WO2001018173A2 - Dominant negative neuropilin-1 - Google Patents

Abstract

Neuropilins have recently been characterized as receptors for secreted semaphorins. The present invention provides a dominant negative form of neuropilin-1 comprising a deletion construct of one of its extracellular domains. Expression of this variant in cultured primary sympathetic neurons blocks the paralysis of growth cone motility normally induced by SEMA-3A (collapsin-1, semaphorin III, semaphorin D) and SEMA-3C (collapsin-3, semaphorin E), but not that induced by SEMA-3F (semaphorin IV). Other truncated forms of neuropilin-1, such as a variant missing the cytoplasmic domain, fail to act as a dominant negative receptor component. Thus, overexpression of dominant negative neuropilins provide a powerful new method of blocking the functions of selected secreted semaphorins, as demonstrated by the modulation of olfactory axon trajectory in a developing animal model.

Description

Dominant Negative Neuropilin-1

REFERENCE TO RELATED APPLICATIONS

This application claims priority to U.S. Provisional Application 60/153,309, filed September 10, 1999 and U.S. Provisional Application 60/171,176, filed December 16, 1999.

GOVERNMENT SUPPORT

This work was supported in part by grants from the National Institutes of Health, grant numbers RO1-NS26527 and T32HD07516. The government may have certain rights in this invention.

BACKGROUND OF THE INVENTION

The development of a functional nervous system in the embryo requires that axons navigate through a complex environment, sometimes over long distances, to locate their correct synaptic targets (reviewed in Tessier-Lavigne et al., Science 274:1123-1133 (1996); US Pat. No. 6,054,293). Motile growth cones at the growing tips of axons, detect and respond to a multitude of diffusible, extracellular matrix or cell surface chemoattractant and chemorepellent guidance cues in their environment. At the molecular level, two families of guidance cues, the netrin and semaphorin families, have been shown to comprise members that can act as chemorepellents. The semaphorins are a large family of structurally diverse secreted and transmembrane proteins, characterized by the presence of a conserved domain (about 500 amino acids) at the amino end of the molecule (Kolodin et al., Trends in Cell Biol. 6:15-22 (1996)).

Class 3 semaphorins are secreted proteins of about 120 kD. (Yu et al., Neuron 22:11- 14 (1999)). The best characterized member of this class, SEMA-3A (also known as chick collapsin-1) and its mammalian homologs (semaphorin-III in humans, and semaphorin-D in mice) are secreted members of the semaphorin family of signaling proteins that possess, in addition to the semaphorin domain, an immunoglobulin domain and a highly basic carboxy- terminal domain (Luo et al, Cell 75:217-227 (1993); Kolodin et al, Cell 75:1389-1399 (1993) Messersmith et al, Neuron 14:949-959 (1995); Puschel et al, Neuron 14:941-948 (1995)). When presented from a point source, it has been shown to act as a repellent guidance cue for a vaπety of specific sensory and sympathetic axons, and has been implicated in patterning sensory ax on projections into the ventral spmal cord

Recombmant SEMA-3A inhibits the motihty of growth cones from explanted dorsal root ganglia neurons (DRG) (Luo et al , 1993), sympathetic neurons (Koppel et al , Neuron 19 531-537 (1997), Adams et al EMBO J 16 6077-6086 (1997)), motor neurons (Shepherd et al , 1996;

Shepherd et al Development 124 1377-1385 (1997), Varela-Echavama et al , Neuron 18 193-207 (1997)), sensory neurons from the cranial nerve ganglia V and VII (Kobayashi et al , J Neurosci 17 8339-8352 (1997)), olfactory sensory neurons (Kobayashi et al , 1997), cortical neurons (Bagnard et al, Development 125 5043-53 (1998)), and hippocampal neurons (Chedotal et al, Development 125:4313-23 (1998)) Semaphonns III and IV repel hippocampal axons via two distinct receptors In collagen stabilized cultures it has been shown to repel sensory axons projecting from explanted DRGs (Messersmith et al , 1995) and motor axons from most motor nuclei in the bramstem (Varela- Echavarπa et al , 1997) Knocking out the homologous protein (semaphoπn-D) in embryonic mice has been shown to result m defasciculation and aberrant pathfmdmg of penpheral axon projections (Behar et al , Nature 383:525-528 (1996), Tamguchi et al , Neuron 19 519-530 (1997))

The semaphoπn family now includes more than 20 members Several of these are secreted proteins structurally related to SEMA-3A SEMA-3C (chick collapsm-3, mouse semaphonn-E) and SEMA-3F (human sema-IV) have overall domain structures identical to SEMA-3A and share about a 50% ammo acid sequences identity to SEMA-3A and to each other (Adams et al , 1997, Chen et al , Neuron 21.1283-1290 (1998), Koppel et al , Neuron 19:531-537 (1997)) All three of these semaphoπn family members induce the collapse of sympathetic growth cones, but only SEMA-3A induces the collapse of DRG growth cones (Chen et al, Neuron 19:547-559 (1997); Koppel et al, 1997, Giger et al , J Neurosci. Res 52:27-42 (1997) All three are expressed in overlapping patterns in the developing embryo (Adams et al., 1996, Shepherd et al , Dev Biology 173:185-199 (1996), Giger et al , Neuron 21:1079-1092 (1998)) and are likely to act as repellents that help guide penpheral axons, particularly sympathetic axons, along their appropπate trajectoπes

Significant progress has been made in identifying receptors for these axonal guidance molecules A cell surface protein recently identified as a receptor or receptor component for SEMA-3A, neuropιlm-1, has been identified by expression cloning (He et al , Cell 90 739- 751 (1997); Kolodkm et al , Cell 90 753-762 (1997)) Neuropilm- 1 has a large extracellular domain containing 5 distinct sub-domains, a single transmembrane domain, and a short cytoplasmic domain (Figure 1A). The 5 extracellular domains, al, a2, bl, b2, and C, have been defined by their homology to other proteins (Takagi et al, Neuron 7:295-307 (1991)). Domains al and a2 are related to each other and to the non-catalytic region of the complement components Clr and Cls. The bl and b2 domains are related to each other and to the Cl and C2 domains of coagulation factors VIII and V. A portion of the C domain shares homology to MAM domains found in a variety of proteins that are thought to mediate homophilic protein-protein interactions (Beckmann et al, Trends Biochem. Sci. 18:40-41 (1993); Zondag et al, J. Biol. Chem. 270: 14247-12250 (1995)).

Neuropilin-1 is expressed in SEMA-3A sensitive neurons as they extend their axons during development (Takagi et al, Develop. Biol. 170: 207-222 (1995)). Antibodies directed against neuropilin-1 inhibit SEMA-3A induced collapse of growth cones from DRGs (He et al, 1997, Kolodkin et al, 1997), and DRGs from neuropilin-1 knockout mice are unresponsive to SEMA-3A when tested in the growth cone collapse assay (Kitsukawa et al, Neuron 19:995-1005 (1997)). In addition, neuropilin-1 knockout mice have a phenotype that is similar to the SEMA-3A knockout mouse until they die between E10.5 and E13.5 dpc. Thus, it is apparent that neuropilin-1 is required in neurons for SEMA-3A responsiveness.

Although neuropilin-1 is necessary for SEMA-3A function, several lines of evidence suggest that, by itself, it is unlikely to comprise the complete SEMA-3 A receptor (Feiner et al, Neuron 19:539-545 (1997)). First, neuropilin-1 has an extremely short cytoplasmic tail, lacking any known signaling motifs. Second, a wide variety of secreted semaphorin family members bind to neuropilin-1 with approximately equal affinities, yet as described above, they do not all have the same biological specificities. Third, alkaline phosphatase (AP)- tagged versions of these semaphorins bind in overlapping, but distinct patterns, on sectioned embryonic tissues, suggesting that binding specificities are determined by more than the distribution of neuropilin-1. Nevertheless, until the present invention, the role of neuropilin- 1 with regard to receptors responsive to secreted semaphorins remained unknown, and it was unclear whether additional receptor components affected binding specificities and biological responsiveness. Determination of dominant negative receptors and characterization of neuropilin-1 could have significant impact on triggering and controlling axon regeneration, and overexpression of this molecule may affect the activities of semaphorins during embryogenesis in vivo. In addition, a dominant negative form of neuropilin-1 would be of considerable practical use in studying the role semaphorins play in growth cone guidance. However, semaphorins appear to have overlapping functions in vivo, based upon their overlapping patterns of expression; their ability to share at least one receptor component, and the similarities of their biological activities. Therefore, an analysis of animals in which only one factor is knocked out would be relatively uninformative. One way to avoid this difficulty would be to examine axon trajectories in animals missing the shared receptor component neuropilin-1. Unfortunately however, neuropilin-1 knockout embryos die before the formation of many of the projections likely to be affected. Thus, overexpression of a dominant negative neuropilin-1 in older embryos would provide a very useful alternative to a knockout strategy. Moreover, a dominant negative approach to blocking semaphorin function would be advantageous since multiple family members with similar biological functions could be blocked all at once.

SUMMARY OF THE INVENTION

The present invention focuses on a dominant negative form of neuropilin-1, and on its functional role in semaphorin receptors. The invention provides several neuropilin-1 constructs, which are missing specific structural domains, and which are expressed in cultured primary sympathetic cells responsive to several secreted semaphorins. Further, the invention provides a method for effectively blocking the responsiveness to multiple secreted semaphorins by the use of the dominant negative neuropilin-1. Specifically, by deleting a portion of the extracellular domain of neuropilin-1, a dominant negative construct has been generated which blocks the activities of both SEMA-3A and SEMA-3C, but it does not affect SEMA-3F, confirming that neuropilin-1 is a component of receptors for some, but not all, secreted semaphorins.

The practical application of dominant negative neuroplin-1 is demonstrated in an animal olfactory sensory axon system. Expressing dnNP-1 in olfactory sensory axons alters their trajectories when they reach the telencephalon. Instead of pausing at the surface of the brain and waiting for their target, the olfactory bulb, to mature as they normally would; dnNP-1 expressing axons enter the brain prematurely and overshoot the area that will become their appropriate target. These results indicate that class 3 semaphorins act as repellents in vivo and prevent axons from entering their target prematurely. Embodiments of the present invention provide an isolated DNA encoding a dominant negative receptor, wherein the DNA comprises a nucleic acid sequence encoding a neuropilin-1 which has semaphorin receptor specific antigenicity or immunogenicity, including homologs, modifications, derivatives and active fragments thereof. The DNA can be isolated from natural sources, recombinantly or chemically created, or a chimera from more than one source. Typically, the DNA is isolated from a developing or embryonic animal. As provided, the DNA may me found in a recombinant cell or tissue, or in a vector capable of expression.

In addition, the invention provides an isolated polypeptide encoded by the DNA, including homologs, analogs, variants and active fragments thereof. The isolated polypeptide comprises a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F. In particular, the polypeptide comprises a C-domain deletion construct of neuropilin-1, including homologs, analogs, variants and active fragments thereof. A prefeπed embodiment provides a polypeptide, wherein amino acid residues Ala₂₅₈ to Ile₈₅i are deleted from a full- length neuropilin-1 molecule, and includes homologs, analogs, variants and active fragments of the polypeptide.

Also provided is a method of modulating or inactivating the activity of selected secreted semaphorins, comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F. In a prefeπed embodiment of the method, the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1, particularly wherein amino acid residues Ala ₅₈ to Ile₈ ι are deleted from a full-length neuropilin-1 molecule. The present invention is further embodied by a method of inhibiting or preventing the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, said method comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3 A and for semaphorin 3C, but not for semaphorin 3F. Also provided is the method, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin- 1 , particularly wherein amino acid residues Ala₂₅₈ to Ilessi are deleted from a full-length neuropilin-1 molecule. In addition, the method is provided, wherein the axon growth occurs in a developing neurological system, and wherein the axon growth occurs in a regenerating neurological system.

Also provided in embodiments of the present invention is an in vivo method for modulating overgrowth or premature entry of axons to their targets, said method comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F. Moreover, there is provided the method, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1, particularly wherein amino acid residues Ala ₅₈ to Ile₈₅ι are deleted from a full-length neuropilin-1 molecule. In addition, the method is provided, wherein the axon growth occurs in a developing neurological system, and wherein the axon growth occurs in a regenerating neurological system.

Yet additional embodiments of the present invention provide a method for enhancing axon generation or regeneration by blocking secreted semaphorin binding, said method comprising adding or overexpressing a dominant negative receptor, which has receptor- specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F. Also, there is provided the method, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1, particularly wherein amino acid residues Ala₂₅₈ to Ile₈₅ι are deleted from a full-length neuropilin-1 molecule. In addition, the method is provided, wherein the axon growth occurs in a developing neurological system, and wherein the axon growth occurs in a regenerating neurological system.

Also provided is a method of screening for an agent which modulates the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, wherein the method comprises the steps of: a) incubating a mixture comprising an isolated dominant negative neuropilin-1, a binding target of the polypeptide, and a candidate agent, under conditions whereby, but for the presence of the agent, said polypeptide binds the binding target at a reference affinity; and b) detecting the binding affinity of said polypeptide to said binding target to determine the agent-biased affinity, wherein a difference between the agent-biased affinity and the reference affinity indicates that said agent modulates the binding of the polypeptide to the binding target.

Additional objects, advantages and novel features of the invention will be set forth in part in the description, examples and figures which follow, and in part will become apparent to those skilled in the art on examination of the following, or may be learned by practice of the invention.

DESCRIPTION OF THE DRAWINGS The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings, certain embodiment(s) which are presently prefeπed. It should be understood, however, that the invention is not limited to the precise aπangements and instrumentalities shown. Figures 1A and IB depict neuropilin-1 deletion constructs and their expression products. In Figure 1 A, the domain structure of full length neuropilin-1 is shown on the left, and the deletion constructs used in this study are aπayed to the right. The domains are described in the boxed key and the boundaries between domains are defined in the text. In Figure IB, HEK293T cells were transfected with the neuropilin-1 constructs shown in Figure 1A.

Figure 2 is a table summarizing the domain mapping of SEMA-3 A binding to neuropilin-1. Full length and partial AP -tagged SEMA-3 A constructs (top row) were tested for binding to various neuropilin-1 constructs (first column). Schematics of neuropilin-1 deletion constructs from different labs are shown with the amino acid numbers used to define domain deletion boundaries. (') refers to results from Renzi et al, 1999; (²) refers to results from Giger et al, 1998; (³) refers to results from Nakamura et al, Neuron 21 : 1093-1100 (1998)). Neuropilin-1 deletion constructs with break points differing by 12 amino acids or less are grouped together. Binding results are expressed as: (+++) strong binding, (+) weak binding, (-) no detectable binding, and ( ) not tested. The symbol "§" indicates an entry wherein the results differed between two labs in experiments using similar reagents. Figures 3A-3C depict models showing how neuropilin-1 could be involved in semaphorin signaling. In Figure 3 A, it would be unlikely that neurolpilin-1 acts as a type I receptor, rather semaphorin signaling would involve a second component. In Figure 3B, additional factor(s) may be present as preformed complexes with neuropilin-1 on the cell surface. Figure 3C depicts the model most consistent with the data of the present invention, wherein a second component is recruited into the neuropilin/semaphorin complex following ligand binding. Figures 4A and 4B depict mapping of the SEMA-3 A binding sites to neuropilin-1 domains. In Figure 4A, HEK293T cells were transiently transfected with A-, B-, or C- deletion neuropilin-1 and probed with approximately 1.5 nM AP-SEMA-3A (Top, reported at 1 hour; Middle, reported at 48 hours), or with an anti-myc antibody (Bottom). Staining with anti-myc demonstrates that all constructs are expressed on the cell surface. In Figure 4B, the same neuropilin-1 deletion constructs were probed with approximately 3 nM of AP -tagged semaphorin domain from SEMA-3A (AP-Sema) (Top, reported at 1 hour; Middle, reported at 48 hours), or with 1.5 nM of AP-tagged Ig-basic domains from SEMA-3A (AP-Ig-basic) (Bottom). Scale bar: Figure 4A, 62.5 μm; Figure 4B, 100 μm. Figures 5A-5F depict expression of truncated, full-length and deletion neuropilin-1 constructs in growth cones from cultured sympathetic neurons. Myc-tagged recombinant proteins were visualized using an anti-myc ascities and a Cy3 conjugated secondary antibody. The constructs, as described in the figure legends, are Figure 5 A, truncated trk-b; Figure 5B,truncated trk-b + SEMA-3 A; Figure 5C, full length neuropilin-1; Figure 5D, full length neuropilin-1 + SEMA-3 A; Figure 5E, C-deletion neuropilin-1 ; and Figure 5F, C-deletion neuropilin-1 + SEMA-3 A. Scale bar, 20 μm.

Figures 6A-6C show that C-deletion neuropilin-1 is a dominant negative receptor component for SEMA-3A. Sympathetic neurons were transfected with the indicated constructs and then exposed to either control media or media containing AP-SEMA-3 A. Figure 6 A shows the resulting number of labeled neurites with growth cones following the addition of 10 cu. of AP-SEMA-3 A As shown, the addition induced collapse in growth cones expressing TrTrk-B, full length neuropilin-1, and cytoplasmic-deletion neuropilin-1. As shown in Figure 6B, expression of B-deletion neuropilin-1 caused a partial block of SEMA-3A induced collapse. When sympathetic neurons were transfected with test constructs, and then re-aggregated, growth cones expressing TrTrk-B, full length neuropilin-1 and B-deletion neuropilin-1 all collapsed in response to AP-SEMA-3 A. Growth cones expressing C-deletion neuropilin-1 did not respond to SEMA-3 A (Figure 6B). The standard error of mean (s.e.m.) of three to eight experiments is shown for each condition. (* p < 0.01; ** p< 0.001 by Student's two tailed t-test ). In Figure 6C, sympathetic neurons were transfected with either full length or C-deletion neuropilin-1 and then re-aggregated. 10, 30, or 100 cu. SEMA-3A induced approximately 85% growth cone collapse in neuropilin-1 transfected neurons, whereas neurons transfected with C-deletion neuropilin-1 did not respond to 10 or 30 cu. of AP-SEMA-3 A and were partially responsive at 100 cu.

Figure 7 A and 7B shows that C-deletion neuropilin-1 is a dominant negative receptor component for SEMA-3C, but not for SEMA-3F. Sympathetic re-aggregates were transfected with TrTrk-B, full length neuropilin-1 or C-deletion neuropilin-1 and treated with 10 cu. of AP-SEMA-3C or 10 cu. of AP-SEMA-3F. As shown in Figure 7A, growth cones expressing TrTrk-B or full length neuropilin-1 are shown to collapse when exposed to AP- SEMA-3C. Neurons expressing C-deletion neuropilin-1 did not respond to AP-SEMA-3C. As shown in Figure 7B, growth cones expressing TrTrk-B or C-deletion neuropilin-1 were seen to collapse normally in response to AP-SEMA-3F. The s.e.m. of 4 experiments is shown (** p< 0.001 by Student's two tailed t-test ).

Figure 8 shows that C-deletion neuropilin-1 is not a dominant negative receptor component for collapse induced by the semaphorin domain of SEMA-3 A. The s.e.m. of four experiments is shown for each condition. Figures 9A-9C depict transfection of olfactory epithelium in the embryonic chick using in ovo electroporation. Figure 8 A shows a stage 13 embryo marked with blue dye to show the injection site beneath the amniotic membrane and adjacent to the nasal pit. The electrodes (+, -) were placed 5mm apart and positioned as shown. Figure 9B shows the distribution of transfected cells in E4 whole mount embryo. AP-labeled transfected cells can be seen in and around the nasal pit. Figure 9C shows a whole mount preparation of an E6 embryo bisected at the midline and viewed from the medial surface. Labeled olfactory axons leave the olfactory epithelium at lower left and project within the olfactory nerve to the nascent olfactory bulb.

Figures 10A-10C depict the progressive development of the olfactory nerve in the embryonic chick. As shown, embryos were sectioned through the developing olfactory nerve, and olfactory sensory axons were visualized using an anti-neurofilament antibody and a Cy3 conjugated secondary antibody. In Figure 10A, at the E5 stage, sensory axons have grown out of the olfactory epithelium and crossed the intervening mesenchyme to reach the telencephalon, but stop upon contact with the surface of the telencephalon and do not enter the central nervous system (CNS). In Figure 10B, E7 olfactory axons continue to project to and accumulate on the surface of the telencephalon. In Figure 10C, at the E9 stage, the olfactory bulb has formed and olfactory axons form the olfactory nerve layer. Figures 11 A-l IF show that olfactory axons expressing dnNP-1 are more likely to overshoot their target. In whole mount images of E7 chick brains, AP-labeled axons (seen in purple) can be seen extending in the olfactory nerve to the telencephalon. The majority of olfactory axons expressing AP+BGal (Figures 11 A, 11C, 1 IE) stop outside of the telencephalon and do not enter the CNS, although occasionally a single axon expressing AP+BGal grew past the surface of the telencephalon and into the CNS. Olfactory axons expressing dnNP-1 (Figures 11B, 11 D, 11 F) show an increased tendency to enter and extend within the telencephalon.

Figure 12 is a graph quantifying the average number of axon guidance eπors in transfected olfactory axons. The total number of mis-guided olfactory axons (y-axis) is compared to the total number of axons (x-axis) in embryos co-transfected with either AP+BGal (open squares) or AP + dnNP-1 (filled squares).

Figures 13A-13F depict dnNP-1 expressing axons that overshoot their target grow into the telencephalon. The trajectories of olfactory axons expressing dnNP-1 were reacted with AP-histochemistry and examined in whole mounts at E7 (Figures 13 A, 13D). The brains were then sectioned and probed with anti-neurofilament antibodies to visualize axons within the CNS (Figures 13C, 13F). The majority of overshooting axons extended on the medial side of the forebrain. In Figure 13D, in rare instances (2 of 16 embryos), a large bundle axons overshot on the lateral side. In Figure 13B, bright field, and in Figure 13C, a composite section of bright field and fluorescence, show that axons overshooting on the medial side extend within the telencephalon, just below the pial surface. In Figure 13D, a bright field, and in Figure 13E, a composite section show that the axons overshooting on the lateral side extended outside the CNS.

Figures 14A and 14B depict overshooting olfactory axons persist in E9 embryos. The trajectories of the olfactory axons from four E9 embryos cotransfected with AP+BGal are compared to those of four E9 embryos co-transfected with AP + dnNP-1. In Figure 14A, axons expressing AP+BGal projected to the superficial layers of the nascent olfactory bulb. No labeled axons were found extending beyond the olfactory bulb/forebrain border. In Figure 14B, axons expressing dnNP-1 covered the surface of the nascent olfactory bulb. Some of these axons overshot the bulb/forebrain border and grew extensively over the surface of the brain. Figures 15A-15F depict dnNP-1 expressing axons, and show their confinement to the olfactory nerve fiber layer. Whole mount views of E9 olfactory axon projections are shown in embryos co-transfected with AP+BGal (Figure 15 A), and with AP+dnNP-1 (Figure 15B). Bright field images (Figures 15B and 15E), and composites of a bright field and fluorescent images (Figures 15C and 15F) demonstrate that both control and dnNP-1 expressing axons extended into the olfactory nerve layer.

Figures 16A-16L depict expression of class 3 semaphorins in the developing olfactory system. Horizontal sections though the telencephalon and developing olfactory nerve of E5, E7 and E9 embryos were incubated with Digoxigenin (DIG)-labeled antisense RNA probes for chick SEMA-3 A, SEMA-3C, SEMA-3D, and SEMA-3E. SEMA-3 A is expressed in superficial layers of the telencephalon, while SEMA-3C, SEMA-3D and SEMA-3E are expressed weakly in the olfactory nerve (Figures 16B, 16C, 16D).

DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION In the present invention, also as set forth in part in Renzi et al, J. Neuroscience

19(18):7870-7880 (Sept 15,1999), a variety of neuropilin-1 deletion constructs were developed and tested for both their ability to bind full length and truncated forms of SEMA- 3A, and for their ability to interfere with SEMA-3A function in sympathetic neurons. Sympathetic neurons are known to be responsive to at least 3 secreted semaphorins: SEMA- 3 A, SEMA-3C, and SEMA-3F. The results of the studies are presented in Figure 2, along with the results of similar experiments reported by other laboratories (Giger et al, 1998; Nakamura et al, Neuron 21 :1093-1100 (1998)).

Full length and partial AP-tagged SEMA-3A constructs (top row) were tested for binding to various neuropilin-1 constructs (first column). Schematics of neuropilin-1 deletion constructs from different labs are shown with the amino acid numbers used to define domain deletion boundaries. For example, in certain instances, as shown, Giger et al, (1998) observed no binding, while in the present invention, binding was seen after developing the reactions for very long times.

Although the neuropilin-1 and SEMA-3 A constructs used by the various groups are not always strictly comparable, several interesting conclusions can be drawn. First, neither the A domain, nor the C domains of neuropilin-1 are required for full length SEMA-3 A binding. Second, the same appears to be true for both the Ig and the Basic portions of SEMA-3 A. Third, in contrast, neither the A domain, nor the B domains of neuropilin-1 appear to be required for the binding of the semaphorin portion of SEMA-3 A. These results suggest that the Ig-Basic portion of SEMA-3 A binds to the B domain, while the semaphorin portion of SEMA-3 A binds to the C domain. Tentative conclusions can also be drawn about the necessity of smaller stretches of amino acids. The amino acids 254-274 near the junction of the A and B domains of neuropilin-1 appear to be essential for the binding of the Ig-Basic portion of SEMA-3A. In addition, it appears that the semaphorin portion of SEMA-3 A binds to sequences within the C domain that are exclusive of the MAM domain. These findings reveal a complex multi-site interaction between SEMA-3 A and neuropilin-1.

Although the precise mechanism by which neuropilin-1 mediates semaphorin function is not yet certain, it was an objective of this work to generate a dominant negative neuropilin- 1 that could be used to help distinguish whether neuropilin-1 acts as a simple type I receptor in which the binding of ligand to the extracellular portion of neuropilin-1 causes the direct activation of an mtracellular signaling pathway via the cytoplasmic tail, or whether it is an essential component of one or more receptor complexes, each of which is activated by specific semaphorin ligands (Feiner et al, 1997). In light of the present findings, it appears that neuropilin-1 binds specific semaphorins, and then presents them to additional receptor components that initiate signal transduction. If neuropilin-1 were a simple type I receptor as proposed in FIG. 3 A, then it would be reasonably straightforward to predict the kinds of truncations that are likely to generate dominant negative variants. Previous experiments with Type I receptors have shown that the deletion of their cytoplasmic domains generally makes a dominant negative receptor. When overexpressed in cells that would normally respond to a ligand, the truncated receptor interferes with normal receptor function either by sequestering ligand upon inactive receptors (Ross et al, Mol Endocrinol 11:265-273 (1997); Moriggl et al, Eur. J. Biochem. 251:25-35 (1998)), or by forming inactive multimers with wild type receptors (Ueno et al. J. Biol. Chem. 268:22814-22819 (1993); Peπot-Applanat et al, Mol. Endocrinol. 11:1020-1032 (1997)). Alternatively, overexpression of receptor variants in which the cytoplasmic domains are intact and extracellular domains are missing can sometimes generate dominant negative receptors that sequester downstream signaling components in an inactive complex (Dosil et al, Mol Cell Biol. 18:5981-5991 (1998); Maruyama et α/., Biochem. Biophys. Res. Commun. 246: 142-147 (1998)).

Consequently, truncated versions of neuropilin-1 were constructed that were missing either the cytoplasmic domain or all extracellular domains. Neuropilin-1 missing the cytoplasmic domain reached the cell surface and bound AP-SEMA-3 A, indicating that the presence or absence of the cytoplasmic domain does not affect its ability to bind ligand. On the other hand, expression of neuropilin-1 missing the cytoplasmic domain in cultured sympathetic neurons did not alter their responsiveness to SEMA-3A. Therefore, it does not interfere with the functional activity of endogenous neuropilin-1, and it does not act as a dominant negative receptor. Similarly, a variant of neuropilin-1 that includes only its transmembrane and cytoplasmic domain regions was found to reach the surface of sympathetic neurons, but it did not alter their responsiveness to SEMA-3A (data, not shown). Taken together, these results argue strongly that neuropilin-1 does not act as a Type I receptor. Further evidence supporting this conclusion is the recent observation that SEMA- 3 A responsiveness can be confeπed on otherwise unresponsive retinal ganglion cell axons by the expression of either full length neuropilin-1, or a variant of neuropilin-1 in which the cytoplasmic domain is missing (Nakamura et al, 1998; Takahashi et al, Nature Neuroscience 1:487-493 (1998)).

These findings further demonstrate that neuropilin-1 interacts with an additional receptor component, that in turn initiates signal transduction. This conclusion is further strengthened by the finding in the present invention that a version of neuropilin-1, missing its extracellular C domain, blocks the response of sympathetic neurons to SEMA-3 A. There are several mechanisms by which this variant could act as a dominant negative receptor component. The deleted portion of the molecule contains within it a single MAM-like domain.

MAM domains have been shown to be involved in protein-protein interactions. Several studies have implicated MAM domains in the formation of homodimeric complexes of receptor proteins (Zondag et al, 1995; Marchand et al, J. Biol. Chem. 271:24236-24241 (1996)), and recent evidence indicates that the MAM domains in neuropilins cause them to associate with one another in a ligand independent fashion (Chen et al, 1998; Giger et al, 1998; Takahashi et al, 1998). One possible explanation for this finding is that C-deletion neuropilin-1 binds SEMA-3 A into incompletely organized receptor complexes that are not functional. Either the association of neuropilin-1 with itself, with neuropilin-2, or with an as yet unknown receptor component could be prevented by the absence of the C domain. An alternative model could also explain how C-deletion neuropilin-1 acts as a dominant negative receptor component for SEMA-3A. Previous studies have demonstrated that the semaphorin domain contains a short stretch of sequence which determines the biological specificity of each secreted semaphorin, and it is possible that this sequence triggers signaling activity when presented by neuropilin-1 to a nearby transducing molecule (Koppel et al, 1997). The Ig-basic domains of SEMA-3A bind to the B domain of neuropilin-1, while the semaphorin domain of SEMA-3 A binds outside of the B domain (Chen et al, 1998; Giger et al, 1998; Nakamura et al, 1998; Renzi et al, 1999). Present findings indicate that semaphorin domain binding is greatly reduced in the absence of the C domain. This suggests that the C domain contributes to a semaphorin domain binding site. When present binding data is compared with that of Giger et al. (1998), it becomes apparent that this semaphorin domain binding site is outside of the MAM domain. Thus, it is possible that in the absence of this site, the semaphorin domain of SEMA-3 A is incapable of activating the signal transducing component, either because it is mis-positioned when bound to neuropilin-1, or because it fails to assume a required conformational configuration. C- deletion neuropilin-1 would then block SEMA-3 A activity by binding the ligand, but failing to present it properly to a transducing receptor component. Both of these models predict that neuropilin-1 must interact with additional receptor components to form a functional receptor. However, it is not clear from the model whether these components are preassembled with neuropilin-1 (Figure 3B), or whether they are recruited after neuropilin-1 binds its ligand (Figure 3C). In fact, however, the present data is consistent with the latter model - the components are recruited after ligand binding. This conclusion stems from the observation that although C-deletion neuropilin-1 acts as a dominant negative receptor component for full length SEMA-3 A, it does not interfere with the action of the Sema-Fc fusion protein, wherein Fc refers to the constant region of the molecule. The Sema-Fc fusion protein is described in detail by Koppel et al, 1997; Koppel et al, J. Biol. Chem. 273:15708-15713 (1998), both of which are herein incorporated by reference.

The failure of C-deletion neuropilin-1 to block the activity of this truncated ligand implies that Sema-Fc either (1) acts directly on the presumptive transducing receptor component, or (2) uses native full length neuropilin-1 on the cell surface to access the transducer. The first of these possibilities is unlikely since the presence of neuropilin-1 has been shown to be absolutely required for full length SEMA-3 A to induce collapse (Kitsukawa et al, 1997; Chen et al, 1998; Giger et al, 1998). Therefore, given that the presumptive transducing receptor component cannot be activated without the cooperation of neuropilin-1, it was concluded that Sema-Fc should, therefore, be unable to activate a transducing receptor component directly.

Confirming this conclusion, the present data show that the engineered C-deletion neuropilin-1 does not bind and, therefore, cannot sequester Sema-Fc. Instead, Sema-Fc interacts, as it normally would, with native neuropilin-1 that is still present on sympathetic neurons overexpressing C-deletion neuropilin-1. The native neuropilin-1 then presents Sema-Fc to the presumptive transducing receptor component. This can occur only if native neuropilin-1 still has access to the transducing receptor component. Consequently, the overexpressed C-deletion neuropilin-1 is not pre-assembled with, and therefore does not prevent access of native neuropilin-1 to, the transducer. Thus, a model consistent with these findings is presented in the present invention, wherein neuropilin-1 does not preassemble with the transducing component, but recruits the transducing unit after SEMA-3A is bound.

Nevertheless, although neuropilin-1 acts as a receptor component for multiple secreted semaphorins, it is not involved in the activities of all. C-deletion neuropilin-1 effectively blocks the collapse of sympathetic growth cones induced by SEMA-3 A and SEMA-3C, but does not block collapse induced by SEMA-3F. These results demonstrate that C-deletion neuropilin-1 is specific in its dominant negative effect in each of the semaphorins, and the effect is not acting through a nonspecific artifactual mechanism.

The DNA or nucleotide sequences and the polypeptide or amino acid sequences of the present invention are isolated or pure, meaning that the molecule is unaccompanied by at least some material with which it is associate in its natural state, preferably constituting at least about 0.5%, and more preferably about 5% in a given sample. The domains may be synthesized or produced by recombinant technology, or purified from developing warmblooded animals, preferably avian or mammalian, more preferably chicken, mouse or human cells or embryos. Many techniques for synthesis or recombinant production of this type of deletion construct are well known in the art. Preferred nucleic acid sequences include, synthetic/non-natural sequences and/or are isolated as previously defined, for example, deletion constructs of the neuropilin-1 gene, preferably the C domain deletion construct described above, although C-deletion construct in which the cytoplasmic domain was excised was also found to be effective, as well as modifications of the nucleic acid sequence, including alterations, insertions, deletions, mutations, homologues and fragments thereof encoding the active region of the dominant negative receptor, capable of modulating semaphorin activity induced by SEMA-3 A or SEMA-3C, but not SEMA-3F..

"Modulation" of expression by the dominant negative neuropilin-1, preferably means expression of the polypeptide that blocks or measurably reduces the collapse or paralysis of growth cone or axon motility normally induced by SEMA-3 A or SEMA-3 C, but it does not affect SEMA-3F activity.

A "fragment" of a nucleic acid is included within the present invention if it encodes substantially the same expression product as the isolated nucleic acid, or if it encodes a peptide having essentially the described binding capability. The invention should also be construed to include pep tides, polypep tides or proteins comprising neuropilin-1 deletion constructs, or any mutant, derivative, variant, analogs, homologue or fragment thereof, having the described capability on the semaphorin signal.

The terms "protein," "peptide," "polypeptide," and "protein sequences" are used interchangeably within the scope of the present invention, and include, but are not limited to the precise neuropilin-1 deletion constructs set forth herein, or to the prefeπed deletion of amino acid residues Ala₂₅₈ to Ile₈ ι from a full-length neuropilin-1 molecule, as well as those sequences representing mutations, derivatives, analogs or homologues or fragments thereof having the described binding capability on the semaphorin signal. The invention also provides for analogs or homologues of proteins, peptides or polypeptides encoded by the dominant negative neuropilin-1 gene of interest, preferably the C-deletion neuropilin-1. "Analogs" can differ from naturally occurring proteins or peptides by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. "Homologs" are chromosomal DNA carrying the same genetic loci; when carried on a diploid cell there is a copy of the homologue from each parent.

For example, conservative amino acid changes may be made, which although they alter the primary sequence of the peptide, do not normally alter its function. Conservative amino acid substitutions of this type are known in the art, e.g., changes within the following groups: glycine and alanine; valine, isoleucine and leucine; aspartic acid and glutamic acid; asparagine and glutamine; serine and threonine; lysine and arginine; or phenylalanine and tyrosine. Modifications (which do not normally affect the primary sequence) include in vivo or in vitro chemical derivatization of the peptide, e.g., acetylation or carbonation. Also included are modifications of glycosylation, e.g., modifications made to the glycosylation pattern of a polypeptide during its synthesis and processing, or further processing steps. Also included are sequences in which amino acid residues are phospholated, e.g., phosphotyrosine, phosphoserine or phosphothreonine.

Also included in the invention are polypeptides which have been modified using ordinary molecular biology techniques to improve their resistance to proteolytic degradation or to optimize solubility or to render them more effective as a therapeutic agent. Analogs of such peptides include those containing residues other than the naturally occurring L-amino acids, e.g., D-amino acids or non-naturally occurring synthetic molecules. However, the polypeptides of the present invention are not intended to be limited to products of any specific exemplary process defined herein.

"Derivative" is intended to include both functional and chemical derivatives, including fragments, segments, variants or analogs of a molecule. A molecule is a "chemical derivative" of another, if it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's solubility, absorption, biological half- life, and the like, or they may decrease toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, and the like. Moieties capable of mediating such effects are disclosed in Remington's Pharmaceutical Sciences (1980). Procedures for coupling such moieties to a molecule are well known in the art. Included within the meaning of the term "derivatives" as used in the present invention are "alterations," "insertions," and "deletions" of nucleotides or peptides, polypeptides or the like.

A "fragment" of a polypeptide is included within the present invention if it retains substantially the same activity as the purified peptide, or if it has the described binding capability on the semaphorin signal. Such a fragment of a peptide is also meant to define a fragment of an antibody. A "variant" or "allelic or species variant" of a protein refers to a molecule substantially similar in structure and biological activity to the protein. Thus, if two molecules possess a common activity and may substitute for each other, it is intended that they are "variants," even if the composition or secondary, tertiary, or quaternary structure of one of the molecules is not identical to that found in the other, or if the amino acid or nucleotide sequence is not identical.

In accordance with the invention, the dominant negative neuropilin-1 employed in the invention may be an exogenous molecule. Exogenous or heterologous, as used herein, denotes a nucleic acid sequence which is not obtained from and would not normally form a part of the genetic makeup of the animal or animal cell or tissue to be transformed, in its untransformed state.

Transformed cells, tissues and the like, comprising a nucleic acid sequence of a dominant negative neuropilin-1 are within the scope of the invention. Transformed cells of the invention may be prepared by employing standard transformation techniques and procedures as set forth in Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989).

By the term "nucleic acid encoding" the plant cell and the like wherein semaphorin or secondary target cell expression is modulated by the dommant negative neuropilin-1 binding, as used herein is meant a gene encoding a polypeptide having the described semaphorin binding capability, which modulates the trajectory of a growing axon or dorsal root ganglia in a developing animal. The term is meant to encompass DNA, RNA, and the like.

As described above, the neuropilin-1 gene encodes a protein having specific domains located therein, including for example, a C domain. A mutant, derivative, homolog or fragment of the subject gene is, therefore also one in which selected domains in the related protein share significant homology (at least about 70% homology, preferably 80% homology, and more preferably 90% homology) with the same domains in the prefeπed embodiment of the present invention. It will be appreciated that the definition of such a nucleic acid encompasses those genes having at least about 70% homology, preferably 80% homology, and more preferably 90% homology, in any of the described domains contained therein under conditions of stringency that would be appreciated by one of ordinary skill in the art.

In addition, when the term "homology" is used herein to refer to the domains of these proteins, it should be construed to be applied to homology at both the nucleic acid and the amino acid levels. Significant homology between similar domains in such nucleic acids is considered to be at least about 70%, preferably, the homology between nucleic acid domains is at least about 70% homology, preferably 80% homology, more preferably 90% homology, and most preferably as much as 99%. Significant homology between similar amino acid domains in such protein or polypeptides is considered to be at least about 70%, preferably, the homology between amino acid domains is at least about 70% homology, preferably 80% homology, more preferably 90% homology, and most preferably as much as 99%.

According to the present invention, preferably, the isolated nucleic acid encoding the biologically active dominant negative neuropilin-1 polypeptide or fragment thereof is of sufficient length to encode a regulated or active binding protein capable of modulating the expression of the semaphorin signal, as described above.

The invention further includes a vector comprising a gene encoding dominant negative neuropilin-1. DNA molecules composed of a protein gene or a portion thereof, can be operably linked into an expression vector and introduced into a host cell to enable the expression of these proteins by that cell. Alternatively, a protein may be cloned in viral hosts by introducing the "hybrid" gene operably linked to a promoter into the viral genome. The protein may then be expressed by replicating such a recombinant virus in a susceptible host. A DNA sequence encoding a protein molecule may be recombined with vector DNA in accordance with conventional techniques. When expressing the protein molecule in a virus, the hybrid gene may be introduced into the viral genome by techniques well known in the art. Thus, the present invention encompasses the expression of the desired proteins in either prokaryotic or eukaryotic cells, or viruses that replicate in prokaryotic or eukaryotic cells.

Preferably, the proteins of the present invention are cloned and expressed in a virus. Viral hosts for expression of the proteins of the present invention include viral particles which replicate in prokaryotic host or viral particles which infect and replicate in eukaryotic hosts. Suitable vectors and procedures for generating a vector for delivering the isolated nucleic acid or a fragment thereof, are well known, and are described for example in Sambrook et al, supra.

Once the vector or DNA sequence containing the constructs has been prepared for expression, the DNA constructs may be introduced or transformed into an appropriate host. Various techniques may be employed, such as protoplast fusion, calcium phosphate precipitation, electroporation, or other conventional techniques. As is well known, viral sequences containing the "hybrid" protein gene may be directly transformed into a susceptible host or first packaged into a viral particle and then introduced into a susceptible host by infection. After the cells have been transformed with the recombinant DNA (or RNA) molecule, or the virus or its genetic sequence is introduced into a susceptible host, the cells are grown in media and screened for appropriate activities. Expression of the sequence results in the production of the protein of the present invention. Such procedures are well known in the art, and need not be reiterated.

The expression of the desired protein in eukaryotic hosts requires the use of eukaryotic regulatory regions. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis, and such promotors and techniques are well known in the art. The desired protein encoding sequence and an operably linked promoter may be introduced into a recipient prokaryotic or eukaryotic cell either as a non- replicating DNA (or RNA) molecule. Since such molecules are incapable of autonomous replication, the expression of the desired protein may occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced sequence into the host chromosome. For expression of the desired protein in a virus, the hybrid gene operably linked to a promoter is typically integrated into the viral genome, be it RNA or DNA. Cloning into viruses is well known and thus, one of skill in the art will know numerous techniques to accomplish such cloning. Cells which have stably integrated the introduced DNA into their chromosomes can be selected by also introducing one or more reporter genes or markers which allow for selection of host cells which contain the expression vector. The selectable marker gene can either be directly linked to the DNA gene sequences to be expressed, or introduced into the same cell by co-transfection. In another embodiment, the introduced sequence will be incorporated into a plasmid or viral vector capable of autonomous replication in the recipient host cell. Any of a wide variety of vectors may be employed for this purpose. Factors of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different species. Prefeπed hosts or targets of the present invention, which are affected by dominant negative neuropilin-1, include all warm-blooded animals, including birds and mammals. The invention has not been tested on frogs, snakes or fish, but is anticipated to have the above- described effect on semaphorin activity. Prefeπed mammals of the present invention are human or veterinary species.

The domains retained in the dommant negative neuropilin-1 are known to be highly conserved among warm-blooded species. Human, mouse and chicken neuropilin-1 have proven to be operable in chicken and in mouse. Therefore, the present invention expressly encompassed overexpression of endogenous or exogenous neuropilin-1 to modulate the above-described effect on semaphorin activity. Exogenous expression can be achieved across species, such as using genes or deletion fragments of genes or the polypeptides encoded by them of chicken origin in humans or veterinary animal species, so long as there exists a homology of at least 70% and the encoded polypeptide measurably affect semaphorin activity. The subject nucleic acids find a wide variety of applications including use as translatable transcripts, hybridization probes, PCR primers, diagnostic nucleic acids, etc, use in detecting the presence of genes and gene transcripts that will affect semaphorin binding or activity or axon trajectory and in detecting or amplifying nucleic acids encoding additional dominant negative constructs, neuropilin-1 homologs and structural analogs. In diagnosis, neuropilin-1 and deletion construct hybridization probes find use in identifying wild-type and mutant alleles in clinical and laboratory samples that will affect semaphorin binding or activity or axon trajectory. Mutant alleles are used to generate allele-specific oligonucleotide (ASO) probes for high-throughput clinical diagnoses. In therapy, therapeutic dominant negative neuropilin-1 nucleic acids are used to modulate cellular expression or mtracellular concentration or availability of active neuropilin-1 or of semaphorin receptors affecting neurological generation or regeneration.

It is interesting to note that neuropilin-1 also binds the chemoattractant Vascular Endothelial Growth Factor, or VEGF (Soker et al, Cell 92:735-745 (1998)). VEGF can activate the transmembrane tyrosine kinase KDR directly. But, when neuropilin-1 is present, VEGF activation of KDR is potentiated. VEGF has no chemoattractant effect on cells expressing neuropilin-1 alone. Thus, as in the case for growth cone collapse, neuropilin-1 only acts in endothelial chemotaxis through an additional transducing receptor component. However, a striking difference between the role of neuropilin-1 in growth cone collapse and endothelial chemotaxis, is that neuropilin-1 is essential for inducing growth cone collapse, but not for KDR activation in chemotaxis. Consequently, neuropilin-1 may interact with a signal transducing receptor component in growth cone collapse in the same way that the interleukin-6 receptor (IL-6R) interacts with its signal transducing component gpl30 (Taga et al, Cell 58:573-581 (1989)). The IL-6 receptor by itself is unable to transduce a signal. IL-6 binding to the IL-6 receptor causes the recruitment of a third component, gpl30, that is responsible for signal transduction. As with neuropilin-1, a truncated form of the IL-6 receptor that is missing its cytoplasmic domain fails to act as a dominant negative receptor component, even though the truncated IL-6 receptor is functionally intact and retains the ability to interact with gpl30.

The developing olfactory system is an ideal system in which to study the mechanisms that control axon guidance. It is made up of a relatively homogeneous population of sensory cells that project to a recognizable target, and its development has been extensively characterized in rats (Santacana et al, Brain Res. Dev. Brain Res. 70:213-222 (1992)), mice (Doucette, J. Comp. Neurol 285:514-527 (1989)), frogs (Byrd et al, J. Comp. Neurol 331 :551-563 (1993a) and J Neurobiol 24, 1229-1242 (1993b)), and chickens (Drapkin et al, Developmental Dynamics 214:349-360 (1999)).

Primary sensory neurons are located in the olfactory epithelium, which is derived from the olfactory placode. The olfactory placode invaginates from the surface of the chick embryo to form the nasal pit beginning at stage 18. The first olfactory axons begin to grow out of the olfactory epithelium and into the adjacent mesenchyme by late stage 19. These axons have reached the surface of the telencephalon by E5 (Drapkin et al, 1999; Kobayashi et al, 1997). The vast majority of olfactory axons do not enter the central nervous system (CNS) at this time, but instead, halt at the outside surface of the telencepahlon where the olfactory bulb will form. A small number of axons do penetrate the telencephalon transiently, accompanied by cells that originate in the olfactory epithelium and migrate along the olfactory nerve. Olfactory axons continue to project from the olfactory epithelium and accumulate on the surface of the telencephalon. The bulb forms beneath them over the next several days in chicks and in other species (Byrd et al, 1993a; 1993b; Santacana et al, 1992; Doucette, 1989). Olfactory axons cover the surface of the nascent olfactory bulb to form the olfactory nerve fiber layer (ONL) by E5. They then leave the ONL to make connections in deeper layers of the bulb.

Although until the present invention, it was unknown exactly what kept olfactory axons out of the CNS until their target, the olfactory bulb, had formed, several possible mechanisms had been proposed. First, a physical barrier might prevent olfactory axons from penetrating the telencephalon. Second, the telencephalon might not express molecules permissive for olfactory axon growth. Or third, the telencephalon might contain or secrete a repellent that prevents olfactory axons from entering the CNS.

Arguing against the presence of a physical barrier or the idea that the telencephalon is non-permissive for olfactory axon growth is the observation that during olfactory development in the chick, a small number of processes could be observed entering the telencephalon through small breaks in the basal lamina of the radial glial boundary (Drapkin et al, 1999). A similar process had been described in the mouse (Hinds et al, J. Comp. Neurol. 146:253-276 (1972); Doucette et al, 1989), and were confirmed to be axons using electron microscopy. These axons project transiently into the nascent olfactory bulb, sometimes reaching as far as the ventricular surface before retracting and ending in their appropriate layers.

Therefore, the presence of a repellent in the telencephalon was the only logical explanation for the failure of early arriving olfactory axons to enter the CNS. Moreover, it was concluded by the present inventors that SEMA-3A functioned as a chemo-repellent, since olfactory sensory axons have been shown to express neuropilin-1 and are sensitive to SEMA-3 A induced growth cone collapse (Kobayashi et al, 1997). SEMA-3 A expression is detectable in superficial cells of the telencephalon as early as E5, when the olfactory axons first reach the CNS. High levels of SEMA-3 A expression are maintained in the superficial half of the telencephalon through E7, the waiting period during which olfactory axons fail to enter the CNS (Kobayashi et al, 1997; Renzi et al, in press). The invasion of olfactory axons into the olfactory bulb coincides with the restriction of SEMA-3 A to deeper layers of the bulb.

SEMA-3 A has been suggested in similar role in which it prevent sensory axons from entering the spinal cord too early (Shepherd et al, 1997). Once the axons do enter, SEMA- 3 A prevents them from projecting into inappropriate layers of the cord (Messersmith et al, 1995). Olfactory axons expressing the previously described C-deletion neuropilin-1, therefore, acts as a dominant negative receptor for specific secreted semaphorins. The C- deletion neuropilin-1 axons were found to more often overshoot their target area than normal axons. These overshooting axons entered the CNS and extended into the most superficial layers of the telencephalon, just below the pial surface. As expected, the expression patterns examined in the developing olfactory system indicate that SEMA-3A, but not SEMA-3B, - 3C, or -3D, is expressed in the appropriate time and place to exclude olfactory axons from the telencephalon. Thus, these results confirm that an active repellent, SEMA-3A, expressed by the telencephalon, is responsible for preventing olfactory axons from entering the telencephalon too early.

Olfactory axons also overshoot their target at a low frequency in normal embryos. As described previously, a small number of transient projections have been observed entering the telencephalon prior to the formation of the olfactory bulb during the development of the olfactory system (Drapkin et al, 1999; Doucette et al, 1989; Hinds et al, 1972). These axons then retract to end in their appropriate layers. The overshooting axons observed in control experiments probably represent this population of axons because they are rare and, since they are absent in the older embryos, appear to be transient. The dominant negative neuropilin-1 expressing overshooting axons appear to persist through E9, and therefore may not be equivalent to the early entering, transient population of olfactory axons present in normal embryos.

It is also instructive to consider olfactory pathfϊnding events that are not perturbed by the expression of C-deletion neuropilin-1. Expressing axons exit from the olfactory epithelium, enter the olfactory nerve, and project along a normal course to the telencephalon. SEMA-3 A is expressed in the olfactory epithelium when the olfactory axons exit (Kobayashi et al, 1997). Although this could play a role in influencing the initial direction in which these axons extend by repelling them out of, and away from the olfactory epithelium, it has been determined in the present invention that SEMA-3A does not function in this way. Axons expressing C-deletion neuropilin-1 exit the olfactory epithelium and enter the olfactory nerve as they normally would. Therefore, those class 3 semaphorins whose function is inhibited by neutropilin-1 are not likely to play a very important role in the guidance of olfactory sensory axons while they grow in the olfactory nerve. It should also be noted that the expression of C-deletion neuropilin-1 in olfactory sensory neurons probably does not effect their cell fate or differentiated state, since their axonal processes behave normally until they reach the telencephalon.

It is also interesting to note that a population of cells born in the olfactory epithelium migrate along the olfatory nerve and enter the telencephalon without any apparent pause in both control and C-deletion neuropilin-1 -expressing embryos. GnRH expressing cells migrate along this route, and ultimately populate anterior regions of the hypothalamus. However, they have been reported to pause before entering the telencephalon, just as olfactory axons do (Mulrenin et. al, Endocrinology 140:422-433 (1999)).

In conclusion, the present invention demonstrates that an active chemorepellent is responsible for preventing olfactory axons from entering the telencephalon prematurely, and further suggest that SEMA-3 A mediates this response. The establishment of long axonal projections is facilitated if neurons make their appropriate connections early while distances are short. The obvious disadvantage of this strategy is that axons may arrive at their destinations well before their appropriate targets are ready to be innervated. Thus, chemorepellents provide an active mechanism by which early arriving axons are prevented from entering a target that is not yet ready to receive them.

The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of a semaphorin receptor modulatable cellular function, which modulate neurological generation or regeneration or which affect neuron or axon trajectory. Generally, these screening methods involve assaying for compounds which modulate semaphorin receptor interaction with a natural receptor binding target such as a semaphorin. A wide variety of assays for binding agents are provided including labeled in vitro protein-protein binding assays, immunoassays, cell based assays, etc. The methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. Identified reagents find use in the pharmaceutical industries for animal and human trials. For example, the reagents may be derivatized and rescreened in vitro and in vivo assays to optimize activity and minimize toxicity for pharmaceutical development.

In vitro binding assays employ a mixture of components including a semaphorin receptor or a neuropilin-1 polypeptide, which may be part of a fusion product with another peptide or polypeptide, e.g., a tag for detection or anchoring, etc. The assay mixtures comprise a natural mtracellular receptor binding target. In a particular embodiment, the binding target is a semaphorin polypeptide. While native full-length binding targets may be used, it is frequently prefeπed to use portions (e.g., peptides) thereof so long as the portion provides binding affinity and avidity to the subject semaphorin receptor polypeptide or neuropilin-1 construct conveniently measurable in the assay. The assay mixture also comprises a candidate pharmacological agent. Candidate agents encompass numerous chemical classes, through typically they are organic compounds; preferably small organic compounds and are obtained from a wide variety of sources including libraries of synthetic or natural compounds. A variety of other reagents may also be included in the mixture. These include reagents like salts, buffers, neutral proteins, e.g., albumin, detergents, protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. may be used.

The resultant mixture is incubated uinder conditions whereby, but for the presence of the candidate pharmacological agent, the semaphorin receptor polypeptide or neuropilin-1 construct specifically binds the cellular binding target, portion or analog with a reference binding affinity. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature that facilitates optimal binding. Incubation periods are likewise selected for optimal binding, but also minimized to facilitate rapid, high-throughput screening.

After incubation, the agent-biased binding between the semaphorin receptor polypeptide or neuropilin-1 construct and one or more binding targets is detected by any convenient way known in the art. Where at least one of the binding target polypeptides comprises a label, the label may provide for direct detecting as radioactivity, luminescence, optical or electron density, etc or indirect detection such as an epitope tag, etc. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g. through optical or electron density, radiation emissions, nonradiation energy transfers, etc. or indirectly detected with antibody conjugates, etc.

A difference in the binding affinity of the semaphorin receptor polypeptide or neuropilin-1 construct to the target in the absence of the agent, as compared with the binding affinity in the presence of the agent, indicates that the agent modulates the binding of the semaphorin receptor polypeptide or neuropilin-1 construct to the binding target. For example, in the cell-based assay also described below, a difference in semaphorin receptor- dependent modulation of axon outgrowth or orientation in the presence and absence of an agent indicates that the agent modulates semaphorin receptor function. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably a 70%, even more preferably an 80%, and most preferably at least a 90% difference.

The present invention is further described in the following examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. The scenarios are relevant for many practical situations, and are intended to be merely exemplary to those skilled in the art. These examples are not to be construed as limiting the scope of the appended claims. Thus, the invention should in no way be construed as being limited to the following example, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

EXAMPLES

Example 1

Constructs, Assays and Procedures Generation of Neuropilin-1 Deletion Constructs.

Using methods known in the art, PCR was used to generate constructs of neuropilin-1 with specific domains deleted. PCR products were cloned into the modified mammalian expression vector pAG-NT as described previously by Koppel et al, 1997 (herein expressly incorporated by reference), containing an amino terminal tag consisting of a signal sequence (from the first 25 amino acids of SEMA-3 A), two myc epitope tags and a 6xHis tag. The oligonucleofide primers for the neuropilin deletion constructs were made containing the appropriate restriction enzyme sites so that the amplified products could be cloned directly into the BamHI and Not-1 restriction sites of pAG-NT. Standard PCR amplification between oligonucleofide primers, all of which placed a Bgl-II restriction site 5' and a Not-1 site 3', was used to make the following constructs:

Full length neuropilin-1 between CGAAGCGATAAATGCGGCGAC (FI) (SEQ ID

NO:l) and TCATGCTTCCGAGTAAGAATTCTG (RI) (SEQ ID NO:2) al,a2 domain deletion neuropilin-1 between ATGGAACCACTAGGTATGGAG (F2) (SEQ ID NO:3) and RI, and cytoplasmic domain deletion neuropilin-1 between FI and

GCAGGCACAGTACAGGCAAAC (R2) (SEQ ID NO:4). Constructs that required the deletion of internal domains were made using a two step PCR protocol described in Koppel et al, 1997. Briefly, the sequence on either side of the deleted region is amplified in the first step. The 5' end of the internal reverse primer is complimentary to the internal forward primer. The second step involves annealing the two primers at the complimentary sequence and amplifying the final product using the outer-most primers. The following deletion constructs were made in this manner: bl,b2 domain deletion neuropilin-1 [step 1 between {FI and

TTCGGAAACAGTAGGGACGACAGCGCACTGGAAATCTTCTGATAC (R3) SEQ ID NO:5}and between {GCTGTCCCTACTGTTTCCGAA (F3) SEQ ID NO:6 and RI}] and [step 2 between FI and RI]

C domain deletion neuropilin-1 [stepl between {FI and

TGCACTCATGGCTATGATGGTCGTGGGAGCTTCAAGTTCACA (R4) SEQ ID NO:7} and {ACCATCATAGCCATGAGTGCA (F4) SEQ ID NO:8 and RI }] and [step 2 between FI and RI]. Protein Expression in Cultured Cells.

Human embryonic kidney (HEK)293T cells (hereafter simply 293T cells) or Cos-7 cells were grown to approximately 70% confiuency in a 10 cm dish in DMEM (Life Technologies, Gaithersburg, MD) with 1% penicillin/streptomycin (P/S) (Life Technologies) and 10% fetal bovine serum (FBS) (Hyclone Laboratories, Logan, UT) and transfected using calcium phosphate in the presence of 25 μM of chloroquine (Sigma, St.Louis, MO).

Approximately 50 μg of DNA in 1 ml was added per transfection. Cells were incubated in the transfection mix for at least 4 hours, then changed into fresh media. 293 T cells expressing AP-SEMA-3A or AP-SEMA-3C were allowed to grow for 2 days. Conditioned media was then collected, spun down to remove cell debris, and stored in frozen aliquots until use in the growth cone collapse assay. Cos-7 cells were transfected with the neuropilin-1 deletion constructs, grown overnight, and assayed for AP-SEMA-3A binding the following day.

Culture of Sympathetic Neurons.

Sympathetic chain ganglia were dissected from E7-E8 chick embryos and placed in ice cold Hanks solution (Life Technologies). The ganglia were carefully cleaned of connective tissue and placed in DMEM containing 1% P/S and 10% FBS, preincubated at 37°C with 5% CO₂. The ganglia were spun down, resuspended in 0.05% trypsin, and incubated at 37°C for 15 minutes. Then, the ganglia were again spun down, and then dissociated by trituration in 100 μl of fresh medium. The dissociated cells were plated on 10 mm round coverslips coated with laminin (Life Technologies) at an approximate density of 10⁴ cells/coverslip and cultured in 500 μl of media. Cells were incubated at 37°C in 5% CO for at least 1 hour to allow them to adhere to the coverslip before transfection (see below).

Protein Expression in Sympathetic Cells.

Cultured sympathetic cells were transfected using calcium phosphate. Approximately 1 μg of plasmid DNA was added to 500 μl of medium with 25 μM chloroquin in the well of a 48 well cluster plate. The cells were incubated for no longer than 5 hours at 37°C in 5% CO . To stop the transfection, the media was removed and replaced with F-12 (Life Technologies) supplemented with glutamine, glucose, bovine pituitary extract, nerve growth factor (NGF), insulin, transferrin, selenium, 1% P/S and 10% FBS (see Baird et al, J. Neuroscience 15:6605-6618 (1995), herein incorporated by reference). Cells were grown overnight in supplemented F-12. The following day the dissociated sympathetic cells were washed with warm Hanks solution, and then treated in 0.25% trypsin for 1-2 minutes. After the cells had detached from the coverslip, supplemented F-12 was added, and the cells were either re- plated as dissociated cells on fresh laminin-coated coverslips, or suspended in drop culture for re-aggregation. Dissociated cells were grown for 5-6 hours, and then assayed for collapse and/or protein expression. Sympathetic cells in drop cultures were allowed to re-aggregate for 4-5 hours, and then plated onto fresh laminin-coated coverslips. Re-aggregates were grown overnight (18 hours) in supplemented F-12 at 37°C in 5% CO and assayed the following day for growth cone collapse and/or protein expression.

Collapse Assay.

The collapse assay was performed as described in Luo et al, 1993, with slight alterations. In brief, an amount of recombinant secreted semaphorin, 10 times greater than that required to induce 50% of DRG or sympathetic growth cones to collapse (10 collapsing units), or as a control an equal volume of media, was added to each well in a volume not exceeding 250 ul. The cells were incubated at 37°C in 5% CO₂ for 35 minutes, and then fixed in 4% paraformaldehyde in PBS containing 10%> sucrose. Cells were then stained for the myc epitope tag (see below) to identify transfected cells. Neurites from transfected cells, which had a length of greater than 2 times the width of the cell body, were analyzed. The tips of neurites without lamellipodia or filopodia were scored as being collapsed. Immunohistochemistry.

Cells were fixed as described above and incubated with PBS containing a mix of Polyvinyl-Pyrolidone (Sigma) with molecular weights of 10,000, 40,000, and 360,000, and 3% BSA. Cells were incubated with mouse anti-myc ascites (9E10 from American Type Culture Collection, Manassas, VA), diluted 1 :500 in blocker for 3 hours at RT or overnight at 4°C. Cells were then washed with PBS and incubated with a Cy3 conjugated donkey anti- mouse IgG/IgM secondary antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) for 2 hr at RT, or overnight at 4°C.

AP Fusion Protein Binding Assay. AP-SEMA-3 A, AP-sema, and AP-Ig-basic were tested for their ability to bind to neuropilin-1 deletion constructs expressed in Cos-7. In brief, cells expressing truncated neuropilins were washed gently with PBS and incubated with AP-SEMA-3A, AP-sema, or AP-Ig-basic, diluted in PBS with 10% FBS. The AP fusion proteins were produced by 293T cells, transiently transfected with the appropriate expression vector. The concentration of AP-SEMA-3 A was determined by measuring the amount of conditioned media required to cause 50% collapse in the growth cone collapse assay. The concentrations of AP-Sema and AP-Ig-basic were estimated by comparing their AP activities to that of AP-collapsin. Cells were incubated with probe for 1 hr. After 3, ten minute washes with PBS, the cells were fixed in 4% paraformaldehyde in PBS with 10% sucrose. Inactivation of endogenous alkaline phosphatases was accomplished by heating the samples to 65°C for 3 hours. Binding of the AP-tagged ligands was visualized by reacting with NBT/BCIP (Sigma). Membrane Preparations and Western Blots.

Neuropilin-1 deletion constructs were expressed in 293T cells, as described above, and grown overnight (18 hr). Cells were harvested in lysis buffer (Hallak et al, J. Biol. Chem. 269:4571-4576 (1994)) containing 20 mM HEPES, 2 mM MgCl₂, 1 niM EDTA, Leupeptin (2 ug/ul) and PMSF (0.1 mM). Cells were incubated on ice for 5 minutes, then lysed by passing through a 20-gauge needle. The lysed cells were spun down at 1000 x g for 5 minutes to pellet unbroken cells and nuclei. The supernatant was transfeπed to an ultracentrifuge tube, and spun at 100,000 x g for 60 minutes to pellet the membranes. The pellet was resuspended in 100 μl of lysis buffer. From the suspension, the sample (10 μl) was extracted with SDS-sample buffer and analyzed by Western blot using an anti-myc antibody. Results and Discussion

Generation of Neuropilin-1 Deletion Constructs.

PCR was used to delete specific portions of chick neuropilin-1 sequences coπesponding to the selected domains. The boundaries of the domains were defined approximately as described in Takagi et al, 1991. Specifically, for the purposes of this invention, the boundaries were defined as follows: in the A-deletion construct, the al and a2 domains from Arg2i to GIU254 are missing; in the B-deletion construct, the bl and b2 domains from Gly255 to

are missing; in the C-deletion construct, the C domain from Ala588 ^to H^e851 *^s missing; and in the Cyt-deletion construct the cytoplasmic domain from rpg75 to the C-terminus was deleted. Membranes from 293T cells transfected with these deletion constructs were purified, extracted, and the myc -tagged recombinant deletion products were analyzed by Western blots of reducing gels. All the constructs co-purified with the cell membrane and, with the exception of the C-deletion product, were close to their predicted size (Figure IB). C-deletion neuropilin-1 was reduced in weight to a larger degree than would have been predicted by the loss of the deleted amino acids alone. This is explained by the loss of three predicted glycosylation sites within the C-domain. In addition, a band with the approximate molecular weight of a dimer is present in all of the constructs except C-de|. This finding is consistent with the findings of Giger et al, 1998, and Nakamura et al, 1998, that the C-domain mediates dimer formation which occurs in the absence of ligand. Neuropilin-1 Contains More than One Binding Site For SEMA-3 A. In an effort to determine which domains within neuropilin-1 are responsible for binding SEMA-3 A, neuropilin-1 deletion constructs were expressed in Cos 7 cells, and probed with alkaline phosphatase-tagged versions of (i) full length SEMA-3 A (AP-SEMA- 3 A), (ii) the semaphorin domain of SEMA-3 A (AP-Sema), or (iii) the Ig-basic tail of SEMA- 3A (AP-Ig-basic). Previous studies have shown AP-Sema has about 30 fold reduced activity as compared to full length SEMA-3 A, and that AP-Ig-basic has no detectable biological activity (Koppel et al, 1998). After 1 hour development in NBT/BCIP, AP-SEMA-3 A was visualized. It bound to cells expressing A-deletion and C-deletion neuropilin-1, but not to those expressing B-deletion neuropilin-1 (Figure 4A). Moreover, AP-SEMA-3 A and AP-Ig- basic bound to cells transfected with full length, A-deletion, C-deletion, and Cyt-deletion neuropilin-1 equally well (Figure 4A). After two days development, AP-Sema was visualized with strong binding to A- and B-deletion neuropilin-1, but not to C-deletion neuropilin-1, whereas after two days development, AP-Ig-basic was visualized with strong binding to A- and C- deletion neuropilin-1, but not B-deletion neuropilin-1 (Figure 4B). The bl and b2 domains, therefore, contributed very strongly to the binding of SEMA-3 A to neuropilin- 1 , and the Ig-basic regions of SEMA-3 A appear to mediate this binding.

Commensurate with its much lower biological potency, AP-Sema bound full length neuropilin-1 more weakly than does AP-SEMA-3A (Figure 4B). Surprisingly, it bound to B- deletion neuropilin-1, indicating that it binds outside the bl and b2 domains recognized by the Ig-basic portion of full length SEMA-3 A. It was also possible to detect weak binding of AP-Sema to A-deletion neuropilin-1. No binding of AP-Sema to C-deletion neuropilin-1 was detected in the present experiments. Experiments using the Sema domain fused to FC as a probe produced an identical binding pattern (data not shown). Consequently, it appears that the C domain is the primary locus of semaphorin domain binding on neuropilin-1. Overexpression of Neuropilin-1 Without the C-Domain in Sympathetic Neurons

Blocks Their Responsiveness to SEMA-3A.

Each of the neuropilin-1 deletion constructs was transfected into cultured primary sympathetic cells in an effort to identify a dominant negative neuropilin-1 variant that blocks SEMA-3A function. Dissociated sympathetic neurons from E7-E8 chicks were grown on laminin-coated coverslips. Eighteen (18) hours after transfection the cells were treated with trypsin and replated to ensure that all neurites were newly formed and would, therefore, incorporate proteins generated from the transfected plasmids. Neurites were allowed to extend for an additional 5-6 hours before adding control medium or medium containing approximately 300 pM recombinant AP-SEMA-3 A. This represented approximately 10 collapsing units (10 cu.) of SEMA-3 A. A collapsing unit is defined as the amount of

SEMA-3 A required to induce 50% of the growth cones to collapse in the standard explant assay. Neurons that stained positive for the myc epitope tag incorporated into every neuropilin-1 construct were assayed for their ability to respond to SEMA-3 A.

The engineered recombinant proteins, visualized with anti-myc antibodies, were expressed on the growth cone, as well as on the neurites and cell bodies of all transfected cells (Figure 5). Myc-tagged recombinant proteins were visualized using an anti-myc ascities and a Cy3 conjugated secondary antibody. Expression levels were generally high and uniform between cells, as judged by the intensity of myc staining. The anti-myc antibody did not label untransfected cells. Recombinant protein was expressed throughout the cell, including the lamellipodia and filopodia of the growth cone. The addition of SEMA-3 A induced the collapse of growth cones expressing either a control truncated Trk-B (TrTrk-B) protein or full length neuropilin-1. On the other hand, sympathetic neurons expressing C- deletion neuropilin-1 were resistant to collapse when exposed to SEMA-3 A.

To evaluate the effects of SEMA-3 A on sympathetic neurons transfected with full length neuropilin-1, B- and C- deletion neuropilin-1, as well as truncated Trk-B were re- examined. Sympathetic neurons were transfected with the indicated constructs, and then exposed to either control media or media containing AP-SEMA-3 A. After 35 minutes the cultures were fixed, and the percentage of myc-labeled neurites with growth cones were counted (Figure 6A). As expected, sympathetic neurons transfected with a control plasmid, producing an inactive, myc-tagged Trk-B missing its kinase domain, responded normally to SEMA-3 A. The addition of 10 cu. of AP-SEMA-3 A was seen to induce a loss of motile growth cones, and a collapse in growth cones expressing truncated Trk-B (TrTrk-B) (Figure 6A). SEMA-3 A induced (Figure 6A). A similar dramatic collapsing effect was induced by SEMA-3 A in sympathetic cells expressing full length neuropilin-1, and cytoplasmic-deletion neuropilin-1. In contrast, growth cones expressing C-deletion neuropilin-1 did not respond to SEMA-3A (Figure 6A). The percentage of neurites with recognizable growth cones in dissociated sympathetic cultures was only about 50%>. This relative paucity of growth cones is explained if they collapse on contact with other neuronal processes and with non-neuronal cells in these cultures (Ivins et al, Develop. Biol. 135:147-157 (1989)). Therefore, to decrease these contacts, sympathetic cells were re-aggregated after transfection and plated as large clumps of cells. Neurites were then seen to extend from these re-aggregates in a manner similar to that observed from explanted sympathetic ganglia, while most non-neuronal cells remain associated with the re-aggregates.

As expected, neither the Trk-B control nor the full length neuropilin-1 constructs affected SEMA-3A responsiveness (Figure 6B). The B-deletion neuropilin-1 construct that partially blocks SEMA-3A activity in the dissociated assay, has no detectable blocking effect in the re-aggregate assay (Figure 6B). This result suggests that any dominant negative effect induced by the overexpression of this construct is weak and of doubtful utility. When sympathetic neurons were transfected with test constructs and then re-aggregated, growth cones expressing TrTrk-B, full length neuropilin-1 and B-deletion neuropilin-1, all collapsed in response to AP-SEMA-3 A. By comparison, growth cones expressing C-deletion neuropilin-1 did not respond to SEMA-3 A. In Figure 6C, sympathetic neurons were transfected with either full length or C- deletion neuropilin-1 and then re-aggregated. The ability of C-deletion neuropilin-1 to suppress SEMA-3A activity in sympathetics persisted, even when very high concentrations of SEMA-3 A were used. When 10, 30, or 100 cu. SEMA-3 A were added, strongly suppresses SEMA-3A activity in the re-aggregate assay approximately 85% growth cone collapse was induced in neuropilin-1 transfected neurons. In contrast, neurons transfected with C-deletion neuropilin-1 did not respond to 10 or 30 cu. of AP-SEMA-3 A, and were only partially responsive at 100 cu. (Figure 6C). Thus, the concentration of SEMA-3 A required to induce 50% collapse of sympathetic neurons was shifted to approximately 100 fold higher concentrations by C-deletion neuropilin-1. In contrast, sympathetic neurons expressing B- deletion neuropilin-1 were partially resistant to SEMA-3 A induced collapse (Figure 6C). Thus, C-deletion neuropilin-1 acts as a powerful dominant negative SEMA-3 A receptor.

C-Deletion Neuropilin-1 Blocks Collapse of Sympathetic Growth Cones Induced by SEMA-3C.

SEMA-3C, like SEMA-3 A, induces a dose dependent collapse of cultured sympathetic growth cones. Sympathetic neurons transfected with the C-deletion or appropriate control constructs were tested for their ability to respond to SEMA-3C. Sympathetic re-aggregates were transfected with trunkated Trk-B (TrTrk-B), full length neuropilin-1, or C-deletion neuropilin-1, and treated with 10 cu. of AP-SEMA-3C or 10 cu. of AP-SEMA-3F. As shown in Figure 7 A, growth cones expressing TrTrk-B or full-length neuropilin-1 collapsed when exposed to AP-SEMA-3C. On the other hand, sympathetic neurons expressing C-deletion neuropilin-1 did not respond to AP-SEMA-3C. These results indicate that the C-deletion neuropilin-1 construct acts as a dominant negative receptor component for both SEMA-3 A and SEMA-3 C, and suggests that neuropilin-1 participates in signaling mediated by each of these two ligands. C-Deletion Neuropilin-1 Does Not Block Collapse of Sympathetic Growth Cones

Induced by SEMA-3F. As shown, the C-deletion neuropilin-1 acts as a dominant negative receptor for at least two secreted semaphorin family members. SEMA-3F is another secreted semaphorin family member that induces the collapse of sympathetic growth cones (Chen et al, 1997; Giger et al, 1998). C-deletion neuropilin-1 was, therefore, tested for its ability to prevent SEMA-3F induced collapse of sympathetic growth cones. Sympathetic neurons transfected with TrTrk- B or C-deletion neuropilin-1 collapsed normally when exposed to 10 cu. of AP-SEMA-3F (Figure 7B). The C-deletion neuropilin-1 construct, therefore, does not act as a dominant negative receptor component for SEMA-3F, consistent with the proposal that neuropilin-2 mediates SEMA-3F signaling without any involvement of neuropilin-1. C-Deletion Neuropilin-1 Does Not Block Collapse of Sympathetic Growth Cones

Induced By the Semaphorin Domain of SEMA-3 A.

As disclosed, neuropilin-1 appears to have at least two binding sites for SEMA-3 A, one located in the bi and b2 domains that bind the Ig-basic tail of SEMA-3 A, and at least one outside the bl and b2 domains required for the binding of the semaphorin domain. The semaphorin domain of SEMA-3 A forms a biologically active dimer when made as a fusion protein with an Fc fragment (Koppel et al, 1998). This semaphorin domain dimer is about 30 fold less potent than full length SEMA-3A, presumably because it is missing the Ig-basic portion of SEMA-3 A that binds so strongly to the B domain of neuropilin-1.

Sympathetic neurons transfected with truncated Trk-B (TrTrk-B) or C-deletion neuropilin-1 collapsed normally when exposed to 5 cu. of the semaphorin domain from SEMA-3 A fused to an Fc fragment (Sema-Fc) (Figure 8). This truncated form of SEMA- 3A, that is missing the Ig-basic domains, induces growth cone collapse, even in growth cones expressing C-deletion neuropilin-1. The C-deletion neuropilin-1 construct, therefore, only acts as an effective dominant negative receptor component when the SEMA-3A ligand contains the Ig-basic domains.

Example 2: Overexpression of a Dominant Negative Neuropilin-1 Disrupts Olfactory Sensory Axon Guidance in vivo.

Materials and Methods. DNA Preparation.

PCR was used to generate truncated forms of neuropilin-1, as described in Example 1. The C-deletion neuropilin-1 (missing its C-domain, and refeπed to herein as "dnNP-1") was prepared as a dominant negative receptor component in accordance with Renzi et al, 1999. A more severely truncated form of neuropilin-1, missing its entire extracellular domain (abc-deletion), was made as a control construct and for tracing axonal trajectories. Standard PCR amplification was performed between ACCATCATAGCCATGAGTGCA (SEQ ID NO: 8) and

CAGAATTCTTACTCGGAAGCATGA (SEQ ID NO:9) using oligonucleofide primers that placed a Bgl II restriction site 5' and a NOT-1 restriction site 3' on the amplified sequence. The resulting fragment was cloned into the AP-PAG vector (Kobayashi et al, 1997), which added a signal sequence and a human placental alkaline phosphatase tag at the 5' end of the clone. An expression plasmid containing the B-galactosidase reporter gene was used as a control construct in expression experiments. Electroporation.

The expression of dnNP-1 was induced in embryonic chicks by electroporating an appropriate eukaryotic expression plasmid in ovo. This method of mis-expressing genes in the chick has several advantages over avian retro viral vectors. These include: 1) high levels of recombinant protein are produced within 8 hours of electroporation, 2) large recombinant proteins can be produced since insert size is less restricted than with viral vectors, 3) there are no reported limits to the cell types that can be transfected, and 4) expression of recombinant proteins is restricted to transfected cells and their progeny. The transfection of olfactory neurons within the olfactory epithelium is possible since the olfactory placode that gives rise to the olfactory epithelium is derived from superficial ectoderm and is accessible to plasmid DNA delivered from outside the embryo.

Eggs from white Leghorn chickens were incubated at 37°C until stage 13-14 (48-52 hours). The eggs were then windowed and visualization of the embryo was aided by injecting a 1 :10 dilution of pelican ink in PBS beneath the embryo for contrast. A glass microcapillary tube was pulled on a Flamin-Brown Electrode puller, attached to a 100 μl Hamilton glass syringe and filled with heavy mineral oil. The capillary was then loaded with 20 μl of DNA (1.5 μg/μl final concentration), suspended in TE (10 mM Tris HCL pH 8.0, 1 mm EDTA pH 8.0). Plasmid containing AP-abc-del neuropilin-1 was diluted 1 :10 with either plasmid containing the B-galactosidase reporter gene (AP+BGal) for control transfections, or with plasmid containing C-deletion neuropilin-1 (AP+dnNP-1). The DNA mixture was then injected into the amniotic sac, just rostral to the nasal pit of stage 13 embryos, and electroporated with the electrodes oriented to force the plasmid towards the embryo (Figure 9A).

The electroporation apparatus consisted of a circuit designed generate the electric field, a DC power source to supply the voltage, and a function generator to control the frequency of the pulses. The electric field was applied to the surface of the egg through platinum genetrodes (BTX industries). The electrodes were placed on the surface of the egg as illustrated in Figure 9A. The electrodes were then lowered to form a slight depression in the vitelline membrane, which was then filled with 200 μl of sterile PBS. Three pulses of 25 volts at 20 Hz followed by 3 pulses of 25 volts at 10 Hz were then applied to the surface of the embryo. After electroporation, 200 μl of 10X penicillin/streptomycin (Life Technologies) was added to the surface of the egg, the egg was sealed with tape, and it was placed back in the incubator.

Electroporation resulted in a large amount of embryo mortality. In individual experiments as many as 50% of the electroporated embryos died within 3 days of transfection. The survival rate decreased with time, falling to as low as 20% by 7 days post injection. This high lethality is most likely the result of cuπent induced damage to the heart and to blood vessels in and around the head. Surviving embryos were found to be normal upon gross inspection.

Analysis. Analysis of Whole Mounts.

Chick embryos were sacrificed on the appropriate day and fixed in 4% paraformaldehyde in PBS for 2 to 4 hours at 4°C. Embryos were rinsed with PBS, and then incubated in PBS at 65°C for 3 hours to inactivate endogenous alkaline phosphatase.

A fusion protein composed of human placental alkaline phosphatase (AP) and the transmembrane and cytoplasmic portions of chick neuropilin-1 was used as a tracer construct to identify transfected cells and visualize their axonal processes. After inactivation, the embryos were rinsed in the AP reaction mixture (0.5 mg MgCl , 0.3 mg NaCl, 5ml IM Tris HC1 pH 9.5, 50 μl Tween 20) without substrate for 15 minutes to 1 hour at 4°C, then incubated in AP reaction buffer with 0.33 mg/ml NBT and 0.17 mg/ml BCIP for 1-3 days at 4°C in the dark. The reaction was stopped by washing the embryos in acidic PBS (pH 5.0) containing 0.1% Tween-20 overnight at 4°C. Expression of this AP -tagged marker did not affect semaphorin signaling in cultured sympathetic neurons (data not shown). Analysis of Sections.

To better visualize the olfactory nerve, embryos were bisected sagitally through the midline of the head so that they could be viewed from the medial surface (Figure 9C).

Forebrains that had been dissected from transfected embryos were cryoprotected in 20% sucrose in PBS and imbedded in O.C.T. embedding compound. Those brains that had been cleared in glycerol were rehydrated in PBS overnight at 4°C prior to cryoprotection. Sections of 30 μm were cut on a cryostat (Leica), and collected on Superfrost Plus slides (Fischer).

Sections were then washed in PBS, incubated in blocker (2% powdered milk in PBS) for 1 hour, and then incubated with anti-neurofilament antibody (4H6; Developmental Hybridoma Bank) diluted in blocker for 3 hours at room temperature. Neurofilament staining was visualized with a Cy3 -conjugated secondary antibody.

In situ hybridization.

Chick embryos were staged according to Hamburger and Hamilton (1951). Brain sections from E5, E7, and E9 embryos were prepared for in situ hybridization as follows. Embryos were sacrificed and their heads fixed in 4% paraformaldehyde in PBS at 4°C overnight. The following day the heads from E5 and E7 embryos were cryoprotected in 20% sucrose in PBS at 4°C overnight.

To section an E9 embryo, the forebrain and olfactory bulb were first dissected out of the E9 embryo then cryoprotected as described above. Tissue was then frozen in O.C.T embedding media compound. Sections of 35 microns were cut on a cryostat (Leica) and collected on Superfrost Plus slides. Sections were washed in PBS, incubated in acetylation buffer (3.5 ml triethanolamine, 0.75 ml acetic anyhdride in 300 ml sterile water), then permeabilized in PBT (PBS, 0.1% Triton X-100) and washed again in PBS, all at room temperature. Sections were prehybridized in hybryidization buffer (50%> formamide, 4X SSC, IX

Denhardt's reagent, 10% Dextran sulfate, and 0.5 mg/ml fish sperm DNA) for at least 1 hour at room temperature, then incubated overnight with the Digoxigenin (DIG)-labeled probe, diluted to 400 ng/ml in hybridization buffer at 72°C. The next day, sections were washed in

0.2X SSC at 72°C, rinsed briefly in 0.2X SSC and rinsed in PBS. Sections were blocked in blocker (2% powdered milk in PBS) for 1 hour, and then incubated in an alkaline phosphatase anti-DIG antibody diluted 1 :2500 in blocker for 3 hours at room temperature.

Alkaline phosphatase was visualized by incubating the sections in AP reaction buffer without substrate for 5 minutes, and then incubating overnight in AP reaction buffer containing 0.33 mg/ml NBT and 0.17 mg/ml BCIP.

Embryos with AP labeled cells in and around the nostril were identified. Visualization of the AP marker 2 days later showed transfection of ectodermal cells in and around the nasal pit and in the lens of the eye (Figure 9B).

Embryos in which there was AP staining in the olfactory nerve, were either analyzed immediately, or the brain containing a portion of the olfactory nerve was dissected out of the head, and cleared in 80% glycerol overnight. The number of AP-labeled olfactory axons in each embryo that had reached the telencephalon were counted along with the number of axons which had grown past the normal olfactory nerve stop point, which was defined as the rostral most end of the telencephalon in E5 and E7 embryos, and the olfactory bulb/forebrain border in E9 embryos.

At later ages the labeled axons of olfactory sensory neurons could be seen leaving the olfactory epithelium to form the olfactory nerve (Figure 9C). Other structures which are, at least in part, derived from the ectoderm were also transfected. These included the lens of the eye and the trigeminal, vagal and glossopharyngeal ganglia (data not shown).

Example 3: Olfactory Axons Expressing dnNP-1 Overshoot Their Normal Target.

Embryos were sectioned through the developing olfactory nerve and olfactory sensory axons were visualized using an anti-neurofilament antibody and a Cy3 conjugated secondary antibody. The first olfactory axons exit the olfactory epithelium, cross the intervening mesenchyme, and reach the telencephalon by E5 where the vast majority of them halt for several days before entering the CNS (Figure 10A). By E7, olfactory axons accumulate outside the CNS, the olfactory bulb evaginates from the telencephalon and differentiates beneath them (Kobayashi et al, 1997). Olfactory axons enter the bulb at E8; first projecting into the superficial olfactory nerve fiber layer (ONL), and then projecting into and making synaptic connections within the deeper glomerular layer. By E9, the olfactory bulb has formed and olfactory axons form the olfactory nerve layer (Figure 10C).

To determine if the expression of the deletion construct, C-deletion neutropilin-1 (dnNP-1), in sensory axons interferes with their guidance, the trajectories of olfactory axons co-transfected with either AP+BGal or AP+dnNP-1 plasmids were compared in E7 embryos. At E7, the majority of these axons were found to terminate just outside of the rostral- most telencephalon where the olfactory bulb evaginates (Figure 11 A,C, E). In some of these control embryos a single labeled axon was observed extending beyond the point where the rest of the olfactory axons had stopped (see Figure 11EC). In embryos where the bulb had already begun to form, olfactory axons covered its surface. However, they did not cross the border between the olfactory bulb and the forebrain (Figure 1 IE).

Migrating cells transfected with AP+BGal were observed migrating beyond the point at which sensory axons terminate. The majority of these cells were located along a specific pathway that extended dorso-caudally from the olfactory nerve for some distance before diving ventrally towards the midbrain.

Olfactory axons transfected with AP+dnNP-1, like controls, entered the olfactory nerve and projected to the telencephalon. Although the majority of AP+dnNP-1 transfected axons were found to terminate on the surface of the telencephalon in their normal position, a greatly increased number (as compared to controls) were seen to overshoot this stopping point (Figure 11 B,D,F). When examined in whole mount, as described above, the overshooting axons appeared to extend on, or just below, the surface of the telencepahlon. The trajectories of these escaping axons varied considerably, but the overwhelming majority grew on the medial side of the nascent olfactory bulb and projected caudally along the medial surface of the forebrain. In contrast, two embryos (from a total of 16) each had a large fascicle of AP+dnNP-1 transfected axons that projected some distance outside of the lateral surface of the telencephalon. These fascicles of axons appeared to break off from the main olfactory nerve prior to contact with the telencephalon. Cells transfected with AP+dnNP-1 were found migrating in the telencephalon along a route similar to that seen in controls (Figure 1 IF). To quantify the frequency of dnNP-1 induced overshooting of the target, the number of labeled axons overshooting their target in AP+BGal were compared with AP+dnNP-1 transfected embryos. Since overshooting was more frequent when many labeled axons arrived at the target, data is expressed as the average number of overshooting (mis-guided) axons in relation to the total number of labeled axons in the preparation (Figure 12). In AP+BGal transfected embryos, no overshooting axons were observed when fewer than 4 transfected axons reached the telencephalon. The number of overshooting axons did not exceed two in any of the AP+BGal transfected embryos analyzed. dnNP-1 expressing olfactory axons were observed to overshoot their target when as few as two of them reached the telencephalon. However, the number of overshooting axons increased dramatically as more transfected olfactory axons reached the telencephalon. Nevertheless, regardless of overall transfection levels, axons transfected with dnNP- 1 showed a substantially greater number of eπors than did control axons.

Example 4: Overshooting Olfactory Axons Enter the Telencephalon Prematurely.

AP-labeled, C-deletion neuropilin-1 (AP+dnNP-1) transfected embryos were sectioned and counter-stained with an anti-neurofilament antibody to determine if overshooting olfactory axons entered into the telencephalon or grew upon its surface. The trajectories of olfactory axons expressing dnNP-1 were reacted with AP-histochemistry and examined in whole mounts at E7 (Figures 13 A, 13D).

Three embryos were selected to represent the usual experimental result in which

AP+dnNP-1 expressing overshooting axons. The 3 brains were sectioned for analysis purposes (creating 6 images in Figure 13). One side showed the overextension of axons on the medial side, while the other shoed the extension on the lateral side of the brain. The tissue was probed with anti-neurofilament antibodies to visualize axons within the CNS

(Figures 13C, 13F). The majority of the treated axons were defasciculated and extended largely on the medial side of the telencephalon. In these embryos, labeled axons were found to extend within the CNS. They grew in the most superficial layers of the telencephalon just beneath the pial surface (Figures 13B, 13C).

A fourth embryo was selected an divided, as above, to represent the two experimental cases in which AP+dnNP-1 expressing, overshooting axons were highly fasciculated and extended on the lateral surface of the telencephalon. The labeled axons in this embryo were found to extend outside the pial membrane on the surface of the brain. Labeled axons were bundled together with additional unlabeled axons that may have originated in the olfactory epithelium (Figures 13E, 13F).

Example 5: dnNP-1 Induced Mis-projection of Olfactory Axons Persists in E9 Embryos. The trajectories of olfactory axons in E9 embryos transfected with either AP+BGal or

AP+dnNP-1 were examined to see if overshooting axons survived to later ages and/or converged on an inappropriate secondary targets. Because survival to this late age was rare after transfection, only four embryos in each treatment group were analyzed. Olfactory axons transfected with AP+BGal extended to the nascent olfactory bulb and terminated on its surface. No labeled axons were seen to extend past the caudal margin of the olfactory bulb and into the forebrain (Figures 15 A, 16A). In contrast, all of the four E9 embryos transfected with AP+dnNP-1 contained at least one labeled axon that had overshot the olfactory bulb and extended into the forebrain (Figures 15B, 16D). One particularly dramatic abeπant projection appeared to extend the entire length of the forebrain, turning and branching multiple times.

Nevertheless, not all axons that express C-deletion neuropilin-1 project abeπantly. In fact, some behave normally even when they reach the telencephalon. There are several possible explanations for this. First, AP-labeled axons could express the truncated neuropilin-1 at different levels. The heterogenity of their responses could be ascribed to differences in C-deletion neuropilin-1 expression levels. It is also possible that not all AP labeled axons express C-deletion neuropilin-1, since the two plasmids were co-transfected. Co-transfection by electroporation in ovo has been shown to result in nearly all cells expressing protein from both plasmids (Feiner et al. unpublished). However, even under the best of circumstances, some AP labeled axons would be expected to have little or no truncated neuropilin-1. For this reason, the full null phenotype, coπesponding to the total blockade of semaphorin function, could never be revealed by this approach. Second, the truncated neuropilin-1 construct would be unlikely to block the functions of all of the guidance cues that determine olfactory axon trajectories. Although C-deletion neuropilin-1 can block the function of more than one class 3 semaphorin, it is possible that other semaphorins with overlapping functions could compensate for the loss. For example, some class 3 semaphorin family members have been reported to act exclusively through neuropilin-2 (Chen et al, 1998; Giger et al, 1998), and they may play a role in this system. Although in situ hybridization experiments suggest that SEMA-3A provides telencephalic repellent activity, other classes of semaphorins, or other altogether unrelated guidance molecules, may also help keep olfactory axons out of the CNS.

A third possible explanation for the apparently normal behavior of the certain C- deletion neuropilin-1 expressing olfactory axons is that only the earliest of them may be affected. Very early arriving axons that grow past the location where the olfactory bulb will form never have the opportunity to contact, recognize, and terminate in their appropriate target. But later arriving axons, even those expressing C-deletion neuropilin-1, could have that opportunity since the olfactory bulb would have differentiated more fully by their arrival. The more fully differentiated bulb may provide appropriate synaptic sites or other cues that actively encourage olfactory axons to stop growing and begin to make synapses.

Example 6: dnNP-1 Expressing Axons are Present in the Olfactory Nerve Fiber Layer.

Once the olfactory bulb evaginates from the telencephalon, olfactory axons ramify to form the olfactory nerve fiber layer (ONL) (Figure IOC). To determine if olfactory axons expressing dnNP-1 remain in this layer, or if they enter deeper inappropriate layers, olfactory bulbs from two E9 embryos co-transfected with AP+BGal and two E9 embryos co- transfected with AP+dnNP-1 were sectioned and co-stained with an anti-neurofilament antibody. Olfactory axons transfected with AP+BGal were located within the ONL (Figures 16B, 16C). Serial sections through a single bulb showed that these axons were distributed throughout the ONL (data not shown). Olfactory axons transfected with AP+dnNP-1 were also located in the ONL. A section containing an overshooting olfactory axon showed that it extended in the deepest portion of the ONL (Figures 16E, 16F). Although the sample size was limited, dnNP-1 expressing axons were not detected that projected abnormally into deeper, inappropriate layers of the bulb.

Example 7: SEMA-3 A Repels Olfactory Axons, Preventing Entry into Telencephalon.

Olfactory axons express neuropilin-1 and SEMA-3 A induce the collapse of their growth cones in vitro. Based upon the foregoing findings, it is apparent that SEMA-3 A expression in the telencephalon acts as a repellent that keeps these axons from entering the telencephalon prematurely. To investigate the possibility that the remaining class 3 semaphorins might have comparable chemo-repellent functions for olfactory axons, SEMA- 3B, SEMA-3C and SEMA-3D were studied to determine whether they are also expressed in the telencephalon during the time period that olfactory axons are halted at its surface. No other class 3 chick semaphorins are cuπently known. When olfactory axons are just beginning to reach the telencephalon at E5, SEMA-3A expression is seen in the olfactory epithelium and in cells of the most superficial layer of the telencephalon (Figure 16A). Meanwhile, SEMA-3C and SEMA-3E expression are seen in deep layers of the telencephalon (Figures 16G, 16J). However, SEMA-3D expression is not detectable in the E5 telencephalon (data not shown).

By E7, SEMA-3A expression is observed in superficial layers throughout the telencephalon, including at its point of contact with olfactory axons (Figure 16B). At this point, SEMA-3B, SEMA-3C and SEMA-3D are no longer expressed in the telencephalon. However, all are expressed very weakly by cells located within the olfactory nerve itself (Figures 16E, 16H, 16K). SEMA-3D is also expressed by a subset of cells in the olfactory epithelium (data not shown).

By E9 olfactory axons ramify within the olfactory nerve layer in the bulb. At this age SEMA-3A is no longer expressed on the surface of the bulb; rather, it is restricted to deeper layers (Figure 16C). Sema-3C is expressed in a cluster of cells located adjacent to the olfactory nerve entry point (Figure 161) and SEMA-3D is expressed within or just below the developing ONL (Figure 16F). No SEMA-3E expression was detected in the E9 bulb (data not shown). These results indicate that of the class 3 semaphorins, only SEMA-3 A is expressed in the coπect position at the appropriate time to provide a repellent signal that would prevent olfactory axons from extending into the telencephalon.

Each and every patent, patent application and publication that is cited in the foregoing specification is herein incorporated by reference in its entirety. While the foregoing specification has been described with regard to certain prefeπed embodiments, and many details have been set forth for the purpose of illustration, it will be apparent to those skilled in the art that the invention may be subject to various modifications and additional embodiments, and that certain of the details described herein can be varied considerably without departing from the spirit and scope of the invention. Such modifications, equivalent variations and additional embodiments are also intended to fall within the scope of the appended claims.

Claims

What is claimed is:

1. An isolated DNA encoding a dominant negative receptor, wherein the DNA comprises a nucleic acid sequence encoding a neuropilin-1 which has semaphorin receptor specific antigenicity or immunogenicity, including homologs, modifications, derivatives and active fragments thereof.

2. The DNA of claim 1 produced recombinantly.

3. A recombinant cell or tissue comprising the isolated DNA of claim 1.

4. A vector comprising the isolated DNA of claim 1.

5. A developing animal comprising the isolated DNA of claim 1.

6. An isolated polypeptide encoded by the DNA of claim 1.

7. An isolated polypeptide encoded by the DNA of claim 2.

8. An isolated polypeptide comprising a dommant negative receptor, which has receptor- specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F, including homologs, analogs, variants and active fragments thereof.

9. The polypeptide according to claim 8, comprising a C-domain deletion construct of neuropilin-1, including homologs, analogs, variants and active fragments thereof.

10. The polypeptide according to claim 9, wherein amino acid residues Ala ₅₈ to Ile₈ ι are deleted from a full-length neuropilin-1 molecule, including homologs, analogs, variants and active fragments of said polypeptide.

11. A method of modulating or inactivating the activity of selected secreted semaphorins, comprising adding or overexpressing a dominant negative receptor, which has receptor- specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F.

12. The method according to claim 11, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1.

13. The method according to claim 12, wherein amino acid residues Ala ₅₈ to Ile₈₅ι are deleted from a full-length neuropilin-1 molecule.

14. A method of inhibiting or preventing the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, said method comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F.

15. The method according to claim 14, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1.

16. The method according to claim 15, wherein amino acid residues Ala_{2 8} to Ile₈₅ι are deleted from a full-length neuropilin-1 molecule.

17. The method according to claim 14, wherein the axon growth occurs in a developing neurological system.

18. The method according to claim 17, wherein the axon growth occurs in a regenerating neurological system.

19. An in vivo method for modulating overgrowth or premature entry of axons to their targets, said method comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3 A and for semaphorin 3C, but not for semaphorin 3F.

20. The method according to claim 19, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1.

21. The method according to claim 20, wherein amino acid residues Ala₂₅₈ to Ile₈₅i are deleted from a full-length neuropilin-1 molecule.

22. The method according to claim 19, wherein the axons occur in a developing neurological system.

23. The method according to claim 19, wherein the axons occur in a regenerating neurological system.

24. A method for enhancing axon generation or regeneration by blocking secreted semaphorin binding, said method comprising adding or overexpressing a dominant negative receptor, which has receptor-specific antigenicity or immunogenicity for semaphorin 3A and for semaphorin 3C, but not for semaphorin 3F.

25. The method according to claim 24, wherein the dominant negative receptor comprises a C-domain deletion construct of neuropilin-1.

26. The method according to claim 25, wherein amino acid residues Ala ₈ to Ile₈₅ι are deleted from a full-length neuropilin-1 molecule.

27. The method according to claim 24, wherein axon generation occurs in a developing neurological system.

28. The method according to claim 24, wherein axon regeneration occur in a regenerating neurological system.

29. A method of screening for an agent which modulates the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, said method comprising the steps of:

A) incubating a mixture comprising: i) an isolated peptide according to claim 6, ii) a binding target of said polypeptide, and iii) a candidate agent; iv) under conditions whereby, but for the presence of said agent, said polypeptide binds said binding target at a reference affinity; and B) detecting the binding affinity of said polypeptide to said binding target to determine the agent- biased affinity, wherein a difference between the agent-biased affinity and the reference affinity indicates that said agent modulates the binding of said polypeptide to said binding target.

30. A method of screening for an agent which modulates the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, said method comprising the steps of:

A) incubating a mixture comprising: i) an isolated peptide according to claim 7, ii) a binding target of said polypeptide, and iii) a candidate agent; iv) under conditions whereby, but for the presence of said agent, said polypeptide binds said binding target at a reference affinity; and B) detecting the binding affinity of said polypeptide to said binding target to determine the agent- biased affinity, wherein a difference between the agent-biased affinity and the reference affinity indicates that said agent modulates the binding of said polypeptide to said binding target.

31. A method of screening for an agent which modulates the collapse or motility of an axon growth cone, wherein motility or collapse is mediated by a secreted semaphorin, said method comprising the steps of:

A) incubating a mixture comprising: i) an isolated peptide according to claim 8, ii) a binding target of said polypeptide, and iii) a candidate agent; iv) under conditions whereby, but for the presence of said agent, said polypeptide binds said binding target at a reference affinity; and etecting the binding affinity of said polypeptide to said binding target to determine the agent- biased affinity, wherein a difference between the agent-biased affinity and the reference affinity indicates that said agent modulates the binding of said polypeptide to said binding target.