) , to form the vectors pCR3.1-VDRE-BP1 and pCR3.1- VDRE-BP2, respectively. Hormone-responsive, Old World primate Vero cells bearing a fully-functional VDR were co-transfected with the pCR3.1-VDRE-BPl, pCR3.1-VDRE-BP2, and previously described VDRE-reporter constructs. Reporter activity was unaffected by expression of pCR3.1- VDRE-BPl, but basal reporter activity was reduced 71% in pCR3.1-VDRE-BP2 transfected Vero cells compared to that observed in the same cells co-transfected with an empty vector and VDRE-reporter. This reduction approaches levels observed in hormone-resistant B95-8 cells also co-transfected with the empty vector and reporter construct (Figure 3). Stimulation of hormone-responsive Old World primate Vero cells bearing the empty vector with 1,25- (OH) ₂D increased reporter activity 2.6-fold. Treatment of Vero cells bearing pCR3.1-VDRE-BP2 with the vitamin D elicited only a 1.3-fold increase in reporter activity to a level that was only 19% of that observed in hormone-stimulated empty pCR3.1-bearing Vero cells and to that observed in hormone-resistant B95-8 cells which overexpress VDRE-BP2 endogenously, confirming the marked squelching potential VDRE-BP2.

While the invention has been described in detail with reference to certain preferred embodiments thereof, it will be understood that modifications and variations are within the spirit and scope of that which is described and claimed.

Claims

We claim :

1. Isolated nucleic acid encoding a Vitamin D Response Element-Binding Protein (VDRE-BP) , or a functional fragment thereof, wherein said VDRE-BP is distinct from vitamin D receptor.

2. Isolated nucleic acid encoding Vitamin D Response Element-Binding Protein (VDRE-BP) , or functional fragments thereof, wherein said isolated nucleic acid comprises a nucleic acid selected from: (a) DNA encoding the amino acid sequences set forth in SEQ ID NOS : 2 or 4,

(b) DNA that hybridizes to the DNA of (a) under moderately stringent conditions, wherein said DNA encodes biologically active VDRE-BP, or

(c) DNA degenerate with respect to the DNA of (b) , wherein said degenerate DNA encodes biologically active VDRE-BP.

3. A nucleic acid according to claim 2, wherein said nucleic acid hybridizes under high stringency conditions to the VDRE-BP coding portion of SEQ ID N0S:1 or 3.

4. A nucleic acid according to claim 2, wherein the nucleotide sequence of said nucleic acid is substantially the same as set forth in SEQ ID NOS : 1 or 3.

5. A nucleic acid according to claim 2, wherein the nucleotide sequence of said nucleic acid is the same as that set forth in any of SEQ ID NOS : 1 or 3.

6. A nucleic acid according to claim 2, wherein said nucleic acid is cDNA.

7. A vector containing the nucleic acid of claim 2.

8. Recombinant cells containing the nucleic acid of claim 2.

9. An oligonucleotide comprising at least 14 nucleotides capable of specifically hybridizing with at least one of the nucleotide sequences set forth in SEQ ID NOS:l or 3.

10. An oligonucleotide according to claim 9, wherein said oligonucleotide is labeled with a detectable marker.

11. An antisense-nucleic acid capable of specifically binding to mRNA encoded by the nucleic acid of claim 2.

12. A kit for detecting the presence of the VDRE-BP cDNA sequence comprising at least one oligonucleotide according to claim 9.

13. An isolated Vitamin D Response

Element-Binding Protein (VDRE-BP) characterized by having ability to bind to a vitamin D response element (VDRE) , wherein said VDRE-BP is distinct from vitamin D receptor.

14. A VDRE-BP according to claim 13, wherein said VDRE-BP binds a single VDRE half-site.

15. A VDRE-BP according to claim 13, wherein said VDRE-BP binds a single nucleic acid strand of said VDRE.

16. A VDRE-BP according to claim 13, wherein said VDRE-BP binds said VDRE without binding to a ligand.

17. A VDRE-BP according to claim 13, wherein the amino acid sequence of said protein comprises substantially the same sequence as SEQ ID NOS : 2 or 4.

18. A VDRE-BP according to claim 17 comprising the same amino acid sequence as set forth in SEQ ID NOS : 2 or 4.

19. A VDRE-BP according to claim 13, wherein said protein is encoded by a nucleotide sequence comprising substantially the same nucleotide sequence as set forth in SEQ ID NOS : 1 or 3.

20. A VDRE-BP according to claim 19, wherein said protein is encoded by a nucleotide sequence comprising the same sequence as set forth in SEQ ID NOS : 1 or 3.

21. A method of preparing VDRE-BP, said method comprising culturing cells of claim 8 under conditions suitable for expression of said VDRE-BP.

22. An isolated anti-VDRE-BP antibody having specific reactivity with a VDRE-BP according to claim 13.

23. Antibody according to claim 22, wherein said antibody is a monoclonal antibody.

24. An antibody according to claim 23, wherein said antibody is a polyclonal antibody.

25. A composition comprising an amount of the VDRE-BP, according to claim 13, effective to modulate an activity of vitamin D receptor and an acceptable carrier.

26. A transgenic nonhuman mammal expressing exogenous nucleic acid encoding a VDRE-BP.

27. A transgenic nonhuman mammal according to claim 26, wherein said nucleic acid encoding said VDRE-BP has been mutated, and wherein the VDRE-BP so expressed is not native VDRE-BP.

28. A transgenic nonhuman mammal according to claim 26, wherein the transgenic nonhuman mammal is a mouse .

29. A method for identifying nucleic acids encoding a mammalian VDRE-BP, said method comprising: contacting a sample containing nucleic acids with an oligonucleotide according to claim 9, wherein said contacting is effected under high stringency hybridization conditions, and identifying nucleic acids which hybridize thereto.

30. A method for detecting the presence of a human VDRE-BP in a sample, said method comprising contacting a test sample with an antibody according to claim 22, detecting the presence of an antibody-VDRE-BP complex, thereby detecting the presence of a human VDRE-BP in said test sample.

31. Single strand DNA primers for amplification of VDRE-BP nucleic acid, wherein said primers comprise a nucleic acid sequence derived from the nucleic acid sequence set forth as SEQ ID NOS : 1 or 3.

32. A method for modulating the activity of vitamin D receptor, comprising contacting a vitamin D response element (VDRE) with a substantially pure VDRE-BP, or a VDRE-binding fragment thereof.

33. The VDRE-BP of claim 13, wherein said VDRE comprises the sequence -RGK]K₂SA-.

34. A method to identify proteins that bind one or more VDRE sequences, comprising using one or more repeats of the VDRE sequence of claim 33 to identify proteins that bind said sequences, wherein said protein is selected from the group consisting of:

(a) protein that binds a single VDRE half-site,

(b) protein that binds single a single nucleic acid strand (c) protein that binds said one or more VDRE sequences without binding to a ligand (d) protein having a domain with substantially the same amino acid sequence as a nucleic acid binding domain in the hnRNP family.

35. A method to identify compounds that bind to VDRE-BP, comprising using the VDRE-BP of claim 13 in a binding assay to identify compounds that bind to said VDRE-BP.

36. A compound that binds to the VDRE-BP of claim 13.