WO2001017992A1 - Inhibitors of prenyl-protein transferase - Google Patents

Inhibitors of prenyl-protein transferase Download PDF

Info

Publication number
WO2001017992A1
WO2001017992A1 PCT/US2000/024542 US0024542W WO0117992A1 WO 2001017992 A1 WO2001017992 A1 WO 2001017992A1 US 0024542 W US0024542 W US 0024542W WO 0117992 A1 WO0117992 A1 WO 0117992A1
Authority
WO
WIPO (PCT)
Prior art keywords
substituted
unsubstituted
imidazol
alkyl
methyl
Prior art date
Application number
PCT/US2000/024542
Other languages
French (fr)
Inventor
Ian M. Bell
Steven N. Gallicchio
Douglas C. Beshore
William C. Lumma, Jr.
John T. Sisko
C. Blair Zartman
Original Assignee
Merck & Co., Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck & Co., Inc. filed Critical Merck & Co., Inc.
Priority to AU73549/00A priority Critical patent/AU7354900A/en
Publication of WO2001017992A1 publication Critical patent/WO2001017992A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
    • C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4178—1,3-Diazoles not condensed 1,3-diazoles and containing further heterocyclic rings, e.g. pilocarpine, nitrofurantoin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/445—Non condensed piperidines, e.g. piperocaine
    • A61K31/4523—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems
    • A61K31/454—Non condensed piperidines, e.g. piperocaine containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. pimozide, domperidone
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47—Quinolines; Isoquinolines
    • A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/496—Non-condensed piperazines containing further heterocyclic rings, e.g. rifampin, thiothixene or sparfloxacin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5355—Non-condensed oxazines and containing further heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K41/00—Medicinal preparations obtained by treating materials with wave energy or particle radiation ; Therapies using these preparations
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
    • C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
    • C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
    • C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
    • C07D409/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D417/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00
    • C07D417/14—Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by group C07D415/00 containing three or more hetero rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D513/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00
    • C07D513/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for in groups C07D463/00, C07D477/00 or C07D499/00 - C07D507/00 in which the condensed system contains two hetero rings
    • C07D513/04—Ortho-condensed systems

Definitions

  • Ras proteins are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein.
  • Ras In the inactive state, Ras is bound to GDP.
  • Ras Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change.
  • the GTP -bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M.
  • Mutated ras genes (Ha-ras, Ki4a-r ⁇ s , K ⁇ 4b-ras and N-r ⁇ s) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
  • Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras.
  • the Ras C-terminus contains a sequence motif termed a "CAAX” or "Cys-Aaa - Aaa -Xaa” box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 310:583-586 (1984)).
  • this motif serves as a signal sequence for the enzymes farnesyl- protein transferase or geranylgeranyl -protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C 15 or C 20 isoprenoid, respectively.
  • Such enzymes may be generally termed prenyl-protein transferases.
  • farnesylated proteins include the Ras-related GTP -binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above. Inhibition of farnesyl-protein transferase has been shown to block the growth of Ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype.
  • Famesyl-protein transferase utilizes famesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a famesyl group (Reiss et al, Cell, 62:81-88 (1990); Schaber et al, J. Biol. Chem., 2(55:14701-14704 (1990); Schafer et al, Science, 249:1133-1139 (1990); Marine et al, Proc. Natl. Acad. Sci USA, 87:1541-1545 (1990)). Inhibition of famesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks
  • Ras membrane localization in cultured cells Although direct inhibition of famesyl- protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
  • FPTase famesyl-protein transferase
  • FPP famesyl diphosphate
  • Ras protein substrates
  • the peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation.
  • Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the famesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1931 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)).
  • deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound.
  • the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable.
  • famesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7- 112930).
  • an object of this invention to develop compounds that will inhibit prenyl-protein transferase and thus, the post-translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the compounds of this invention and methods for producing the compounds of this invention.
  • the present invention comprises non-prodrug compounds which inhibit prenyl-protein transferases. Further contained in this invention are chemotherapeutic compositions containing these prenyl-protein transferase inhibitors and methods for their production.
  • the compounds of this invention are useful in the inhibition of prenyl- protein transferase.
  • the inhibitors of a prenyl- protein transferase are illustrated by the formula A:
  • X 1 is (C(R la ) 2 ) n A 1 (C(R la ) 2 ) n A 2 ;
  • X 2 is (C(R lb ) 2 ) A 3 (C(R lb ) ' 2 2) n ;
  • X is (C(R ) 2 ) q A (C(R ) 2 ), q'
  • R la , R lb and R lc are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, R .1 J 0 W ,O-, R 6a S(O) m , unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, -C(O)NR 6 R 7 , R 10 C(O)NR 10 -, (R 10 ) 2 NC(O)NR 10 -, R 10 C(O)-, -N(R 10 ) 2 , R 10 OC(O)-, and
  • R is independently selected from: a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted,
  • R is independently selected from: H, CN, NO 2 , halo, unsubstituted or substituted C j -C 6 alkyl, N 3 , oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C 6 perfluoroalkyl 5 CF 3 O-, CF 3 CH 2 -, unsubstituted or substituted C 3 -C 10 cycloalkyl, O R 10 , NPvV, OR & , -C(O)R 10 , -O(C,-C 6 alkyl)OR 10 , -S(O) m R 6a , -OS(O
  • R and R are independently selected from: H, OR 10 , unsubstituted or substituted C,-C 6 alkyl, unsubstituted or substituted
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) . -NC(O)-, and -N(COR 10 )- ;
  • R , R and R are independently selected from:
  • R and R may be joined in a ring
  • R and R may be joined in a ring
  • R is selected from a) C 3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) C 1-4 alkoxy, 2) aryl or heterocycle,
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted
  • R I O O-, CN, R 6a S(O) m -, -C(O)NR 6 R 7 , R 10 C(O)NR 10 -, NO 2 , (R 10 ) 2 NC(O)NR 10 -, R 10 C(O)-, R 10 OC(O)-, R 10 OC(O)NR 10 -,
  • R is independently selected from 1) H, unsubstituted or substituted C,-C 6 alkyl, unsubstituted or substituted C 2 -C 8 alkenyl, unsubstituted or substituted C 2 -C 8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C 6 alkyl, unsubstituted or substituted, b) (CH 2 ) n OR 6 , c) (CH 2 ) n NR R 7 , d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C ] -C 4 alkyl, i) S(O) m R 6a , j) N(R 10 ) 2 , k)
  • -(C,-C 6 alkyl)NR 10 C(O)R 13 R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
  • R 13 is independently selected from a) H, b) unsubstituted or substituted C,-C 6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C 3 -C 10 cycloalkyl, unsubstituted or substituted,
  • G ,2 are independently selected from oxygen or H-
  • V is selected from a) hydrogen, b) heterocycle, c) aryl, d) C,-C 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and e) C 2 -C 20 alkenyl, provided that V is not hydrogen if A is S(O) and q is 0;
  • W is a heterocycle
  • Y is selected from a) H, b) C,-C 8 alkyl, c) C 2 -C 8 alkenyl, d) C 2 -C 8 alkynyl, e) C 3 -C 20 cycloalkyl, f) aryl, and g) heterocycle;
  • X 2 is (C(R lb ) 2 ) p A 3 (C(R lb ) 2 2)'p'
  • X 3 is (C(R lc ) 2 ) q A 4 ;
  • R a and R are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted ⁇ o. heterocycle, unsubstituted or substituted C 3 -C, 0 cycloalkyl, R " O-,
  • R S(O) m unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, -C(O)NR 6 R 7 , R 10 C(O)NR 10 -, (R 10 ) 2 NC(O)NR ,() -, R 10 C(O)-, -N(R 10 ) 2 , R'°OC(O)-, and
  • R c is selected from a) hydrogen and b) unsubstituted or substituted C ] -C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R O-, R S(O) m ,
  • A is a bond;
  • R is independently selected from: a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R a S(O) m , k) C 3 -C 10 cycloalkyl, unsubstituted or substituted, 1) C 2 -C 6 alkenyl, unsubstituted or substituted, m) C 2 -C 6 alkynyl, unsubstituted or substituted, n) (R 10 ) 2 NC(O)NR 10 -, o) R ,0 C(O)-, p) R 10 C(O)NR 10 -, q) R 10 OC(O)-, r) -N(R 10
  • R is independently selected from:
  • substituted group is substituted with one or more of:
  • aryl or heterocycle unsubstituted or substituted with: a) C,-C 6 alkyl, b) (CH 2 ) n OR C , c) (CH 2 ) n NR 6 R 7 , d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C 1 -C 4 alkyl. h) S(O) m R 6a ,
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) U - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) m , N 10 , -NC(O)-, and -N(COR 10 )- ;
  • R , R and R a are independently selected from: H, C,-C 6 alkyl, C 3 -C 6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C j -C 4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C j -C 6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO, e)
  • R 7 and R 7a may be joined in a ⁇ ng
  • R a is selected from a) C 3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R 6a is independently selected from a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted
  • R is independently selected from
  • R , 10 i.s independently selected from a) hydrogen, b) unsubstituted or substituted C,-C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl; 13 • R is independently selected from a) H, b) unsubstituted or substituted 0,-C 8 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C
  • G and G are independently selected from oxygen or H 2'
  • V is selected from a) heterocycle, b) aryl, and c) j -C 20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O) m , and N, and
  • W is a heterocycle
  • Y is selected from a) H, b) C,-C 8 alkyl, c) C 3 -C 20 cycloalkyl, d) aryl, or e) heterocycle;
  • R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C ]0 cycloalkyl, R O-,
  • R S(O) m unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, -C(O)NR 6 R 7 , R 10 C(O)NR 10 -, (R 10 ) 2 NC (O)NR 10 -, R'°C(O)-, -N(R'°) 2 , R'°OC(O)-, and R 10 OC(O)NR 10 -, and c) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 al
  • R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R'°O-, R 6a S(O) m ,
  • R is independently selected from: a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) j -C 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 63 S(O) m , k) C 3 -C 10 cycloalkyl, unsubstituted or substituted,
  • R is independently selected from: H, CN, NO 2 , halo, unsubstituted or substituted C,-C 6 alkyl, N 3 , oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C 6 perfluoroalkyl ⁇ CF 3 O-, CF 3 CH 2 -, unsubstituted or substituted C 3 -C 10 cycloalkyl, OR 10 , NRV, OR 6 , -C(O)R'°, -O(C r C 6 alkyl)OR 10 , -S(O) m R 6a , -C(O)NRV,
  • R 4 5 R and R are independently selected from:
  • aryl or heterocycle unsubstituted or substituted with: a) C,-C 6 alkyl, b) (CH 2 ) n OR 6 , c) (CH 2 ) NR R 7 , d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C 1 -C 4 alkyl, h) S(O) m R a ,
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) m , NR 10 , -NC(O)-, and -N(COR'°)- ;
  • R , R and R are independently selected from: H, C,-C 6 alkyl, C 3 -C 6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C 4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C ⁇ C g alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
  • R and R may be joined in a ring
  • R and R may be joined in a ⁇ ng
  • R is selected from a) C 3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, unsubstituted or substituted C 3 -C 6 cycloalkyl,
  • R is independently selected from 1) H, unsubstituted or substituted C,-C 6 alkyl, unsubstituted or substituted C 2 -C 8 alkenyl, unsubstituted or substituted C 2 -C 8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C 6 alkyl, unsubstituted or substituted, b) (CH 2 ) n OR 6 , c) (CH 2 ) n NR 6 R , d) halogen, e) CN, > aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted. h) perfluoro-C ] -C 4 alkyl, i) S(0) m R a , j) N(R 10 ) 2 , k) NR 10 C
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C j -C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) unsubstituted or substituted C,-C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) H, b) unsubstituted or substituted C ] -C 6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C 3 -C 10 cycloalkyl, unsubstituted or substituted, j) CF 3 , k) CF 3 O-,
  • G is selected from oxygen or H 2 ;
  • V is aryl or heteroaryl
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
  • Y is selected from a) H, b) C r C g alkyl, c) C 3 -C 20 cycloalkyl, d) aryl or e) heterocycle;
  • X I is (C(R , a ) 2 ) A l (C(R la ) 2 ) n A 2 ;
  • R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, R O-,
  • R S(O) m unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R 10 C(O)NR 10 -, -C(O)NR 6 R 7 , (R 10 ) 2 NC(O)NH 10 -, R 10 C(O)-, -N(R 10 ) 2 , R'°OC(O)-, and
  • R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C j -C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C ]0 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R O-, R S(O) m ,
  • R is independently selected from: a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R a S(O) m , k) C 3 -C 10 cycloalkyl, unsubstituted or substituted, 1) C 2 -C 6 alkenyl, unsubstituted or substituted, m) C 2 -C 6 alkynyl, unsubstituted or substituted, n) (R 10 ) 2 NC(O)NR 10 -, o) R'°C(O)-, p) R 10 C(O)NR 10 -, q) R 10 OC(O)-, r) -N(R 10 )
  • R is independently selected from:
  • R and R are independently selected from:
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) m , NR 10 , -NC(O)-, and -N(COR'°)- ;
  • R , R and R are independently selected from:
  • R and R may be joined in a nng
  • R and R may be joined in a ring
  • R is selected from a) C3_6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from 5 a) hydrogen, b) F, CI, Br, R'°O-, CN, R 6a S(O) m -, -C(O)NR 6 R 7 , R 10 C(O)NR' 0 -, NO 2 , (R 10 ) 2 NC(O)NR 10 -, R'°C(O)-, R 10 OC(O)-, R 10 OC(O)NR 10 -, N 3 , or
  • R is independently selected from 5 1) H, unsubstituted or substituted C,-C 6 alkyl, unsubstituted or substituted C 2 -C 8 alkenyl, unsubstituted or substituted C 2 -C 8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: 0 a) C ] -C 6 alkyl, unsubstituted or substituted, b) (CH 2 ) n OR 6 , c) (CH 2 ) n NR R 7 , d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C ] -C 4 alkyl, i) S(0) m R a , j) N(R ,0 ) 2
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • 1 1 R is independently selected from a) unsubstituted or substituted C,-C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) H, b) unsubstituted or substituted C,-C 6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C 3 -C 10 cycloalkyl, unsubstituted or substituted, j) CF 3 , k) CF 3 O-,
  • G is selected from oxygen or H,
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl; Yis selected from a) H, b) C,-C 8 alkyl, c) C 3 -C 20 cycloalkyl, d) aryl, or e) heterocycle;
  • R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C, 0 cycloalkyl, R O-,
  • R S(O) m unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R 10 C(O)NR 10 -, -C(O)NR 6 R 7 ,
  • R 10 OC(O)NR 10 -; and c) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C j -C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R O-, R S(O) m , R 10 C(O)NR 10 -, -C(O)NR 6 R 7 , (R 10 ) 2 NC(O)NR 10 -, R'°C(O)-,
  • R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C j -C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 5 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R O-, R S(O) m , R 10 C(O)NR 10 -, -C(O)NR 6 R 7 , (R 10 ) 2 NC(O)(NR 10 )-, R'°C(O)-,
  • R is independently selected from: a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C 3 -C 10 cycloalkyl, unsubstituted or substituted,
  • R is independently selected from:
  • OR 10 , -S(O) m R 6a , -C(O)NRV, -NHC(O)R 10 , -(C,-C 6 alkyl)OR 10 , and -(C r C 6 alkyl)C(O)R 10 ;
  • R 4 5 R and R are independently selected from:
  • aryl or heterocycle unsubstituted or substituted with: a) C,-C 6 alkyl, b) (CH 2 ) n OR 6 , c) (CH 2 ) n NR 6 R , d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C 4 alkyl, h) S(O) m R a ,
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) m , N 10 , -NC(O)-, and -N(COR 10 )- ;
  • R , R and R are independently selected from:
  • R and R may be joined in a ring
  • R and R may be joined in a ring
  • R is selected from a) C 3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from a) hydrogen, and b) C,-C 6 alkyl, unsubstituted or substituted by C C 4 perfluoroalkyl,
  • R is independently selected from
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C ⁇ C g alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • 1 1 R is independently selected from a) unsubstituted or substituted C j -C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) H, b) unsubstituted or substituted C,-C 6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C 3 -C 10 cycloalkyl, unsubstituted or substituted,
  • G is selected from oxygen or H 2'
  • Y is selected from a) C r C g alkyl, b) C 3 -C 20 cycloalkyl, c) aryl, or d) heterocycle;
  • R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted
  • R S(O) m unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R 10 C(O)NR ! °-, -C(O)NR 6 R 7 , (R 10 ) 2 NC (O)(NR 10 )-, R 10 C(O)-, -N(R 10 ) 2 , R'°OC(O)-, and R ,0 OC(O)NR 10 -, and c) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C,
  • R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C 6 alkyl, wherein the substituent on the substituted C,-C 6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C 3 -C 10 cycloalkyl, unsubstituted or substituted C 2 -C 6 alkenyl, unsubstituted or substituted C 2 -C 6 alkynyl, R O-, R S(O) m ,
  • R is independently selected from a) hydrogen, b) CN, c) NO 2 , d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C 6 alkyl, unsubstituted or substituted, h) OR 10 , i) N 3 , j) R 6a S(O) m , k) C 3 -C ]0 cycloalkyl, unsubstituted or substituted,
  • R is independently selected from:
  • R and R are independently selected from:
  • R and R are attached to the same C atom and are combined to form -(CH 2 ) u - wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) m , NR 10 , -NC(O)-, and -N(COR 10 )- ;
  • R , R and R are independently selected from:
  • R and R may be joined in a ring
  • R and R may be joined in a ring
  • R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
  • R is independently selected from a) hydrogen, and b) C,-C 6 alkyl, unsubstituted or substituted by C C 4 perfluoroalkyl,
  • R is independently selected from
  • R is independently selected from a) hydrogen, b) unsubstituted or substituted C j -C 6 alkyl, c) C 3 -C 6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
  • 1 1 R is independently selected from a) unsubstituted or substituted C,-C 6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
  • R is independently selected from a) H, b) unsubstituted or substituted C,-C 6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C 2 -C 6 alkynyl, unsubstituted or substituted, h) C 2 -C 6 alkenyl, unsubstituted or substituted, i) C 3 -C ]0 cycloalkyl, unsubstituted or substituted, j) CF 3 , k) CF 3 O-,
  • G is selected from oxygen or H 2 ;
  • Y is selected from a) C r C g alkyl, b) C 3 -C 20 cycloalkyl, c) aryl, or d) heterocycle;
  • the compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention.
  • any variable, term or substituent e.g. aryl, heterocycle, n, Rl a , etc.
  • substituents and/or variables are permissible only if such combinations result in stable compounds.
  • alkyl is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified; "alkoxy” represents an alkyl group having 1 to 6 carbon atoms, unless otherwise indicated, attached through an oxygen bridge.
  • Halogen or “halo” as used herein means fluoro, chloro, bromo and iodo.
  • Cycloalkyl as used herein is intended to include non-aromatic cyclic hydrocarbon groups, having the specified number of carbon atoms, which may or may not be bridged or structurally constrained.
  • cycloalkyls examples include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, cyclooctyl, cycloheptyl, and the like.
  • alkenyl refers to a non-aromatic hydrocarbon, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present.
  • C 2 -C 6 alkenyl means an alkenyl radical having from 2 to 6 carbon atoms.
  • alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl and cyclohexenyl.
  • the straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated.
  • alkynyl refrs to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon-carbon triple bonds may be present.
  • C 2 -C 6 alkynyl means an alkynyl radical having from 2 to 6 carbon atoms.
  • alkynyl groups include, but are not limited to, ethynyl, propynyl and butynyl.
  • the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
  • aryl is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic.
  • aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
  • aralkyl is intended to mean an aryl moiety, as defined above, attached through a C ⁇ -Cg alkyl linker, where alkyl is defined above.
  • alkyl is defined above.
  • aralkyls include, but are not limited to, benzyl, naphthylmethyl and phenylbutyl.
  • heterocycle or heterocyclic represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring.
  • the heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure.
  • heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzo- pyrazolyl, benzotriazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, dihydroimidazothiazolyl, furyl, furanyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazo
  • heteroaryl is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S.
  • heteroaryl elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzopyrazolyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furanyl, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyrazinyl, pyrazolyl, pyri
  • heterocyclycylalkyl is intended to mean a heterocyclic moiety, as defined above, attached through a Cj-Cg alkyl linker, where alkyl is defined above.
  • heterocyclylalkyls include, but are not limited to,
  • substituted alkyl As used herein, the terms "substituted alkyl”, “substituted alkenyl”,
  • substituted alkynyl and “substituted alkoxy” are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, CI, Br, I, CF 3 , N 3 , NO 2 , NH 2 oxo, OH,
  • substituted aryl As used herein, the terms “substituted aryl”, “substituted heterocycle”, “substituted heteroaryl”, “substituted cycloalkyl”, “substituted benzyl”, “substituted aralkyl” and “substituted heterocyclylalkyl” are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound.
  • Such substitutents are preferably selected from the group which includes but is not limited to F, CI, Br, I, CF 3 , NH 2 , N(C,-C 6 alkyl) 2 , NO 2 , CN, N 3 , C,-C 20 alkyl, C,-C 6 alkoxy, C 3 -C 20 cycloalkyl, -OH, -O(C,-C 6 alkyl), S(O) 0 2 , (C,-C 6 alkyl)S(O) favor 2 -, (C,-C 6 alkyl)S(O) 0.2 (C,-C 6 alkyl)-, (C,-C 6 alkyl)C(O)NH-, H 2 N- CH(NH)-, H 2 N-C(O)NH-(C,-C 6 alkyl)C(O)-, (C,-C 6 alkyl)OC(O)-, (C,-C 6 alkyl) O(C,-C 6 al
  • cyclic moieties When R and R are combined to form - (CH2)u -, cyclic moieties are formed. Examples of such cyclic moieties include, but are not limited to:
  • such cyclic moieties may optionally include a heteroatom(s).
  • heteroatom-containing cyclic moieties include, but are not limited to:
  • Examples of the ring structures which may be formed when R and R , or R and R a , are joined include, but are not limited to,
  • C 3 - C 20 cycloalkyl may include, but are not limited to:
  • R is independently selected from hydrogen, -OR , CN, unsubstituted or substituted aryl and halogen. Most preferably, r is 1 to 3 and at least
  • one R is CN.
  • R is independently selected from hydrogen, halo, unsubstituted or substituted C,-C 6 alkyl, unsubstituted or substituted heterocycle,
  • 6 7 6a 10 unsubstituted or substituted aryl, -NR R , oxido, -S(O) m R , -OR , and C,-C 6 perfluoroalkyl.
  • R and R are independently selected from hydrogen
  • R and R are independently selected from hydrogen or unsubstituted or substituted C,-C 6 alkyl.
  • R is selected from hydrogen, or unsubstituted or substituted C,-C 6 alkyl. Most preferably, R is selected from hydrogen or methyl.
  • R is selected from hydrogen, unsubstituted or substituted C,-C 6 alkyl, and unsubstituted or substituted aryl.
  • R is selected from hydrogen, unsubstituted or substituted
  • X is selected from C(O)(CH 2 ) p or (CH 2 ) p , where p is 1 or 2.
  • X is (CR 2 ) p , where p is 1 or 2.
  • a 1 is selected from a bond, C(O), -NR'°C(O)-, OC(O)NR 10 or S(O) m .
  • A is selected from a bond, -NR ,0 C(O)-, C(O), or S(O) m .
  • A is selected from a bond, C(O), or S(O) m .
  • A is a bond or C(O). Most preferably, A is a bond.
  • G 2 is H 2 .
  • V is selected from aryl or heterocycle. More preferably, V is aryl. Most preferably, V is phenyl.
  • W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 2-oxopiperidinyl, quinolinyl, isoquinolinyl, and thienyl. More preferably, W is imidazolyl or pyridinyl. Most preferably, W is imidazolyl.
  • Y is selected from aryl, heterocycle, C,-C 6 alkyl or a C 3 -
  • Y is aryl or heterocycle.
  • n, p, and q are independently 0, 1 , 2, 3 or 4.
  • r,s and t are independently selected from 0, 1, 2, or 3.
  • any substituent or variable e.g., R la , R 2 , m, p, etc.
  • -C(R la ) 2 can represent -CH 2 , -CHCH 3 , -CHC 2 H 5 , etc.
  • substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
  • the pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids.
  • such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, trifluoroacetic and the like.
  • the pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichio- metric amounts or with an excess of the desired salt- forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • variable n is defined as 0 to 6 and variable p is defined as 0 to 4.
  • Scheme 1 depicts the synthesis of intermediate amide 1.
  • One variation starts with the EDC-mediated coupling of methionine with the amine of interest to give amide 1.
  • a second variation of this procedure uses PYBOP and DIEA in dichloromethane to achieve the initial coupling of the amine and methionine.
  • Scheme 2 details the construction of various 1 -substituted 3-amino- pyrrolidinones.
  • Amide 1 is treated with excess iodomethane, and the resulting sulfonium salt undergoes cyclization upon reaction with lithium Bis(trimefhylsily ⁇ ) amide in THF at 0°C to give the simple pyrrolidinone 2.
  • Scheme 3 demonstrates the synthesis of suitably substituted imidazolyl acetic acids.
  • the imidazole acetic acid 4 can be converted to the ester 5 by standard procedures.
  • Selective nitrogen protection provides intermediate 6 which is first reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester 7.
  • the ester 7 can be converted to the acetic acid 8 using either aqueous HCl or LiOH.
  • Scheme 3 A illustrates the synthesis of aldehyde A using the imidazolyl alcohol 9.
  • This alcohol 10 can be converted to the TBS ether intermediate B using TBSCl in DIEA, CH 2 C1 2 and DMAP.
  • Treating the alcohol 10 with pyridine and acetic anhydride will also yield the ester 11.
  • the ester 11 is converted to the benzylimidazolyl ester 12.
  • Treating 12 with LiOH will yield the benzyl- imidazolyl alcohol 13 which can be converted to aldehyde A using triethylamine and SO 3 -Py in DMSO
  • Scheme 3B demonstrates an alternative route for the synthesis of aldehyde A.
  • Benzyl bromide 14 is treated with hexamethyenetetramine in ethanol, resulting in compound 15.
  • Compound 15 is then treated with H 3 PO 4 , ethanol, and propionic acid to convert compound 15 to the benzylamine phosphate salt 16.
  • the phosphate salt is converted to the imidazolyl 17, using DHA, KSCN, C 2 H 5 COOH in MeCN and water.
  • DHA represents dihydroxyacetone and its dimer in equilibrium, as shown below:
  • the BOC-protected 3-aminopyrrolidinone of general structure 2 can be deprotected, as depicted in Scheme 4, with HCl in EtOAc at 0°C to give the corresponding amine 19. As shown, this amine 19 is then reductively alkylated with aldehyde A using either NaCNBH 3 in methanol, or NaBH(OAc) 3 in 1 ,2- dichloroethane, to provide the secondary amine 20. Similarly, compound 21 in Scheme 5 may be converted to compound 23 by analogous procedures.
  • Scheme 5 A demonstrates the synthesis of an isomeric pyrrolidinone.
  • the synthesis of the 3-aminopyrrolidinone 19a begins by treating the amine and a BOC-protected aspartic acid ethyl ester with PYBOP and DIEA. The resulting product is treated with Lawesson's reagent and the desired aminopyrrolidinone is cyclized using NaBH 4 and NiCl 2 to obtain the intermediate 5. Using techniques described above, the intermediate 2a is converted to the compound 19a, which may be used as a substitute for the basic 3-aminopyrrolidinone in any of the following schemes.
  • Scheme 6 shows the synthesis of amides of stmcture 24.
  • alde-hyde 28 an aminoalcohol is protected with a BOC group by treatment with di-tert- butyl dicarbonate and DIEA in DMF, and the resulting alcohol is subjected to standard Swem oxidation conditions to give alde-hyde 28.
  • ethylene glycol is selectively monoprotected by reaction of its sodium alkoxide with tert-butyldimethylsilyl chloride in THF. Swem oxidation of the monoprotected alcohol gives the desired aldehyde 29.
  • Compound 23 (from Scheme 5) may be reductively alkylated with aldehyde 28 and NaCNBH 3 in methanol to give the tertiary amine derivative 30, as shown in Scheme 9. Deprotection of 30 with HCl in EtOAc affords the amine 31.
  • Aldehyde 29 may be employed in a similar series of reactions to provide the corresponding hydroxyl compound of the instant invention.
  • Reductive alkylation of compound 23 with aldehyde 29 using NaCNBH in methanol provides structure 32 in Scheme 10.
  • This silyl ether is deprotected by treatment with TBAF in THF, and the resulting alcohol 33 is subjected to standard Swem oxidation to provide aldehyde 34.
  • This aldehyde 34 can be reductively aminated with, for example, mo ⁇ holine under standard NaCNBH 3 conditions to afford the instant compound 35.
  • Scheme 11 demonstrates a route to imidazolylethyl derivatives such as 38.
  • the methyl ester 7A is converted to the alcohol 36 using NaBH 4 and methanol. Then the alcohol 36 is converted to the corresponding mesylate 37 using methane- sulfonyl chloride and DIEA in dichloromethane. Reaction of aminopyrrolidinone 22 with a mixture of this mesylate, sodium iodide, and DIEA in DMF at 50°C affords compound 38.
  • Reductive alkylation of amine 39 with aldehyde A is carried out using standard NaCNBH 3 conditions to give compound 40 in Scheme 13. Removal of the BOC group using HCl in EtOAc, followed by EDC coupling of the amine with carboxylic acid (R a CO 2 H) provides the amide derivative 41.
  • Scheme 13A illustrates the synthesis of compound 41a, where compound 40 is deprotected, then reacted with the isocyanate (in THF) to provide the desired urea.
  • the aryl fluoride 42 may be converted to the corresponding aryl ethers 43 and 44 as shown in Scheme 14.
  • aryl ethers 43 and 44 For aliphatic alcohols (R OH), it is preferable to use potassium tert-butoxide as the base in THF at low temperature, and this yields compound 43.
  • R a OH aliphatic alcohols
  • cesium carbonate as base in DMF at 40°C affords the instant ether 44.
  • Scheme 15 illustrates the synthesis of a 3-amino-l-pyridin-2- ylpy ⁇ olidinone 50.
  • This amide 55 is treated with excess iodomethane, and the resulting sulfonium salt undergoes cyclization upon reaction with lithium bis(trimethylsilyl)amide in THF at 0°C to give the pyrrolidinone 56.
  • the benzyl ether can be removed by hydrogenolysis over Pd(OH) 2 in ethanol and acetic acid to give phenol 57, and the diastereomers may be separated by chromatography on silica gel, as shown in Scheme 17.
  • a pure diastereomer for example structure 58 in Scheme 17, is treated with HCl in EtOAc at 0°C to give the amine 59, and this is subjected to reductive alkylation with aldehyde A and NaCNBH 3 in methanol to provide compound 60.
  • benzaldehyde 61 is treated with methyl-magnesium bromide in THF at -78°C to give the alcohol 62.
  • a mixture of this alcohol, intermediate B (as described in Scheme 3 A) and DIEA in dichloromethane at -78°C is treated with trifluoromethanesulfonic anhydride, and the resulting imidazolium salt is heated in methanol to provide the imidazole 64.
  • the silyl ether is deprotected using TBAF in THF and the resulting alcohol is converted to the aldehyde 65 by treatment with sulfur trioxide-pyridine complex and triethylamine in DMSO.
  • This aldehyde can be reacted with amine 19 and NaCNBH 3 in methanol to provide the desired compound 66.
  • Ar represents a carbocyclic or heterocyclic, substituted or unsubstituted aromatic ring
  • R a represents an unsubstituted or substituted aryl or an unsubstituted or substituted heteroaryl
  • R D represents an unsubstituted or substituted aralkyl or an unsubstituted or substituted heterocyclylalkyl.
  • the compounds of the invention are selective inhibitors of farnesyl-protein transferase.
  • a compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 177, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 178.
  • a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: a) an IC 50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC 50 for the inhibition of the famesylation of hDJ protein.
  • the selective inhibitor of farnesyl-protein transferase is further characterized by: b) an IC 50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-Ras dependent activation of MAP kinases in cells at least 100-fold greater than the EC 50 for inhibition of the famesylation of the protein hDJ in cells.
  • the selective inhibitor of famesyl-protein transferase is further characterized by: c) an IC 50 (a measurement of in vitro inhibitory activity) against
  • H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC 50 ) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
  • IC 50 inhibitory activity against H-ras-CVLL
  • the assays described in Example 181 may be utilized.
  • the compounds of the invention are dual inhibitors of famesyl-protein transferase and geranylgeranyl-protein transferase type I.
  • a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed.
  • the dual inhibitor compound has an in vitro inhibitory activity (IC 5 o) that is less than about 12 ⁇ M against K4B-Ras dependent activation of MAP kinases in cells.
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC 50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC 5 o for inhibiting the famesylation of the protein hDJ in cells; and b) an IC 50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC 50 ) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC 50 a measurement of in vitro inhibitory activity
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC 50 (a measurement of in vitro inhibitory activity) against
  • H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC 50 ) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC 5 o (a measurement of in vitro inhibitory activity) against IC 50 ) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC 5 o (a measurement of in vitro inhibitory activity) against
  • the Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC 50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC 50 ) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC 50 (a measurement of in vitro inhibitory activity) against H-r ⁇ s-CVLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC 5 o) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
  • IC 50 a measurement of in vitro inhibitory activity against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity
  • Example 181 A method for measuring the activity of the inhibitors of prenyl-protein transferase, as well as the instant combination compositions, utilized in the instant methods against Ras dependent activation of MAP kinases in cells is described in Example 181.
  • a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of famesyl-protein transferase.
  • the instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer.
  • Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes them- selves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1), neu, src, abl, lck, fyn) or by other mechanisms.
  • NF-1 neurofibromin
  • neu src
  • abl abl
  • lck lck
  • the compounds of the instant invention inhibit famesyl-protein transferase and the famesylation of the oncogene protein Ras.
  • the instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)).
  • Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
  • the compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment.
  • the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder.
  • the instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S.
  • the compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1 :541-545(1995).
  • the instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of
  • the instant compounds may also be useful for the treatment of fungal infections.
  • the instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies.
  • the compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
  • the prenyl-protein transferase inhibitors of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the prenyl-protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue.
  • drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
  • Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
  • the instant compounds may also be useful as inhibitors of comeal inflammation. These compounds may improve the treatment of comeal opacity which results from cauterization-induced comeal inflammation. The instant compounds may also be useful in reducing comeal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol Vis. Sci., 1998, vol. 39, p 2245-2251).
  • the compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice.
  • the compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.
  • the compounds of the instant invention may be administered to a mammal in need thereof using a gel extrusion mechanism (GEM) device, such as that described in USSN 60/144,643, filed on July 20, 1999, which is hereby incorporated by reference.
  • GEM gel extrusion mechanism
  • composition is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
  • compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
  • excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc.
  • the tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropyl- cellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed.
  • Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyl- eneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil.
  • Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene- oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate.
  • dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin
  • the aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame.
  • Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin.
  • the oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • the pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions.
  • the oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these.
  • Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
  • Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • sweetening agents for example glycerol, propylene glycol, sorbitol or sucrose.
  • Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
  • compositions may be in the form of a sterile injectable aqueous solutions.
  • acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • the sterile injectable preparation may also be a sterile injectable oil-in- water microemulsion where the active ingredient is dissolved in the oily phase.
  • the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
  • the injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection.
  • a continuous intravenous delivery device may be utilized.
  • An example of such a device is the Deltec CADD-PLUSTM model 5400 intravenous pump.
  • the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration.
  • This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above.
  • the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil may be employed including synthetic mono- or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • topical use creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed. (For purposes of this application, topical application shall include mouth washes and gargles.)
  • the compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
  • a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
  • the compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated.
  • the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant famesyl-protein transferase inhibitors and an antineo- plastic agent. It is also understood that such a combination of antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. It is further understood that any of the therapeutic agents described herein may also be used in combination with a compound of the instant invention and an antineoplastic agent.
  • antineoplastic agent examples include, in general, microtubule- stabilizing agents (such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, for example, nitrogen mustards, ethyleneimine compounds, alkyl sulfonates and other compounds with an alkylating action such as nitrosoureas, cisplatin, and dacarbazine; anti- metabolites, for example, folic acid, purine or pyrimidine antagonists; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; mitotic inhibitors, for example, vinca alkaloids and derivative
  • Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins.
  • Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunombicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
  • antineoplastic agents include estra- mustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, bleomycin, chlorambucil, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interle
  • antineoplastic, or chemotherapeutic, agents are described, for example, by D. J. Stewart in “Nausea and Vomiting: Recent Research and Clinical Advances", Eds. J. Kucharczyk, et al., CRC Press Inc., Boca Raton, Florida, USA (1991), pages 177-203, especially page 188. See also, R. J. Gralla, et al., Cancer Treatment Reports, 68(1), 163-172 (1984).
  • the preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel.
  • the compounds of the instant invention may also be co-administered with antisense oligonucleotides which are specifically hybridizable with RNA or DNA deriving from human ras gene. Such antisense oligonucleotides are described in U.S. Patent No. 5,576,208 and PCT Publication No. WO 99/22772.
  • the instant compounds are particularly useful when co-administered with the antisense oligo- nucleotide comprising the amino acid sequence of SEQ.ID.NO: 2 of U.S. Patent No. 5,576,208.
  • Certain compounds of the instant invention may exhibit very low plasma concentrations and significant inter-individual variation in the plasma levels of the compound. It is believed that very low plasma concentrations and high intersubject variability achieved following administration of certain prenyl-protein transferase inhibitors to mammals may be due to extensive metabolism by cytochrome P450 enzymes prior to entry of drug into the systemic circulation. Prenyl-protein transferase inhibitors may be metabolized by cytochrome P450 enzyme systems, such as CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other cytochrome P450 isoform.
  • a compound of the instant invention demonstrates an affinity for one or more of the cytochrome P450 enzyme systems
  • another compound with a higher affinity for the P450 enzyme(s) involved in metabolism should be administered concomitantly.
  • compounds that have a comparatively very high affinity for CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other P450 isoform include, but are not limited to, piperonyl butoxide, troleandomycin, erythromycin, proadifen, isoniazid, allylisopropylacetamide, ethinylestradiol, chloramphenicol, 2- ethynylnaphthalene and the like.
  • Such a high affinity compound when employed in combination with a compound of formula A, may reduce the inter-individual variation and increase the plasma concentration of a compound of formula A to a level having substantial therapeutic activity by inhibiting the metabolism of the compound of formula A. Additionally, inhibiting the metabolism of a compound of the instant invention prolongs the pharmacokinetic half-life, and thus the pharmacodynamic effect, of the compound.
  • a compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy.
  • a compound of the present invention may be used in conjunction with other anti-emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, or a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.SPatent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712.
  • conjunctive therapy with a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is preferred.
  • Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos.
  • a particularly preferred neurokinin- 1 receptor antagonist for use in conjunction with the compounds of the present invention is 2-(R)-(l-(R)-(3,5-bis (trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)mefhyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147.
  • a compound of the present invention and the other pharmacologically active agent(s) may be administered to a patient simultaneously, sequentially or in combination.
  • the present compound may employed directly in combin- ation with the other active agent(s), or it may be administered prior, concurrent or subsequent to the administration of the other active agent(s).
  • the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
  • a compound of the present invention may be presented together with another therapeutic agent in a combined preparation, such as with an antiemetic agent for simultaneous, separate, or sequential use in the relief of emesis associated with employing a compound of the present invention and radiation therapy.
  • a combined preparation may be, for example, in the form of a twin pack.
  • a preferred combination comprises a compound of the present invention with antiemetic agents, as described above.
  • Radiation therapy including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer.
  • compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein inco ⁇ orated by reference.
  • the instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation.
  • the instant compounds may be utilized in combination with famesyl pyrophosphate competitive inhibitors of the activity of famesyl-protein transferase or in combination with a compound which has Raf antagonist activity.
  • the instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase.
  • the compound of the instant invention is a selective inhibitor of famesyl-protein transferase
  • co-administration with a compound(s) that is a selective inhibitor of geranylgeranyl protein transferase may provide an improved therapeutic effect.
  • the compounds disclosed in the following patents and publications may be useful as famesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Serial Nos. 08/254,228 and 08/435,047. Those patents and publications are inco ⁇ orated herein by reference.
  • such administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously.
  • the protein substrate-competitive inhibitor and famesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
  • the instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Serial No. 09/055,487, filed April 6, 1998, and WO 98/44797, published on October 15, 1998, which are inco ⁇ orated herein by reference.
  • an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells.
  • the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the ⁇ v ⁇ 5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the ⁇ v ⁇ 3 integrin and the ⁇ v ⁇ 5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells.
  • the term also refers to antagonists of the ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the term also refers to antagonists of any combination of ⁇ v ⁇ 3 integrin, ⁇ v ⁇ 5 integrin, ⁇ l ⁇ l, ⁇ 2 ⁇ l, ⁇ 5 ⁇ l, ⁇ 6 ⁇ l and ⁇ 6 ⁇ 4 integrins.
  • the instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase
  • HMG-CoA reductase 3-hydroxy-3-methylglutaryl-CoA reductase
  • Compounds which have inhibitory activity for HMG-CoA reductase can be readily identified by using assays well-known in the art. For example, see the assays described or cited in U.S. Patent 4,231,938 at col. 6, and WO 84/02131 at pages 30-33.
  • the terms "HMG-CoA reductase inhibitor” and "inhibitor of HMG-CoA reductase” have the same meaning when used herein.
  • HMG-CoA reductase inhibitors examples include but are not limited to lovastatin (MEVACOR®; see US Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR®; see US Patent No. 4,444,784; 4,820,850; 4,916,239), pravastatin (PRAVACHOL®; see US Patent Nos. 4,346,227; 4,537,859; 4,410,629; 5,030,447 and 5,180,589), fluvastatin (LESCOL®; see US Patent Nos.
  • HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention.
  • An illustration of the lactone portion and its corresponding open-acid form is shown below as stmctures I and II.
  • HMG-CoA reductase inhibitor In HMG-CoA reductase inhibitor's where an open-acid form can exist, salt and ester forms may preferably be formed from the open-acid, and all such forms are included within the meaning of the term "HMG-CoA reductase inhibitor" as used herein.
  • the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, and most preferably simvastatin.
  • the term "pharmaceutically acceptable salts" with respect to the HMG-CoA reductase inhibitor shall mean non- toxic salts of the compounds employed in this invention which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, omithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanol- amine, procaine, N-benzylphenethylamine, l-p-chlorobenzyl-2-pyrrolidine-l '- yl-me hylbenzimidazole, diethylamine, piperazine, and tris(hydroxymethyl) aminomethane.
  • salt forms of HMG-CoA reductase inhibitors may include, but are not limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium edetate, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynapthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, oleate, oxalate, pamao
  • Ester derivatives of the described HMG-CoA reductase inhibitor compounds may act as prodrugs which, when absorbed into the bloodstream of a warm-blooded animal, may cleave in such a manner as to release the drug form and permit the drug to afford improved therapeutic efficacy.
  • the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related vimses and fungal infections.
  • combination products employ the combinations of this invention within the dosage range described above and the other pharmaceutically active agent(s) within its approved dosage range.
  • Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
  • the instant compounds may also be useful in combination with prodrugs of antineoplastic agents.
  • the instant compounds may be co-administered either concurrently or sequentially with a conjugate (termed a "PSA conjugate") which comprises an oligopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • a conjugate termed a "PSA conjugate”
  • PSA conjugate which comprises an oligopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent.
  • the compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl- protein transferase (FPTase) in a composition.
  • FPTase farnesyl- protein transferase
  • the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptie having a cysteine at the amine terminus) and famesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention.
  • the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
  • potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample.
  • a series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl- protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and famesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention.
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • concentration of a sufficiently potent inhibitor i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel
  • Step A 4-(Hydroxymethyl)- 1 -(triphenylmefhyl)imidazole
  • Step B 4-( Acetoxymethyl)- 1 -(triphenylmethyl)imidazole
  • Step C 5-(Acetoxymethyl)- 1 -(4-cyanobenzyl)imidazole hydrobromide

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention is directed to compounds which inhibit prenyl-protein transferase and the prenylation of the oncogene protein Ras. The invention is further directed to chemotherapeutic compositions containing the compounds of this invention and methods for inhibiting prenyl-protein transferase and the prenylation of the oncogene protein Ras.

Description

TITLE OF THE INVENTION
INHIBITORS OF PRENYL-PROTEIN TRANSFERASE
BACKGROUND OF THE INVENTION The Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-Ras) are part of a signalling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Biological and biochemical studies of Ras action indicate that Ras functions like a G-regulatory protein. In the inactive state, Ras is bound to GDP. Upon growth factor receptor activation Ras is induced to exchange GDP for GTP and undergoes a conformational change. The GTP -bound form of Ras propagates the growth stimulatory signal until the signal is terminated by the intrinsic GTPase activity of Ras, which returns the protein to its inactive GDP bound form (D.R. Lowy and D.M. Willumsen, Ann. Rev. Biochem. (52:851-891 (1993)). Mutated ras genes (Ha-ras, Ki4a-rαs , K\4b-ras and N-rαs) are found in many human cancers, including colorectal carcinoma, exocrine pancreatic carcinoma, and myeloid leukemias. The protein products of these genes are defective in their GTPase activity and constitutively transmit a growth stimulatory signal.
Ras must be localized to the plasma membrane for both normal and oncogenic functions. At least 3 post-translational modifications are involved with Ras membrane localization, and all 3 modifications occur at the C-terminus of Ras. The Ras C-terminus contains a sequence motif termed a "CAAX" or "Cys-Aaa - Aaa -Xaa" box (Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino acid) (Willumsen et al, Nature 310:583-586 (1984)). Depending on the specific sequence, this motif serves as a signal sequence for the enzymes farnesyl- protein transferase or geranylgeranyl -protein transferase, which catalyze the alkylation of the cysteine residue of the CAAX motif with a C15 or C20 isoprenoid, respectively. Such enzymes may be generally termed prenyl-protein transferases. (S. Clarke., Ann. Rev. Biochem. (57:355-386 (1992); W.R. Schafer and J. Rine, Ann. Rev. Genetics 30:209-231 (1992)). The Ras protein is one of several proteins that are known to undergo post-translational farnesylation. Other farnesylated proteins include the Ras-related GTP -binding proteins such as Rho, fungal mating factors, the nuclear lamins, and the gamma subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994) have identified a peroxisome associated protein Pxf which is also farnesylated. James, et al., have also suggested that there are farnesylated proteins of unknown structure and function in addition to those listed above. Inhibition of farnesyl-protein transferase has been shown to block the growth of Ras-transformed cells in soft agar and to modify other aspects of their transformed phenotype. It has also been demonstrated that certain inhibitors of farnesyl-protein transferase selectively block the processing of the Ras oncoprotein intracellularly (N.E. Kohl et al, Science, 260:1934-1931 (1993) and G.L. James et al, Science, 260:1931-1942 (1993). Recently, it has been shown that an inhibitor of farnesyl-protein transferase blocks the growth of rαs-dependent tumors in nude mice (N.E. Kohl et al, Proc. Natl Acad. Sci U.S.A., 97:9141-9145 (1994) and induces regression of mammary and salivary carcinomas in ras transgenic mice (N.E. Kohl et al, Nature Medicine, 1 :792-797 (1995).
Indirect inhibition of farnesyl-protein transferase in vivo has been demonstrated with lovastatin (Merck & Co., Rahway, NJ) and compactin (Hancock et al, ibid; Casey et al, ibid; Schafer et al, Science 245:319 (1989)). These drugs inhibit HMG-CoA reductase, the rate limiting enzyme for the production of poly- isoprenoids including famesyl pyrophosphate. Famesyl-protein transferase utilizes famesyl pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX box with a famesyl group (Reiss et al, Cell, 62:81-88 (1990); Schaber et al, J. Biol. Chem., 2(55:14701-14704 (1990); Schafer et al, Science, 249:1133-1139 (1990); Marine et al, Proc. Natl. Acad. Sci USA, 87:1541-1545 (1990)). Inhibition of famesyl pyrophosphate biosynthesis by inhibiting HMG-CoA reductase blocks
Ras membrane localization in cultured cells. However, direct inhibition of famesyl- protein transferase would be more specific and attended by fewer side effects than would occur with the required dose of a general inhibitor of isoprene biosynthesis.
Inhibitors of famesyl-protein transferase (FPTase) have been described in two general classes. The first are analogs of famesyl diphosphate (FPP), while the second class of inhibitors is related to the protein substrates (e.g., Ras) for the enzyme. The peptide derived inhibitors that have been described are generally cysteine containing molecules that are related to the CAAX motif that is the signal for protein prenylation. (Schaber et al, ibid; Reiss et. al, ibid; Reiss et al, PNAS, 88:132-136 (1991)). Such inhibitors may inhibit protein prenylation while serving as alternate substrates for the famesyl-protein transferase enzyme, or may be purely competitive inhibitors (U.S. Patent 5,141,851, University of Texas; N.E. Kohl et al, Science, 260:1934-1931 (1993); Graham, et al., J. Med. Chem., 37, 725 (1994)). In general, deletion of the thiol from a CAAX derivative has been shown to dramatically reduce the inhibitory potency of the compound. However, the thiol group potentially places limitations on the therapeutic application of FPTase inhibitors with respect to pharmacokinetics, pharmacodynamics and toxicity. Therefore, a functional replacement for the thiol is desirable. It has recently been reported that famesyl-protein transferase inhibitors are inhibitors of proliferation of vascular smooth muscle cells and are therefore useful in the prevention and therapy of arteriosclerosis and diabetic disturbance of blood vessels (JP H7- 112930).
It has recently been disclosed that certain tricyclic compounds which optionally incorporate a piperidine moiety are inhibitors of FPTase (WO 95/10514, WO 95/10515 and WO 95/10516). Imidazole-containing inhibitors of famesyl protein transferase have also been disclosed (WO 95/09001 and EP 0 675 112 Al). It has also been disclosed that certain compounds which incorporate a pyrrolidine moiety are inhibitors of FPTase (WO 97/37900, and U.S. Patent Nos. 5,627,202 and 5,661,161).
It is, therefore, an object of this invention to develop compounds that will inhibit prenyl-protein transferase and thus, the post-translational isoprenylation of proteins. It is a further object of this invention to develop chemotherapeutic compositions containing the compounds of this invention and methods for producing the compounds of this invention.
SUMMARY OF THE INVENTION
The present invention comprises non-prodrug compounds which inhibit prenyl-protein transferases. Further contained in this invention are chemotherapeutic compositions containing these prenyl-protein transferase inhibitors and methods for their production.
The compounds of this invention are illustrated by the formula A:
Figure imgf000004_0001
A DETAILED DESCRIPTION OF THE INVENTION
The compounds of this invention are useful in the inhibition of prenyl- protein transferase. In a first embodiment of this invention, the inhibitors of a prenyl- protein transferase are illustrated by the formula A:
Figure imgf000005_0001
A
wherein
X1 is (C(Rla)2)nA1(C(Rla)2)nA2;
X2 is (C(Rlb)2) A3(C(Rlb) '22)n;
lc. lc.
X is (C(R )2)qA (C(R )2), q'
R la , R lb and R lc are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R .1J0W,O-, R 6a S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R10C(O)-, -N(R10)2, R10OC(O)-, and
R10OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted Cj-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, -C(O)NR6R7, R C(O)NR -, (R10)2NC(O)NR10-, R C(O)-, R10OC(O)-, halo, -N(R10)2, and R10OC(O)NR10-;
A and A are independently selected from a) a bond, b) -C(=O)-, c) -HC=CH-, d) -C≡C-, e) O, f) NR10, g) NR10C(O), h) C(O)NR10, i) OC(O)NR10, j) NR10C(O)O, k) S(=0)m,
1) C(O)O, and m) OC(O);
2
. is selected from a) a bond, b) -C(=O)-, c) NR10C(O), d) S(=O)m, and e) OC(O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted,
0 heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR", i) N3, j) R as(0)m, k) C3-C] 0 cycloalkyl, unsubstituted or substituted.
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R,0)2NC(O)NR10-, o) R,0C(O)-,
P) R'°C(O)NR10-, q) R10OC(O)-, r) -N(R,0)2, s) R10OC(O)NR10-, and t) -(CrC6 alkyl)NR10C(O)R13 ;
R is independently selected from: H, CN, NO2, halo, unsubstituted or substituted Cj-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl5 CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, O R10, NPvV, OR&, -C(O)R10, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -OS(O)mR6a, -C(O)NRV, -NHC(O)R10, -(CrC6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5
R and R are independently selected from: H, OR10, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted
C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, γNR6R7 and γ°R6, o o wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2)nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR a, 2) C "33-C ^66 cycloalkyl,
3) OR6,
6a
4) S(O)mR ,
5) — NR6R7
Figure imgf000008_0001
-CX_,NR6R7
8) T O
9) -C ^OR6 T o
Figure imgf000008_0002
11 ) — S02-NR6R7
12) — f-S02-R6a
3) ^ ,R6
O 14) - -OR6
O 15) N3,
16) halo, and
17) perfluoro-C,.4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O) . -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
Figure imgf000009_0001
0
0 OR,°
9) -S(0)mR6a or h) N(R10)2; or
6 7
R and R may be joined in a ring;
7 7a R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) C1-4 alkoxy, 2) aryl or heterocycle,
3) halogen,
4) HO,
5)
0
6) SO2R6a,
7) N(R10)6; and b) C- ; alkyl, unsubstituted oi the following:
1) -C(R10)2C1 -4 alkoxy,
2) aryl or heterocycle,
3) -C(R )2halogen,
4) -C(R10)2OH,
Figure imgf000010_0001
R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted
C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl, unsubstituted or substituted C C4 perfluoroalkyl, F, CI, Br,
RI OO-, CN, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, NO2, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, R10OC(O)NR10-,
N3, or -N(R10)2, and c) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and R10OC(O)NR10-;
9
R is independently selected from 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2)nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C]-C4 alkyl, i) S(O)mR6a, j) N(R10)2, k) NR10C(O)R! I,
1) NR10C(O)R11N(R10)2, m) -R10(CH2)nRu,
2) C3-C6 cycloalkyl,
3) S(O)mR6a,
\ /NR6R7
4) O
5) — SO2-NR6R7 ,
Figure imgf000011_0001
8) -(C,-C6 alkyl)NR10C(O)R13 R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R 13 is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted,
J) CF3, k) CF3O-, 1) CF3CH2-, m) OR10, n) -C(O)R'°, o) -O(CrC6 alkyl)OR10,
Figure imgf000012_0001
q) -(C,-C6 alkyl)OR10, and r) -(C,-C6 alkyl)C(O)R10;
and G ,2 are independently selected from oxygen or H-
V is selected from a) hydrogen, b) heterocycle, c) aryl, d) C,-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if A is S(O) and q is 0;
W is a heterocycle;
Y is selected from a) H, b) C,-C8 alkyl, c) C2-C8 alkenyl, d) C2-C8 alkynyl, e) C3-C20 cycloalkyl, f) aryl, and g) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; q is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5, provided that r is 0 when V is hydrogen; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1, 2, 3 or 4; and W IS 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Another embodiment of the compounds of this invention is illustrated by formula A:
Figure imgf000014_0001
wherein
Figure imgf000014_0002
X2 is (C(Rlb)2)pA3(C(Rlb)2 2)'p'
X3 is (C(Rlc)2)qA4;
R a and R are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted ιo. heterocycle, unsubstituted or substituted C3-C,0 cycloalkyl, R "O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR,()-, R10C(O)-, -N(R10)2, R'°OC(O)-, and
R,0OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-, halo, -N(R10)2, and R10OC(O)NR10-;
R c is selected from a) hydrogen and b) unsubstituted or substituted C]-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R]°C(O)-,
R10OC(O)-, halo, -N(R10)2, and R10OC(O)NR10-
A 1 and A 3 are independently selected from a) a bond, b) -C(=O)-, c) O, d) NR'°, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NR10C(O)O, i) S(=0)m, j) OC(O), and k) C(O)O;
2
. is selected from a) a bond, b) -C(=O)-, c) NR10C(O), and d) S(=0)m; A is a bond;
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted, 1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R,0C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)RB ;
R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted Cj-C8 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NR6R7, OR6, -C(O)R10, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -OS(O)mR6a, -C(O)NR6R7, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(C.-C, alkyl)C(O)R10; R 4 and R 5 are independently selected from:
H, OR10, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle,
0 O wherein the substituted group is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nORC, c) (CH2) nNR6R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C1-C4 alkyl. h) S(O)mR6a,
2) C3-C6 cycloalkyl,
6
3) OR ,
4) S(O)mR6a,
5) — NR 6R7
Figure imgf000017_0001
Figure imgf000018_0001
9) — C ,OR6
T 0
10) \ Y ^NR6R7 o
11 ) — S02-NR6R7
12) — f-S02— R6a
Figure imgf000018_0002
15) N3,
16) halo, and
17) perfluoro-C,.4-alkyl; or
R and R are attached to the same C atom and are combined to form -(CH2)U- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, N 10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
R , R and R a are independently selected from: H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) Cj-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO, e)
0 f) γ o 0R,°
g) -S(0)mR6a or
10 h) N( )2; or
Figure imgf000019_0001
may be joined in a ring;
R 7 and R 7a may be joined in a πng;
R a is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C]-4 alkoxy,
2) aryl or heterocycle,
3) halogen, 4) HO,
5) o
6) SO2R6a,
7) N(R10)2; and b) CrCe j alkyl, unsubstituted or substituted with one or more of the following:
1) -C(R]0)2C1 -4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" ,
6) -C(R,0)2SO2R6a, and
Figure imgf000019_0002
R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted
C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl, unsubstituted or substituted C C4 perfluoroalkyl, F, CI, Br, R'°O-, CN, R6aS(O) -, -C(O)NR6R7, R'°C(O)NR10-, NO,
(R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-, R10OC(O)NR10-, N3, or -N(R )2, and c) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R'°O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, Rl°C(O)-, R10OC(O)-, N3, -N(R'°)2, and
10 10
R OC(O)NR -;
R is independently selected from
1) H, unsubstituted or substituted C[-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfiuoro-C,-C4 alkyl, i) S(O)mR6a, j) N(R'°)2, k) NR10C(O)Rπ,
1) NR10C(O)RπN(R, 0)2, m) -R, 0(CH2)nRπ, 2) C3-C6 cycloalkyl,
3) S(O) R6a,
Figure imgf000021_0001
5) — SO2 ~NR6R7
6) Rfc
O
Figure imgf000021_0002
8) -(CrC6 alkyl)NR10C(O)R13 ;
R , 10 i.s independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl; 13 • R is independently selected from a) H, b) unsubstituted or substituted 0,-C8 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C]0 cycloalkyl, unsubstituted or substituted,
J) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(CrC6 alkyl)OR10, p) -C(O)NR6R7, q) -(C,-C6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
1 2
G and G are independently selected from oxygen or H 2'
V is selected from a) heterocycle, b) aryl, and c) j-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and
W is a heterocycle;
Y is selected from a) H, b) C,-C8 alkyl, c) C3-C20 cycloalkyl, d) aryl, or e) heterocycle;
Figure imgf000023_0001
n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; tis 0, 1 , 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1, 2, 3 or 4; and w is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Another embodiment of the compounds of this invention is illustrated by the formula B:
Figure imgf000023_0002
B
wherein
Figure imgf000023_0003
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C]0 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC (O)NR10-, R'°C(O)-, -N(R'°)2, R'°OC(O)-, and R10OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R,0)2NC(O)NR10-, R10C(O)-, R10OC(O)-
, halo, -N(RI0)2, and R10OC(O)NR10-;
R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R'°O-, R6aS(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-
, halo, -N(R'°)2, and R,0OC(O)NR10-;
lected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NR10C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) N ,0C(O), and d) S(=0)m;
A is selected from a bond or C(=O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) j-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R63S(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)R13.
3
R is independently selected from: H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NRV, OR6, -C(O)R'°, -O(CrC6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R'°, -(C,-C6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5 R and R are independently selected from:
H, OR , unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of:
1 ) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) NR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C1-C4 alkyl, h) S(O)mR a,
2) C3-C6 cycloalkyl,
3) OR6, 4) S(O) R6a,
6D 7
5) — NR°R
Figure imgf000026_0001
— C ,NR6R7
8) T 0
9) — CX .OR6
T 0
10) \ ^NR6R7 O
11 ) — S02-NR6R7
12) — t-S02— R6a
Figure imgf000027_0001
15) N3,
16) halo, and
17) perfluoro-C,_4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR'°)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from: H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C^Cg alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
R 11 e) Y o
0 Y 0 0R" g) -S(0)mR6a or h) N(R'°)2; or
6 7
R and R may be joined in a ring;
7 7a
R and R may be joined in a πng;
6a R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Cι-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
R11
5) Y o
6) SO2R6a,
7) N(R10)2; and b) C,-C( ( alkyl, unsubstituted oi following:
1) -C(R10)2C1-4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y 0 R" .
6) -C(R10)2SO2R6a, and
Figure imgf000028_0001
R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl,
10 unsubstituted or substituted C C4 perfluoroalkyl, F, CI, Br, R O-, 2NC(O)NR' 10 -"VII ■■
Figure imgf000029_0001
and c) j-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, F, CI, Br, R'°O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R'°C(O)-, R, 0OC(O)-, N3, -N(R'°)2, and
10 10
R OC(O)NR -;
9
R is independently selected from 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2)nNR6R , d) halogen, e) CN, > aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted. h) perfluoro-C]-C4 alkyl, i) S(0)mR a, j) N(R10)2, k) NR10C(O)R",
1) NR10C(O)RπN(R1())2, m) -R10(CH2)nRπ, 2) C3-C6 cycloalkyl, 6a
3) S(O) R
Figure imgf000030_0001
5) — SO2-NR6R7
6) Rfc
O
OR
7)
O and
8) -(CrC6 alkyl)NR10C(O)R13
10
R is independently selected from a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1
R is independently selected from a) unsubstituted or substituted C,-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted C]-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(CrC6 alkyl)OR10,
Figure imgf000031_0001
q) -(C,-C6 alkyl)OR10, and r) -(C.-C8 alkyfjC^R10;
G is selected from oxygen or H2;
V is aryl or heteroaryl;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
Y is selected from a) H, b) CrCg alkyl, c) C3-C20 cycloalkyl, d) aryl or e) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1 , 2, 3 or 4; and w is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Another embodiment of the compounds of this invention is illustrated by the formula C:
Figure imgf000032_0001
wherein
XI is (C(R, a)2) Al(C(Rla)2)nA2;
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NH10-, R10C(O)-, -N(R10)2, R'°OC(O)-, and
RI0OC(O)NR10-, and c) unsubstituted or substituted 0,-C8 alkyl, wherein the substituent on the substituted C^Cg alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-,
R10OC(O)-, halo, -N(R'°)2, and R'°OC(O)NR10-;
R and R are independently selected from a) hydrogen and b) unsubstituted or substituted Cj-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C]0cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R10C(O)-,
R10OC(O)-, halo, -N(R10),, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NR10C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) NR10C(O), and d) S(=0)m;
3
A is selected from a) a bond, or b) C(=O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted, 1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R'°C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)R13 ;
3 R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl CF3O-, CF3CH2-, unsubstituted or substituted C3-C]0 cycloalkyl, OR10, NR R , OR , -C(O)R10, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(CrC6 alkyl)C(O)R10;
5
R and R are independently selected from:
H, OR , unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C]-C4 alkyl, h) S(O)mR6a, 2) C3-C6 cycloalkyl, 3) OR6,
4) — N R6R7
Figure imgf000035_0001
7> ^ ^R6
O
8) halo, and
9) perfluoro-Cl-4-alkyl; or 4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR'°)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) j-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO, pi 1
*> o
OR 10
«» Y o g) -S(0)mR6a , or h) N(RI0)2; or
6 7 R and R may be joined in a nng;
7 7a
R and R may be joined in a ring;
6a
R is selected from a) C3_6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C\. alkoxy,
2) aryl or heterocycle,
3) halogen, 4) HO, 5) Y o R" .
6) SO2R6a,
7) N(R10)2; and b) c,-c, ; alkyl, unsubstituted or substituted with one or more of
5 the following:
1) -C(R10)2C1-4 alkoxy,
2) aryl or heterocycle,
3) -C(R'°)2halogen,
4) -C(R10)2OH,
5)
A u Y o R" ,
6) -C(R10)2SO2R6a, and
7) -C(R'0)2N(Rio)2;
R is independently selected from 5 a) hydrogen, b) F, CI, Br, R'°O-, CN, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR'0-, NO2, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-, R10OC(O)NR10-, N3, or
-N(R'°)2, and c) j-C8 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, 0 F, CI, Br, R °O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
10 10
R OC(O)NR -;
9
R is independently selected from 5 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: 0 a) C]-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2)nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C]-C4 alkyl, i) S(0)mR a, j) N(R,0)2, k) NR10C(O)Rπ,
1) NR10C(O)R, 1N(R10)2, m) -R,0(CH2)nRπ,
2) C3-C6 cycloalkyl,
3) S(0)mR a,
\ .NR6R7
4) O
Figure imgf000038_0001
6) -Rfc
O
ORfc
7)
O and
8) -(CrC6 alkyl)NR10C(O)R13 ;
10
R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1 R is independently selected from a) unsubstituted or substituted C,-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(C,-C6 alkyl)OR10, p) -C(O)NR6R7, q) -(C,-C6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R,0 ;
G is selected from oxygen or H,;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl; Yis selected from a) H, b) C,-C8 alkyl, c) C3-C20 cycloalkyl, d) aryl, or e) heterocycle;
m is 0, 1 or 2; n is 0, 1,2, 3, 4, 5 or 6; p is 0, 1,2, 3, or 4; q is 0, 1, 2, or 3; r is 0to5; s is 0, 1,2, 3 or 4; tis 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1, 2, 3 or 4; and w is 0, 1,2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Another embodiment of the compounds of this invention is illustrated by formula D:
Figure imgf000040_0001
wherein
x'is^R'^A'^R'^A2; l a .
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C,0 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10C(O)NR10-, -C(O)NR6R7,
(R10)2NC(O)(NR10)-, R10C(O)-, -N(R10)2, R,0OC(O)-, and
R10OC(O)NR10-; and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted Cj-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-,
R'°OC(O)-, halo, -N(R10)2, and R10OC(O)NR10-;
R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted Cj-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C5 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)(NR10)-, R'°C(O)-,
R,0OC(O)-, halo, -N(R10),, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NRl0C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
A is selected from a) a bond, b) -C(=O)-, cc)) NNRR1 1'00C, ((CO), and d) S(=O)m;
A is selected from a) a bond or b) C(=O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R,0)2NC(O)NR10-, o) RI0C(O)-, p) R10C(O)NR10-, q) R,0OC(O)-, r) -N(R'°)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)R13 ;
3 R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, Cj-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C]0 cycloalkyl, OR10, NRV, OR6, -C(O)R10, -O(CrC6 alkyl)
OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(CrC6 alkyl)C(O)R10;
4 5 R and R are independently selected from:
H, OR10, unsubstituted or substituted C,-C5 alkyl, wherein the substituted group is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR6R , d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR a,
2) C3-C6 cycloalkyl,
3) OR6,
Figure imgf000044_0001
8) halo, and
9) perfluoro-C,_4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, N 10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, Cj-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) Cj-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO, R11 e) Y 0 f) γ 0 0R,°
g) -S(0)mR6a or
10 h) N(R )2; or
6 7
R and R may be joined in a ring;
7 7a
R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) Cι- alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5) Y 0 R" .
6) SO2R6a,
7) N(R10)2; and b) CrC6 alkyl, unsubstituted or substituted with one or more of the following:
1) -C(R10)2C1-4 alkoxy,
2) ' aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" .
6) -C(R10)2SO2R6a, and
7) -C(R'0)2N(Ri°)2;
R is independently selected from a) hydrogen, and b) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R10O-, R6aS(O)m-,-C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R'°C(O)-, R'°OC(O)-, N3, -N(R'°)2, and
10 10 R OC(O)NR -;
9
R is independently selected from
1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C,-C4 alkyl,
Figure imgf000046_0001
j) N(R10)2, k) NR10C(O)Rπ,
1) NR10C(O)RπN(R10)2, m) -R10(CH2)nRπ,
2) C3-C !6 cycloalkyl,
6a
3) S(O) R ,
Figure imgf000047_0001
5) -SO2— N R6R7
6) -R<
O
ORe
7)
O and
8) -(C,-C6 alkyl)NR10C(O)R13 ;
10 R is independently selected from a) hydrogen, b) unsubstituted or substituted C^Cg alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1 R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
13
R is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted,
J) CF3, k) CF3O-, 1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(C,-C6 alkyl)OR10,
Figure imgf000048_0001
q) -(CrC6 alkyl)OR10, and r) -(C1-C6 alkyl)C(O)R,°;
G is selected from oxygen or H 2'
Y is selected from a) CrCg alkyl, b) C3-C20 cycloalkyl, c) aryl, or d) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; u is 4 or 5; v is 0, 1 , 2, 3 or 4; and W IS 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Another embodiment of the compounds of this invention is illustrated by formula E:
Figure imgf000049_0001
wherein
X' IS ^^ A'^R'^A2;
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted
10 , heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10C(O)NR!°-, -C(O)NR6R7, (R10)2NC (O)(NR10)-, R10C(O)-, -N(R10)2, R'°OC(O)-, and R,0OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C,-Cfi alkynyl, R O-, R S(O) , ιo. 10 10.
R C(O)NR -, -C(O)NR6R7, (R,0)2NC(O)NR10-, R C(O)-, R OC(O)- halo, -N(R10),, and R10OC(O)NR10-; R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
RIOC(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-, R'°OC(O)-
, halo, -N(R10)2, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(0)NR'°, g) OC(O)NR10, h) NR10C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) NR10C(O), and d) S(=0)m;
A is selected from a) a bond, or b) C(=O);
2
R is independently selected from a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C3-C]0 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R'°OC(O)-, r) -N(R,0)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)Rl 3 ;
3
R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NR R , OR6, -C(O)R10, -O(CrC6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R'°, -(C,-C6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5
R and R are independently selected from:
H, OR , unsubstituted or substituted C,-C6 alkyl, wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR6a,
2) C3-C6 cycloalkyl,
6
3) OR ,
4) — NR6R7
Figure imgf000052_0001
8) halo, and
9) perfluoro-C,.4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom; 6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C]-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
R1 1 e)
O
Figure imgf000053_0001
g) -S(O)mR6a or
10 h) N(R )2; or
6 7
R and R may be joined in a ring;
7 7a
R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C1-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5) Y o R" .
6) SO2R6a,
7) N(R!0)2; and b) C,-( Zβ alkyl, unsubstituted o: the following:
1) -C(R10)2C1 -4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" ,
6) -C(R10)2SO2R6a, and
Figure imgf000054_0001
8
R is independently selected from a) hydrogen, and b) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R10O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R °C(O)-, R10OC(O)-, N3, -N(R'°)2, and
10 10
R OC(O)NR -;
9
R is independently selected from
1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR6R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C,-^ alkyl, i) S(O)mR6a, j) N(R10)2, k) NR10C(O)Rπ,
1) NR10C(O)R"N(R10)2: m) -R10(CH2)nR",
2) C3-C6 cycloalkyl,
3) S(0)mR a,
\ ^NR6R7
4)
O
5) — SO2-NR6R7
6) Rc
O
ORc
7)
O and
8) -(Cι-C6 alkyl)NR10C(O)R13
10 R is independently selected from a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1 R is independently selected from a) unsubstituted or substituted C,-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C]0 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10,
10 o) -O(C,-C "6, alkyl)OR p) -C(O)NR6R7, q) -(C,-C6 alkyl)OR10, and r) -(C,-C6 alkyl)C(O)R10;
.1
G is selected from oxygen or H2;
Y is selected from a) CrCg alkyl, b) C3-C20 cycloalkyl, c) aryl, or d) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; u is 4 or 5; v is 0, 1, 2, 3 or 4; and w is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Specific examples of the compounds of the invention are: (R)-4-{5-[(2-Oxo-l-phenylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(5)-4-{5-[(2-Oxo-l-phenylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(R)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(<S)-4-{5-[(l-Benzyl-2-oxopyrrolidin -3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(R)-4-(5- {[ 1 -(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 - ylmethyl) benzonitrile,
(S)-4-(5- { [ 1 -(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5-{[l-(3-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5 - { [ 1 -(3 -Chlorophenyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)benzonitrile, (R)-4-(5-{[l-(4-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(S)-4-(5- {[ 1 -(4-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5- { [ 1 -(2-Chlorobenzyl)-2-oxopyrrolidin-3 -ylamino Jmefhyl } imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[l-(2-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(4-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(4-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitri le,
(R)-4-{5-[(2-Oxo-l-phenethylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(S)-4- {5-[(2-Oxo- 1 -phenethylpyrrolidin-3-ylamino)methyl]imidazol- 1 -ylmethyl} benzonitrile,
(R)-2-[l-(4-Cyanobenzyl)-lH-imidazol-5-yl]-N-(2-oxo-l-phenylpyrrolidin-3-yl) acetamide,
(5)-2-[l-(4-Cyanobenzyl)-lH-imidazol-5-yl]-N-(2-oxo-l-phenylpyrrolidin-3-yl) acetamide, (R)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl] acetamide,
(5)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl] acetamide,
(R)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]-N- methylacetamide,
(/S)-/ -(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]-N- methylacetamide,
(R)-4- {5-[(l -Benzylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile,
(5)-4-{5-[(l-Benzylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(R)-4-(5-{[Benzyl(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl}imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5-{[Benzyl(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl}imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)phenethylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)phenethylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(3-phenylpropyl)amino]methyl}imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(3-phenylpropyl)amino]methyl}imidazol- 1 -ylmethyl)benzonitrile, (R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(4-phenylbutyl)amino]methyl}imidazol- 1 -ylmefhyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(4-phenylbutyl)amino]methyl}imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)propylamino]methyl}imidazol-l- ylmethyl) benzonitrile,
(S)-4-(5-{[(\ -Benzyl-2-oxopyrrolidin-3 -yl)propylamino]methy 1 } imidazol- 1 -ylmethyl) benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl}imidazol-l-ylmethyl) benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl}imidazol-l -ylmethyl) benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-2-ylmethylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-2-ylmethylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(Λ)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-3-ylmethylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(JS)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-3-ylmethylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-4-ylmethylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-4-ylmethylamino]methyl} imidazol- 1 -ylmethyι)benzonitrile, (R)-4-(5-{[(3-Aminopropyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl} imidazol- 1 -ylmethy l)benzonitri le,
(iS)-4-(5 - { [(3 - Aminopropyl)( 1 -benzyl-2-oxopyrrolidin-3 -yl)amino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(R)-4-(5- { [(2-Aminoethyl)( 1 -benzyl-2-oxopyrrolidin-3 -yl)amino]methyl} imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[(2-Aminoethyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl} imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5 - { [(4- Aminobutyl)( 1 -benzyl-2-oxopyrrolidin-3 -yl)amino]methyl } imidazol- 1 - ylmethyi)benzonitrile,
(5)-4-(5-{[(4-Aminobutyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl} imidazol-1- ylmethyl)benzonitri le,
(R)-4-{5-[2-(l-Benzyl-2-oxopyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl} benzonitrile,
(5)-4-{5-[2-(l-Benzyl-2-oxopyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl} benzonitrile,
(R)-4-{5-[2-(2-Oxo-l-phenylpyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl} benzonitrile,
(S)-4- {5-[2-(2-Oxo- 1 -phenylpyrrolidin-3-ylamino)ethyl]imidazol- 1 -ylmethyl } benzonitrile,
(R)-4-{5-[2-(2-Oxo-l-phenethylpyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl} benzonitrile, (5)-4-{5-[2-(2-Oxo-l-phenethylpyrrolidin-3-ylamino)ethyl]imidazol-l-ylmethyl} benzonitrile,
(R)-4-(5 - { [ 1 -(Naphthalene- 1 -carbony l)pyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[l-(Naphthalene-l-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Naphthalene-2-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(S)-4-(5-{[l-(Naphthalene-2-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(R)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl}benzonitrile,
(5)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl}benzonitrile,
(R)-Λ^-(l-Benzoylpyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetamide,
(5)-N-(l-Benzoylpyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetamide,
(R)-2-[ 1 -(4-Cyanobenzyl)- lH-imidazol-5-yl]-N-[ 1 -(naphthalene- 1 -carbony 1) pyrrolidin-3-yl] acetamide,
(S)-2-[\ -(4-Cyanobenzyl)- lH-imidazol-5-yl]-N-[l -(naphthalene- 1 -carbonyl) pyrrolidin-3 -yl] acetamide,
(R)-4-(5-{[l-(3-Chlorobenzoyl)pyrrolidin-3-ylamino]methyl}imidazol-l-ylmethyl) benzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzoyl)pyrrolidin-3-ylamino]methyl}imidazol-l -ylmethyl) benzonitrile, (R)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl}benzonitrile,
(5)-4-(5- {[ 1 -(2-Chlorobenzoyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl) benzonitrile,
(R)-4-(5-{[l-(2-Methylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
( )-4-(5-{[l-(2-Methylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Isoquinoline-4-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(S)-4-(5- {[ 1 -(Isoquinoline-4-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5 - { [ 1 -(5 -Bromopyridine-3-carbonyl)pyrrolidin-3 -ylaminojmethyl } imidazol- 1 - y lmethyl)benzonitri le,
(5)-4-(5-{[l-(5-Bromopyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(2-Methylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- l-ylmethyl)benzonitrile,
(iS)-4-(5-{[l-(2-Methylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- l-ylmethyl)benzonitrile,
(R)-4-(5-{[l-(2-Ethylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[l-(2-Ethylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile, 4-(5 - { [(3R)- 1 -(trα«s-Cotinine-4-carbonyl)pyιτolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)benzonitrile,
4-(5-{[(3iS)-l-(trfln5-Cotinine-4-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Biphenyl-2-carbonyl)pyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(Biphenyl-2-carbonyl)pyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Adamantan-l-ylacetyl)pyrrolidin-3-ylamino]methyl} imidazol-1- ylmethyl)benzonitrile,
(S)-4-(5- { [ 1 -(Adamantan- 1 -ylacetyl)pyrrolidin-3-ylamino]methyl } imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5 - { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-phenoxybenzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-phenoxybenzonitri le,
(R)-4-(5 - { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-phenethyloxybenzonitrile,
(5)-4-(5- { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-phenethyloxybenzonitrile,
(R)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
(5)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile, (R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylaminojmethyl}imidazol-l- ylmethyl)-2-(3-phenylpropoxy)benzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-(3-phenylpropoxy)benzonitrile,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-methoxybenzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-methoxybenzonitrile,
(R)-4-{5-[(2-oxo-l-pyridin-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile,
(5)-4-{5-[(2-oxo-l-pyridin-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile,
(#)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](3-phenyrpropyl) amino } methyl) imidazol- 1 -ylmethyljbenzonitrile,
(S)-4- [5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3-yl] (3-phenylpropyl) amino } methyl) imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({(3-Aminopropyl)[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl]amino}methyl) imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-[5-({(3-Aminopropyl)[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl]amino}methyl) imidazol- 1 -ylmethyljbenzonitrile,
(R)-N-(3-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl][l-(4-cyanobenzyl)-lH- imidazol-5 -ylmethyl] amino } propyι)nicotinamide, (S)-N-(3 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -yl] [ 1 -(4-cyanobenzyl)- 1 H-imidazol- 5 -ylmethyl] amino } propyl)nicotinamide,
(R)-4- [5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -yl] (2-morpholin-4-ylethyl)amino } methyl)imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](2-mo holin-4-ylethyl)amino} methyl)imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](2-piperazin-l-ylethyl)amino} methyl)imidazol- 1 -ylmethyljbenzonitrile,
(iS)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](2-piperazin-l-ylethyl)amino} methyl)imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl][2-(pyridin-2-ylamino) ethyl] amino }methyl)imidazol-l -ylmethyljbenzonitrile,
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl][2-(pyridin-2-ylamino) ethyl] amino} methyl)imidazol-l -ylmethyljbenzonitrile,
(R)-6- Amino-N-(3- { [ 1 -(3-chlorobenzyl)-2-oxopyrrolidin-3-ylJ [ 1 -(4-cyanobenzyl)- 1H- imidazol-5-ylmethyl]amino}propyl)nicotinamide,
(5)-6-Amino-N-(3-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl][l-(4-cyanobenzyl)-lH- imidazol-5-ylmethyl]amino}propyl)nicotinamide,
(35)-4-[5-({l-[(5)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3- ylamino } methyl)imidazol- 1 -ylmethyl] -2-fluorobenzonitrile,
(35)-4-[5-( { 1 -[(R)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile,
(3R)-4-[5-({l-[(R)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile, (3R)-4-[5-({l-[(5)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile,
(35)-2-Fluoro-4-[5-( { 1 -[(5)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l -ylmethyljbenzonitrile,
(35)-2-Fluoro-4-[5-({l-[(R)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol- 1 -ylmethyljbenzonitrile,
(3R)-2-Fluoro-4-[5-({l-[(R)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l -ylmethyljbenzonitrile,
(3R)-2-Fluoro-4-[5-( { 1 -[(5)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]benzonitrile,
(R)-2-Fluoro-4-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyrrolidin-3-ylamino] methyl} imidazol- 1 -ylmethyl)benzonitrile,
(5)-2-Fluoro-4-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyrrolidin-3-ylaminoJ methyl } imidazol- 1 -ylmethyl)benzoni trile,
(R)-2-Fluoro-4-[l-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyrrolidin-3-ylamino] methyl} imidazol- 1 -yl)eth- 1 -yl]benzonitrile,
(5)-2-Fluoro-4-[l-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyrrolidin-3-ylamino] methyl}imidazol-l-yl)eth-l-yl]benzonitrile,
(R)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethylJamino}pyrrolidine-l -carboxylic acid (adamantan-l-yl)amide,
(5)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]amino}pyrrolidine-l -carboxylic acid (adamantan-l-yl)amide, (R)-3 - { [ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5 -ylmethyl] amino } pyrrolidine- 1 -carboxylic acid (2,6-difluorophenyl)amide,
(S)-3 - { [ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5-ylmethyl] amino } pyrrolidine- 1 -carboxylic acid (2,6-difluorophenyl)amide,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}pyridin-3- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}pyridin-3- ylmethyl)benzonitrile,
(R)-4-{5-[(2-Oxo-l-pyridin-4-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(5)-4-{5-[(2-Oxo-l-pyridin-4-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(R)-4-{5-[(2-Oxo-l-pyridin-3-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(5)-4-{5-[(2-Oxo-l-pyridin-3-ylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile;
(R)-4-{5-[(2-Oxo-l-pyrazin-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(S)-4- { 5- [(2-Oxo- 1 -pyrazin-2-ylpyrrolidin-3-ylamino)methyl] imidazol- 1 -ylmethyl } benzonitrile;
(R)-4-{5-[(2-Oxo-l-tetrahydrofuran-3-ylpyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyl} benzonitrile;
(iS)-4-{5-[(2-Oxo-l-tetrahydrofuran-3-ylpyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyljbenzonitrile; (R)-4-{5-[(2-Oxo-l-thiazol-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile;
(5)-4-{5-[(2-Oxo-l-thiazol-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(R)-4-{5-[(l-(4-Mθφholinophenyl)-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyl}benzonitrile;
(5)-4-{5-[(l-(4-Mθφholinophenyl)-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyl } benzonitrile;
(R)-4-{5-[(l-(l-Benzylpyrrolidin-3-yl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l- ylmefhyl}benzonitrile;
(iS)-4-{5-[(l-(l-Benzylpyrrolidin-3-yl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyl } benzonitrile;
(R)-4-{5-[(2-Oxo-l-quinolin-5-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile;
(5)-4-{5-[(2-Oxo-l-quinolin-5-ylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile;
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methanoyl}imidazol- 1 -ylmethyl)benzonitrile;
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methanoyl}imidazol- l-ylmethyl)benzonitrile;
(S)-4- { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylamino]methanoyl } -3 - (4-cyanophenyl)-2,3-dihydroimidazo[2,l-b]thiazole;
(/?)-4-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methanoyl}-3- (4-cyanophenyl)-2,3-dihydroimidazo[2,l-b]thiazole,;
(R)-2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyrrolidin-3-ylamino)ethyl]imidazol-l- ylmethyl} benzonitrile;
(S)-2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyrrolidin-3-ylamino)ethyl]imidazol-l- ylmethyl} benzonitrile;
(R)-4-(5-{[l-(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyrrolidin-3-ylamino] ethyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile;
(5)-4-(5-{[l-(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyrrolidin-3-ylamino] ethyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile;
(R)-3-{[l-(4-Cyanobenzyl)imidazol-5-yl]methylamino}-l-[(2-ethoxybenzyl) oxycarbonyl]pyrrolidine;
(5)-3-{[l-(4-Cyanobenzyl)imidazol-5-yl]methylamino}-l-[(2-ethoxybenzyl) oxycarbonyl]pyrrolidine;
(R)-3 - { [ 1 -(4-Cyanobenzyl)-2-methylimidazol-5-yl]methylamino } - 1 - [(2- trifluoromethoxybenzyl)oxycarbonyl]pyrrolidine;
(5)-3-{[l-(4-Cyanobenzyl)-2-methylimidazol-5-yl]methylamino}-l-[(2- trifluoromethoxybenzyl)oxycarbonyl]pyrrolidine;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
Specific examples of compounds of the instant invention are
Figure imgf000070_0001
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1- ylmethyl)benzonitrile,
Figure imgf000071_0001
(5)-4-(5-{[l-(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile,
Figure imgf000071_0002
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-phenoxybenzonitrile,
Figure imgf000071_0003
(5 -4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-methoxybenzonitrile,
Figure imgf000072_0001
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](2-moφholin-4-ylethyl)amino} methyl)imidazol- 1 -ylmethyl]benzonitrile,
Figure imgf000072_0002
(3/S)-4-[5-({l-[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile,
Figure imgf000072_0003
4-(5-{[(35)-l-(2-Ethylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)benzonitrile,
Figure imgf000073_0001
(S)-4-(5- {[ 1 -(Adamantan-1 -ylacetyl)pyrrolidin-3-ylamino]methyl} imidazol- 1 - ylmethyl)benzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
The compounds of the present invention may have asymmetric centers and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers, including optical isomers, being included in the present invention. When any variable, term or substituent (e.g. aryl, heterocycle, n, Rla, etc.) occurs more than one time in any formula or generic structure, its definition on each occurrence is independent from the definition at every other occurrence. Also, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. As used herein, "alkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having 1 to 6 carbon atoms, unless otherwise specified; "alkoxy" represents an alkyl group having 1 to 6 carbon atoms, unless otherwise indicated, attached through an oxygen bridge. "Halogen" or "halo" as used herein means fluoro, chloro, bromo and iodo. "Cycloalkyl" as used herein is intended to include non-aromatic cyclic hydrocarbon groups, having the specified number of carbon atoms, which may or may not be bridged or structurally constrained. Examples of such cycloalkyls include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, adamantyl, cyclooctyl, cycloheptyl, and the like. If no number of carbon atoms is specified, the term "alkenyl" refers to a non-aromatic hydrocarbon, straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon double bond. Preferably one carbon to carbon double bond is present, and up to four non-aromatic carbon-carbon double bonds may be present. Thus, "C2-C6 alkenyl" means an alkenyl radical having from 2 to 6 carbon atoms. Examples of such alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl and cyclohexenyl. As described above with respect to alkyl, the straight, branched or cyclic portion of the alkenyl group may contain double bonds and may be substituted if a substituted alkenyl group is indicated. The term "alkynyl" refrs to a hydrocarbon radical straight, branched or cyclic, containing from 2 to 10 carbon atoms and at least one carbon to carbon triple bond. Up to three carbon-carbon triple bonds may be present. Thus, "C2-C6 alkynyl" means an alkynyl radical having from 2 to 6 carbon atoms. Examples of such alkynyl groups include, but are not limited to, ethynyl, propynyl and butynyl. As described above with respect to alkyl, the straight, branched or cyclic portion of the alkynyl group may contain triple bonds and may be substituted if a substituted alkynyl group is indicated.
As used herein, "aryl" is intended to mean any stable monocyclic, bicyclic or tricyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic. Examples of such aryl elements include phenyl, naphthyl, tetrahydronaphthyl, indanyl, indanonyl, biphenyl, tetralinyl, tetralonyl, fluorenonyl, phenanthryl, anthryl or acenaphthyl.
As used herein, "aralkyl" is intended to mean an aryl moiety, as defined above, attached through a C^-Cg alkyl linker, where alkyl is defined above. Examples of aralkyls include, but are not limited to, benzyl, naphthylmethyl and phenylbutyl.
The term heterocycle or heterocyclic, as used herein, represents a stable 5- to 7-membered monocyclic or stable 8- to 11-membered bicyclic heterocyclic ring which is either saturated or unsaturated, and which consists of carbon atoms and from one to four heteroatoms selected from the group consisting of N, O, and S, and including any bicyclic group in which any of the above-defined heterocyclic rings is fused to a benzene ring. The heterocyclic ring may be attached at any heteroatom or carbon atom which results in the creation of a stable structure. Examples of such heterocyclic elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl, benzo- pyrazolyl, benzotriazolyl, chromanyl, cinnolinyl, dibenzofuranyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, dihydroimidazothiazolyl, furyl, furanyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl, moφholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl, 4- oxonaphthyridinyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, 2- oxopyridyl, 2-oxoquinolinyl, piperidyl, piperazinyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrimidyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydrofuranyl, tetrahydrofuryl, tetrahydroimidazopyridinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiamoφholinyl, thiamoφholinyl sulfoxide, thiazolyl, thiazolinyl, thienofuryl, thienothienyl, thienyl and triazolyl.
As used herein, "heteroaryl" is intended to mean any stable monocyclic or bicyclic carbon ring of up to 7 members in each ring, wherein at least one ring is aromatic and wherein from one to four carbon atoms are replaced by heteroatoms selected from the group consisting of N, O, and S. Examples of such heteroaryl elements include, but are not limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofuranyl, benzofurazanyl, benzopyranyl, benzopyrazolyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzotriazolyl, benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furanyl, furyl, imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl, isothiazolyl, naphthyridinyl, oxadiazolyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridinyl, pyridyl, pyrimidinyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl, tetrahydroimidazopyridinyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl, thienothienyl, thienyl and triazolyl.
As used herein, "heterocycylalkyl" is intended to mean a heterocyclic moiety, as defined above, attached through a Cj-Cg alkyl linker, where alkyl is defined above. Examples of heterocyclylalkyls include, but are not limited to,
2-pyridylmethyl, 2-moφholinylethyl, 2-imidazolylethyl, 2-quinolinylmethyl,
2-imidazolylmethyl, 1-piperazineethyl, and the like.
As used herein, the terms "substituted alkyl", "substituted alkenyl",
"substituted alkynyl" and "substituted alkoxy" are intended to include the branch or straight-chain alkyl group of the specified number of carbon atoms, wherein the carbon atoms may be substituted with F, CI, Br, I, CF3, N3, NO2, NH2 oxo, OH,
-O(C,-C6 alkyl), S(O)0_2, (C,-C6 alkyl)S(O)0.2-, C2-C6 alkenyl, C2-C6 alkynyl, -(C,-C6 alkyl)S(O)02(C,-C6 alkyl), C3-C20 cycloalkyl, C2-C5 alkenyl, C2-C6 alkynyl, -C(O)NH,
(C,-C6 alkyl)C(O)NH-, H2N-CH(NH)-, (C,-C6 alkyl)C(O)-, -O(C,-C6 alkyl)CF3, (C,-C6 alkyl)OC(O)-, (C,-C6 alkyl)O(C1-C6 alkyl)-, (C,-C6 alkyl)C(O)2(C,-C6 alkyl)-, (C,-C6 alkyl)OC(O)NH-, aryl, benzyl, heterocycle, aralkyl, heterocyclylalkyl, halo- aryl, halo-benzyl, halo-heterocycle, cyano-aryl, cyano-benzyl and cyano-heterocycle.
As used herein, the terms "substituted aryl", "substituted heterocycle", "substituted heteroaryl", "substituted cycloalkyl", "substituted benzyl", "substituted aralkyl" and "substituted heterocyclylalkyl" are intended to include the cyclic group containing from 1 to 3 substitutents in addition to the point of attachment to the rest of the compound. Such substitutents are preferably selected from the group which includes but is not limited to F, CI, Br, I, CF3, NH2, N(C,-C6 alkyl)2, NO2, CN, N3, C,-C20 alkyl, C,-C6 alkoxy, C3-C20 cycloalkyl, -OH, -O(C,-C6 alkyl), S(O)0 2, (C,-C6 alkyl)S(O)„2-, (C,-C6 alkyl)S(O)0.2(C,-C6 alkyl)-, (C,-C6 alkyl)C(O)NH-, H2N- CH(NH)-, H2N-C(O)NH-(C,-C6 alkyl)C(O)-, (C,-C6 alkyl)OC(O)-, (C,-C6 alkyl) O(C,-C6 alkyl)-, (C,-C6)C(O)2(C, -C6 alkyl)-, (C,-C6 alkyl)OC(O)NH-, aryl, aralkyl, heteroaryl, heterocyclylalkyl, halo-aryl, halo-aralkyl, halo-heterocycle, halo- heterocyclylalkyl, cyano-aryl, cyano-aralkyl, cyano-heterocycle and cyano- heterocyclylalky 1.
4 5
When R and R are combined to form - (CH2)u -, cyclic moieties are formed. Examples of such cyclic moieties include, but are not limited to:
Figure imgf000076_0001
4 5 In addition, with respect to R and R , such cyclic moieties may optionally include a heteroatom(s). Examples of such heteroatom-containing cyclic moieties include, but are not limited to:
Figure imgf000077_0001
Examples of the ring structures which may be formed when R and R , or R and R a, are joined include, but are not limited to,
Figure imgf000077_0002
-N O — N S
As used herein, examples of "C3 - C20 cycloalkyl" may include, but are not limited to:
Figure imgf000077_0003
Lines drawn into the ring systems from substituents (such as from R , R , X , etc.) indicate that the indicated bond may be attached to any of the substitut- able ring carbon atoms or heteroatoms. 2 10
Preferably, R is independently selected from hydrogen, -OR , CN, unsubstituted or substituted aryl and halogen. Most preferably, r is 1 to 3 and at least
2 one R is CN.
3 Preferably, R is independently selected from hydrogen, halo, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted heterocycle,
6 7 6a 10 unsubstituted or substituted aryl, -NR R , oxido, -S(O)mR , -OR , and C,-C6 perfluoroalkyl.
4 5
Preferably, R and R are independently selected from hydrogen,
10 4 5 unsubstituted or substituted C,-C6 alkyl, OR . Most preferably, R and R are independently selected from hydrogen or unsubstituted or substituted C,-C6 alkyl.
Preferably, R is selected from hydrogen, or unsubstituted or substituted C,-C6 alkyl. Most preferably, R is selected from hydrogen or methyl.
Preferably, R is selected from hydrogen, unsubstituted or substituted C,-C6 alkyl, and unsubstituted or substituted aryl. Preferably, R is selected from hydrogen, unsubstituted or substituted
C,-C6 alkyl, unsubstituted or substituted aryl, or unsubstituted or substituted heterocycle.
Preferably, X is selected from C(O)(CH2)p or (CH2)p, where p is 1 or 2. Preferably, X is (CR 2)p, where p is 1 or 2. Preferably, A1 is selected from a bond, C(O), -NR'°C(O)-, OC(O)NR10 or S(O)m .
Preferably, A is selected from a bond, -NR,0C(O)-, C(O), or S(O)m.
3 Preferably, A is selected from a bond, C(O), or S(O)m.
4 4
Preferably, A is a bond or C(O). Most preferably, A is a bond. Preferably, G2 is H2.
Preferably, V is selected from aryl or heterocycle. More preferably, V is aryl. Most preferably, V is phenyl.
Preferably, W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl, thiazolyl, 2-oxopiperidinyl, quinolinyl, isoquinolinyl, and thienyl. More preferably, W is imidazolyl or pyridinyl. Most preferably, W is imidazolyl.
Preferably, Y is selected from aryl, heterocycle, C,-C6 alkyl or a C3-
C,0 cycloalkyl. More preferably, Y is aryl or heterocycle.
Preferably, n, p, and q are independently 0, 1 , 2, 3 or 4. Preferably, r,s and t are independently selected from 0, 1, 2, or 3. Preferably, the moiety
Figure imgf000079_0001
represents
Figure imgf000079_0002
or
Figure imgf000079_0003
where p is 1 or 2.
It is intended that the definition of any substituent or variable (e.g., Rla, R2, m, p, etc.) at a particular location in a molecule is independent of its definitions elsewhere in that molecule. Thus, -C(Rla)2 can represent -CH2, -CHCH3, -CHC2H5, etc. It is understood that substituents and substitution patterns on the compounds of the instant invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of this invention include the conventional non-toxic salts of the compounds of this invention as formed, e.g., from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like: and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, trifluoroacetic and the like.
The pharmaceutically acceptable salts of the compounds of this invention can be synthesized from the compounds of this invention which contain a basic moiety by conventional chemical methods. Generally, the salts are prepared either by ion exchange chromatography or by reacting the free base with stoichio- metric amounts or with an excess of the desired salt- forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
Abbreviations which may be used in the description of the chemistry and in the Examples that follow include:
Ac2θ Acetic anhydride;
AIBN 2,2'-Azobisisobutyronitrile
BOC/Boc t-Butoxycarbonyl or tert-butoxycarbonyl;
CBz Carbobenzyloxy;
DBAD Di-tert-butyl azodicarboxylate; DBU l,8-Diazabicyclo[5.4.0]undec-7-ene;
DCE 1,2-Dichloroethane;
DIEA NN-Diisopropylethylamine;
DMAP 4-Dimefhylaminopyridine;
DME 1,2-Dimethoxyethane; DMF NN-Dimethylformamide;
DMSO Methyl sulfoxide;
DPPA Diphenylphosphoryl azide;
DTT Dithiothreitol;
EDC l-(3-Dimethylaminopropyl)-3-ethyl-carbodiimide-hydrochloride; EDTA Ethylenediaminetetraacetic acid;
EtβN Triethylamine;
EtOAc Ethyl acetate;
EtOH Ethanol;
FAB Fast atom bombardment; HEPES 4-(2-Hydroxyethyl)-l-piperazineethanesulfonic acid; HOBT 1 -Hydroxybenzotriazole hydrate;
HOOBT 3-Hydroxy-l,2,2-benzotriazin-4(3H)-one;
HPLC High-performance liquid chromatography;
LAH Lithium aluminum hydride;
MCPBA -Chloroperoxybenzoic acid;
Me Methyl;
MeOH Methanol;
Ms Methanesulfonyl;
MsCl Methanesulfonyl chloride; n-Bu3P Tri-n-butylphosphine;
NaHMDS Sodium bis(trimethylsilyf)amide;
NBS N-Bromosuccinimide;
PMSF a-Toluenesulfonyl chloride;
Py or pyr Pyridine;
PYBOP Benzotriazole-1-yl-oxy-trispyrrolidinophosphonium hexafluorophosphate; t-Bu tert-Butyl
TBAF Tetrabutylammonium fluoride
RPLC Reverse Phase Liquid Chromatography
TBSC1 tert-Butyldimethylsilyl chloride
TFA Trifluoroacetic acid;
THF Tetrahydrofuran;
TMS Tetramethylsilane;
Tr Trityl;
These reactions may be employed in a linear sequence to provide the compounds of the invention or they may be used to synthesize fragments which are subsequently joined by the alkylation reactions described in the Schemes. The procedures discussed and illustrated in the following schemes and synopsis may be used in the preparation of the compounds of the instant invention, for either (R) or (S) stereochemistry.
Synopsis of Schemes
Unless otherwise indicated, variable n is defined as 0 to 6 and variable p is defined as 0 to 4. Scheme 1 depicts the synthesis of intermediate amide 1. One variation starts with the EDC-mediated coupling of methionine with the amine of interest to give amide 1. A second variation of this procedure uses PYBOP and DIEA in dichloromethane to achieve the initial coupling of the amine and methionine. Scheme 2 details the construction of various 1 -substituted 3-amino- pyrrolidinones. Amide 1 is treated with excess iodomethane, and the resulting sulfonium salt undergoes cyclization upon reaction with lithium Bis(trimefhylsilyι) amide in THF at 0°C to give the simple pyrrolidinone 2. Treatment of compound 2 with lithium bis(trimethyl-silyl)amide in THF at 0°C, followed by iodomethane, provides the methylated analog 3.
Scheme 3 demonstrates the synthesis of suitably substituted imidazolyl acetic acids. Thus, the imidazole acetic acid 4 can be converted to the ester 5 by standard procedures. Selective nitrogen protection provides intermediate 6 which is first reacted with an alkyl halide, then treated with refluxing methanol to provide the regiospecifically alkylated imidazole acetic acid ester 7. The ester 7 can be converted to the acetic acid 8 using either aqueous HCl or LiOH.
Scheme 3 A illustrates the synthesis of aldehyde A using the imidazolyl alcohol 9. Treating the imidazolyl alcohol 9 with triethyl-amine and tritylchloride in DMF yielded the protected imidazolyl alcohol 10. This alcohol 10 can be converted to the TBS ether intermediate B using TBSCl in DIEA, CH2C12 and DMAP. Treating the alcohol 10 with pyridine and acetic anhydride will also yield the ester 11. Using a substitited benzylbromide, ethyl acetate and then methanol, the ester 11 is converted to the benzylimidazolyl ester 12. Treating 12 with LiOH will yield the benzyl- imidazolyl alcohol 13 which can be converted to aldehyde A using triethylamine and SO3-Py in DMSO
Scheme 3B demonstrates an alternative route for the synthesis of aldehyde A. Benzyl bromide 14 is treated with hexamethyenetetramine in ethanol, resulting in compound 15. Compound 15 is then treated with H3PO4, ethanol, and propionic acid to convert compound 15 to the benzylamine phosphate salt 16. The phosphate salt is converted to the imidazolyl 17, using DHA, KSCN, C2H5COOH in MeCN and water. DHA represents dihydroxyacetone and its dimer in equilibrium, as shown below:
Figure imgf000083_0001
Using hydrogen peroxide, HO Ac and water, 17 is converted to benzylimidazolyl alcohol 18. The benzylimidazolyl alcohol 18 is then converted to aldehyde A using triethylamine and SO3-Py in DMSO.
The BOC-protected 3-aminopyrrolidinone of general structure 2 can be deprotected, as depicted in Scheme 4, with HCl in EtOAc at 0°C to give the corresponding amine 19. As shown, this amine 19 is then reductively alkylated with aldehyde A using either NaCNBH3 in methanol, or NaBH(OAc)3 in 1 ,2- dichloroethane, to provide the secondary amine 20. Similarly, compound 21 in Scheme 5 may be converted to compound 23 by analogous procedures.
Scheme 5 A demonstrates the synthesis of an isomeric pyrrolidinone. The synthesis of the 3-aminopyrrolidinone 19a begins by treating the amine and a BOC-protected aspartic acid ethyl ester with PYBOP and DIEA. The resulting product is treated with Lawesson's reagent and the desired aminopyrrolidinone is cyclized using NaBH4 and NiCl2 to obtain the intermediate 5. Using techniques described above, the intermediate 2a is converted to the compound 19a, which may be used as a substitute for the basic 3-aminopyrrolidinone in any of the following schemes. Scheme 6 shows the synthesis of amides of stmcture 24. As before, deprotection of the amine functionality in 21 gives 22, which is then coupled to the carboxylic acid, such as described in Scheme 3, using EDC, HOBT and DIEA in DMF. Application of these same procedures to the N-methyl carbamate 3 (from Scheme 2) produces the tertiary amide 26 in Scheme 7. The synthesis of two useful aldehydes is detailed in Scheme 8.
Firstly, an aminoalcohol is protected with a BOC group by treatment with di-tert- butyl dicarbonate and DIEA in DMF, and the resulting alcohol is subjected to standard Swem oxidation conditions to give alde-hyde 28. In the second case, ethylene glycol is selectively monoprotected by reaction of its sodium alkoxide with tert-butyldimethylsilyl chloride in THF. Swem oxidation of the monoprotected alcohol gives the desired aldehyde 29. Compound 23 (from Scheme 5) may be reductively alkylated with aldehyde 28 and NaCNBH3 in methanol to give the tertiary amine derivative 30, as shown in Scheme 9. Deprotection of 30 with HCl in EtOAc affords the amine 31. Aldehyde 29 may be employed in a similar series of reactions to provide the corresponding hydroxyl compound of the instant invention.
Reductive alkylation of compound 23 with aldehyde 29 using NaCNBH in methanol, provides structure 32 in Scheme 10. This silyl ether is deprotected by treatment with TBAF in THF, and the resulting alcohol 33 is subjected to standard Swem oxidation to provide aldehyde 34. This aldehyde 34 can be reductively aminated with, for example, moφholine under standard NaCNBH3 conditions to afford the instant compound 35.
Scheme 11 demonstrates a route to imidazolylethyl derivatives such as 38. The methyl ester 7A is converted to the alcohol 36 using NaBH4 and methanol. Then the alcohol 36 is converted to the corresponding mesylate 37 using methane- sulfonyl chloride and DIEA in dichloromethane. Reaction of aminopyrrolidinone 22 with a mixture of this mesylate, sodium iodide, and DIEA in DMF at 50°C affords compound 38.
In Scheme 12, 3-(trifluoroacetamido)pyrrolidine is treated with di-tert-butyl dicarbonate and DIEA in dichloromethane, and the resulting carbamate is treated with lithium hydroxide in aqueous THF to provide the protected aminopyrrolidine 39.
Reductive alkylation of amine 39 with aldehyde A is carried out using standard NaCNBH3 conditions to give compound 40 in Scheme 13. Removal of the BOC group using HCl in EtOAc, followed by EDC coupling of the amine with carboxylic acid (RaCO2H) provides the amide derivative 41.
Scheme 13A illustrates the synthesis of compound 41a, where compound 40 is deprotected, then reacted with the isocyanate (in THF) to provide the desired urea.
The aryl fluoride 42, prepared as illustrated in Scheme 4 but using a suitably substituted fluorobenzyl imidazolyl aldehyde, may be converted to the corresponding aryl ethers 43 and 44 as shown in Scheme 14. For aliphatic alcohols (R OH), it is preferable to use potassium tert-butoxide as the base in THF at low temperature, and this yields compound 43. In the case of reaction with a phenol (RaOH), use of cesium carbonate as base in DMF at 40°C affords the instant ether 44. Scheme 15 illustrates the synthesis of a 3-amino-l-pyridin-2- ylpyπolidinone 50. In this case, BOC-protected homoserine lactone is treated with the dimethylaluminum amide of the appropriate aminopyridine 46. The resulting homoserine derivative 47 is reacted with di-tert-butyl azodicarboxylate and tributylphosphine in THF to afford the pyπolidinone 48. The standard deprotection and reductive amination procedures yield the instant compound 50.
The synthesis of l-(diarylmethyl)pyπolidinone intermediates such as 57 is illustrated in Scheme 16. Benzyl 3-bromophenyl ether 51 is treated with magnesium in THF, and the resulting Grignard reagent is reacted with 3- chlorobenzaldehyde to give the alcohol 52. This alcohol can be converted to the corresponding azide 53 using DPP A and DBU in toluene, and reduction of the azide by treatment with LAH in THF affords the amine 54. Coupling of amine 54 and methionine is effected by treatment with PYBOP and DIEA in dichloromethane to give amide 55 as a mixture of diastereomers. This amide 55 is treated with excess iodomethane, and the resulting sulfonium salt undergoes cyclization upon reaction with lithium bis(trimethylsilyl)amide in THF at 0°C to give the pyrrolidinone 56. The benzyl ether can be removed by hydrogenolysis over Pd(OH)2 in ethanol and acetic acid to give phenol 57, and the diastereomers may be separated by chromatography on silica gel, as shown in Scheme 17. A pure diastereomer, for example structure 58 in Scheme 17, is treated with HCl in EtOAc at 0°C to give the amine 59, and this is subjected to reductive alkylation with aldehyde A and NaCNBH3 in methanol to provide compound 60.
In Scheme 18, benzaldehyde 61 is treated with methyl-magnesium bromide in THF at -78°C to give the alcohol 62. A mixture of this alcohol, intermediate B (as described in Scheme 3 A) and DIEA in dichloromethane at -78°C is treated with trifluoromethanesulfonic anhydride, and the resulting imidazolium salt is heated in methanol to provide the imidazole 64. The silyl ether is deprotected using TBAF in THF and the resulting alcohol is converted to the aldehyde 65 by treatment with sulfur trioxide-pyridine complex and triethylamine in DMSO. This aldehyde can be reacted with amine 19 and NaCNBH3 in methanol to provide the desired compound 66.
Schemes 19-22 illustrate syntheses of suitably substituted aldehydes useful in the syntheses of the instant compounds wherein the variable W is present as a pyridyl moiety. Similar synthetic strategies for preparing alkanols that incoφorate other heterocyclic moieties for variable W are also well known in the art. SCHEME 1
Figure imgf000086_0001
PYBOP, DIEA CH2CI n = 0 to 6
SCHEME 2
Figure imgf000086_0002
(i) (TMS)2NI_i
THF (ϋ)Mel
I —NHBOC
0°C 2
Figure imgf000086_0003
SCHEME 3
Figure imgf000087_0001
Figure imgf000087_0002
Figure imgf000087_0003
Figure imgf000087_0004
SCHEME 3A
Figure imgf000088_0001
SCHEME 3B
Figure imgf000089_0001
Figure imgf000089_0002
SCHEME 4
Figure imgf000090_0001
SCHEME 5
Figure imgf000091_0001
Figure imgf000092_0001
Lawesson's NaBH4 Reagent NiCI2
Figure imgf000092_0002
Figure imgf000092_0003
2a (ii) HCl, EtOAc 19a
SCHEME 6
Figure imgf000093_0001
SCHEME 7
Figure imgf000094_0001
HCl
EtOAc
0°C
Figure imgf000094_0002
SCHEME 8
BOC2O
Figure imgf000095_0001
27
(i) DMSO
Figure imgf000095_0002
(ϋ) Et3N 28
NaH TBSCl
H ^^0H THF ■ H0^^0TBS
(i) DMSO, (COCI)2
CH2CI2 ^^
_70 °C OHC OTBS
(ϋ) Et3N 29
SCHEME 9
Figure imgf000096_0001
SCHEME 10
Figure imgf000097_0001
SCHEME 10 (CONTD)
Figure imgf000098_0001
SCHEME 11
Figure imgf000099_0001
SCHEME 12
Figure imgf000100_0001
39
SCHEME 13
Figure imgf000100_0002
Figure imgf000100_0003
SCHEME 13A
Figure imgf000101_0001
SCHEME 14
Figure imgf000102_0001
SCHEME 15
O
NHBOC
Figure imgf000103_0001
Figure imgf000103_0002
Figure imgf000103_0003
SCHEME 16
Figure imgf000104_0001
Figure imgf000104_0002
'NHBOC
Figure imgf000104_0003
SCHEME 17
separate diastereomers
'NHBOC
Figure imgf000105_0001
Figure imgf000105_0002
59
Figure imgf000105_0003
SCHEME 18
Figure imgf000106_0001
where n=0 and X=1 -naphthyl
Figure imgf000106_0002
SCHEME 19
Figure imgf000107_0001
Figure imgf000107_0002
Figure imgf000107_0003
SCHEME 20
Figure imgf000108_0001
SCHEME 21
Figure imgf000109_0001
SCHEME 22
Figure imgf000110_0001
Figure imgf000110_0002
In the above Schemes, it is understood that X represents
Y X — , unless otherwise indicated; Ph represents phenyl;
Ar represents a carbocyclic or heterocyclic, substituted or unsubstituted aromatic ring;
Ra represents an unsubstituted or substituted aryl or an unsubstituted or substituted heteroaryl; and
RD represents an unsubstituted or substituted aralkyl or an unsubstituted or substituted heterocyclylalkyl. In a preferred embodiment of the instant invention the compounds of the invention are selective inhibitors of farnesyl-protein transferase. A compound is considered a selective inhibitor of farnesyl-protein transferase, for example, when its in vitro farnesyl-protein transferase inhibitory activity, as assessed by the assay described in Example 177, is at least 100 times greater than the in vitro activity of the same compound against geranylgeranyl-protein transferase-type I in the assay described in Example 178. Preferably, a selective compound exhibits at least 1000 times greater activity against one of the enzymatic activities when comparing geranylgeranyl-protein transferase-type I inhibition and farnesyl-protein transferase inhibition. It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: a) an IC50 (a measure of in vitro inhibitory activity) for inhibition of the prenylation of newly synthesized K-Ras protein more than about 100-fold higher than the EC50 for the inhibition of the famesylation of hDJ protein. When measuring such IC50s and EC50s the assays described in Example 182 may be utilized. It is also preferred that the selective inhibitor of farnesyl-protein transferase is further characterized by: b) an IC50 (a measurement of in vitro inhibitory activity) for inhibition of K4B-Ras dependent activation of MAP kinases in cells at least 100-fold greater than the EC50 for inhibition of the famesylation of the protein hDJ in cells.
It is also preferred that the selective inhibitor of famesyl-protein transferase is further characterized by: c) an IC50 (a measurement of in vitro inhibitory activity) against
H-Ras dependent activation of MAP kinases in cells at least 1000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells. When measuring Ras dependent activation of MAP kinases in cells the assays described in Example 181 may be utilized.
In another preferred embodiment of the instant invention the compounds of the invention are dual inhibitors of famesyl-protein transferase and geranylgeranyl-protein transferase type I. Such a dual inhibitor may be termed a Class II prenyl-protein transferase inhibitor and will exhibit certain characteristics when assessed in in vitro assays, which are dependent on the type of assay employed. In a SEAP assay, such as described in Example 181 , it is preferred that the dual inhibitor compound has an in vitro inhibitory activity (IC5o) that is less than about 12 μM against K4B-Ras dependent activation of MAP kinases in cells. The Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells between 0.1 and 100 times the IC5o for inhibiting the famesylation of the protein hDJ in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) for inhibiting K4B-Ras dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
The Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against
H-Ras dependent activation of MAP kinases in cells greater than 2 fold lower but less than 20,000 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC5o (a measurement of in vitro inhibitory activity) against
H-ras-CVLL dependent activation of MAP kinases in cells greater than 5-fold lower than the inhibitory activity (IC50) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
I l l The Class II prenyl-protein transferase inhibitor may also be characterized by: a) an IC50 (a measurement of in vitro inhibitory activity) against H-Ras dependent activation of MAP kinases in cells greater than 10-fold lower but less than 2,500 fold lower than the inhibitory activity (IC50) against H-ras-CVLL (SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells; and b) an IC50 (a measurement of in vitro inhibitory activity) against H-rαs-CVLL dependent activation of MAP kinases in cells greater than 5 fold lower than the inhibitory activity (IC5o) against expression of the SEAP protein in cells transfected with the pCMV-SEAP plasmid that constitutively expresses the SEAP protein.
A method for measuring the activity of the inhibitors of prenyl-protein transferase, as well as the instant combination compositions, utilized in the instant methods against Ras dependent activation of MAP kinases in cells is described in Example 181.
In yet another embodiment, a compound of the instant invention may be a more potent inhibitor of geranylgeranyl-protein transferase-type I than it is an inhibitor of famesyl-protein transferase.
The instant compounds are useful as pharmaceutical agents for mammals, especially for humans. These compounds may be administered to patients for use in the treatment of cancer. Examples of the type of cancer which may be treated with the compounds of this invention include, but are not limited to, colorectal carcinoma, exocrine pancreatic carcinoma, myeloid leukemias and neurological tumors. Such tumors may arise by mutations in the ras genes them- selves, mutations in the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1), neu, src, abl, lck, fyn) or by other mechanisms.
The compounds of the instant invention inhibit famesyl-protein transferase and the famesylation of the oncogene protein Ras. The instant compounds may also inhibit tumor angiogenesis, thereby affecting the growth of tumors (J. Rak et al. Cancer Research, 55:4575-4580 (1995)). Such anti-angiogenesis properties of the instant compounds may also be useful in the treatment of certain forms of vision deficit related to retinal vascularization.
The compounds of this invention are also useful for inhibiting other proliferative diseases, both benign and malignant, wherein Ras proteins are aberrantly activated as a result of oncogenic mutation in other genes (i.e., the Ras gene itself is not activated by mutation to an oncogenic form) with said inhibition being accomplished by the administration of an effective amount of the compounds of the invention to a mammal in need of such treatment. For example, the composition is useful in the treatment of neurofibromatosis, which is a benign proliferative disorder. The instant compounds may also be useful in the treatment of certain viral infections, in particular in the treatment of hepatitis delta and related viruses (J.S.
Glenn et al. Science, 256:1331-1333 (1992).
The compounds of the instant invention are also useful in the prevention of restenosis after percutaneous transluminal coronary angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature medicine, 1 :541-545(1995). The instant compounds may also be useful in the treatment and prevention of polycystic kidney disease (D.L. Schaffner et al. American Journal of
Pathology, 142:1051-1060 (1993) and B. Cowley, Jr. et al.FASEB Journal, 2:A3160
(1988)). The instant compounds may also be useful for the treatment of fungal infections.
The instant compounds may also be useful as inhibitors of proliferation of vascular smooth muscle cells and therefore useful in the prevention and therapy of arteriosclerosis and diabetic vascular pathologies. The compounds of the instant invention may also be useful in the prevention and treatment of endometriosis, uterine fibroids, dysfunctional uterine bleeding and endometrial hyperplasia.
In such methods of prevention and treatment as described herein, the prenyl-protein transferase inhibitors of the instant invention may also be co- administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the prenyl-protein transferase inhibitor may be useful in further combination with drugs known to supress the activity of the ovaries and slow the growth of the endometrial tissue. Such drugs include but are not limited to oral contraceptives, progestins, danazol and GnRH (gonadotropin-releasing hormone) agonists.
Administration of the prenyl-protein transferase inhibitor may also be combined with surgical treatment of endometriosis (such as surgical removal of misplaced endometrial tissue) where appropriate.
The instant compounds may also be useful as inhibitors of comeal inflammation. These compounds may improve the treatment of comeal opacity which results from cauterization-induced comeal inflammation. The instant compounds may also be useful in reducing comeal edema and neovascularization. (K. Sonoda et al., Invest. Ophthalmol Vis. Sci., 1998, vol. 39, p 2245-2251).
The compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard pharmaceutical practice. The compounds can be administered orally or parenterally, including the intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. Additionally, the compounds of the instant invention may be administered to a mammal in need thereof using a gel extrusion mechanism (GEM) device, such as that described in USSN 60/144,643, filed on July 20, 1999, which is hereby incorporated by reference.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specific amounts, as well as any product which results, directly or indirectly, from combination of the specific ingredients in the specified amounts.
The pharmaceutical compositions containing the active ingredient may be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use may be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients may be for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, microcrystalline cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and lubricating agents, for example, magnesium stearate, stearic acid or talc. The tablets may be uncoated or they may be coated by known techniques to mask the unpleasant taste of the drug or delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a water soluble taste masking material such as hydroxypropyl-methylcellulose or hydroxypropyl- cellulose, or a time delay material such as ethyl cellulose, cellulose acetate buryrate may be employed. Formulations for oral use may also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water soluble carrier such as polyethyl- eneglycol or an oil medium, for example peanut oil, liquid paraffin, or olive oil. Aqueous suspensions contain the active material in admixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose, sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents may be a naturally-occurring phosphatide, for example lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethylene- oxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions may also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose, saccharin or aspartame. Oily suspensions may be formulated by suspending the active ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in mineral oil such as liquid paraffin. The oily suspensions may contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents such as those set forth above, and flavoring agents may be added to provide a palatable oral preparation. These compositions may be preserved by the addition of an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, may also be present. These compositions may be preserved by the addition of an anti-oxidant such as ascorbic acid.
The pharmaceutical compositions of the invention may also be in the form of an oil-in-water emulsions. The oily phase may be a vegetable oil, for example olive oil or arachis oil, or a mineral oil, for example liquid paraffin or mixtures of these. Suitable emulsifying agents may be naturally-occurring phosphatides, for example soy bean lecithin, and esters or partial esters derived from fatty acids and hexitol anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions may also contain sweetening, flavouring agents, preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such formulations may also contain a demulcent, a preservative, flavoring and coloring agents and antioxidant.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous solutions. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution.
The sterile injectable preparation may also be a sterile injectable oil-in- water microemulsion where the active ingredient is dissolved in the oily phase. For example, the active ingredient may be first dissolved in a mixture of soybean oil and lecithin. The oil solution then introduced into a water and glycerol mixture and processed to form a microemulation.
The injectable solutions or microemulsions may be introduced into a patient's blood-stream by local bolus injection. Alternatively, it may be advantageous to administer the solution or microemulsion in such a way as to maintain a constant circulating concentration of the instant compound. In order to maintain such a constant concentration, a continuous intravenous delivery device may be utilized. An example of such a device is the Deltec CADD-PLUS™ model 5400 intravenous pump.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleagenous suspension for intramuscular and subcutaneous administration. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1,3-butane diol. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
Compounds of Formula A may also be administered in the form of a suppositories for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions or suspensions, etc., containing the compound of Formula A are employed. (For purposes of this application, topical application shall include mouth washes and gargles.)
The compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles and delivery devices, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in the art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Compounds of the present invention may also be delivered as a suppository employing bases such as cocoa butter, glycerinated gelatin, hydrogenated vegetable oils, mixtures of polyethylene glycols of various molecular weights and fatty acid esters of polyethylene glycol.
When a compound according to this invention is administered into a human subject, the daily dosage will normally be determined by the prescribing physician with the dosage generally varying according to the age, weight, sex and response of the individual patient, as well as the severity of the patient's symptoms. In one exemplary application, a suitable amount of compound is administered to a mammal undergoing treatment for cancer. Administration occurs in an amount between about 0.1 mg/kg of body weight to about 60 mg/kg of body weight per day, preferably of between 0.5 mg/kg of body weight to about 40 mg/kg of body weight per day. The compounds of the instant invention may also be co-administered with other well known therapeutic agents that are selected for their particular usefulness against the condition that is being treated. For example, the compounds of the instant invention may also be co-administered with other well known cancer therapeutic agents that are selected for their particular usefulness against the condition that is being treated. Included in such combinations of therapeutic agents are combinations of the instant famesyl-protein transferase inhibitors and an antineo- plastic agent. It is also understood that such a combination of antineoplastic agent and inhibitor of farnesyl-protein transferase may be used in conjunction with other methods of treating cancer and/or tumors, including radiation therapy and surgery. It is further understood that any of the therapeutic agents described herein may also be used in combination with a compound of the instant invention and an antineoplastic agent.
Examples of an antineoplastic agent include, in general, microtubule- stabilizing agents ( such as paclitaxel (also known as Taxol®), docetaxel (also known as Taxotere®), epothilone A, epothilone B, desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-disruptor agents; alkylating agents, for example, nitrogen mustards, ethyleneimine compounds, alkyl sulfonates and other compounds with an alkylating action such as nitrosoureas, cisplatin, and dacarbazine; anti- metabolites, for example, folic acid, purine or pyrimidine antagonists; epidophyllotoxin; an antineoplastic enzyme; a topoisomerase inhibitor; procarbazine; mitoxantrone; platinum coordination complexes; biological response modifiers and growth inhibitors; mitotic inhibitors, for example, vinca alkaloids and derivatives of podophyllotoxin; cytotoxic antibiotics; hormonal/anti-hormonal therapeutic agents, haematopoietic growth factors and antibodies (such as trastuzumab (Herceptin™)). Example classes of antineoplastic agents include, for example, the anthracycline family of drugs, the vinca drugs, the mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes, the epothilones, discodermolide, the pteridine family of drugs, diynenes and the podophyllotoxins. Particularly useful members of those classes include, for example, doxorubicin, carminomycin, daunombicin, aminopterin, methotrexate, methopterin, dichloro-methotrexate, mitomycin C, porfiromycin, 5-fluorouracil, 6-mercaptopurine, gemcitabine, cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine, vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like. Other useful antineoplastic agents include estra- mustine, cisplatin, carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide, melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate, trimetrexate, dacarbazine, L-asparaginase, dactinomycin, mechlorethamine (nitrogen mustard), streptozocin, cyclophosphamide, carmustine (BCNU), lomustine (CCNU), procarbazine, mitomycin, cytarabine, etoposide, methotrexate, bleomycin, chlorambucil, camptothecin, CPT-11, topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole derivatives, interferons and interleukins. Particular examples of antineoplastic, or chemotherapeutic, agents are described, for example, by D. J. Stewart in "Nausea and Vomiting: Recent Research and Clinical Advances", Eds. J. Kucharczyk, et al., CRC Press Inc., Boca Raton, Florida, USA (1991), pages 177-203, especially page 188. See also, R. J. Gralla, et al., Cancer Treatment Reports, 68(1), 163-172 (1984).
The preferred class of antineoplastic agents is the taxanes and the preferred antineoplastic agent is paclitaxel. The compounds of the instant invention may also be co-administered with antisense oligonucleotides which are specifically hybridizable with RNA or DNA deriving from human ras gene. Such antisense oligonucleotides are described in U.S. Patent No. 5,576,208 and PCT Publication No. WO 99/22772. The instant compounds are particularly useful when co-administered with the antisense oligo- nucleotide comprising the amino acid sequence of SEQ.ID.NO: 2 of U.S. Patent No. 5,576,208.
Certain compounds of the instant invention may exhibit very low plasma concentrations and significant inter-individual variation in the plasma levels of the compound. It is believed that very low plasma concentrations and high intersubject variability achieved following administration of certain prenyl-protein transferase inhibitors to mammals may be due to extensive metabolism by cytochrome P450 enzymes prior to entry of drug into the systemic circulation. Prenyl-protein transferase inhibitors may be metabolized by cytochrome P450 enzyme systems, such as CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other cytochrome P450 isoform. If a compound of the instant invention demonstrates an affinity for one or more of the cytochrome P450 enzyme systems, another compound with a higher affinity for the P450 enzyme(s) involved in metabolism should be administered concomitantly. Examples of compounds that have a comparatively very high affinity for CYP3A4, CYP2D6, CYP2C9, CYP2C19 or other P450 isoform include, but are not limited to, piperonyl butoxide, troleandomycin, erythromycin, proadifen, isoniazid, allylisopropylacetamide, ethinylestradiol, chloramphenicol, 2- ethynylnaphthalene and the like. Such a high affinity compound, when employed in combination with a compound of formula A, may reduce the inter-individual variation and increase the plasma concentration of a compound of formula A to a level having substantial therapeutic activity by inhibiting the metabolism of the compound of formula A. Additionally, inhibiting the metabolism of a compound of the instant invention prolongs the pharmacokinetic half-life, and thus the pharmacodynamic effect, of the compound.
A compound of the present invention may be employed in conjunction with antiemetic agents to treat nausea or emesis, including acute, delayed, late-phase, and anticipatory emesis, which may result from the use of a compound of the present invention, alone or with radiation therapy. For the prevention or treatment of emesis a compound of the present invention may be used in conjunction with other anti-emetic agents, especially neurokinin-1 receptor antagonists, 5HT3 receptor antagonists, such as ondansetron, granisetron, tropisetron, and zatisetron, GABAB receptor agonists, such as baclofen, or a corticosteroid such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or others such as disclosed in U.SPatent Nos. 2,789,118, 2,990,401, 3,048,581, 3,126,375, 3,929,768, 3,996,359, 3,928,326 and 3,749,712. For the treatment or prevention of emesis, conjunctive therapy with a neurokinin-1 receptor antagonist, a 5HT3 receptor antagonist and a corticosteroid is preferred.
Neurokinin-1 receptor antagonists of use in conjunction with the compounds of the present invention are fully described, for example, in U.S. Patent Nos. 5,162,339, 5,232,929, 5,242,930, 5,373,003, 5,387,595, 5,459,270, 5,494,926, 5,496,833, 5,637,699, 5,719,147; European Patent Publication Nos. EP 0 360 390, 0 394 989, 0 428 434, 0 429 366, 0 430 771, 0 436 334, 0 443 132, 0 482 539, 0 498 069, 0 499 313, 0 512 901, 0 512 902, 0 514 273, 0 514 274, 0 514 275, 0 514 276, 0 515 681, 0 517 589, 0 520 555, 0 522 808, 0 528 495, 0 532 456, 0 533 280, 0 536 817, 0 545 478, 0 558 156, 0 577 394, 0 585 913,0 590 152, 0 599 538, 0 610 793, 0 634 402, 0 686 629, 0 693 489, 0 694 535, 0 699 655, 0 699 674, 0 707 006, 0 708 101, 0 709 375, 0 709 376, 0 714 891, 0 723 959, 0 733 632 and 0 776 893; PCT International Patent Publication Nos. WO 90/05525, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/05181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362, 97/18206, 97/19084, 97/19942 and 97/21702; and in British Patent Publication Nos. 2 266 529, 2 268 931, 2 269 170, 2 269 590, 2 271 774, 2 292 144, 2 293 168, 2 293 169, and 2 302 689. The preparation of such compounds is fully described in the aforementioned patents and publications. A particularly preferred neurokinin- 1 receptor antagonist for use in conjunction with the compounds of the present invention is 2-(R)-(l-(R)-(3,5-bis (trifluoromethyl)phenyl)ethoxy)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-lH,4H-l,2,4- triazolo)mefhyl)morpholine, or a pharmaceutically acceptable salt thereof, which is described in U.S. Patent No. 5,719,147. For the treatment of cancer, it may be desirable to employ a compound of the present invention in conjunction with another pharmacologically active agent(s). A compound of the present invention and the other pharmacologically active agent(s) may be administered to a patient simultaneously, sequentially or in combination. For example, the present compound may employed directly in combin- ation with the other active agent(s), or it may be administered prior, concurrent or subsequent to the administration of the other active agent(s). In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.
For example, a compound of the present invention may be presented together with another therapeutic agent in a combined preparation, such as with an antiemetic agent for simultaneous, separate, or sequential use in the relief of emesis associated with employing a compound of the present invention and radiation therapy. Such combined preparations may be, for example, in the form of a twin pack. A preferred combination comprises a compound of the present invention with antiemetic agents, as described above. Radiation therapy, including x-rays or gamma rays which are delivered from either an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with the instant inhibitor of prenyl-protein transferase alone to treat cancer. Additionally, compounds of the instant invention may also be useful as radiation sensitizers, as described in WO 97/38697, published on October 23, 1997, and herein incoφorated by reference.
The instant compounds may also be useful in combination with other inhibitors of parts of the signaling pathway that links cell surface growth factor receptors to nuclear signals initiating cellular proliferation. Thus, the instant compounds may be utilized in combination with famesyl pyrophosphate competitive inhibitors of the activity of famesyl-protein transferase or in combination with a compound which has Raf antagonist activity. The instant compounds may also be co-administered with compounds that are selective inhibitors of geranylgeranyl protein transferase.
In particular, if the compound of the instant invention is a selective inhibitor of famesyl-protein transferase, co-administration with a compound(s) that is a selective inhibitor of geranylgeranyl protein transferase may provide an improved therapeutic effect. In particular, the compounds disclosed in the following patents and publications may be useful as famesyl pyrophosphate-competitive inhibitor component of the instant composition: U.S. Serial Nos. 08/254,228 and 08/435,047. Those patents and publications are incoφorated herein by reference.
In practicing methods of this invention, which comprise administering, simultaneously or sequentially or in any order, two or more of a protein substrate- competitive inhibitor and a famesyl pyrophosphate-competitive inhibitor, such administration can be orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration. It is preferred that such administration be orally. It is more preferred that such administration be orally and simultaneously. When the protein substrate-competitive inhibitor and famesyl pyrophosphate-competitive inhibitor are administered sequentially, the administration of each can be by the same method or by different methods.
The instant compounds may also be useful in combination with an integrin antagonist for the treatment of cancer, as described in U.S. Serial No. 09/055,487, filed April 6, 1998, and WO 98/44797, published on October 15, 1998, which are incoφorated herein by reference.
As used herein the term an integrin antagonist refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to an integrin(s) that is involved in the regulation of angiogenisis, or in the growth and invasiveness of tumor cells. In particular, the term refers to compounds which selectively antagonize, inhibit or counteract binding of a physiological ligand to the αvβ3 integrin, which selectively antagonize, inhibit or counteract binding of a physiological ligand to the αvβ5 integrin, which antagonize, inhibit or counteract binding of a physiological ligand to both the αvβ3 integrin and the αvβ5 integrin, or which antagonize, inhibit or counteract the activity of the particular integrin(s) expressed on capillary endothelial cells. The term also refers to antagonists of the αlβl, α2βl, α5βl, αόβl and α6β4 integrins. The term also refers to antagonists of any combination of αvβ3 integrin, αvβ5 integrin, αlβl, α2βl, α5βl, α6βl and α6β4 integrins. The instant compounds may also be useful with other agents that inhibit angiogenisis and thereby inhibit the growth and invasiveness of tumor cells, including, but not limited to angiostatin and endostatin.
The instant compounds may also be useful in combination with an inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) for the treatment of cancer. Compounds which have inhibitory activity for HMG-CoA reductase can be readily identified by using assays well-known in the art. For example, see the assays described or cited in U.S. Patent 4,231,938 at col. 6, and WO 84/02131 at pages 30-33. The terms "HMG-CoA reductase inhibitor" and "inhibitor of HMG-CoA reductase" have the same meaning when used herein.
Examples of HMG-CoA reductase inhibitors that may be used include but are not limited to lovastatin (MEVACOR®; see US Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR®; see US Patent No. 4,444,784; 4,820,850; 4,916,239), pravastatin (PRAVACHOL®; see US Patent Nos. 4,346,227; 4,537,859; 4,410,629; 5,030,447 and 5,180,589), fluvastatin (LESCOL®; see US Patent Nos. 5,354,772; 4,911,165; 4,929,437; 5,189,164; 5,118,853; 5,290,946; 5,356,896), atorvastatin (LIPITOR®; see US Patent Nos. 5,273,995; 4,681,893; 5,489,691; 5,342,952) and cerivastatin (also known as rivastatin and BAYCHOL®; see US Patent No. 5,177,080). The structural formulas of these and additional HMG-CoA reductase inhibitors that may be used in the instant methods are described at page 87 of M. Yalpani, "Cholesterol Lowering Drugs", Chemistry & Industry, pp. 85-89 (5 February 1996) and US Patent Nos. 4,782,084 and 4,885,314. The term HMG-CoA reductase inhibitor as used herein includes all pharmaceutically acceptable lactone and open-acid forms (i.e., where the lactone ring is opened to form the free acid) as well as salt and ester forms of compounds which have HMG-CoA reductase inhibitory activity, and therefor the use of such salts, esters, open-acid and lactone forms is included within the scope of this invention. An illustration of the lactone portion and its corresponding open-acid form is shown below as stmctures I and II.
Figure imgf000125_0001
Lactone Open-Acid
I II
In HMG-CoA reductase inhibitor's where an open-acid form can exist, salt and ester forms may preferably be formed from the open-acid, and all such forms are included within the meaning of the term "HMG-CoA reductase inhibitor" as used herein. Preferably, the HMG-CoA reductase inhibitor is selected from lovastatin and simvastatin, and most preferably simvastatin. Herein, the term "pharmaceutically acceptable salts" with respect to the HMG-CoA reductase inhibitor shall mean non- toxic salts of the compounds employed in this invention which are generally prepared by reacting the free acid with a suitable organic or inorganic base, particularly those formed from cations such as sodium, potassium, aluminum, calcium, lithium, magnesium, zinc and tetramethylammonium, as well as those salts formed from amines such as ammonia, ethylenediamine, N-methylglucamine, lysine, arginine, omithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine, diethanol- amine, procaine, N-benzylphenethylamine, l-p-chlorobenzyl-2-pyrrolidine-l '- yl-me hylbenzimidazole, diethylamine, piperazine, and tris(hydroxymethyl) aminomethane. Further examples of salt forms of HMG-CoA reductase inhibitors may include, but are not limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, calcium edetate, camsylate, carbonate, chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate, hexylresorcinate, hydrabamine, hydrobromide, hydrochloride, hydroxynapthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylsulfate, mucate, napsylate, nitrate, oleate, oxalate, pamaote, palmitate, panthothenate, phosphate/ diphosphate, polygalacturonate, salicylate, stearate, subacetate, succinate, tannate, tartrate, teoclate, tosylate, triethiodide, and valerate.
Ester derivatives of the described HMG-CoA reductase inhibitor compounds may act as prodrugs which, when absorbed into the bloodstream of a warm-blooded animal, may cleave in such a manner as to release the drug form and permit the drug to afford improved therapeutic efficacy.
Similarly, the instant compounds may be useful in combination with agents that are effective in the treatment and prevention of NF-1, restenosis, polycystic kidney disease, infections of hepatitis delta and related vimses and fungal infections.
If formulated as a fixed dose, such combination products employ the combinations of this invention within the dosage range described above and the other pharmaceutically active agent(s) within its approved dosage range. Combinations of the instant invention may alternatively be used sequentially with known pharmaceutically acceptable agent(s) when a multiple combination formulation is inappropriate.
The instant compounds may also be useful in combination with prodrugs of antineoplastic agents. In particular, the instant compounds may be co-administered either concurrently or sequentially with a conjugate (termed a "PSA conjugate") which comprises an oligopeptide, that is selectively cleaved by enzymatically active prostate specific antigen (PSA), and an antineoplastic agent. Such co-administration will be particularly useful in the treatment of prostate cancer or other cancers which are characterized by the presence of enzymatically active PSA in the immediate surrounding cancer cells, which is secreted by the cancer cells.
Compounds which are PSA conjugates and are therefore useful in such a co-administration, and methods of synthesis thereof, can be found in the following patents, pending patent applications and publications which are herein incoφorated by reference: U.S. Patent No. 5,599,686, granted on Feb. 4, 1997;
WO 96/00503 (January 11, 1996); USSN 08/404,833, filed on March 15, 1995; USSN 08/468,161, filed on June 6, 1995;
U.S. Patent No. 5,866,679, granted on February 2, 1999;
WO 98/10651 (March 19, 1998); USSN 08/926,412, filed on September 9, 1997;
WO 98/18493 (May 7, 1998); USSN 08/950,805, filed on October 14, 1997;
WO 99/02175 (January 21, 1999); USSN 09/112,656, filed on July 9, 1998; and
WO 99/28345 (June 10, 1999); USSN 09/193,365, filed on November 17, 1998.
Compounds which are described as prodrugs wherein the active therapeutic agent is released by the action of enzymatically active PSA and therefore may be useful in such a co-administration, and methods of synthesis thereof, can be found in the following patents, pending patent applications and publications, which are herein incoφorated by reference: WO 98/52966 (November 26, 1998).
All patents, publications and pending patent applications identified are herein incoφorated by reference.
The compounds of the instant invention are also useful as a component in an assay to rapidly determine the presence and quantity of farnesyl- protein transferase (FPTase) in a composition. Thus the composition to be tested may be divided and the two portions contacted with mixtures which comprise a known substrate of FPTase (for example a tetrapeptie having a cysteine at the amine terminus) and famesyl pyrophosphate and, in one of the mixtures, a compound of the instant invention. After the assay mixtures are incubated for an sufficient period of time, well known in the art, to allow the FPTase to famesylate the substrate, the chemical content of the assay mixtures may be determined by well known immunological, radiochemical or chromatographic techniques. Because the compounds of the instant invention are selective inhibitors of FPTase, absence or quantitative reduction of the amount of substrate in the assay mixture without the compound of the instant invention relative to the presence of the unchanged substrate in the assay containing the instant compound is indicative of the presence of FPTase in the composition to be tested.
It would be readily apparent to one of ordinary skill in the art that such an assay as described above would be useful in identifying tissue samples which contain famesyl-protein transferase and quantitating the enzyme. Thus, potent inhibitor compounds of the instant invention may be used in an active site titration assay to determine the quantity of enzyme in the sample. A series of samples composed of aliquots of a tissue extract containing an unknown amount of farnesyl- protein transferase, an excess amount of a known substrate of FPTase (for example a tetrapeptide having a cysteine at the amine terminus) and famesyl pyrophosphate are incubated for an appropriate period of time in the presence of varying concentrations of a compound of the instant invention. The concentration of a sufficiently potent inhibitor (i.e., one that has a Ki substantially smaller than the concentration of enzyme in the assay vessel) required to inhibit the enzymatic activity of the sample by 50% is approximately equal to half of the concentration of the enzyme in that particular sample.
EXAMPLES
Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof.
EXAMPLE 1
(R)-4-{5-[(2-Oxo-l-phenylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile hydrochloride
Step A: 4-(Hydroxymethyl)- 1 -(triphenylmefhyl)imidazole
To a solution of 4-(hydroxymethyl)imidazole hydrochloride (35.0 g, 260 mmol) in dry DMF (250 mL) at room temperature was added triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the solution. Chloro triphenyl- methane (76.1 g, 273 mmol) in DMF (500 mL) was added dropwise. The reaction mixture was stirred for 20 hrs, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid.
Step B: 4-( Acetoxymethyl)- 1 -(triphenylmethyl)imidazole
4-(Hydroxymethyl)-l-(triphenylmethyl)imidazole, as described in Step A above, (88.5 g, 260 mmol) was suspended in pyridine (500 mL). Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction was stirred for 48 hrs during which it became homogeneous. The solution was poured into EtOAc, washed sequentially with water, 5% aqueous HCl solution, saturated aqueous NaHCO3 solution, and brine. The organic extracts were dried (Na2SO4) and concentrated in vacuo to provide the ester as a white powder.
Step C: 5-(Acetoxymethyl)- 1 -(4-cyanobenzyl)imidazole hydrobromide
A solution of 4-(acetoxymethyl)-l-(triphenylmethyl) imidazole, as described in Step B above, (85.8 g, 225 mmol) and 4-cyanobenzyl bromide (50.1 g, 232 mmol) in EtOAc (500mL) was stirred at 60°C for 20 hrs, during which a pale yellow precipitate formed. The reaction was cooled to room temperature and filtered to provide the solid imidazohum bromide salt. The filtrate was concentrated in vacuo to a volume of 200 mL, reheated at 60°C for 2 hrs, cooled to room temperature, and filtered again. This filtrate was concentrated in vacuo to a volume of 100 mL, reheated at 60 °C for another 2 hrs, cooled to room temperature, and concentrated in vacuo to provide a pale yellow solid. All of the solid material was combined, dissolved in methanol (500mL), and warmed to 60°C. After 2 hrs, the solution was concentrated in vacuo to provide a white solid which was triturated with hexane to remove soluble materials. Removal of residual solvents in vacuo provided the titled product as a white solid.
Step D: l-(4-Cyanobenzyl)-5-(hydroxymethyl)imidazole
To a solution of 5-(acetoxymethyl)-l-(4-cyanobenzyl)-imidazole hydrobromide, as described in Step C above, (50.4 g, 150 mmol) in 3:1 THF/water (1.5 L) at 0°C was added lithium hydroxide monohydrate (18.9 g, 450 mmol). After 1 hr, the reaction was concentrated in vacuo, diluted with EtOAc (3 L), and washed with water, saturated aqueous NaHCO3 and brine. The solution was then dried (Na2SO4), filtered, and concentrated in vacuo to provide the crude product as a pale yellow fluffy solid.
Step E: l-(4-Cyanobenzyl)-5-imidazolecarboxaldehyde To a solution of l-(4-cyanobenzyl)-5-(hydroxymethyl) imidazole, as described above in Step D, (21.5 g, 101 mmol) in DMSO (500 mL) at room temperature was added triethylamine (56 mL, 402 mmol), then SO3-pyridine complex (40.5 g, 254 mmol). After 45 min, the reaction was poured into EtOAc (3 L), washed with water (4 x 800 mL), then brine (800 mL), dried (Na2SO4), and concentrated in vacuo to provide the aldehyde as a white powder.
Step F: (R)-2-(tert-Butoxycarbonylamino)-4-(methylmercapto)-
N-phenylbutyr amide
To (R)-N-(tert-butoxycarbonyl)methionine (589 mg, 2.36 mmol) in dry CH2C12 (5 mL) under argon were added PYBOP (1.23 g, 2.36 mmol), aniline (196 μL, 2.14 mmol), and N,N-diisopropylethylamine (655 μL, 3.76 mmol). The reaction mixture was stirred for 1 hr, then quenched with 10% citric acid (20 mL) and extracted with CH2C12 (2 x 20 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with hexane - 15% ethyl acetate to yield the product as a white solid.
Step G: (R)-2-(tert-Butoxycarbonylamino)-4-(dimethylsulfonium)-
N-phenylbutyramide iodide (R)-2-(tert-Butoxycarbonylamino)-4-(methylmercapto)-
N-phenylbutyramide, as described above in Step F, (650 mg, 2.00 mmol) was dissolved in iodomethane (3 mL, 48.0 mmol) and the solution was stirred under argon for 18 hrs. The iodomethane was removed by distillation under reduced pressure to give the sulfonium salt as a white solid.
Step H: (R)-3-(tert-Butoxycarbonylamino)-2-oxo- 1 -phenylpyrrolidine
(R)-2-(tert-Butoxycarbonylamino)-4-(dimethylsulfonium)-N- phenylbutyramide iodide, as described above in Step G, (930 mg, 2.0 mmol) was stirred in dry THF (40 mL), under argon, at 0°C and lithium bis(trimethylsilyl)amide (1.0 M in THF, 2.0 mL, 2.0 mmol) was added dropwise. The reaction mixture was stirred at 0°C for 2 h, then quenched with saturated aqueous NH4C1 (5 mL) and most of the THF was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (10 mL) and CH2C12 (20 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane -20% ethyl acetate to yield the above-titled pyrrolidinone as a white solid.
Step I: (R)-3 - Amino-2-oxo- 1 -phenylpyrrolidine hydrochloride
A solution of (R)-3-(tert-butoxycarbonylamino)-2-oxo-l -phenylpyrrolidine, as described above in Step H, (490 mg, 1.8 mmol) in EtOAc (40 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the above-titled amine hydrochloride as a pale solid.
Step J: (R)- 4- { 5 -[(2-Oxo- 1 -phenylpyrrolidin-3 -ylamino)methyl] imidazol-
1 -ylmethyljbenzonitrile hydrochloride
(R)-3-Amino-2-oxo-l -phenylpyrrolidine, as described above in Step I, (100 mg, 0.57 mmol), l-(4-cyanobenzyl)-5-imidazole-carboxaldehyde, as described above in Step E, (132 mg, 0.62 mmol), and acetic acid (98 μL, 1.71 mmol) were stirred in MeOH (2 mL) for 1 hr then NaCNBH3 (47 mg, 0.74 mmol) was added. Stirring was continued for 1 hr, then the reaction was quenched with saturated aqueous NaHCO3 (2 mL) and most of the MeOH was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (3 mL) and CH2C12 (5 mL). The aqueous layer was extracted further with CH2CI2 (2 x 5 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with CH2C12 - 2% MeOH - 0.2% NH4OH, to yield the desired product which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C22H2ιN5O»1.4 HC1O.85 H2O:
C: 60.35; H: 5.55; N: 16.00 Found: C: 60.39; H: 5.54; N: 15.90 FAB MS: 372 (MH+). EXAMPLE 1A
( -3-Amino-2-oxo-l-phenylpyrrolidine hydrochloride Following the procedures described in Example 1 , Steps F-I, but using S)-N-(tert-butoxycarbonyl)methionine in place of (R)-N-(tert-butoxycarbonyl) methionine in Step F, the above-title compound was obtained.
EXAMPLE IB
(R -3-Amino-l -benzyl-2-oxopyrrolidine hydrochloride
Following the procedures described in Example 1 , Steps F-I, but using benzylamine in place of aniline in Step F, the above-title compound was obtained.
EXAMPLE 1C
(S)-3- Amino- 1 -benzyl-2-oxopyrrolidine hydrochloride
Following the procedures described in Example 1, Steps F-I, but using benzylamine in place of aniline and (iS)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl) methionine in Step F, the above-title compound was obtained.
EXAMPLE ID
(R)- 1 -Benzyl-3-(tert-butoxycarbonylamino)-2-oxopyrrolidine
Following the procedures described in Example 1, Steps F-H, but using benzylamine in place of aniline in Step F, the above-title compound was obtained.
EXAMPLE IE
(S)- 1 -Benzyl-3-(tert-butoxycarbonylamino)-2-oxopyrrolidine
Following the procedures described in Example 1, Steps F-H, but using benzylamine in place of aniline and (S)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained. EXAMPLE IF
(R)-3-Amino-2-oxo-l-phenethylpyrrolidine hydrochloride Following the procedures described in Example 1, Steps F-I, but using phenethylamine in place of aniline in Step F, the above-title compound was obtained.
EXAMPLE 1G
( )-3-Amino-2-oxo-l-phenethylpyrrolidine hydrochloride
Following the procedures described in Example 1, Steps F-I, but using phenethylamine in place of aniline and (iS)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl) methionine in Step F, the above-title compound was obtained.
EXAMPLE IH
(R)-3-Amino- 1 -(3-chlorobenzyl)2-oxopyrrolidine hydrochloride
Following the procedures described in Example 1, Steps F-I, but using 3- chlorobenzylamine in place of aniline in Step F, the above-title compound was obtained.
EXAMPLE II
(5)-3-Amino-l-(3-chlorobenzyl)2-oxopyrrolidine hydrochloride Following the procedures described in Example 1, Steps F-I, but using
3 -chlorobenzylamine in place of aniline and (5)-N-(tert-butoxycarbonyl)methionine in place of (R)-N-(tert-butoxycarbonyl) methionine in Step F, the above-title compound was obtained.
EXAMPLE 2
(■S)-4-{5-[(2-Oxo-l-phenylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 1, but using (S)-N- (tert-butoxycarbonyl)methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H21N5O .7 HC1-1.7 H2O*0.2 EtOAc: C: 56.96; H: 5.79; N: 14.57 Found: C: 56.93; H: 5.67; N: 14.54
FAB MS: 372 (MH+).
EXAMPLE 3
(R)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 1 , but using benzylamine in place of aniline in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H23N5O'1.6 HC1-0.7 H2O»0.35 CH3CN: C: 60.46; H: 5.79; N: 15.92 Found: C: 60.40; H: 5.79; N: 15.91
FAB MS: 386 (MH+).
EXAMPLE 4
(1S)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 1 , but using benzylamine in place of aniline and (■S)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H23N5O»1.8 HOI.5 H2O: C: 57.77; H: 5.86; N: 14.69
Found: C: 57.77; H: 5.85; N: 14.77
FAB MS: 386 (MH+).
EXAMPLE 5 (R)-4-(5-{[l-(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyl)benzonitrile hydrochloride
Following the procedures described in Example 1, but using 2- chloroaniline in place of aniline in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H2oClN5O»2 HC1O.75 H2O»0.2 CH2C12:
C: 52.35; H: 4.73; N: 13.75 Found: C: 52.33; H: 4.73; N: 13.80
FAB MS: 406 (MH ).
EXAMPLE 6
(5 -4-(5-{[l-(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 1 , but using 2- chloroaniline in place of aniline and (<S)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H2oClΝ5O»2 HO 1.2 H2O»0.1 CH2C12: C: 52.15; H: 4.87; N: 13.76 Found: C: 52.15; H: 4.84; N: 13.93
FAB MS: 406 (MH+).
EXAMPLE 7
(.S)-4-(5-{[l-(3-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyl)benzonitrile hydrochloride
Following the procedures described in Example 1, but using 3-chloroaniline in place of aniline and (5)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H2oClΝ5O'2 HCKU5 EtOAc0.3 CH2C12: C: 53.14; H: 4.64; N: 13.53 Found: C: 53.11; H: 4.89; N: 13.60
FAB MS: 406 (MH+).
EXAMPLE 8
(R)-4-(5-{[l-(4-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyl)benzonitrile hydrochloride
Following the procedures described in Example 1 , but using 4- chloroaniline in place of aniline in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H2oClN5O*2 HCM.3 H2O:
C: 52.61; H: 4.94; N: 13.95 Found: C: 52.60; H: 4.76; N: 14.02
FAB MS: 406 (MH+).
EXAMPLE 9
(5)-4-(5-{[l-(4-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyl)benzonitrile hydrochloride Following the procedures described in Example 1 , but using 4- chloroaniline in place of aniline and S)-N-(tert-butoxycarbonyl) methionine in place of (R)-/V-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C22H2oClN5O'2 HCl* 1.05 H2O: C: 53.09; H: 4.88; N: 14.07 Found: C: 53.05; H: 4.69; N: 14.37
FAB MS: 406 (MH+).
EXAMPLE 10
(5)-4-(5-{[l-(2-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyl)benzonitrile hydrochloride
Following the procedures described in Example 1 , but using 2- chlorobenzylamine in place of aniline and (.S)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H22ClN5O»2 HCM 5 H2O»0.4 CH2C12: C: 53.07; H: 4.78; N: 13.32
Found: C: 53.09; H: 4.68; N: 13.30
FAB MS: 420 (MH+).
EXAMPLE 11
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 1, but using 3- chlorobenzylamine in place of aniline in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H22C1N50'2 HC1-0.55 H2O'0.3 CH2C12:
C: 52.98; H: 4.90; N: 13.26 Found: C: 52.97; H: 4.89; N: 13.32 FAB MS: 420 (MH+).
EXAMPLE 12
(S)-4-(5- { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 1, but using 3- chlorobenzylamine in place of aniline and (S)-.V-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H22C1Ν50'2 HC1O.65 H2O:
C: 54.75; H: 5.05; N: 13.88 Found: C: 54.75; H: 5.17; N: 14.00
FAB MS: 420 (MH+). EXAMPLE 13
(S)-4-(5-{[l-(4-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-
1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 1, but using 4- chlorobenzylamine in place of aniline and (5)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyljmethionine in Step F, the above-title compound was obtained.
Elemental analysis calculated for C23H22ClΝ5O»2 HC1-0.35 CHC13 »0.05 EtOAc: C: 52.47; H: 4.63; N: 12.99 Found: C: 52.39; H: 5.00; N: 13.32
FAB MS: 420 (MH+).
EXAMPLE 14
(R)-4-{5-[(2-Oxo-l-phenethylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 1, but using phenethylamine in place of aniline in Step F, the above-title compound was obtained.
Elemental analysis calculated for C24H25N5O*2 HC1-0.65 H2O:
C: 59.54; H: 5.89; N: 14.47 Found: C: 59.48; H: 6.04; N: 14.53 FAB MS: 400 (MH+).
EXAMPLE 15
(1S)-4-{5-[(2-Oxo-l-phenethylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 1, but using phenethylamine in place of aniline and (S)-N-(tert-butoxycarbonyl) methionine in place of (R)-N-(tert-butoxycarbonyljmethionine in Step F, the above-title compound was obtained. Elemental analysis calculated for C24H25N5O»2 HO0.85 H O:
C: 59.10; H: 5.93; N: 14.36 Found: C: 59.08; H: 5.85; N: 14.60
FAB MS: 400 (MH+).
EXAMPLE 16
(R)-2-[ 1 -(4-Cyanobenzyl)- lH-imidazol-5-yl]-N-(2-oxo- 1 -phenylpyrrolidin-3-yl) acetamide hydrochloride
Step A: Methyl(imidazol-4-yl)acetate hydrochloride
A solution of 4-imidazoleacetic acid hydrochloride (4.00 g, 24.6 mmol) in MeOΗ (100 mL) was saturated with ΗC1 (g). Trimethyl orthoformate (10 mL, 91 mmol) was added and the mixture was allowed to stand at ambient temperature for 18 hrs, then concentrated to dryness in vacuo to afford the titled ester as a white solid.
Step B: Methyl [l-(triphenylmethyl)-lH-imidazol-4-yl]acetate
To a solution of methyl (imidazol-4-yl)acetate hydrochloride, as described above in Step A, (4.30 g, 24.3 mmol) in dry DMF (50 mL) were added triethylamine (7.45 mL, 53.5 mmol), then triphenylmethyl bromide (8.64 g, 26.7 mmol). The mixture was stirred at ambient temperature for 18 hrs, then partitioned between Η2O (250 mL) and EtOAc (250 mL). The organic layer was dried over
Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica, eluting with ethyl acetate, to yield the product as a pale solid.
Step C: Methyl [1 -(4-cyanobenzyl)- lH-imidazol-5-yl]acetate hydrobromide
A mixture of methyl [1 -(triphenylmethyl)- lH-imidazol-4-yl] acetate, as described above in Step B, (3.33 g, 8.71 mmol) and 4-cyanobenzyl bromide (1.71 g, 8.71 mmol) in acetonitrile (30 mL) was heated to 50°C for 2 hrs. The mixture was allowed to cool, and the solid collected by filtration. The acetonitrile filtrate was concentrated in vacuo to a volume of approximately 10 mL and then reheated to 50°C for 2 hrs, cooled, and the solid removed by filtration. The two crops of precipitated imidazohum salts were combined in MeOΗ (100 mL) and the solution was heated to reflux for 30 min, then concentrated in vacuo to a volume of approximately 5 mL. EtOAc was added, and the titled product was crystallized and then collected by filtration.
Step D: Lithium [1 -(4-cyanobenzyl)- lH-imidazol-5-yl]acetate
Methyl [ 1 -(4-cyanobenzyl)- lH-imidazol-5-yl]acetate hydrobromide, as described above in Step C, (1.36 g, 4.05 mmol) was dissolved in TΗF (26 mL) and Η2O (4.5 mL). 1.0 N aqueous lithium hydroxide (4.45 mL, 4.45 mmol) was added and the resulting mixture was stirred at ambient temperature for 18 hrs, then adjusted to pH 7 with 1.0 N aqueous HCl and concentrated to dryness in vacuo to give the titled lithium salt.
Step E: (R)-2-[ 1 -(4-Cyanobenzyl)- lH-imidazol-5-yl ]-/V-(2-oxo- 1 - phenylpyrrolidin-3-yl)acetamide hydrochloride Lithium [1 -(4-cyanobenzyl)- lH-imidazol-5-yl]acetate, as described above in Step D, (93 mg, 0.37 mmol) was dissolved in CΗ2C12 (1 mL) and DMF (1 mL). PYBOP (195 mg, 0.37 mmol), (R)-3-amino-2-oxo-l -phenylpyrrolidine, as described in Example 1, Step I, (60 mg, 0.34 mmol), and diisopropyle hylamine (208 mL, 1.19 mmol) were added and the mixture was stirred at ambient temperature for 18 hrs. The solvents were removed under reduced pressure and the residue was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (5 mL). The aqueous layer was extracted further with CH2C1 (3 x 5 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with CH2C12 -8% MeOH - 0.5% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C23H21N5O2O.7 HCM.8 H2O: C: 60.39; H: 5.58; N: 15.31 Found: C: 60.41; H: 5.59; N: 15.62
FAB MS: 400 (MH+).
EXAMPLE 17
(1S)-2-[l-(4-Cyanobenzyl)-lH-imidazol-5-yl]-N-(2-oxo-l-phenylpyrrolidin-3-yl) acetamide hydrochloride
Following the procedures described in Example 16, but using (S)-3- amino-2-oxo-l -phenylpyrrolidine (as described in Example 1 A) in place of (R)-3- amino-2-oxo-l -phenylpyrrolidine in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C23H2iN5O2*1.3 HC1-2.5 H2O*0.25 EtOAc: C: 56.18; H: 5.74; N: 13.65
Found: C: 56.17; H: 5.89; N: 13.63
FAB MS: 400 (MH+).
EXAMPLE 18
(R)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl] acetamide hydrochloride Following the procedures described in Example 16, but using (R)-
3-amino-l-benzyl-2-oxopyrrolidine (as described in Example IB) in place of (R)-3- amino-2-oxo-l -phenylpyrrolidine in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C24Η23Νsθ2*0.6 ΗCIΗ2O: C: 63.58; H: 5.69; Ν: 15.45
Found: C: 63.61; H: 5.68; Ν: 15.40
FAB MS: 414 (MH+).
EXAMPLE 19
(5)-N-(l-Benzyl-2-oxopyπolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl] acetamide hydrochloride
Following the procedures described in Example 16, but using (S)-3- amino-l-benzyl-2-oxopyrrolidine (as described in Example 1C) in place of (R)-3- amino-2-oxo-l -phenylpyrrolidine in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C24Η23Ν5O2O.8 ΗCl*Η2θ:
C: 62.57; H: 5.65; Ν: 15.20 Found: C: 62.61; H: 5.66; Ν: 15.04 FAB MS: 414 (MH+). EXAMPLE 20
(R)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]-N- methylacetamide hydrochloride
Step A: (R)-l-Benzyl-3-[(tert-butoxycarbonyl)methylamino)-2-oxopyrrolidine
To a stirred solution of (R)-l-benzyl-3-(tert-butoxycarbonyl-amino)- 2-oxopyrrolidine (as described in Example ID) (200 mg, 0.69 mmol) in dry TΗF (3 mL) at 0°C was added lithium bis(trimethylsilyl) amide (1.0 M in TΗF, 0.69 mL, 0.69 mmol) dropwise. The resulting solution was stirred for 2 hrs at 0°C, then iodomethane (47 mL, 0.75 mmol) was added and stirring was continued at 0°C for 4 hrs. The reaction was quenched by addition of saturated aqueous ΝaΗCO3 (3 mL) and the mixture was extracted with EtOAc (2 x 5 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by semi-preparative HPLC using a Vydac C18 reversed phase column and eluting with a gradient of 95/5 to 0/100 A7B; A = H2θ-0.1% TFA, B =
CH3CN-0.1% TFA. The pure fractions were collected and extracted with CH2CI2 (15 mL), and the CH2CI2 layer was dried over MgSO4, filtered, and concentrated in vacuo to give the titled product as a colorless oil.
Step B: (R)- 1 -Benzyl-3-(methylamino)-2-oxopyrrolidine-hydrochloride
A solution of (R)-l-Benzyl-3-[N-(tert-butoxycarbonyl)-N- methylamino)-2-oxopyrrolidine, as described above in Step A, (100 mg, 0.33 mmol) in EtOAc (3 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the amine hydrochloride as a pale solid.
Step C: (R)-N-( 1 -Benzyl-2-oxopyrrolidin-3 -yl)-2- [ 1 -(4-cyanobenzyl)- 1 H- imidazol-5-yl]-N-methylacetamide hydrochloride
Lithium [l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetate, as described in Example 16, Step D, (116 mg, 0.47 mmol), (R)-l-benzyl-3-(mefhylamino)-2- oxopyrrolidine, as described above in Step B, (80 mg, 0.39 mmol), EDC (113 mg, 0.59 mmol), 1-hydroxybenzotriazole hydrate (80 mg, 0.59 mmol), and N,N- diisopropylethylamine (103 mL, 0.59 mmol) were combined in DMF (1 mL) and the mixture was stiπed at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was partitioned between saturated aqueous NaHCO3 (3 mL) and CH2C12 (3 mL). The aqueous layer was extracted further with CH2C12 (2 3 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 - 4% MeOH - 0.3% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C25H25N5O2*l A HCl'0.05 H2O: C: 62.86; H: 5.58; N: 14.66 Found: C: 62.88; H: 5.57; N: 14.41
FAB MS: 428 (MH+).
EXAMPLE 21
(5)-N-(l-Benzyl-2-oxopyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]-N- methylacetamide hydrochloride
Following the procedures described in Example 20, but using (S)-l- benzyl-3-(tert-butoxycarbonylamino)-2-oxopyrrolidine (as described in Example IE) in place of (R)-l-benzyl-3-(tert-butoxycarbonylamino)-2-oxopyrrolidine in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C25Η25N5θ2*1 3 HCl'0.7 H2O: C: 61.82; H: 5.74; N: 14.42
Found: C: 61.86; H: 5.73; N: 14.43
FAB MS: 428 (MH+).
EXAMPLE 22
(R)-4-{5-[(l-Benzylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl}-benzonitrile hydrochloride (R)-3-Amino-l-benzylpyrrolidine, (100 mg, 0.57 mmol), l-(4- cyanobenzyl)-5-imidazolecarbox-aldehyde, as described in Example 1, Step E, (126 mg, 0.60 mmol), and acetic acid (130 mL, 2.27 mmol) were stirred in MeOH (1 mL) for 1 hr then NaCNBH3 (43 mg, 0.68 mmol) was added. Stirring was continued for 1 hr, then the reaction was quenched with saturated aqueous NaHCO3 (2 mL) and most of the MeOH was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (3 mL) and CH2C12 (5 mL). The aqueous layer was extracted further with CH2C12 (2 x 5mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with CH2C12 -3% MeOH - 0.3% NH4OH, to yield the desired product which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C23H25N5*2 HO0.3 H O*0.7 EtOAc: C: 60.58; H: 6.54; N: 13.69 Found: C: 60.60; H: 6.24; N: 13.72
FAB MS: 372 (MH+).
EXAMPLE 23
(,S)-4-{5-[(l-Benzylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl}-benzonitrile hydrochloride
Following the procedures described in Example 22, but using (S)-3- amino-1-benzylpyrrolidine in place of (R)-3-amino-l-benzylpyrrolidine, the above- titled compound was obtained.
Elemental analysis calculated for C23H25N5 «1.5 HC1O.5 H2O*0.3 EtOAc:
C: 64.09; H: 6.45; N: 15.44 Found: C: 64.05; H: 6.33; N: 15.42
FAB MS: 372 (MH+). EXAMPLE 24
(iS)-4-(5 - { [Benzyl( 1 -benzyl-2-oxopyrrolidin-3 -yl)amino]methyl } imidazol- 1 -ylmethyl) benzonitrile hydrochloride (5)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl] imidazol-1- ylmefhyl}benzonitrile hydrochloride (as described in Example 4) (50 mg, 0.13 mmol), benzaldehyde (21 mg, 0.19 mmol), and acetic acid (30 mL, 0.52 mmol) were stirred in MeOH (0.5 mL) for 1 hr then NaCNBH3 (11 mg, 0.18 mmol) was added. Stirring was continued for 3 hrs, then the reaction was quenched with saturated aqueous NaHCO3 (1 mL) and most of the MeOH was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3
(2 mL) and EtOAc (2 mL). The aqueous layer was extracted further with EtOAc (2 x
2mL).
The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 - 2% MeOH - 0.2% NH4OH, to yield the desired product which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C3oH29NsO*1.6 HCl*H2θ: C: 65.28; H: 5.95; N: 12.69
Found: C: 65.34; H: 5.96; N: 12.65
FAB MS: 476 (MH+).
EXAMPLE 25
(iS)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)phenethylamino]methyl}imidazol-l- ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using phenylacetaldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C3iH3ιN5O*1.6 HCM.6 H2O:
C: 64.65; H: 6.25; N: 12.16 Found: C: 64.59; H: 6.25; N: 12.16 FAB MS: 490 (MH+). EXAMPLE 26
(1S)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(3-phenylpropyl)amino]-methyl}imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using 3-phenylpropionaldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C32H33N5O*1.4 HCl* 1.7 H2O: C: 65.86; H: 6.52; N: 12.00 Found: C: 65.91 ; H: 6.53; N: 11.93
FAB MS: 504 (MH+).
EXAMPLE 27
(S)-4-(5 - { [( 1 -Benzyl-2-oxopyrrolidin-3 -yl)(4-phenylbuty ljaminoj-methyl } imidazol-
1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using 4- phenylbutyraldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for 033^5^0*1.5 HCM.5 H2O: C: 66.02; H: 6.62; N: 11.67 Found: C: 65.98; H: 6.63; N: 11.69
FAB MS: 518 (MH+).
EXAMPLE 28
(R)-4-(5- {[(l-Benzyl-2-oxopyιτolidin-3-yl)propylamino]methyl} imidazol- 1- ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using propionaldehyde in place of benzaldehyde and (R)-4-{5-[(l-benzyl-2-oxopyrrolidin- 3-ylamino)methyl]imidazol-l-ylmethyl}benzonitrile hydrochloride (as described in Example 3) in place of (1S)-4-{5-[(l-benzyl-2-oxopyrrolidin-3-ylamino)methyl] imidazol- 1 -ylmethyljbenzonitrile, the above-titled compound was obtained.
Elemental analysis calculated for C26H29N5O*2 HCW3.65 H2O: C: 60.97; H: 6.36; N: 13.67 Found: C: 60.96; H: 6.35; N: 13.45
FAB MS: 428 (MH+).
EXAMPLE 29
(5)-4-(5-{[(l-Benzyl-2-oxopyffolidin-3-yl)propylamino]methyl}imidazol-l- ylmethyljbenzonitri le hydrochloride
Following the procedures described in Example 24, but using propionaldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C26H29N5O*2 HC1*0.55 H2O*0.25 EtOAc: C: 60.91; H: 6.46; N: 13.16 Found: C: 60.87; H: 6.30; N: 13.16
FAB MS: 428 (MH+).
EXAMPLE 30
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl}imidazol-l- ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using butyraldehyde in place of benzaldehyde and (R)-4- {5-[(l-benzyl-2-oxopyrrolidin- 3-ylamino)methyl]imidazol-l-ylmethyl}benzonitrile hydrochloride (as described in Example 3) in place of (5)-4-{5-[(l-benzyl-2-oxopyrrolidin-3-ylamino)methyl] imidazol-l-ylmethyl}benzonitrile, the above-titled compound was obtained.
Elemental analysis calculated for C27H3 ,N5O« 1.8 HC1*H2O*0.4 CH3CN: C: 61.64; H: 6.70; N: 13.97 Found: C: 61.62; H: 6.69; N: 13.96
FAB MS: 442 (MH+).
EXAMPLE 31 (5)-4-(5- { [( 1 -Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl} imidazol- 1 - ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using butyraldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C27H31N5O*2.5 HCl* 1.8 H2O*0.4 CH3CN:
C: 57.50; H: 6.63; N: 13.03 Found: C: 57.54; H: 6.33; N: 13.01 FAB MS: 442 (MH+).
EXAMPLE 32
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-2-ylmethylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using 2- pyridinecarboxaldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C29H28N6O*2.5 HCl'2.3 H2O*0.35 CH2C12: C: 55.25; H: 5.64; N: 13.17 Found: C: 55.25; H: 5.67; N: 12.91
FAB MS: 477 (MH+).
EXAMPLE 33
(5j-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-3-ylmethylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using 3- pyridinecarboxaldehyde in place of benzaldehyde, the above-titled compound was obtained. Elemental analysis calculated for C29H28N6O*2.5 HCl'0.55 H2O*0.55 CH2C12:
C: 56.84; H: 5.28; N: 13.46 Found: C: 56.83; H: 5.28; N: 13.20 FAB MS: 477 (MH+). EXAMPLE 34
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-4-ylmethylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 24, but using 4- pyridinecarboxaldehyde in place of benzaldehyde, the above-titled compound was obtained.
Elemental analysis calculated for C29H28N6O*2.5 HC1*1.3 H2O*0.45 CH2C12: C: 56.20; H: 5.45; N: 13.35 Found: C: 56.19; H: 5.44; N: 13.32
FAB MS: 477 (MH+).
EXAMPLE 35
(5j-4-(5-{[(3-Aminopropyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl}-imidazol- 1 -ylmethyljbenzonitrile hydrochloride _^_
Step A: 3-(tert-Butoxycarbonylamino)propionaldehyde
To a stirred solution of oxalyl chloride (0.32 mL, 3.7 mmol) in dry CH2C12 (5 mL) at -70°C, under argon, was added dry DMSO (0.53 mL, 7.5 mmol) dropwise. The resulting mixture was stirred at -70°C for 10 min, then a solution of 3-(tert-butoxycarbonylamino)propanol (500 mg, 2.85 mmol) in CH2C12 (3 mL) was added slowly. After stirring for an additional 15 min, triethylamine (2.0 mL, 14.3 mmol) was added and the mixture was allowed to warm to ambient temperature, then partitioned between hexane (20 mL) and H2O (30 mL). The organic phase was further washed with saturated aqueous NaHCO3 (20 mL) and then brine (20 mL), then dried over Na2SO , filtered, and concentrated in vacuo to obtain the cmde aldehyde.
Step B: (S -4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(3-{tert-butoxycarbonyl- amino}propyl)amino]methyl} imidazol- 1 -ylmethyljbenzonitrile (5)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl] imidazol- 1 - ylmethyljbenzonitrile hydrochloride (as described in Example 4) (90 mg, 0.23 mmol), 3-(tert-butoxycarbonylamino)propionaldehyde, as described above in Step A, (81 mg, 0.47 mmol), and acetic acid (27 mL, 0.47 mmol) were stirred in MeOH (1 mL) for 1 hr then NaCNBH3 (18 mg, 0.29 mmol) was added. Stirring was continued for 18 hrs, then most of the MeOH was removed under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (3 mL) and CH2C1 (5 mL). The aqueous layer was extracted further with CH2C1 (2 x 5 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 -2% MeOH - 0.2% NH4OH, to yield the desired product.
Step C: (iS)-4-(5-{[(3-Aminopropyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino] methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
A solution (5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(3-{tert- butoxycarbonylamino}propyl)amino]methyl} imidazol- l-ylmefhylj-benzonitrile, as described above in Step B, (15 mg, 0.028 mmol) in EtOAc (5 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the amine hydrochloride as a white solid.
Elemental analysis calculated for C26H30N6O*2.5 HC1-0.45 EtOAc*0.45 CH2C12: C: 55.48; H: 6.10; N: 13.74 Found: C: 55.33; H: 6.09; N: 13.79
FAB MS: 443 (MH+).
EXAMPLE 36
(5)-4-(5-{[(2-Aminoethyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl}-imidazol-
1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 35, but using 2-(tert- butoxycarbonylaminojethanol in place of 3-(tert-butoxycarbonylamino)propanol in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C25H28N6O*2.5 HCl* 1.8 H2O:
C: 54.38; H: 6.23; N: 15.22 Found: C: 54.39; H: 6.08; N: 14.93
FAB MS: 429 (MH+). EXAMPLE 37
(5)-4-(5- {[(4-Aminobutyl)(l -benzyl-2-oxopyrrolid ^ ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 35, but using 4-(tert- butoxycarbonylaminojbutanol in place of 3-(tert-butoxycarbonylamino)propanol in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C27H32N O*2.5 HC1*2.5 H2O: C: 54.78; H: 6.71; N: 14.20
Found: C: 54.79; H: 6.45; N: 14.35
FAB MS: 457 (MH+).
EXAMPLE 38
(R)-4-{5-[2-(l-Benzyl-2-oxopyrrolidin-3-ylamino)ethyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Step A: 4-[5-(2-Hydroxyethyl)imidazol-l-ylmethyl"|benzonitrile To a stirred solution of methyl [l-(4-cyanobenzyl)-lH-imidazol-5- yljacetate hydrobromide, as described in Example 16, Step C (1.44 g, 5.64 mmol) in methanol at 0°C was added sodium borohydride (0.96 g, 25.4 mmol) in one portion.
After 3 hrs, saturated aqueous NΗ4C1 (20 mL) was added, followed by saturated aqueous NaHCO3 (20 mL), and the mixture was extracted with EtOAc (3 x 75 mL). The combined organic extracts were dried over MgSO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 - 5% MeOH, to yield the desired product.
Step B: Methanesulfonic acid 2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]ethyl ester
A solution of 4-[5-(2-hydroxyefhyl)imidazol- 1 -ylmethylj-benzonitrile, as described above in Step A, (250 mg, 1.10 mmol) in dry CΗ2C12 (35 mL) at 0°C, under argon, was treated with N,/V-diisopropylethylamine (233 mL, 1.34 mmol) followed by methanesulfonyl chloride (103 mL, 1.33 mmol). The reaction mixture was stirred at 0°C for 3 hrs, then quenched with saturated aqueous NaHCO3 (25 mL) and extracted with CH2C12 (3 x 15 mL). The combined organic extracts were dried over MgSO , filtered, and concentrated in vacuo to give the mesylate as a thick yellow oil.
Step C: (^H-IS-^ l-Benzyl^-oxopyrrolidin-S-ylaminojefhyl]- imidazol- 1 -ylmethyl}benzonitrile hydrochloride
Methanesulfonic acid 2-[l -(4-cyanobenzyl)-lH-imidazol-5-yl]ethyl ester, as described above in Step B, (173 mg, 0.57 mmol), (R)-3-amino-l-benzyl- 2-oxopyrrolidine hydrochloride (as described in Example IB) (80 mg, 0.42 mmol), sodium iodide (126 mg, 0.84 mmol), and N,N-diisopropylethylamine (110 mL,
0.63 mmol) were combined in dry, degassed DMF (2 mL) and heated to 50°C, under argon, for 18 hrs. The reaction was quenched with saturated aqueous ΝaΗCO3 (2 mL) and then concentrated under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2CI2 (5 mL). The aqueous layer was extracted further with CH2C12 (3 x 5 mL). The combined organic extracts were dried over MgSO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CHC13 - 3% to 4% MeOH - 0.4% NH4OH, to yield the desired product which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C24H25N5O*2.5 HCl'0.65 CH3CN*0.85 PhCH3:
C: 62.29; H: 6.06; N: 13.14 Found: C: 62.23; H: 6.05; N: 13.16
FAB MS: 400 (MH+).
EXAMPLE 39
(5 -4-{5-[2-(l-Benzyl-2-oxopyrrolidin-3-ylamino)ethyl]imidazol-l-ylmethyl} benzonitrile hydrochloride Following the procedures described in Example 38, but using (S)-
3-amino-l-benzyl-2-oxopyrrolidine hydrochloride (as described in Example 1C) in place of (R)-3 -amino- l-benzyl-2-oxopyrrolidine hydrochloride in Step C, the above-titled compound was obtained.
Elemental analysis calculated for C24H25N5O*2.5 HC1-0.2 H2O*0.35 Et2O: C: 58.64; H: 6.08; N: 13.46 Found: C: 58.67; H: 6.08; N: 13.45
FAB MS: 400 (MH+).
EXAMPLE 40
(R)-4-{5-[2-(2-Oxo-l-phenylpyrrolidin-3-ylamino)ethyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 38, but using (R)-3- amino-2-oxo-l -phenylpyrrolidine hydrochloride (as described in Example 1, Step I) in place of (R)-3 -amino- 1 -benzyl-2-oxopyrrolidine hydrochloride in Step C, the above-title compound was obtained.
Elemental analysis calculated for C23H23N5O*2.3 HC1-0.85 H2O: C: 57.00; H: 5.62; N: 14.45
Found: C: 56.93; H: 5.62; N: 14.45
FAB MS: 386 (MH+).
EXAMPLE 41
(5)-4-{5-[2-(2-Oxo-l-phenylpyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 38, but using (S)- 3-amino-2-oxo-l -phenylpyrrolidine hydrochloride (as described in Example 1A) in place of (R)-3 -amino- l-benzyl-2-oxopyrrolidine hydrochloride in Step C, the above-title compound was obtained.
Elemental analysis calculated for 023^3^0*2.5 HCl* 1.2 H2O: C: 56.90; H: 5.72; N: 14.43 Found: C: 56.94; H: 5.72; N: 14.12
FAB MS: 386 (MH+).
EXAMPLE 42 (R)-4- { 5 -[2-(2-Oxo- 1 -phenethylpyrrolidin-3 -ylamino)ethyl] imidazol- 1 - ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 38, but using (R)-3- amino-2-oxo-l-phenethylpyrrolidine hydrochloride (as described in Example IF) in place of (R)-3-amino-l-benzyl-2-oxopyrrolidine hydrochloride in Step C, the above- title compound was obtained.
Elemental analysis calculated for C25H27N5O*2 HCl* 1.5 H2O*0.25 CH2C12: C: 56.71 ; H: 6.13; N: 13.10 Found: C: 56.68; H: 6.09; N: 13.12
FAB MS: 414 (MH+).
EXAMPLE 43
(5)-4-{5-[2-(2-Oxo-l-phenethylpyrrolidin-3-ylamino)ethyl]imidazol-l- ylmethyl}benzonitrile hydrochloride
Following the procedures described in Example 38, but using (S)-3- amino-2-oxo-l-phenethylpyrrolidine hydrochloride (as described in Example IG) in place of (R)-3 -amino- l-benzyl-2-oxopyrrolidine hydrochloride in Step C, the above- title compound was obtained.
Elemental analysis calculated for C25H27N5O*2 HC1-0.05 H2O*0.15 CHC13:
C: 59.78; H: 5.84; N: 13.86 Found: C: 59.83; H: 5.63; N: 13.75 FAB MS: 414 (MH+).
EXAMPLE 44
(S)-4-(5 - { [ 1 -(Naphthalene- 1 -carbony l)pyrrolidin-3 -ylaminojmethyl} -imidazol- 1 - ylmethyljbenzonitrile hydrochloride
Step A: (5)-l-(tert-Butoxycarbonyl)-3-(trifluoroacetamido)pyrrolidine
To a stirred solution of (S)-3-(trifluoroacetamido)pyrrolidine hydrochloride (2.08 g, 9.5 mmol) and /V,/V-diisopropylefhylamine (1.82 mL, 10.5 mmol) in CH2C12 (25 mL) was added di-tert-butyl dicarbonate (2.08 g, 9.5 mmol) in CH2C12 (25 mL). The reaction mixture was stirred at ambient temperature for 2 hrs, then partitioned between saturated aqueous Na2CO3 (30 mL) and CH2C12 (50 mL). The aqueous layer was extracted further with CH2C12 (50 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo to give the titled product.
Step B: (5)-3-Amino-l-(tert-butoxycarbonyl)pyπolidine
To a stirred solution of (5)-l-(tert-butoxycarbonyl)-3- (trifluoroacetamido)pyrrolidine, as described above in Step A, (2.80 g, 9.5 mmol) in THF (80 mL) and H2O (10 mL) was added 1.0 N aqueous lithium hydroxide (10.5 mL, 10.5 mmol) and the resulting mixture was stirred at ambient temperature for 18 hrs, then adjusted to pH 7 with 1.0 N aqueous HCl and concentrated to dryness in vacuo to give the titled compound.
Step C: (S)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]-amino} pyrrolidine- 1 -carboxylic acid tert-butyl ester
(<S)-3-Amino-l-(tert-butoxycarbonyl)pyrrolidine, as described above in from Step B, (1.18 g, 6.34 mmol), l-(4-cyanobenzyl)-5-imidazolecarboxaldehyde, as described in Example 1, Step E, (1.41 g, 6.68 mmol), and acetic acid (0.363 mL, 6.34 mmol) were stirred in MeOΗ (35 mL) for 30 min then NaCNBΗ3 (0.44 g, 7.00 mmol) was added. Stirring was continued for 18 hrs, then the reaction was quenched with 10% aqueous citric acid (5 mL), followed by saturated aqueous Na2CO3 (50 mL) and the mixture was extracted with CH2C12 (2 x 100 mL). The combined organic extracts were dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 -1% to 7% MeOH - 0.5% NH4OH, to yield the desired product as a white solid.
Step D: (5)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]-amino} pyrrolidine hydrochloride A solution of (5)-3-{[l-(4-cyanobenzyl)-lH-imidazol-5-ylmethyl] amino} pyrrolidine- 1 -carboxylic acid tert-butyl ester, as described above in Step C, (1.92 g, 5.03 mmol) in EtOAc (100 mL) at 0°C was saturated with ΗC1 (g). After 15 min, the mixture was concentrated in vacuo to yield the amine hydrochloride as a white solid. Step E: (S)-4-(5 - { [ 1 -(Naphthalene- 1 -carbonyl)pyrrolidin-3 -ylamino] methyl}imidazol-l -ylmethyljbenzonitrile hydrochloride
(iS)-3 - { [ 1 -(4-Cyanobenzylj- 1 H-imidazol-5 -ylmethylj-aminoj pyrrolidine hydrochloride, as described above in Step D, (40 mg, 0.143 mmol), 1-naphthoic acid (27 mg, 0.157 mmol), EDC (30 mg, 0.157 mmol), 1 -hydroxybenzo- triazole hydrate (21 mg, 0.157 mmol), and N,N-diisopropylethylamine (27 μL, 0.157 mmol) were combined in DMF (0.5 mL) and the mixture was stirred at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was partitioned between 10% aqueous citric acid (1 mL) and CΗC13 (2 mL). The organic layer was discarded, and the aqueous layer was basified by addition of saturated aqueous Νa2CO3 (1.4 mL) then extracted with CHC13 (2 x 2 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 - 3% MeOH - 0.3% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C27H25N5O*2.4 HCl'2.3 H2O:
C: 57.72; H: 5.72; N: 12.47 Found: C: 57.73; H: 5.72; N: 12.37 FAB MS: 436 (MH+).
EXAMPLE 45
(R)-4-(5- {[ 1 -(Naphthalene- 1 -carbonyl)pyrrolidin-3 -ylaminojmethyl} -imidazol- 1 - ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using (R)-3- (trifluoroacetamidojpyrrolidine hydrochloride
Figure imgf000156_0001
pyrrolidine hydrochloride in Step A, the above-title compound was obtained.
Elemental analysis calculated for C27H25N5O*2.1 HCl* 1.1 H2O: C: 61.28; H: 5.55; N: 13.24 Found: C: 61.29; H: 5.54; N: 13.41
FAB MS: 436 (MH+). EXAMPLE 46
(S)-4-(5 - { [ 1 -(Naphthalene-2-carbonyl)pyrrolidin-3 -ylaminojmethyl } -imidazol- 1 - ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 44, but using 2- naphthoic acid in place of 1-naphthoic acid in Step E, the above-title compound was obtained.
Elemental analysis calculated for C27H25N5O*2 HCl* 1.1 H2O: C: 61.70; H: 5.57; N: 13.33
Found: C: 61.69; H: 5.57; N: 13.69
FAB MS: 436 (MH+).
EXAMPLE 47
(1S)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} - benzonitrile trifluoroacetate
Following the procedures described in Example 44, but using benzoic acid in place of 1-naphthoic acid in Step E, the above-title compound was obtained. The product was purified by semi-preparative HPLC using a Vydac CI 8 reversed phase column and eluting with a gradient of 95/5 to 0/100 A/B; A = H2O-0.1% TFA, B = CH3CN-0.1% TFA.
Elemental analysis calculated for 023^3^0*2.5 TFA*1.2 H2O: C: 48.65; H: 4.05; N: 10.13
Found: C: 48.68; H: 4.07; N: 9.86
FAB MS: 386 (MH+).
EXAMPLE 48
(1S)-N-(l-Benzoylpyrrolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetamide hydrochloride
Step A: (iS)-l-Benzoyl-3-(tert-butoxycarbonylamino)pyrrolidine To benzoic acid (90 mg, 0.74 mmol) in dry CΗ2C12 (3 mL) under argon were added PYBOP (384 mg, 0.74 mmol), (5)-3-(tert-butoxycarbonylamino) pyrrolidine (125 mg, 0.67 mmol), and N,N-diisopropylethylamine (205 mL, 1.18 mmol). The reaction mixture was stiπed for 18 hrs, then quenched with saturated aqueous NaHCO3 (5 mL) and extracted with CH2C12 (3 x 3mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane - 50% ethyl acetate to yield the product as a white solid.
Step B: (■S)-3-Amino-l -benzoylpyrrolidine hydrochloride A solution of (S)- 1 -benzoyl-3-(tert-butoxycarbonylamino)pyrrolidine, as described above in Step A, (194 g, 0.67 mmol) in EtOAc (10 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the amine hydrochloride as a white solid.
Step C: (S)-N-( 1 -Benzoylpyrrolidin-3-yl)-2-[ 1 -(4-cyanobenzyl)- lH-imidazol-
5-ylJacetamide hydrochloride
(S)-3 -Amino- 1 -benzoylpyrrolidine hydrochloride, as described above in Step B, (30 mg, 0.16 mmol), lithium [1 -(4-cyanobenzyl)- lH-imidazol-5-ylJacetate, as described in Example 16, Step D, (43 mg, 0.17 mmol), EDC (36 mg, 0.19 mmol), 1-hydroxybenzotriazole hydrate (26 mg, 0.19 mmol), and NN-diisopropylethylamine (61 μL, 0.35 mmol) were combined in DMF (0.5 mL) and the mixture was stirred at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was partitioned between saturated aqueous NaΗCO3 (3 mL) and CH2C12 (3 mL). The aqueous layer was extracted further with CH2C12 (2 x 3 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with CH2C12 - 5% MeOH - 0.5% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with aqueous HCl in acetonitrile.
Elemental analysis calculated for C24H23N5O2*1.5 HCl* 1.1 H2O: C: 59.18; H: 5.50; N: 14.38 Found: C: 59.16; H: 5.51; N: 14.35
FAB MS: 414 (MH+). EXAMPLE 49
(S)-2-[ 1 -(4-Cyanobenzyl)- lH-imidazol-5-yl]-/V-[ 1 -(naphthalene- 1 -carbonyl)- pyrrolidin-3 -yl] acetamide hydrochloride Following the procedures described in Example 48, but using 1- naphthoic acid in place of benzoic acid in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C28Η25N5θ2*1.5 HCl: C: 64.89; H: 5.15; N: 13.51
Found: C: 64.87; H: 5.13; N: 13.61
FAB MS: 464 (MH+).
EXAMPLE 50
(S)-4-(5-{[l-(3-Chlorobenzoyl)pyrrolidin-3-ylamino]methyl}imidazol-l-ylmethyl) benzonitrile hydrochloride
Following the procedures described in Example 44, but using 3- chlorobenzoic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C23H22ClN5O*2.2 HCl* 1.1 H2O*0.5 CH3CN:
C: 53.33; H: 5.20; N: 14.25 Found: C: 53.36; H: 5.08; N: 14.25 FAB MS: 420 (MH+).
EXAMPLE 51
(R)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl} -benzonitrile hydrochloride
Following the procedures described in Example 44, but using (R)-3-
(trifluoroacetamido)pyrrolidine hydrochloride in place of (5)-3-(trifluoroacetamido) pyrrolidine hydrochloride in Step A, and benzoic acid in place of 1-naphthoic acid in
Step E, the above-titled compound was obtained. Elemental analysis calculated for C23H23N5O*2.1 HC1-0.9 H2O: C: 57.98; H: 5.68; N: 14.70
Found: C: 57.95; H: 5.67; N: 14.78
FAB MS: 386 (MH+).
EXAMPLE 52
(S)-4-(5 - { [ 1 -(2-Chlorobenzoyl)pyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 44, but using 2- chlorobenzoic acid in place of 1 -naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C23H22ClN5O*3 HC1*0.65 H2O*0.2 Et2O: C: 54.93; H: 5.48; N: 13.46
Found: C: 54.90; H: 5.31; N: 13.42
FAB MS: 420 (MH+).
EXAMPLE 53
(5)-4-(5-{[l-(2-Methylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl}-imidazol-
1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using 2- methylnicotinic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C23H24N6O*3 HCl'0.45 H O*0.6 THF:
C: 54.35; H: 5.87; N: 14.98 Found: C: 54.40; H: 5.84; N: 14.94 FAB MS: 401 (MH+).
EXAMPLE 54
(5)-4-(5-{[l-(Isoquinoline-4-carbonyl)p τrolidin-3-ylamino]methyl}-imidazol-l- ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 44, but using 4- isoquinolinecarboxylic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C26H24N6O*2.5 HCM.6 H2O: C: 56.20; H: 5.40; N: 15.13 Found: C: 56.17; H: 5.40; N: 14.93
FAB MS: 437 (MH+).
EXAMPLE 55
(5)-4-(5-{[l-(5-Bromopyridine-3-carbonyl)pyπOlidin-3-ylamino]methylj-imidazol-l- ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using 5- bromonicotinic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C22H2iBrN6O*3 HCl'0.9 H2O*0.5 PhCH3: C: 48.08; H: 4.72; N: 13.19 Found: C: 48.09; H: 4.48; N: 13.18
FAB MS: 465 (MH+).
EXAMPLE 56
(5)-4-(5-{[l-(2-Methylthiopyridine-3-carbonyl)pyrrolidin-3-ylamino]-methylj imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using 2- (methylthiojnicotinic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C23H24N6OS*3 HC1-0.45 H2O*0.35 PhCH3:
C: 52.49; H: 5.31; N: 14.43 Found: C: 52.51; H: 5.15; N: 14.33
FAB MS: 433 (MH+). EXAMPLE 57
4-(5-{[(3iS)-l-(2-Ethylthiopyridine-3-carbonyl)pyrrolidin-3-ylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 44, but using 2-
(ethylthiojnicotinic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C24H26N6OS*2.4 HCl* 1.9 H2O: C: 50.80; H: 5.70; N: 14.81
Found: C: 50.82; H: 5.71; N: 14.88
FAB MS: 447 (MH+).
EXAMPLE 58
4-(5-{[(3iS)-l-(tran5-Cotinine-4-carbonyl)pyrrolidin-3-ylamino]methyl}-imidazol-
1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using trans- 4-cotininecarboxylic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C27H29N7O2*2.5 HCM.6 H2O*0.5 CH3CN:
C: 54.75; H: 5.88; N: 16.51 Found: C: 54.77; H: 6.15; N: 16.51 FAB MS: 484 (MH+).
EXAMPLE 59
(£)-4-(5-{[l-(Biphenyl-2-carbonyl)pynolidin-3-ylamino]methyl}imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using biphenyl-2-carboxylic acid in place of 1 -naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C29H27N5OΗO2.1 H2O: C: 63.11 ; H: 5.88; N: 12.69 Found: C: 63.12; H: 5.88; N: 12.92
FAB MS: 462 (MH+).
EXAMPLE 60
(S)-4-(5- {[ 1 -(Adamantan- 1 -ylacetyl)pyπolidin-3-ylamino]methyl} - imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 44, but using 1- adamantylacetic acid in place of 1-naphthoic acid in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C28H35N5O*2 HCl'0.9 H2O*0.2 EtOAc: C: 61.29; H: 7.22; N: 12.41 Found: C: 61.34; H: 7.16; N: 12.39
FAB MS: 458 (MH+).
EXAMPLES 61-126
Table 1 : Examples 61 -126
Following the procedures described in Example 44, but using the appropriate carboxylic acid in place of 1-naphthoic acid in Step E, the following compound were obtained. The cmde products from corresponding Step E were not purified on silica gel.
Figure imgf000164_0001
EXAMPLE R FAB MS (MH +, )
Figure imgf000164_0002
Figure imgf000165_0001
Figure imgf000166_0001
Figure imgf000167_0001
Figure imgf000168_0001
88 387
Figure imgf000168_0002
Figure imgf000169_0001
Figure imgf000170_0001
102 401
<o
Figure imgf000170_0002
Figure imgf000171_0001
Figure imgf000172_0001
Figure imgf000173_0001
EXAMPLE 127
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)-2-phenoxybenzonitrile hydrochloride
Step A: 4-(Hydroxymethylj- 1 -(triphenylmethyljimidazole
To a solution of 4-(hydroxymethyl)imidazole hydrochloride (35.0 g, 260 mmol) in dry DMF (250 mL) at room temperature was added triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the solution. Chlorotriphenyl- methane (76.1 g, 273 mmol) in DMF (500 mL) was added dropwise. The reaction mixture was stirred for 20 hrs, poured over ice, filtered, and washed with ice water. The resulting product was slurried with cold dioxane, filtered, and dried in vacuo to provide the titled product as a white solid. Step B: 4-(Acetoxymethyl)-l-(triphenylmethyl)imidazole
4-(Hydroxymethylj-l-(triphenylmethyl)imidazole, as described above in Step A, (88.5 g, 260 mmol) was suspended in pyridine (500 mL). Acetic anhydride (74 mL, 780 mmol) was added dropwise, and the reaction was stirred for 48 hrs during which it became homogeneous. The solution was poured into EtOAc, washed sequentially with water, 5% aqueous HCl solution, saturated aqueous NaHCO3 solution, and brine. The organic extracts were dried (Na2SO ), and concentrated in vacuo to provide the ester as a white powder.
Step C: 4-Cyano-3-fluorotoluene
To a deoxygenated solution of 4-bromo-3 -fluoro toluene (25.0 g, 132 mmol) in DMF (500 mL) was added Zn(CN)2 (10.1 g, 86 mmol) and Pd(PPh3)4 (15 g, 13 mmol). The reaction was stirred at 100°C for 18 hrs, then cooled to room temperature. The solution was poured into toluene (1 L), washed with 30% aqueous NH4OH (2 x 1 L), then brine (800 mL), then dried (Na2SO4), filtered, and concentrated in vacuo to provide the crude product. Purification by silica gel chromatography, eluting with a gradient of hexane -0% to 7% EtOAc, to yield the titled product.
Step D: 4-Cyano-3-fluorobenzylbromide
To a solution of 4-cyano-3-fluorotoluene, as described above in Step C, (5.0 g, 37.0 mmol) in carbon tetrachloride (300 mL) was added N-bromosuccini- mide (7.57 g, 42.6 mmol) and 2,2'-azobisisobutyronitrile (610 mg, 3.7 mmol). The reaction mixture was heated to reflux under argon for 24 hrs, then cooled to room temperature, filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluting with a gradient of hexane -4% to 7% EtOAc, to yield the titled product as a yellow solid.
Step E: 5-(Acetoxymethyl)-l-(4-cyano-3-fluorobenzyl)imidazole hydrobromide
A mixture of 4-(acetoxymethyl)-l -(triphenylmethyl) imidazole, as describe aboved in Step B, (19.7 g, 51.4 mmol) and 4-cyano-3-fluorobenzylbromide, as described above in Step D, (11.0 g, 51.4 mmol) in dry CH3CN (140 mL) was stiπed at 50°C for 3 hrs, during which a white precipitate formed. The reaction was cooled to room temperature and filtered to provide the solid imidazohum bromide salt. The filtrate was concentrated in vacuo to a volume of 70 mL, reheated at 50°C for 2 hrs, cooled to room temperature, and filtered again. The solid material was combined and dissolved in MeOH (500 mL), and the solution was heated to reflux for 2 hrs. The solution was concentrated in vacuo to a volume of 20 mL, then cold hexane - EtOAc (1 :1, 500 mL) was added and the white precipitate was collected and dried in vacuo to obtain the titled compound.
Step F: l-(4-Cyano-3-fluorobenzyl)-5-(hydroxymethyl)imidazole To a solution of 5 -(acetoxymethyl)- 1 -(4-cyano-3 -fluorobenzyl) imidazole hydrobromide, as described above in Step E, (19.8 g, 72.5 mmol) in 5:1 THF/water (430 mL) at ambient temperature was added lithium hydroxide monohydrate (3.33 g, 79.4 mmol). After 4 hrs, the solution was adjusted to pH 7 with 1.0 N hydrochloric acid and concentrated in vacuo. The residue was concentrated from toluene in vacuo (3 x 100 mL) to give the titled product as a pale solid.
Step G: l -(4-Cyano-3-fluorobenzyl)-5-imidazolecarboxaldehyde
To a solution of l-(4-cyano-3-fluorobenzyl)-5-(hydroxymethyl) imidazole, as described above in Step F, (2.31 g, 10.0 mmol) in DMSO (20 mL) at 0°C was added triethylamine (5.6 mL, 40 mmol), then SO3-pyridine complex (3.89 g, 25 mmol). After 30 minutes, the reaction was poured into EtOAc (400 mL), washed with water (4 x 50 mL), then brine (50 mL), dried (Na2SO4), filtered, and concentrated in vacuo to provide the aldehyde as a pale yellow powder.
Step H: (S)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]- methyl} imidazol- 1 -ylmethyl)-2-fluorobenzonitrile
(S)-3 -Amino- 1 -(3 -chlorobenzyl)-2-oxopyπolidine hydrochloride (as described in Example II) (74 mg, 0.28 mmol) and l-(4-cyano-3-fluorobenzyl)- 5-imidazolecarboxaldehyde, as described above in Step G, (68 mg, 0.30 mmol), were stirred in MeOH (1 mL) and N,N-diisopropylethylamine was added dropwise to adjust the mixture to ca. pH 5, as judged by wetted pH paper. The mixture was stirred for 1 hr at ambient temperature then ΝaCΝBH3 (21 mg, 0.33 mmol) was added, AcOH was added to adjust the mixture to about pH 5, and stirring was continued for 18 hrs. The reaction mixture was concentrated under reduced pressure, and the residual solution was partitioned between saturated aqueous NaHCO3 (1 mL) and CH2C12 (3 mL). The aqueous layer was extracted further with CH2C12 (2 x 3 mL). The combined organic extracts were dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 0% to 5% MeOH - 0% to 0.5% NH4OH to yield the titled product as a colorless oil.
Step I: (S)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylaminoJ- methyljimidazol-l-ylmethyl)-2-phenoxybenzonitrile hydrochloride A mixture of (5)-4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3- ylaminojmethyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile, as described above in Step H, (29 mg, 0.066 mmol), phenol (7.5 mg, 0.079 mmol) and Cs2CO3 (42 mg, 0.129 mmol) in dry, degassed DMF (1 mL) was stirred at 40°C under argon for 6 hrs. The reaction mixture was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (10 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CHC13 - 0% to 3% MeOH - 0% to 0.3% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C29H26ClN5O2*2 HC1-0.4 H2O*0.15 EtOAc:
C: 58.72; H: 5.00; N: 11.57 Found: C: 58.70; H: 4.82; N: 11.54 FAB MS: 512 (MH+).
EXAMPLE 128
(S)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl} imidazol- 1 - ylmethyl)-2-phenethyloxybenzonitrile hydrochloride
To a suspension of potassium tert-butoxide (98 mg, 0.87 mmol) in dry THF (10 mL), under argon, at 0°C was added phenethyl alcohol (106 mg, 0.87 mmol). The mixture was stirred for 30 min at 0°C, then a 1 mL aliquot was added dropwise to a solution of (5)-4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3- ylaminojmethyl } imidazol- l-ylmethyl)-2-fluorobenzonitrile, as described in Example 127, Step H, (38 mg, 0.087 mmol) in dry THF (2 mL) at -78°C. The reaction mixture was stirred at -78°C for 2 hrs, then partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (10 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CHC13 - 1% to 3% MeOH - 0.1% to 0.3% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C31H3oClN5O2*2 HCl* 1.1 H2O: C: 58.83; H: 5.45; N: 11.07 Found: C: 58.83; H: 5.07; N: 11.02
FAB MS: 540 (MH+).
EXAMPLE 129
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylaminoJmethy l-ylmethyl)-2-phenoxybenzonitrile hydrochloride
Following the procedures described in Example 127, but using (R)-3- amino- l-(3-chlorobenzyl)-2-oxopyrrolidine hydrochloride (as described in Example IH) in place of (5)-3-amino-l-(3-chlorobenzyl)-2-oxopyrrolidine hydrochloride in Step H, the above-titled compound was obtained.
Elemental analysis calculated for C29H26ClN5O2*2 HCl'0.75 H2O*0.2 EtOAc: C: 58.09; H: 5.09; N: 11.37
Found: C: 58.11; H: 5.14; N: 11.36
FAB MS: 512 (MH+).
EXAMPLE 130
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylaminoJmethyl}imidazol-l- ylmethyl)-2-phenethyloxybenzonitrile hydrochloride
Following the procedures described in Example 128, but using (R)- 4- (5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} imidazol- l-ylmethyl)-2- fluorobenzonitrile [prepared as described in Example 127, Steps A-H, but using (R)- 3-amino-l-(3-chlorobenzyl)-2-oxopyπolidine hydrochloride (as described in Example IH) instead of (<S)-3-amino-l-(3-chlorobenzyl)-2-oxopyπolidine hydrochloride in Step H] in place of (5)-4-(5-{[l-(3-chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile, the above-titled compound was obtained.
Elemental analysis calculated for C3iH3oClN5O2*2 HCl-0.1 H2O*0.3 CH2C12:
C: 58.71; H: 5.16; N: 10.94 Found: C: 58.66; H: 4.88; N: 11.12
FAB MS: 540 (MH+).
EXAMPLE 131
(<S)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-ylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 128, but using benzyl alcohol in place of phenethyl alcohol, the above-titled compound was obtained.
Elemental analysis calculated for C30H28C1N5O2*2 HC1*0.25 CH2C12*0.1 EtOAc: C: 58.52; H: 5.02; N: 11.13 Found: C: 58.47; H: 5.00; N: 11.11
FAB MS: 526 (MH+).
EXAMPLE 132
(R)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyπolidin-3-ylamino]-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 128, but using benzyl alcohol in place of phenethyl alcohol, and (Rj- 4-(5-{[l-(3-chlorobenzyl)-2- oxopyrrolidin-3 -ylaminojmethyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile [prepared as described in Example 127, Steps A-H, but using (R)-3-Amino-l-(3-chlorobenzyl)- 2-oxopyπolidine hydrochloride (as described in Example IH) instead of (S)-3- Amino-l-(3-chlorobenzyl)-2-oxopyrrolidine hydrochloride in Step H] in place of (Sj- 4-(5 - { [ 1 -(3 -chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 -ylmethylj- 2-fluorobenzonitrile, the above-titled compound was obtained. Elemental analysis calculated for C30H28C1N5O2*2 HC1O.2 CH2C12*0.05 EtOAc:
C: 58.85; H: 5.00; N: 11.29 Found: C: 58.82; H: 5.02; N: 11.28
FAB MS: 526 (MH+).
EXAMPLE 133
(S)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-(3-phenylpropoxy)benzonitrile hydrochloride Following the procedures described in Example 128, but using
3-phenylpropanol in place of phenethyl alcohol, the above-titled compound was obtained.
Elemental analysis calculated for C32H32ClN5O2*2 HC1-0.15 CH2C12*0.05 H2O: C: 60.27; H: 5.41; N: 10.93
Found: C: 60.24; H: 5.16; N: 10.89
FAB MS: 554 (MH+).
EXAMPLE 134
(R)-4-(5 - { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-(3 -phenylpropoxyjbenzonitrile hydrochloride
Following the procedures described in Example 128, but using 3- phenylpropanol in place of phenethyl alcohol, and (R)- 4-(5-{[l-(3-chlorobenzyl)-2- oxopyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyl)-2-fluorobenzonitrile [prepared as described in Example 127, Steps A-H, but using (R)-3-Amino-l-(3-chlorobenzyl)- 2-oxopyrrolidine hydrochloride (as described in Example IH) instead of (S)-3- Amino-l-(3-chlorobenzyl)-2-oxopyrrolidine hydrochloride in Step HJ in place of (5)- 4-(5-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-ylaminoJmethyl}imidazol-l-ylmethyl)- 2-fluorobenzonitrile in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C32H32ClN5O2*2 HCl'0.1 CH2C12*0.1 H2O:
C: 60.49; H: 5.44; N: 10.99 Found: C: 60.51; H: 5.19; N: 10.84 FAB MS: 554 (MH+). EXAMPLE 135
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol- 1 -ylmethyl)-2-methoxybenzonitrile hydrochloride
Step A: Methyl 4-amino-3-hydroxybenzoate
Through a solution of 4-amino-3-hydroxybenzoic acid (75 g, 0.49 mol) in dry methanol (2 L) at ambient temperature was bubbled anhydrous HCl gas until the solution was saturated. The solution was stirred for 48 hours, then concentrated in vacuo. The product was partitioned between EtOAc and saturated aqueous NaHCO3 solution, and the organic layer was washed with brine, dried (Na2SO4), and concentrated in vacuo to provide the title compound.
Step B: Methyl 3-hydroxy-4-iodobenzoate
A cloudy, dark solution of methyl 4-amino-3-hydroxybenzoate from Step A (79 g, 0.47 mol) in 3N HCl (750 mL), and THF (250 mL) was cooled to 0°C. A solution of NaNO2 (35.9 g, 0.52 mol) in 115 mL of water was added over ca. 5 minutes, and the solution was stirred for another 25 minutes. A solution of potassium iodide (312 g, 1.88 mol) in 235 mL of water was added all at once, and the reaction was stirred for an additional 15 minutes. The mixture was poured into EtOAc, shaken, and the layers were separated. The organic phase was washed with water and brine, dried (Na2SO4), and concentrated in vacuo to provide the cmde product (148 g). The cmde product was purified by flash column chromatography on silica, eluting with a gradient of hexane - 20% to 50% EtOAc to yield the title product.
Step C: Methyl 4-cyano-3-hydroxybenzoate
A mixture of methyl 3-hydroxy-4-iodobenzoate, as described above in Step B, (101 g, 0.36 mol) and zinc(II)cyanide (30 g, 0.25 mol) in dry DMF (400 mL) was degassed by bubbling argon through the solution for 20 minutes. Tetrakis (triphenylphosphine)palladium (8.5 g, 7.2 mmol) was added, and the solution was heated to 80°C for 4 hours. The solution was cooled to ambient temperature, then stirred for an additional 36 hours. The reaction was poured into EtOAc (3 L) and water (1 L) and the organic layer was washed with brine (4 x 500 mL), dried (Na2SO4), and concentrated in vacuo to provide the cmde product. The cmde product was partially purified by flash column chromatography on silica, eluting with a gradient of hexane - 25% to 50% EtOAc, then crystallized from EtOAc-hexane to yield the title product.
Step D: Methyl 4-cyano-3-methoxybenzoate
Sodium hydride (13.9 g of a 60 wt. % dispersion in mineral oil, 0.348 mol) was added to a solution of methyl 4-cyano-3-hydroxybenzoate, as described above in Step C, (56 g, 0.316 mol) in dry DMF (600 mL) at 0°C, and the mixture was stirred for 20 min at ambient temperature. Iodomethane (49.4 g, 0.348 mol) was added, and the reaction mixture was stirred for 2 hours, then partitioned between EtOAc (2 L) and water (1 L). The aqueous layer was extracted further with EtOAc (1 L). The combined organic extracts were washed with saturated aqueous Na2CO3 (1 L), then water (1 L), then brine (2 x 1 L), then dried over Na2SO4, filtered, and concentrated in vacuo to provide the title product.
Step E: 4-Cyano-3-mefhoxybenzyl alcohol
To a solution of methyl 4-cyano-3-methoxybenzoate, as described above in Step D, (59.1 g, 0.309 mol) in dry THF (600 mL), under argon, at ambient temperature was added lithium borohydride (309 mL of a 2 M solution in THF, 0.618 mol) over 10 min. After 3 hrs, the reaction mixture was warmed to reflux for 45 min, then cooled to room temperature. The solution was poured into EtOAc (1 L) and 1 N aqueous HCl (1 L) [CAUTION], and the layers were separated. The organic layer was washed with water (500 mL), saturated aqueous Na2CO3 (500 mL), and brine
(2 x 500 mL), dried (Na2SO4), and concentrated in vacuo to provide the title product.
Step F: 4-Cyano-3-methoxybenzyl bromide
A solution of 4-cyano-3-methoxybenzyl alcohol, as described above in Step E, (40.3 g, 0.247 mol) in dry THF (600 mL) was cooled to 0°C. Triphenyl- phosphine (97.2 g, 0.370 mol) was added, followed by carbon tetrabromide (122.9 g, 0.370 mol). The reaction mixture was stirred at 0°C for 15 min, then at ambient temperature for 30 min, then concentrated in vacuo. The residue was partitioned between CH2C12 (2 L) and saturated aqueous NaHCO3 (1 L). The organic layer was dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of hexane ■ 25% to 35% EtOAc to yield the title product.
Step G: (S)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylaminoJ- methyl } imidazol- 1 -ylmefhyl)-2-mefhoxybenzonitrile hydrochloride Following the procedures described in Example 1 , but using 4-cyano- 3-mefhoxybenzyl bromide (as described above in Step F) in place of 4-cyanobenzyl bromide in Step C, 3 -chlorobenzylamine in place of aniline in Step F, and (S)-N-(tert- butoxycarbonyl)methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step F, the above-titled compound was obtained.
Elemental analysis calculated for C24H24ClN5O2*2 HC1O.25 CH2C12*0.55 EtOAc: C: 53.61; H: 5.26; N: 11.82 Found: C: 53.61; H: 5.00; N: 11.81
FAB MS: 450 (MH+).
EXAMPLE 136
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl} imidazol- 1- ylmethyl)-2-methoxybenzonitrile hydrochloride
Following the procedures described in Example 1, but using 4- cyano-3-methoxybenzyl bromide (as described in Example 135, Step F) in place of 4-cyanobenzyl bromide in Step C, and 3 -chlorobenzylamine in place of aniline in Step F, the above-titled compound was obtained.
Elemental analysis calculated for C24H24ClN5O2*2 HC1O.55 CH2C12*0.15 C6H5CH3:
C: 54.19; H: 5.03; N: 12.34 Found: C: 54.26; H: 5.00; N: 12.35 FAB MS: 450 (MH+).
EXAMPLE 137
(5)-4-{5-[(2-oxo-l-pyridin-2-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride Step A: (S)-N-(tert-Butoxycarbonyl)homoserine lactone
(S)-N-(tert-Butoxycarbonyl)homoserine (2.00 g, 9.12 mmol), EDC (1.92 g, 10.04 mmol), 1-hydroxybenzotriazole hydrate (1.36 g, 10.04 mmol), and N,N-diisopropylethylamine (103 mL, 0.59 mmol) were combined in DMF (20 mL) and the mixture was stiπed at ambient temperature for 3 hrs. The solvent was removed under reduced pressure and the residue was partitioned between saturated aqueous ΝaHCO3 (30 mL) and EtOAc (50 mL). The aqueous layer was extracted further with CH2C12 (50 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane - 50% EtOAc, to yield the titled product as a white solid.
Step B: (5 -2-(tert-Butoxycarbonylamino)-4-hydroxy-N-pyridin-2- ylbutyr amide
To a stirred solution of 2-aminopyridine (257 mg, 2.73 mmol) in dry CH2C12 (7 mL) at ambient temperature, under argon, was added trimethylaluminum (1.37 mL of a 2.0 N solution in hexane, 2.73 mmol) dropwise. The resulting mixture was stirred for 15 min, then (5)-/V-(tert-butoxycarbonyl)homoserine lactone, as described above in Step A, (500 mg, 2.48 mmol) in CH2C12 (5 mL) was added and stirring was continued at ambient temperature for 18 hrs. The reaction was quenched carefully with 10% aqueous citric acid (5 mL) and, after effervescence had stopped, the mixture was partitioned between saturated aqueous potassium sodium tartrate (30 mL) and CH2CI2 (30 mL). The aqueous layer was extracted further with CH2C12 (2 x 30 mL). The combined organic extracts were dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of EtOAc - 20% to 5% hexane to yield the titled product.
Step C: (5 -3-(tert-Butoxycarbonylamino)-2-oxo-l-pyridin-2-ylpyrrolidine hydrochloride
Tri-n-butylphosphine (0.172 mL, 0.69 mmol) and di-tert-butyl azodicarboxylate (159 mg, 0.69 mmol) were combined in dry THF (1 mL) at ambient temperature and stirred for 5 min, then added dropwise to a solution of (S)-2-(tert- butoxycarbonylamino)-4-hydroxy-N-pyridin-2-ylbutyramide, as described above in Step B, (102 mg, 0.345 mmol) in THF (0.5 mL) at 0°C, under argon. The resulting mixture was allowed to warm slowly to ambient temperature and stiπed for 18 hrs, then partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (10 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of hexane - 30% to 40% EtOAc to yield the titled product.
Step D: (5)- - {5-[(2-oxo-l -pyridin-2-ylpyrrolidin-3-ylamino)methyl]imidazol- l-ylmethyl}benzonitrile hydrochloride
Following the procedures described in Example 1, but using (S)- 3-(tert-butoxycarbonylamino)-2-oxo-l -pyridin-2-ylpyπolidine hydrochloride (as described above in Step C) in place of (R)-3-(tert-butoxycarbonylamino)-2-oxo-l- phenylpyrrolidine hydrochloride in Step I, the above-titled compound was obtained.
Elemental analysis calculated for C21H20N6O*2.5 HC1*0.4 H2O*0.1 EtOAc:
C: 53.59; H: 5.07; N: 17.52 Found: C: 53.53; H: 5.17; N: 17.53
FAB MS: 373 (MH+).
EXAMPLE 138
(-S)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylJ(3-phenylpropyl)amino} me hyljimidazol- 1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 24, but using 3- phenylpropionaldehyde in place of benzaldehyde and (5)-4-(5-{[l-(3-chlorobenzyl)- 2-oxopyrrolidin-3-ylamino]methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride (as described in Example 12) in place of (.S)-4-{5-[(l-benzyl-2-oxopyπolidin-3- ylamino)methyl]imidazol-l -ylmethyl} benzonitrile in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C32H32ClN5O*2 HC1*0.1 EtOAc:
C: 62.78; H: 5.66; N: 11.30 Found: C: 62.94; H: 5.85; N: 11.25 FAB MS: 538 (MH+). EXAMPLE 139
(5)-4- [5 -( {(3 - Aminopropyl) [ 1 -(3 -chlorobenzyl)-2-oxopyπolidin-3 -yljamino } methyl)imidazol-l -ylmethyljbenzonitrile hydrochloride
Following the procedures described in Example 35, but using (S)-4- (5- { [ 1 -(3 -chlorobenzyl)-2-oxopyrrolidin-3 -ylamino] -methyl } imidazol- 1 -ylmethyl) benzonitrile hydrochloride (as described in Example 12) in place of (5)-4-{5-[(l- benzyl-2-oxopyrrolidin-3-ylamino) methyl]imidazol-l-ylmethyl}benzonitrile in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C26H29ClN6O*3 HC1*0.15 H2O:
C: 53.01; H: 5.53; N: 14.27 Found: C: 52.96; H: 5.71; N: 14.34 FAB MS: 477 (MH+).
EXAMPLE 140
(S)-N-(3 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyrrolidin-3-yl] [ 1 -(4-cyanobenzyl)- 1 H- imidazol-5-ylmethylJamino}propyl)nicotinamide hydrochloride
To a stirred mixture of (iS)-4-[5-({(3-aminopropyl)[l-(3-chloro- benzyl)-2-oxopyrrolidin-3-yl]amino}methyl)imidazol-l-ylmethylJ benzonitrile hydrochloride (as described in Example 139) (20 mg, 0.034 mmol) and nicotinoyl chloride hydrochloride (7 mg, 0.039 mmol) in CH2C12 (0.5 mL) was added NJV- diisopropylethylamine (35 mL, 0.20 mmol) and stiπing was continued at ambient temperature for 5 min. The reaction mixture was partitioned between saturated aqueous ΝaHCO3 (5 mL) and CH2C12 (20 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C1 - 1% to 5% MeOH - 0.1% to 0.5% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C32H32ClN7O2*3 HCM.35 H2O*0.45 EtOAc: C: 53.74; H: 5.51; N: 12.98 Found: C: 53.74; H: 5.58; N: 13.01
FAB MS: 582 (MH+).
EXAMPLE 141
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl](2-moφholin-4-ylethyl) amino} me hyljimidazol- 1 -ylmethyljbenzonitrile hydrochloride
Step A: 2-(tert-Butyldimethylsilyloxy)ethanol To a stirred suspension of NaH (0.64 g of a 60 wt. % dispersion in mineral oil, 16 mmol) in dry THF, under argon, was added ethylene glycol (1.00 g, 16 mmol) and the resulting mixture was allowed to stir for 45 min at ambient temperature. tert-Butyldimethylsilyl chloride (2.43 g, 16 mmol) was added in one portion, and stirring was continued for 45 min. The reaction mixture was poured into Et2O (200 mL) and washed with saturated aqueous Na2CO3 (100 mL) and then brine (100 mL), then dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane - 30% EtOAc to yield the titled product as a colorless oil.
Step B: 2-(tert-Butyldimethylsilyloxy)ethanal
To a stirred solution of oxalyl chloride (1.43 mL, 16.4 mmol) in dry CH2C12 (20 mL) at -70°C, under argon, was added dry DMSO (2.33 mL, 32.8 mmol) dropwise, over 5 min. The resulting mixture was stirred at -70°C for 30 min, then a solution of 2-(tert-butyldimethylsilyloxy)ethanol, as described above in Step A, (2.23 g, 12.6 mmol) in CH2C12 (10 mL) was added slowly. After stirring for an additional 15 min, triethylamine (8.8 mL, 63 mmol) was added and the mixture was allowed to warm to -^40°C, then partitioned between CH2C1 (100 mL) and saturated aqueous NaHCO3 (50 mL). The aqueous layer was extracted further with CH C12 (2 x 100 mL). The combined organic extracts were dried over Na2SO4, filtered, and concen- trated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with CH2C12 to yield the desired aldehyde.
Step C: (S)-4-[5-({[2-(tert-Butyldimethylsilyloxy)ethyl][l-(3-chlorobenzyl)-
2-oxopyrrolidin-3-ylJamino}methyl)imidazol-l-ylmethyl]benzonitrile (5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylaminoJ-methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride (as described in Example 12) (203 mg, 0.48 mmol), 2-(tert-butyldimethylsilyloxy)ethanal, as described above in Step B, (126 mg, 0.72 mmol), and acetic acid (58 mg, 0.96 mmol) were stirred in MeOH (2 mL) for 30 min then NaCNBH3 (60 mg, 0.96 mmol) was added. Stirring was continued for 18 hrs, then most of the MeOH was removed under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (20 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO , filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1 % to 3% MeOH - 0.1 % to 0.3% NH4OH, to yield the desired product.
Step D: (S)-4- [5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -yl] (2-hydroxyethyl) amino } methyl)imidazol- 1 -ylmethyljbenzonitrile To a solution of (<S)-4-[5-({[2-(tert-butyldimethylsilyloxy)ethylJ [l-(3- chlorobenzyl)-2-oxopyπolidin-3-yl]amino}methyl)imidazol-l-ylmethylJbenzonitrile, as described above in Step C, (175 mg, 0.303 mmol) in THF (3 mL) was added tetra- butylammonium fluoride (0.363 mL of a 1.0 M solution in THF, 0.363 mmol). The reaction mixture was stirred for 1 hr, then poured into H2O (20 mL) and extracted with CH2C1 (3 x 20 mL). The combined organic extracts were dried over Na SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with a gradient of CH2C12 - 1% to 6% MeOH - 0.1% to 0.6% NH4OH, to yield the desired product as a colorless oil.
Step E: (5)-2-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl][l-(4-cyanobenzyl)-
1 H-imidazol-5 -ylmethyl] amino } acetaldehyde
To a stiπed solution of oxalyl chloride (35 mL, 0.39 mmol) in dry CΗ2C12 (2 mL) at -70°C, under argon, was added dry DMSO (56 mL, 0.78 mmol) dropwise, over 2 min. The resulting mixture was stiπed at -70°C for 10 min, then a solution of (>S)-4-[5-({[l-(3-chlorobenzyl)-2-oxopyπolidin-3-yl](2-hydroxyethyl) amino }mefhyl)imidazol-l -ylmethyl] -benzonitrile, as described above in Step D, (140 mg, 0.30 mmol) in CH2C12 (3 mL) was added slowly. After stirring for an additional 15 min, triethylamine (0.21 mL, 1.51 mmol) was added and the mixture was allowed to warm to ambient temperature, then partitioned between CH2C12 (20 mL) and saturated aqueous NaHCO3 (10 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo to yield the desired aldehyde.
Step F: (S)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](2-moφholin- 4-ylethyl)amino}methyl)imidazol-l-ylmethyl]benzonitrile hydrochloride
(S)-2- { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl] [ 1 -(4-cyanobenzyl)- lH-imidazol-5-ylmethyl]amino}acetaldehyde, as described above in Step E (46 mg, 0.10 mmol), moφholine (10 mL, 0.11 mmol), and acetic acid (40 mL, 0.70 mmol) were stiπed in MeOΗ (2 mL) for 30 min then NaCNBΗ3 (13 mg, 0.21 mmol) was added. Stirring was continued for 18 hrs, then most of the MeOH was removed under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C1 (20 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was partially purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1% to 5% MeOH - 0.1% to 0.5% NH4OH, then further purified by semi-preparative HPLC using a Vydac C18 reversed phase column and eluting with a gradient of 95/5 to 0/100 A/B; A = H2O- 0.1% TFA, B = CH3CN-0.1% TFA. The pure fractions were collected and extracted from saturated aqueous Na2CO3 (2 mL) with CHC13 (15 mL), and the CHC13 layer was dried over Na2SO4, filtered, and concentrated in vacuo to give the titled product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C29H33ClN6O2*3 HC1O.3 EtOAc*0.1 CH2C12: C: 53.72; H: 5.74; N: 12.41
Found: C: 53.72; H: 6.09; N: 12.40
FAB MS: 533 (MH+).
EXAMPLE 142
(S)-4-[5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -yl] (2-piperazin- 1 -ylethyl)amino } mefhyl)imidazol-l -ylmethyljbenzonitrile hydrochloride Step A: (S)-4- [5 -( { [2-(4-tert-B utoxycarbonylpiperazin- 1 -yl)ethyl] [ 1 -(3 - chlorobenzyl)-2-oxopyπolidin-3 -yl] amino } methyl) imidazol- 1 - ylmethyljbenzonitrile (5)-2-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl][l-(4-cyanobenzyl)- lH-imidazol-5-ylmethyl]amino}acetaldehyde (as described in Example 141, Step E) (46 mg, 0.10 mmol), 1-tert-butoxycarbonylpiperazine (22 mg, 0.12 mmol), and acetic acid (40 mL, 0.70 mmol) were stirred in MeOΗ (2 mL) for 30 min then NaCNBΗ3 (13 mg, 0.21 mmol) was added. Stirring was continued for 18 hrs, then most of the MeOH was removed under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (5 mL) and CH2C12 (20 mL). The aqueous layer was extracted further with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO , filtered, and concentrated in vacuo. The residue was purified by semi -preparative HPLC using a Vydac C18 reversed phase column and eluting with a gradient of 95/5 to 0/100 A/B; A = H2O-O. /0 TFA, B = CH3CN-0.1% TFA. The pure fractions were collected and extracted from saturated aqueous NaHCO3 (2 mL) with CH2C12 (100 mL), and the CH2C12 layer was dried over Na2SO4, filtered, and concentrated in vacuo to give the desired product.
Step B: (5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](2-piperazin-l - ylethyl)amino} methyl)imidazol- 1 -ylmethyljbenzonitrile hydrochloride A solution of (5)-4-[5-({[2-(4-tert-butoxycarbonylpiperazin-l-yl) ethyl] [ 1 -(3-chlorobenzyl)-2-oxopyπolidin-3 -yl] amino } methyl) imidazol- 1 -ylmethyl] benzonitrile, as described above in Step A, (20 mg, 0.032 mmol) in EtOAc (5 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo, and the residue was purified by semi -preparative HPLC using a Vydac C18 reversed phase column and eluting with a gradient of 95/5 to 0/100 A/B; A = H2O- 0.1% TFA, B = CH3CN-0.1% TFA. The pure fractions were collected and extracted from saturated aqueous NaHCO3 (2 mL) with CH2C12 (15 mL), and the CH2C12 layer was dried over Na2SO , filtered, and concentrated in vacuo to give the desired product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc. Elemental analysis calculated for C29H34ClN7O*4 HCl-2.25 H2O*0.2 CH2C12:
C: 50.10; H: 6.18; N: 14.01 Found: C: 50.13; H: 6.18; N: 13.92
FAB MS: 532 (MH+).
EXAMPLE 143
(5)-4-[5-( { [ 1 -(3-Chlorobenzyl)-2-oxopyπolidin-3-yl] [2-(pyridin-2-ylamino)ethyl] amino }methyl)imidazol- 1 -ylmethyljbenzonitrile hydrochloride Following the procedures described in Example 141, but using 2- aminopyridine in place of moφholine in Step F, the above-titled compound was obtained.
Elemental analysis calculated for C30H3θClN7O*3 HCl'0.3 EtOAc: C: 55.44; H: 5.28; N: 14.51
Found: C: 55.70; H: 5.65; N: 14.50
FAB MS: 540 (MH+).
EXAMPLE 144
(S)-6-Amϊno-N-(3- {[ 1 -(3-chlorobenzyl)-2-oxopyrrolidin-3-yl][ 1 -(4-cyanobenzyl)- lH-imidazol-5-ylmethyl]amino}propyl)nicotinamide hydrochloride
Step A: Methyl 6-aminonicotinate A suspension of 6-aminonicotinic acid (100 mg, 0.72 mmol) in MeOΗ
(25 mL) was saturated with ΗC1 (g) and the resulting mixture was stood at ambient temperature for 72 hrs, then concentrated in vacuo to give the desired ester.
Step B: Methyl 6-(tert-butoxycarbonylamino)nicotinate To a stirred solution of methyl 6-aminonicotinate, as described above in Step A, (105 mg, 0.69 mmol) in DMF (3 mL) was added di-tert-butyl dicarbonate (158 mg, 0.72 mmol) and the reaction mixture was stiπed at ambient temperature for 18 hrs, then concentrated in vacuo and partitioned between Η2O (10 mL) and EtOAc (20 mL). The aqueous layer was extracted further with EtOAc (2 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of hexane - 20% to 50% EtOAc to yield the titled product.
Step C: Lithium 6-(tert-butoxycarbonylamino)nicotinate To a stiπed solution of methyl 6-(tert-butoxycarbonylamino) nicotinate, as described above in Step B, (36 mg, 0.14 mmol) in THF (5 mL) was added LiOH (1.5 mL of a 0.1 N solution in H2O, 0.15 mmol) and the resulting mixture was stiπed for 18 hrs. The pH of the solution was adjusted to ca. pH 7 with 1 N aqueous HCl and the solvents were removed under reduced pressure to provide the desired salt.
Step D: (5)-6-tert-Butoxycarbonylamino-N-(3- {[ 1 -(3-chlorobenzyl)-2- oxopyπolidin-3-yl][l-(4-cyanobenzyl)-lH-imidazol-5-ylmethyl] amino }propyl)nicotinamide (5)-4-[5-({(3-Aminopropyl)[l-(3-chlorobenzyl)-2-oxopyπolidin-3- yl] amino }methyl)imidazol-l-ylmethyl]benzonitrile hydrochloride (as described in Example 139) (18 mg, 0.031 mmol), lithium 6-(tert-butoxycarbonylamino)nicotinate (8 mg, 0.032 mmol), EDC (6 mg, 0.032 mmol), 1-hydroxybenzotriazole hydrate (4 mg, 0.032 mmol), and N,N-diisopropylethylamine (25 mL, 0.144 mmol) were combined in DMF (1 mL) and the mixture was stiπed at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was partitioned between saturated aqueous NaΗCO3 (3 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (2 x 10 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1% to 5% MeOH - 0.1% to 0.5% NH4OH to yield the titled product.
Step E: (5)-6-Amino-N-(3-{[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl][l-(4- cyanobenzyl)-lH-imidazol-5-ylmethyl]amino}propyl)nicotinamide hydrochloride
A solution (S)-6-tert-butoxycarbonylamino-N-(3- {[1 -(3-chlorobenzyl)- 2-oxopyπolidin-3-yl][l-(4-cyanobenzyl)-lH-imidazol-5-ylmethyl]amino}propyl) nicotinamide, as described above in Step D, (20 mg, 0.029 mmol) in EtOAc (5 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo, and the residue was partitioned between saturated aqueous Na2CO3 (3 mL) and CHC13 (20 mL). The organic layer was dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1 % to 5% MeOH - 0.1 % to 0.5% NH4OH to yield the titled product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
FAB MS: 597 (MH+). HRFABMS: 597.2475; calculated mass for C32H34ClN8O2 (MH+) = 597.2488
EXAMPLE 145
(35)-4-[5-({l-[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin- 3-ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile, diastereomer A, hydrochloride
Step A: Benzyl 3-bromophenyl ether
To a stiπed solution of 3-bromophenol (9.50 g, 54.9 mmol) in degassed DMF (150 mL) at 0°C, under argon, was added Cs2CO3 (35.8 g, 109 mmol). The resulting mixture was stiπed for 1 hr, then benzyl bromide (10.3 g, 60.2 mmol) was added and stiπing was continued for 2 hrs at 0°C. The solvent was removed under reduced pressure, and the residue was partitioned between 20% aqueous NaOH (250 mL) and CHC13 (500 mL). The organic layer was dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting first with two column volumes of hexane, then with hexane - 2% EtOAc to yield the desired product as a white solid.
Step B: (3-Benzyloxyphenyl)(3-chlorophenyl)methanol To a stiπed suspension of Rieke Mg (0.93 g, 38 mmol) in refluxing dry THF (15 mL), under argon, was added benzyl 3-bromophenyl ether, as described above in Step A, (9.0 g, 34 mmol) in dry THF (90 mL) dropwise, at a rate that maintained reflux with the heat source removed. The resulting mixture was heated to reflux for 1 hr, then allowed to cool to ambient temperature. The solution of Grignard reagent was added dropwise to a stiπed solution of 3-chlorobenzaldehyde in THF (50 mL) at -78°C. The reaction mixture was stiπed at -78°C for 1 hr, then quenched with saturated aqueous NH4CI (200 mL), allowed to warm to ambient temperature, and extracted with Et2θ (500 mL). The organic layer was dried over MgSO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with hexane - 7% EtOAc, to yield the titled product as a colorless oil.
Step C: (3 -Benzyloxyphenyl)(3 -chlorophenyl)methyl azide
To a stiπed solution of (3-benzyloxyphenyl)(3-chlorophenyl)methanol, as described above in Step B, (4.0 g, 12.3 mmol) and diphenylphosphoryl azide (4.1 g, 14.9 mmol) in dry toluene (35 mL) at 0°C, was added 1,8- diazabicyclo[5.4.0]undec-
7-ene (2.1 g, 13.8 mmol). The resulting mixture was allowed to warm to ambient temperature, and stiπed under argon for 18 hrs, then washed with 5% hydrochloric acid (10 mL). The organic layer was dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane - 2% ethyl acetate to yield the product as a colorless oil.
Step D: (3-Benzyloxyphenyl)(3-chlorophenyl)methylamine
(3-Benzyloxyphenyl)(3-chlorophenyl)methyl azide, as described above in Step C, (6.2 g, 17.7 mmol) was dissolved in dry THF (150 mL) and the solution was cooled to -70°C. Lithium aluminum hydride (21.2 mL of a 1.0 M solution in THF, 21.2 mmol) was added dropwise, then the reaction mixture was warmed to 0°C and stiπed for 2 hrs. The reaction was quenched with EtOAc (0.75 mL), then water (0.75 mL), then 15% NaOH (0.75 mL), and finally water (2.2 mL). The resulting mixture was filtered, concentrated under reduced pressure and purified by flash column chromatography on silica, eluting with hexane - 15% EtOAc, to yield the titled product as a colorless oil.
Step E: (35)-N-[(3-Benzyloxyphenyl)(3-chlorophenyl)methyl]-2-(tert- butoxycarbonylamino)-4-(methylmercapto) butyramide, diastereomers
A & B
To S)-N-(tert-butoxycarbonyl)mefhionine (1.60 g, 6.7 mmol) in dry CH2C12 (5 mL) under argon were added PYBOP (3.50 g, 6.7 mmol), (3- benzyloxyphenyl)(3-chlorophenyl)methylamine, as described above in Step C, (2.0 g, 6.2 mmol), and N,/V-diisopropylefhylamine (1.2 mL, 6.9 mmol). The reaction mixture was stiπed for 2 hrs, then quenched with aqueous NaHCO3 (20 mL), and extracted with CH2C12 (2 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with hexane - 20% ethyl acetate to yield a mixture (ca. 1 :1) of diastereomeric amides as a white solid.
Step F: (35)-N-[(3-Benzyloxyphenyl)(3-chlorophenyl)methyl]-2-(tert- butoxycarbonylamino)-4-(dimethylsulfonium)-butyramide iodide, diastereomers A & B (3,S)-N-[(3-Benzyloxyphenyl)(3-chlorophenyl)methyl]-2-(tert- butoxycarbonylamino)-4-(methylmercapto)butyramide, diastereomers A & B, as described above in Step E, (3.30 g, 5.94 mmol) was dissolved in iodomethane (20 L, 320 mmol) and the solution was stiπed under argon for 18 hrs. The iodomethane was removed by distillation under reduced pressure to give the sulfonium salt diastereomers (ca. 1 : 1 ) as a yellow solid.
Step G: (3SHH(3-Benzyloxyphenyl)(3-chlorophenyl)methyl]-2- oxopyrrolidin-3-yl}carbamic acid tert-butyl ester, diastereomers A & B (35)-N-[(3-Benzyloxyphenyl)(3-chlorophenyl)methyl]-2-(tert- butoxycarbonylamino)-4-(dimethylsulfonium)butyramide iodide, diastereomers A & B, as described above in Step F, (4.10 g, 5.94 mmol) was stirred in dry THF (90 mL), under argon, at 0°C and lithium bis(trimethylsilyl)amide (1.0 M in THF, 5.6 mL, 5.6 mmol) was added dropwise. The reaction mixture was stirred at 0°C for 2 h, then quenched with saturated aqueous ΝH4C1 (50 mL) and most of the THF was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (25 mL) and CHC13 (75 mL). The aqueous layer was extracted further with CHC13 (2 x 25 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of hexane - 20% to 25% ethyl acetate to yield the mixture (ca. 1 : 1) of diastereomeric pyrrolidinones as a white solid.
Step H: (35)-{l-[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyπolidin-
3-yl}carbamic acid tert-butyl ester, diastereomers A & B To a solution of (3S)- { 1 -[(3-benzyloxyphenyl)(3-chlorophenyl) methyl]-2-oxopyπolidin-3-yl}carbamic acid tert-butyl ester, diastereomers A & B, as described above in Step G, (1.30 g, 2.62 mmol) in EtOH (125 mL) and EtOAc (25 mL) was added 20% Pd(OH)2 on carbon (250 mg) and acetic acid (5 mL) and the reaction mixture was stiπed under an atmosphere of hydrogen (ca. 1 atm) at ambient temperature for 18 hrs. The mixture was filtered through a pad of celite, washing with EtOH, and the filtrate was concentrated in vacuo to give a crude product. This was purified by flash column chromatography on silica, eluting with a gradient of CHC13 - 20% to 30%, to yield the separated products, diastereomer A (higher Rp on silica gel) and diastereomer B (lower Rp on silica gel), as colorless oils.
Step I: (3iS)-3-Amino-l-[(3-chlorophenyl)(3-hydroxyphenyl)methyl]-2- oxopyπolidine trifluoroacetate, diastereomer A
A solution of (35)- {1 -[(3-chlorophenyl)(3-hydroxyphenyl)-methyl]-2- oxopyπolidin-3-yl}carbamic acid tert-butyl ester, diastereomer A, as described above in Step H, (480 mg, 1.15 mmol) in EtOAc (75 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the amine, which was purifed by preparative HPLC on a Deltapak C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 60% CH3CN to provide the titled product as a white foam.
Step J: (35)-4-[5-({l-[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-
2-oxopyπolidin-3 -ylamino } methyl)imidazol- 1 -ylmethyl] -2- fluorobenzonitrile, diastereomer A, hydrochloride
(35)-3-Amino-l-[(3-chlorophenyl)(3-hydroxyphenyl)methyl]-2- oxopyπolidine trifluoroacetate, diastereomer A, as described above in Step I, (95 mg, 0.221 mmol) and l-(4-cyano-3-fluorobenzyl)-5-imidazolecarboxaldehyde, as described in Example 127, Step G, (56 mg, 0.244 mmol), were stiπed in MeOH (1 mL) and NN-diisopropylethylamine was added dropwise to adjust the mixture to ca. pH 5, as judged by wetted pH paper. The mixture was stiπed for 1 hr at ambient temperature then NaCNBH3 (17 mg, 0.27 mmol) was added, AcOH was added to adjust the mixture to about pH 5, and stiπing was continued for 18 hrs. The MeOH was removed under reduced pressure, and the residue was partitioned between saturated aqueous NaHCO3 (1 mL) and CHC13 (3 mL). The aqueous layer was extracted further with CHC13 (2 x 3 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with CHC13 - 4% MeOH - 0 4% NH4OH to yield the titled product as a white solid, which was converted to the hydrochloride salt by treatment with HCl in EtOAc
Elemental analysis calculated for C29H25ClFN5O2*2 HC1*0 1 H2O*0 85 CH2C12 C 52 96, H 4 30, N 10 35 Found C 52 96, H 4 18, N 10 33
FAB MS 530 (MH+)
EXAMPLE 146
(3S)-2-Fluoro-4-[5-({l-[(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπohdm-3- ylamιno}methyl)ιmιdazol-l-ylmethyl]benzonιtnle, diastereomer B, hydrochloride
Step A (3S)-{l-[(3-Hydroxyphenyl)φhenyl)methyl]-2-oxopyπohdιn-3- yl}carbamιc acid tgrt-butyl ester diastereomers A & B
To a solution of (35 -{l-[(3-benzyloxyphenyl (3- chlorophenyl)- methyl]-2-oxopyπohdm-3-yl}carbamιc acid tert-butyl ester, diastereomers A & B, as descπbed in Example 145, Step G, (1 20 g, 2 41 mmol) in EtOH (125 mL) and EtOAc (25 mL) was added 20% Pd(OH)2 on carbon (1 20 g) and the reaction mixture was shaken m a Parr hydrogenation apparatus under an atmosphere of hydrogen (ca 50 atm) at ambient temperature for 3 days The mixture was filtered through a pad of celite, washing with EtOH, and the filtrate was concentrated in vacuo to give a cmde product This was puπfied by flash column chromatography on silica, eluting with a gradient of CHCI3 - 20% to 30%, to yield the separated products, diastereomer A (higher RF on silica gel) and diastereomer B (lower RF on silica gel), as colorless
Step B (35)-3-Amino-l-[(3-hydroxyphenyl)(phenyl)methyl]-2- oxopyπohdme tnfluoroacetate, diastereomer B
A solution of (35)-{l-[(3-hydroxyphenyl)(phenyl)methyl]-2- oxopyπohdιn-3-yl}carbamιc acid tert-butyl ester, diastereomer B, as described above in Step A, (88 mg, 1 15 mmol) in EtOAc (15 mL) at 0°C was saturated with HCl (g) After 15 mm, the mixture was concentrated in vacuo to yield the amine, which was purifed by preparative HPLC on a Deltapak C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 60% CH3CN to provide the titled product as a white foam.
Step C: (35)-2-Fluoro-4-[5-({l-[(3-hydroxyphenyl)(phenyl)methyl]-2- oxopyπolidin-3-ylamino}methyl)imidazol-l-ylmethyl]-benzonitrile, diastereomer B, hydrochloride
(35)-3-Amino-l-[(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidine trifluoroacetate, diastereomer B, as described above in Step B, (26 mg, 0.060 mmol) and l-(4-cyano-3-fluorobenzyl)-5-imidazolecarboxaldehyde, as described in Example 127, Step G, (20 mg, 0.087 mmol), were stiπed in MeOH (1 mL) and N,N-diiso- propyle hylamine was added dropwise to adjust the mixture to ca. pH 5, as judged by wetted pH paper. The mixture was stiπed for 1 hr at ambient temperature then NaCNBH3 (6 mg, 0.095 mmol) was added, AcOH was added to adjust the mixture to about pH 5, and stirring was continued for 18 hrs. The MeOH was removed under reduced pressure, and the residue was partitioned between saturated aqueous NaHCO3 (1 mL) and CHC13 (3 mL). The aqueous layer was extracted further with CHC13 (2 x 3 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CHC13 - 2% to 5% MeOH - 0.2% to 0.5% NH4OH to yield the desired product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C 9H26FN5O2*2 HCl* 1.2 H2O: C: 59.11; H: 5.18; N: 11.89 Found: C: 59.14; H: 5.17; N: 11.61
FAB MS: 496 (MH+).
EXAMPLE 147
(35)-4-[5 -( { 1 - [(3 -Chlorophenyl)(3 -hydroxyphenyl)mefhyl] -2-oxopyπolidin- 3-ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile, diastereomer B, hydrochloride
Following the procedures described in Example 145, but using (35)- {l-[(3-chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin-3-yl}carbamic acid tert-butyl ester, diastereomer B (as described in Example 145, Step H) in place of (35)-{l-[(3-chlorophenyl)(3-hydroxy-phenyl)methyl]-2-oxopyrrolidin-3-yl}carbamic acid tert-butyl ester, diastereomer A, in Step I, the above-titled compound was obtained.
Elemental analysis calculated for C29H25ClFN5O2*2 HC1*H2O*0.25 EtOAc: C: 56.04; H: 4.86; N: 10.89 Found: C: 56.01 ; H: 5.19; N: 10.92
FAB MS: 530 (MH+).
EXAMPLE 148
(35)-2-Fluoro-4-[5-( { 1 -[(3-hydroxyphenyl)(phenyl)methyl]-2-oxop τrolidin-3- ylamino}methyl)imidazol-l-ylmethyl]benzonitrile, diastereomer A, hydrochloride Following the procedures described in Example 146, but using (35)- {l-[(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3-yl}carbamic acid tert-butyl ester, diastereomer A, (as described in Example 146, Step A) in place of (35)- {1 -[(3- hydroxyphenyl)(phenyl) methyl]-2-oxopyπolidin-3-yl}carbamic acid tert-butyl ester, diastereomer B in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C29H26FN5O2*2 HC1*2.2 H2O*0.15 EtOAc: C: 57.22; H: 5.45; N: 11.27 Found: C: 57.19; H: 5.36; N: 11.28
FAB MS: 496 (MH+).
EXAMPLE 149
(3R)-4-[5-( { 1 -[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyrrolidin- 3 -ylamino } methyl)imidazol- 1 -ylmethyl] -2-fluorobenzonitrile, diastereomer A, hydrochloride Following the procedures described in Example 145, but using (R)-N-
(tert-butoxycarbonyl)me hionine in place of (5)-N-(tert-butoxycarbonyl)methionine, the above-titled compound was obtained. Elemental analysis calculated for C29H25ClFN5O2*2 HC1-1.7 H2O*0.2 C6H5CH3:
C: 56.08; H: 4.94; N: 10.76 Found: C: 56.07; H: 4.68; N: 10.78
FAB MS: 530 (MH+).
EXAMPLE 150
(3R)-2-Fluoro-4-[5-({l-[(3-hydroxyphenyl)(phenyl)methyl]-2-oxop ylamino}methyl)imidazol-l -ylmethyljbenzonitrile, diastereomer B, hydrochloride Following the procedures described in Example 146, but using (R)-N-
(tert-butoxycarbonyl)methionine in place of (5)-N-(tert-butoxycarbonyl)methionine, the above-titled compound was obtained.
Elemental analysis calculated for C29H26FN5O2*2 HCl* 1.3 H2O: C: 58.84; H: 5.21; N: 11.83
Found: C: 58.83; H: 5.19; N: 11.90
FAB MS: 496 (MH+).
EXAMPLE 151
(3R)-4- [5 -( { 1 -[(3 -Chlorophenyl)(3 -hydroxyphenyl)methyl] -2-oxopyπolidin- 3-ylamino}methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile, diastereomer B, hydrochloride
Following the procedures described in Example 147, but using (R)-N- (tert-butoxycarbonyl)methionine in place of (5)-N-(tert-butoxycarbonyl)methionine, the above-titled compound was obtained.
Elemental analysis calculated for C29H25ClFN5O2*2 HCl* 1.4 H2O*0.3 C6H5CH3: C: 56.96; H: 4.95; N: 10.68 Found: C: 56.93; H: 4.94; N: 10.72
FAB MS: 530 (MH+). EXAMPLE 152
(3R)-2-Fluoro-4-[5-({l-[(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3- ylamino}methyl)imidazol-l -ylmethyljbenzonitrile, diastereomer A, hydrochloride Following the procedures described in Example 148, but using (R)-N-
(tert-butoxycarbonyl)methionine in place of (5)-N-(tert-butoxycarbonyl)methionine, the above-titled compound was obtained.
Elemental analysis calculated for C29H26FΝ5O2*2 HC1*2 H2O*0.35 C6H5CH3: C: 59.40; H: 5.50; N: 11.01
Found: C: 59.44; H: 5.12; N: 10.68
FAB MS: 496 (MH+).
EXAMPLE 153
(R)-2-Fluoro-4-(5- { [ 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyπolidin-3-ylamino] methyl} imidazol- 1 -ylmethyljbenzonitrile hydrochloride
Step A: 8-tert-Butoxycarbonylamino-2-naphthol A mixture of 8-amino-2-naphthol (500 mg, 3.14 mmol) and di-tert- butyl dicarbonate (685 mg, 3.14 mmol) in CH2C12 (10 mL) and THF (5 mL) was stiπed at 70°C for 18 hrs, then poured into saturated aqueous Na2CO3 (25 mL) and CH2C12 (75 mL). The aqueous layer was extracted further with CH2C1 (2 x 50 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 0 to 7% ethyl acetate to yield the desired product as a light brown solid.
Step B: 7-Benzyloxy- 1 -(tert-butoxycarbonylamino)naphthalene A mixture of 8-tert-butoxycarbonylamino-2-naphthol, as described above in Step A, (93 mg, 0.36 mmol), benzyl bromide (64 mg, 0.37 mmol), and CS2CO3 (146 mg, 0.45 mmol) in dry DMF (3 mL) was stirred, under argon, at ambient temperature for 18 hrs. The reaction mixture was poured into saturated aqueous NaHCO3 (15 mL) and EtOAc (20 mL). The organic layer was dried over Na2SO4, filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with a gradient of hexane - 5 to 15% diethyl ether to yield the desired product as a pale solid.
Step C: 1 -Amino-7-benzyloxynaphfhalene A solution of 7-benzyloxy-l -(tert-butoxycarbonylamino) naphthalene, as described above in Step B, (100 mg, 0.29 mmol) in EtOAc (10 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo. The residue was partitioned between saturated aqueous Na2CO3 (5 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (2 x 10 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo to yield the desired amine as a pale solid.
Step D: (R)-N-(7-Benzyloxynaphthalen- 1 -yl)-2-(tert-butoxycarbonylamino)- 4-(methylmercapto)butyr amide To (R)-N-(tert-butoxycarbonyl)methionine (2.85 g, 12.0 mmol) in dry
CH2C12 (5 mL) under argon were added PYBOP (6.26 g, 12.0 mmol), l-amino-7- benzyloxynaphthalene, as described above in Step C, (3.0 g, 12.0 mmol), and N,N- diisopropylethylamine (2.12 mL, 12.2 mmol). The reaction mixture was stiπed for 2 hrs, then partitioned between 10% aqueous citric acid (20 mL) and CH2CI2 (150 mL). The aqueous layer was extracted further with CH2CI2 (2 x 150 mL). The combined organic extracts were dried over Νa2SO4, filtered, and concentrated in vacuo. The residue was purified by flash column chromatography on silica, eluting with 2 column volumes of CH2CI2, then CH2C12 - 5% ethyl acetate to yield the titled product.
Step E: (R)-N-(7-Benzyloxynaphthalen-l-yl)-2-(tert-butoxycarbonyl- amino)-4-(dimethylsulfonium)butyramide iodide
(R)-N-(7-Benzyloxynaphthalen-l-yl)-2-(tert-butoxycarbonyl-amino)-4- (methylmercapto)butyramide, as described above in Step D, (4.69 g, 9.75 mmol) was dissolved in iodomethane (50 mL, 0.80 mol) and the solution was stiπed under argon for 18 hrs. The iodomethane was removed by distillation under reduced pressure to give the sulfonium salt as a yellow solid.
Step F: (R)-l-(7-Benzyloxynaphthalen-l-yl)-3-(tert-butoxycarbonyl- amino)-2-oxopyπolidine (7?)-N-(7-Benzyloxynaphthalen-l-yl)-2-(tert-butoxycarbonyl-amino)- 4-(dimethylsulfonium)butyramide iodide, as described above in Step E, (6.40 g, 10.3 mmol) was stiπed in dry THF (100 mL), under argon, at 0°C and lithium bis(trimethylsilyl)amide (1.0 M in THF, 9.76 mL, 9.76 mmol) was added dropwise. The reaction mixture was stiπed at 0°C for 2 h, then quenched with saturated aqueous NH4CI (75 mL) and most of the THF was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (75 mL) and CH2d2 (150 mL). The aqueous layer was extracted further with CH2CI2 (2 x 150 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 5% to 20% ethyl acetate to yield the pyπolidinone as a white solid.
Step G: (R)-3-(tert-Butoxycarbonylamino)-l -(7-hydroxynaphthalen- l-yl)-2- oxopyπolidine To a solution of (R)-l-(7-benzyloxynaphthalen-l-yl)-3-(tert- butoxycarbonylamino)-2-oxopyπolidine, as described above in Step F, (1.00 g, 2.31 mmol) in EtOH (100 mL) and EtOAc (100 mL) was added 20% Pd(OH)2 on carbon (150 mg) and the reaction mixture was stiπed under an atmosphere of hydrogen (ca. 1 atm) at ambient temperature for 18 hrs. The mixture was filtered through a pad of celite, washing with EtOH, and the filtrate was concentrated in vacuo to give a cmde product. This was purified by flash column chromatography on silica, eluting with a gradient of hexane - 50% to 75% EtOAc, to yield the titled product.
Step H: (R)-3 -Amino- 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyπolidine hydrochloride
A suspension of (R)-3-(tert-butoxycarbonylamino)-l -(7-hydroxynaphthalen- l-yl)-2-oxopyπolidine, as described above in Step G, (175 mg, 0.51 mmol) in EtOAc (10 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the amine hydrochloride as a white solid.
Step I: (R)-2-Fluoro-4-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyπolidin-
3-ylamino]methyljimidazol-l-ylmethyl)-benzonitrile hydrochloride (R)-3-Amino-l -(7-hydroxynaphthalen- 1 -yl)-2-oxopyπolidine hydrochloride, as described above in Step H, (146 mg, 0.52 mmol) and l-(4-cyano- 3-fluorobenzyl)-5-imidazolecarboxaldehyde, as described in Example 127, Step G, (126 mg, 0.55 mmol), were stiπed in MeOH (2 mL) and 7V,N-diisopropylethylamine was added dropwise to adjust the mixture to ca. pH 5, as judged by wetted pH paper. The mixture was stiπed for 1 hr at ambient temperature then NaCNBH3 (43 mg, 0.68 mmol) was added, AcOH was added to adjust the mixture to about pH 5, and stirring was continued for 18 hrs. The reaction was quenched with saturated aqueous NaHCO3 (2 mL) and most of the MeOH was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (3 mL) and CH2C12 (10 mL). The aqueous layer was extracted further with CH2C12 (3 x 10 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1% to 6% MeOH - 0.1% to 0.6% NH4OH to yield the titled product, which was converted to the hydrochloride salt with HCl in EtOAc.
Elemental analysis calculated for C26H22FN5O2*3 HC1-0.2 MeOH*0.35 EtOAc: C: 56.84; H: 4.94; N: 12.01 Found: C: 56.84; H: 5.34; N: 12.35
FAB MS: 456 (MH+).
EXAMPLE 154
(5)-2-Fluoro-4-(5- { [ 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyπolidin-3-ylamino] methyl j imidazol- 1 -ylmethyljbenzonitri le hydrochloride
Following the procedures described in Example 153, but using (S)-N- (tert-butoxycarbonyl)methionine in place of (R)-N-(tert-butoxycarbonyl)methionine in Step D, the above-titled compound was obtained.
Elemental analysis calculated for C26H22FN5O2*3 HC1O.55 H2O*0.45 EtOAc: C: 56.07; H: 5.03; N: 11.76 Found: C: 56.08; H: 5.35; N: 11.82
FAB MS: 456 (MH+). EXAMPLE 155
(3R)-2-Fluoro-4-[l -(5- {[1 -(7-hydroxynaphthalen- l-yl)-2-oxopyrrolidin-3-ylamino] methyl} imidazol- l-yl)eth-l-yl]benzonitrile, diastereomers A & B, hydrochloride
Step A: α,α -Dibromo-4-cyano-3 -fluoro toluene
To a solution of 4-cyano-3 -fluoro toluene, as described in Example 127, Step C, (4.0 g, 29.6 mmol) in carbon tetrachloride (250 mL) was added N- bromosuccinimide (10.5 g, 59.2 mmol) and 2,2'-azobisisobutyronitrile (490 mg, 3.0 mmol). The reaction mixture was heated to reflux under argon for 24 hrs, then cooled to room temperature, filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluting with a gradient of hexane - 3% to 7% EtOAc, to yield the titled product as a yellow-brown solid.
Step B: 4-Cyano-3-fluorobenzaldehyde
To a solution of α,α-dibromo-4-cyano-3-fluorotoluene, as described above in Step A, (5.60 g, 19.1 mmol) in EtOH (255 mL) and water (45 mL) was added AgNU3. The mixture was heated to reflux for 3 hrs, then stood at ambient temperature for 18 hrs, then the solid was removed by filtration and the filtrate was concentrated under reduced pressure to a volume of approximately 20 mL. Water (30 mL) was added, and the mixture was concentrated to dryness in vacuo. The residue was partitioned between saturated aqueous NaHCO3 (20 mL) and CH2CI2 (50 mL).
The aqueous layer was extracted further with CH2CI2 (2 x 50 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was dried for several days at ca. 0.5 mm Hg to yield the desired aldehyde as a pale solid.
Step C: l-(4-Cyano-3-fluorophenyl)ethanol To a solution of 4-cyano-3-fluorobenzaldehyde, as described above in Step B, (250 mg, 1.68 mmol) in THF, under argon, at -78°C was added MeMgBr dropwise (0.59 mL of a 3.0 M solution in Et2O, 1.77 mmol). The reaction mixture was stiπed at -78°C for 1 hr, then quenched with saturated aqueous NH4CI, allowed to warm to ambient temperature, and extracted with CH2CI2 (2 x 40 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with a gradient of hexane - 20% to 40% EtOAc, to yield the titled product as a white solid.
Step D: 4-(tert-Butyldimethylsilyloxymethyl)- 1 -(triphenylmethyl) imidazole 4-(Hydroxymethyl)-l-(triphenylmethyl)imidazole, as described in
Example 1, Step A, (1.97 g, 5.72 mmol) and 4-(dimethylamino)pyridine (280 mg, 2.29 mmol) were stiπed in CH2CI2 (15 mL) and tert-butyldimethylsilyl chloride (905 mg, 6.01 mmol) was added. After 1 min, triethylamine (0.88 mL, 6.31 mmol) was added dropwise over 3 min. The reaction mixture was stiπed for 45 min, then CH2C12 (150 mL) was added and the solution was washed with 0.1 N HCl (50 mL). The organic layer was dried (Na2SO4), and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with hexane - 30% EtOAc, to yield the titled product as a white solid.
Step E: 5-(tert-Butyldimethylsilyloxymethyl)-l-[l-(4-cyano-3-fluorophenyl) ethyljimidazole
A mixture of 4-(tert-butyldimethylsilyloxymethyl)-l-(triphenyl- methyl)imidazole, as described above in Step D, (485 mg, 1.07 mmol), l-(4-cyano- 3-fluorophenyl)ethanol, as described above in Step C, (160 mg, 0.969 mmol), and N,N-diisopropylethylamine (0.219 mL, 1.26 mmol) in CH2C12 ( 12 mL) was cooled to -78°C, under argon. Trifluoromethanesulfonic anhydride (0.196 mL, 1.17 mmol) was added dropwise, and the mixture was stiπed for 18 hrs while it slowly warmed to ambient temperature. Methanol (15 mL) was added and the CH2CI2 was distilled off in vacuo. The resulting methanolic solution was heated to reflux for 3 hrs, then concentrated in vacuo to give a residue which was partitioned between saturated aqueous Na2CO3 (10 mL) and CH2CI2 (20 mL). The aqueous layer was extracted further with CH2CI2 (20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with a gradient of CH2CI2 - 0% to 5% MeOH, to yield the titled product as a pale foam.
Step F: l-[l-(4-Cyano-3-fluorophenyl)ethyl]-5-(hydroxymethyl) imidazole
To a solution of 5-(tert-butyldimethylsilyloxymethyl)-l-[l-(4-cyano-3- fluorophenyl)efhyl]imidazole, as described above in Step E, (101 mg, 0.281 mmol) in THF (2 mL) was added tetrabutylammonium fluoride (0.309 mL of a 1.0 M solution in THF, 0.309 mmol) dropwise. The reaction mixture was stiπed for 1 hr, then poured into saturated aqueous NaHCO3 (20 mL) and extracted with CH2CI2 (3 x 20 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with a gradient of CH2C12 - 0% to 10% MeOH, to yield the desired product as a pale solid.
Step G: l-[l-(4-Cyano-3-fluorophenyl)ethyl]-5-imidazole-carboxaldehyde
To a solution of l-[l-(4-cyano-3-fluorophenyl)ethyl]-5-(hydroxy- methyl)imidazole, as described above in Step F, (60 mg, 0.245 mmol) in DMSO (1 mL) at ambient temperature was added triethylamine (0.136 mL, 0.979 mmol), then SO3-pyridine complex (97 mg, 0.612 mmol). After 30 minutes, the reaction was poured into EtOAc (10 mL), washed with water (4 x 2 mL) and brine (2 mL), dried (Na2SO4), filtered, and concentrated in vacuo to provide the aldehyde as a pale solid.
Step H: (3R)-2-Fluoro-4-[l-(5-{[l-(7-hydroxynaphthalen-l-yl)-2- oxopyπolidin-3 -ylaminojmethyl} imidazol- 1 -yl)eth- 1 -yl]benzonitrile, diastereomers A & B, hydrochloride
Following the procedures described in Example 153, but using l-[l-(4- cyano-3-fluorophenyl)ethyl]-5-imidazolecarboxaldehyde (as described above in Step G) in place of l-(4-cyano-3-fluorobenzyl)-5-imidazolecarboxaldehyde in Step I, the above-titled compound was obtained. The product was obtained as a ca. 1 :1 mixture of two diastereomers.
Elemental analysis calculated for C27H24FN5O2*3 HC1O.45 H2O*0.45 EtOAc: C: 56.92; H: 5.23; N: 11.53
Found: C: 56.91; H: 5.39; N: 11.59
FAB MS: 470 (MH+).
EXAMPLE 156
(R)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]amino}pyπolidine-l -carboxylic acid (adamantan-l-yl)amide hydrochloride
Step A: (/?)-3-(tert-Butoxycarbonylamino)pyπolidine-l -carboxylic acid (adamantan- 1 -yljamide A mixture of (R)-3-(tert-butoxycarbonylamino)pyπolidine, which is commercially available, (1.00 g, 5.37 mmol) and 1-adamantyl isocyanate (1.05 g, 5.93 mmol) in dry THF (30 mL) was stiπed at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was crystallized from CH2CI2 - hexane to provide the desired urea.
Step B: (R)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]-amino} pyπolidine-1 -carboxylic acid (adamantan- l-yl)amide hydrochloride Following the procedures described in Example 1, but using (R)-3- (tert-butoxycarbonylamino)pyπolidine- 1 -carboxylic acid (adamantan- 1 -yl)amide (as described above in Step A) in place of (R)-3-(tert-butoxycarbonylamino)-2-oxo-l- phenylpyπolidine in Step I, the above-titled compound was obtained.
Elemental analysis calculated for C27Η34N6O*2 HC1*2.1 H2O*0.25 EtOAc: C: 56.86; H: 7.19; N: 14.21
Found: C: 56.90; H: 6.86; N: 14.17
FAB MS: 459 (MH+).
EXAMPLE 157
(5)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]amino}pyπolidine-l- carboxylic acid (adamantan- l-yl)amide hydrochloride
Following the procedures described in Example 156, but using (5)-3- (tert-butoxycarbonylamino)pyπolidine in place of (R)-3-(tert-butoxycarbonylamino) pyπolidine in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C27Η34N6O*2 HOI.5 H2O*0.05 CH3CN:
C: 56.32; H: 6.90; N: 14.66 Found: C: 56.34; H: 6.70; N: 14.69 FAB MS: 459 (MH+).
EXAMPLE 158
(R)-3 - { [ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5 -ylmethyl] amino } pyrrolidine- 1 - carboxylic acid (2,6-difluorophenyl)amide hydrochloride Following the procedures described in Example 156, but using 2,6- difluorophenyl isocyanate in place of 1 -adamantyl isocyanate in Step A, the above- titled compound was obtained.
Elemental analysis calculated for C23H22F2N6O*2 HO0.05 H O*0.45 CHC13: C: 49.93; H: 4.39; N: 14.90 Found: C: 49.98; H: 4.37; N: 14.63
FAB MS: 437 (MH+).
EXAMPLE 159
(5)-3 - { [ 1 -(4-Cyanobenzyl)- lH-imidazol-5-ylmethyl] amino } pyπolidine- 1 -carboxylic acid (2,6-difluorophenyl)amide hydrochloride
Following the procedures described in Example 156, but using (5)-3- (tert-butoxycarbonylamino)pyrrolidine in place of (R)-3-(tert-butoxycarbonylamino) pyπolidine, and 2,6-difluorophenyl isocyanate in place of 1-adamantyl isocyanate in Step A, the above-titled compound was obtained.
Elemental analysis calculated for C23Η22F2N6O*2 HO0.55 CHC13: C: 49.18; H: 4.30; N: 14.62
Found: C: 49.20; H: 4.32; N: 14.31
FAB MS: 437 (MH+).
EXAMPLE 160
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl}pyridin- 3-ylmethyl)benzonitrile hydrochloride
Step A: Ethyl 5-(4-cyanobenzyl)nicotinate Zinc dust (acid washed then dried in vacuo, 915 mg, 14 mmol) and
1,2-dibromoethane (132 mg, 0.7 mmol) were stiπed in dry THF (7 mL) under argon at ambient temperature for 1 hr. A solution of 4-cyanobenzyl bromide (1.78 g, 9.1 mmol) in dry THF (8 mL) was added dropwise over 10 min and the resulting mixture was stiπed for 4 hrs. Ethyl 5-bromonicotinate (1.61 g, 7.0 mmol) was added in one portion, followed by NiCl2(PPh3)2 (458 mg, 0.7 mmol) and stiπing was continued at ambient temperature for 18 hrs. Saturated aqueous NH4C1 (25 mL) was added and the mixture was stirred for 2 hrs. The mixture was adjusted to pH ~ 8 by addition of saturated aqueous NaHCO3, and then extracted with EtOAc (2 x 100 mL). The combined organic extracts were dried (Na SO4), filtered, and concentrated in vacuo, and the residue was purified by silica gel chromatography, eluting with a gradient of hexane - 20% to 50% EtOAc, to yield the desired product as a pale solid.
Step B: Lithium 5-(4-cyanobenzyl)nicotinate
Ethyl 5-(4-cyanobenzyl)nicotinate, as described above in Step A, (1.06 g, 3.98 mmol) was dissolved in THF (30 mL) and H2O (4.38 mL). 1.0 N aqueous lithium hydroxide (4.38 mL, 4.38 mmol) was added and the resulting mixture was stiπed at ambient temperature for 18 hrs, then adjusted to pH 7 with 1.0 N aqueous HCl and concentrated to dryness in vacuo to give the titled lithium salt.
Step C: N-Methoxy-N-methyl-5-(4-cyanobenzyl)nicotinamide
Lithium 5-(4-cyanobenzyl)nicotinate, as described above in Step B, (502 mg, 2.06 mmol), N,0-dimethylhydroxylamine hydrochloride, (221 mg, 2.26 mmol), EDC (473 mg, 2.47 mmol), 1-hydroxybenzotriazole hydrate (278 mg, 2.06 mmol), and N,N-diisopropylethylamine (716 mL, 4.11 mmol) were combined in DMF (7 mL) and the mixture was stiπed at ambient temperature for 18 hrs. The solvent was removed under reduced pressure and the residue was partitioned between saturated aqueous Νa2CO3 (50 mL) and EtOAc (100 mL). The organic layer was dried over Na2SO , filtered, and concentrated in vacuo. The crude product was purified by flash column chromatography on silica, eluting with a gradient of EtOAc - 0% to 2% MeOH to yield the titled product.
Step D: 5 -(4-Cyanobenzyl)nicotinaldehyde
To a solution of N-methoxy-N-methyl-5-(4-cyanobenzyl) nicotinamide, as described above in Step C, (1.86 g, 6.61 mmol) in dry THF (70 mL), at -78°C, under argon, was added DIBAL (5.3 mL of a 1.5 M solution in toluene,
7.95 mmol) dropwise over 10 min. The mixture was stiπed at -78°C for 90 min, then an addi-tional portion of DIBAL (2.6 mL of a 1.5 M solution in toluene, 3.9 mmol) was added dropwise. After a further 60 min at -78°C, the reaction mixture was quenched with a solution of 5% HCl in 1 :1 MeOH - H2O (50 mL) and allowed to warm to -10°C. Saturated aqueous NaHCO3 (100 mL) and 1.0 N aqueous NaOH (15 mL) were added, and the resulting mixture was extracted with EtOAc (3 x 150 mL). The combined organic extracts were dried (Na2SO4), filtered, and concentrated in vacuo, and the cmde solid was purified by silica gel chromatography, eluting with EtOAc - 30% hexane, to yield the desired product as a crystalline solid.
Step E: (5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl} pyridin-3-ylmethyl)benzonitrile hydrochloride (5)-3-Amino-l-(3-chlorobenzyl)-2-oxopyπolidine hydrochloride (as described in Example II) (57 mg, 0.22 mmol) and 5-(4-cyanobenzyl)nicotinaldehyde, as described above in Step D, (51 mg, 0.23 mmol), were stiπed in MeOH (1 mL) and NN-diisopropyle hylamine was added dropwise to adjust the mixture to ca. pH 5, as judged by wetted pH paper. The mixture was stiπed for 30 min at ambient tempera- ture then NaCNBH3 (16 mg, 0.26 mmol) was added, AcOH was added to adjust the mixture to about pH 5, and stiπing was continued for 18 hrs. The reaction mixture was concentrated under reduced pressure, and the residual solution was partitioned between saturated aqueous NaHCO3 (1 mL) and CH2C12 (3 mL). The aqueous layer was extracted further with CH2C12 (2 x 3 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 0% to 5% MeOH - 0% to 0.5% NH4OH to yield the titled product, which was converted to the hydrochloride salt with HCl in EtOAc.
Elemental analysis calculated for C25H23N40O2 HO0.35 EtOAc*0.4 H2O: C: 54.19; H: 5.03; N: 12.34 Found: C: 54.26; H: 5.00; N: 12.35
FAB MS: 431 (MH+).
EXAMPLE 161
(5)-4-{5-[(2-Oxo-l-pyridin-4-ylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride Following the procedures described in Example 137, but using 4- aminopyridine in place of 2-aminopyridine in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C21H20N6O*3 HCl*EtOAc*0.15 H2O: C: 52.44; H: 5.51; N: 14.68 Found: C: 52.44; H: 5.57; N: 14.72
FAB MS: 373 (MH+).
EXAMPLE 162
(5)-4-{5-[(2-Oxo-l-pyridin-3-ylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 137, but using 3- aminopyridine in place of 2-aminopyridine in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C21H20N6O*3 HO0.2 EtOAc*0.6 H2O: C: 51.31; H: 5.10; N: 16.47 Found: C: 51.34; H: 5.45; N: 16.47
FAB MS: 373 (MH+).
EXAMPLE 163
(5)-4-{5-[(2-Oxo-l-pyrazin-2-ylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile trifluoroacetate
Following the procedures described in Example 137, but using aminopyrazine in place of 2-aminopyridine in Step B, and purifying the final product by HPLC on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, the above-titled compound was obtained.
Elemental analysis calculated for C20H19N7O*2 CF3CO2H*H2O:
C: 46.53; H: 3.74; N: 15.83 Found: C: 46.44; H: 3.51 ; N: 15.87 FAB MS: 374 (MH+). EXAMPLE 164
(R5)-4-{5-[(2-Oxo-l-tetrahydrofuran-3-ylpyπolidin-3-ylamino)methyl]imidazol-l- ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 137, but using (R)- 3-aminotetrahydrofuran in place of 2-aminopyridine in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C20H23N5O2*2 HO0.5 H2O: C: 53.70; H: 5.86; N: 15.65 Found: C: 53.52; H: 6.01; N: 15.82
FAB MS: 366 (MH+).
EXAMPLE 165
(5)-4-{5-[(2-Oxo-l-thiazol-2-ylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile trifluoroacetate
Following the procedures described in Example 137, but using 2- aminothiazole in place of 2-aminopyridine in Step B, and purifying the final product by HPLC on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, the above-titled compound was obtained.
Elemental analysis calculated for C19H,8N6OS*2.2 CF3CO2H*0.6 H2O: C: 43.91; H: 3.37; N: 13.13
Found: C: 43.91 ; H: 3.38; N: 13.05
FAB MS: 379 (MH+).
EXAMPLE 166
(5)-4-{5-[(l-(4-Mθφholinophenyl)-2-oxopyπolidin-3-ylamino)methyl]imidazol-l- ylmethyl} benzonitrile trifluoroacetate
Following the procedures described in Example 137, but using 4- moφholinoaniline in place of 2-aminopyridine in Step B, and purifying the final product by HPLC on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, the above-titled compound was obtained.
Elemental analysis calculated for C26H28N6O2*2.2 CF3CO2H*CHCl3: C: 45.62; H: 3.80; N: 10.16
Found: C: 45.65; H: 3.72; N: 10.10
FAB MS: 457 (MH+).
EXAMPLE 167
(R,5)-4-{5-[(l-(l-Benzylpyrrolidin-3-yl-2-oxopyπolidin-3-yla
1 -ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 137, but using (R)- 3-amino-l-benzylpyπolidine in place of 2-aminopyridine in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C27H30N6O*3 H02.5 H2O*0.45 CHC13:
C: 49.82; H: 5.84; N: 12.70 Found: C: 49.81; H: 5.81; N: 12.74 FAB MS: 455 (MH+).
EXAMPLE 168
(5)-4-{5-[(2-Oxo-l-quinolin-5-ylpyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Following the procedures described in Example 137, but using 5- aminoquinoline in place of 2-aminopyridine in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C25H22N6O*2.4 H 0.7 CHC13*1.7 H2O: C: 48.28; H: 4.48; N: 13.15 Found: C: 48.27; H: 4.48; N: 13.12
FAB MS: 423 (MH+). EXAMPLE 169
(5)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -ylamino]methanoyl } imidazol-
1 -ylmethyljbenzonitrile trifluoroacetate
Step A: Sodium 1 -(4-cyanobenzyl)-5-imidazolecarboxylate
The l-(4-cyanobenzyl)-5-imidazolecarboxaldehyde, as described in Example 1, Step E, (100 mg, 0.487 mmolj and isobutylene (1 mL) were dissolved in t-butanol. Sodium chlorite (80% purity) (65 mg, 0.584 mmol) and sodium dihydrogen phosphate (67 mg, 0.487 mmol) were dissolved in water (1 mL) and added to the aldehyde solution. The clear solution gradually became pale yellow. After 2 hrs, a precipitate had formed. This was filtered and dried to give the title compound.
Step B: (5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methanoyl} imidazol- 1 -ylmethyljbenzonitrile trifluoroacetate
(5)-3-Amino-l-(3-chlorobenzyl)2-oxopyrrolidine hydrochloride (as described in Example II) (56 mg, 0.214mmol), sodium l-(4-cyanobenzyl)-5- imidazolecarboxylate (as described in Step A) (69 mg, 0.279 mmol), 1-hydroxy- benzotriazole hydrate (43 mg, 0.322 mmol), EDC (62 mg, 0.322mmol) and N,N- diisopropylethyl amine (93 μL, 0.536 mmol) were combined in 1 mL DMF under Ar and were stiπed overnight at ambient temperature. The cmde mixture was applied onto a Gilsen preparative HLPC system, and purified on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, to afford the above-titled compound.
Elemental analysis calculated for C23H20C1N5O2*CF3CO2H*1.35 H2O*0.35 EtOAc: C:52.57; H:4.43; N:11.61 Found: C:52.58; H:4.18; N:11.58
FAB MS: 434 (MH+).
EXAMPLE 170
(R)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -ylamino]methanoy 1 } imidazol- 1 -ylmethyljbenzonitrile trifluoroacetate Following the procedures described in Example 169, but using (R)-3- amino-l-(3-chlorobenzyl)2-oxopyπolidine hydrochloride, as described in Example IH, in place of (5)-3-amino-l-(3-chlorobenzyl)2-oxopyrrolidine hydrochloride in Step B, the above-titled compound was obtained.
Elemental analysis calculated for C23H20C1N5O2*CF3CO2H *0.55 H2O*0.35 EtOAc:
C:53.86; H:4.26; N:11.90 Found: C:53.83; H:3.90; N:11.86
FAB MS: 434 (MH+).
EXAMPLE 171
(35)-4-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methanoyl}-3- (4-cyanophenyl)-2,3-dihydro-imidazo[2,l-b]thiazole, diastereomers A & B, trifluoroacetate
Step A: Ethyl 2-[2-(4-cyanophenyl)-2-oxo-ethylthio]-3H-imidazole-4- carboxylate
To a solution of 4-ethoxycarbonylimidazole-2-thiol (8.22 g, 47.8 mmol) and potassium carbonate (19.8 g, 143 mmol) in dry acetonitrile (100 mL) at ambient temperature was added 4-cyanophenacyl bromide (10.7 g, 47.8 mmol). The reaction mixture was stiπed for 20 hrs, during which time a white precipitate formed. To the solution was added ice-water (100 mL). The resulting solid was filtered and washed with water (2 x 25 mL) to provide the title product as an off-white solid.
Step B: Ethyl 2-[2-(4-cyanophenyl)-2-hydroxy-l-ethylthio]-3H-imidazole-4- carboxyate
Ethyl 2-[2-(4-cyanophenyl)-2-oxo-ethylthio]-3H-imidazole-4- carboxylate, as described above in Step A, (6.91 g, 21.9 mmol) was suspended in methanol (50 mL). Sodium borohydride (829 mg, 21.9 mmol) was added in portions at 0°C, and the suspension was stiπed until it became homogeneous (1 hr). The reaction was quenched by the addition of saturated aqueous ammonium chloride until hydrogen evolution ceased. The resulting precipitate was filtered and washed with water (2 x 25 mL) to provide the title product as a white. Step C: Ethyl 3-(4-cyanophenyl)-2,3-dihydroimidazo[2,l-b]thiazole-5- carboxylate
To a solution of ethyl 2-[2-(4-cyanophenyl)-2-hydroxy-l-ethylthio]-
3H-imidazole-4-carboxyate, as described above in Step B, (6.95 g, 21.9 mmol) and N,N-diisopropylethylamine (1 1.4 mL, 65.7 mmol) in methylene chloride (300 mL) and DMF (50 mL) was added di-tert-butyl dicarbonate (6.69 g, 30.7 mmol) at 0°C.
The reaction mixture was stiπed for 24 hrs, then methanesulfonic anhydride (7.63 g,
43.8 mmol) was added in one portion. The reaction mixture was stiπed for 3 hrs at
25°C and 16 hrs at reflux, then poured into saturated aqueous sodium bicarbonate and extracted with methylene chloride (3 x 100 mL). The combined organic layers were dried over sodium sulfate, filtered, and concentrated in vacuo to provide a yellow oil.
The cmde product was purified by flash column chromatography, eluting with a gradient of 50 to 70% ethyl acetate in hexane, to provide the title compound as a yellow oil.
Step D: 3-(4-Cyanophenyl)-2,3-dihydroimidazo[2,l-b]thiazole-5-carboxylic acid hydrochloride
To a solution of ethyl 3-(4-cyanophenyl)-2,3-dihydroimidazo[2,l-b] thiazole-5-carboxylate, as described above in Step C, (4.81 g, 16.1 mmol) in ethanol (10 mL) and methylene chloride (10 mL) at 0°C was added sodium hydroxide (10 M in water, 2.09 mL, 20.9 mmol). After stirring for 16 hours, the organic solvents were evaporated in vacuo at 25°C, and the water was removed by a stream of nitrogen. The cmde product was acidified by the addition of hydrogen chloride (1 M in diethylether,
40 mL) and reconcentrated to provide the cmde product as a white solid.
Step E: (35)-4-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]mefhanoyl}-
3-(4-cyanophenyl)-2,3-dihydro-imidazo[2,l-b]thiazole, diastereomers
A & B, trifluoroacetate
(5)-3-Amino-l-(3-chlorobenzyl)2-oxopyπolidine hydrochloride (as described in Example II) (56 mg, 0.214 mmol), 3-(4-cyanophenyl)-2,3-dihydro- imidazo[2,l-b]thiazole-5-carboxylic acid hydrochloride (as described above in Step
D) (115 mg, 0.375 mmol), 1 -hydroxybenzotriazole hydrate (60 mg, 0.429 mmol),
EDC (82 mg, 0.429 mmol) and N,N-diisopropylethylamine (360 μL, 2.06 mmol) were combined in DMF (1 mL) and stiπed overnight at ambient temperature. The crude mixture was applied onto a Gilsen preparative ΗLPC system, and purified on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, to afford the above-titled compound as an approximately 1 : 1 mixture of two diastereomers.
Elemental analysis calculated for C24H20C1N5O2S *CF3CO2H*0.6 H2O*0.25 EtOAc: C:51.90; H:3.90; N:11.21 Found: C:51.93; H:3.56; N:11.20
FAB MS: 478 (MH+).
EXAMPLE 172
(3RJ-4- { [ 1 -(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methanoyl} -3-(4- cyanophenyl)-2,3-dihydro-imidazo[2,l-b]thiazole, diastereomers A & B, trifluoroacetate Following the procedures described in Example 171, but using (Rj-3- amino-l-(3-chlorobenzyl)2-oxopyrrolidine hydrochloride, as described in Example IH, in place of (5)-3-amino-l-(3-chlorobenzyl)2-oxopyπolidine hydrochloride in Step E, the above-titled compound was obtained.
Elemental analysis calculated for C24H20C1N5O2S *CF3CO2H*0.2 CH3CN*0.3 EtOAc:
C:52.90; H:3.86; N:11.62 Found: C:53.27; H:3.61; N:11.62
FAB MS: 478 (MH+).
EXAMPLE 173
2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyπolidin-3-ylamino)ethyl]imidazol-l-ylmethyl} benzonitrile hydrochloride
Step A: l-(tert-Butoxycarbonyl)-4-[2-(tert-butoxycarbonylamino)ethyl] imidazole
To a stiπed suspension of histamine dihydrochloride (23.6 g, 128 mmol) in MeOH (270 mL) was added di-tert-butyl dicarbonate (58.8 g, 269 mmol) in MeOH (180 mL), dropwise. The resulting mixture was stiπed at ambient temperature for 18 hrs, then concentrated under reduced pressure. The residue was partitioned between H2O (200 mL) and CH2C12 (700 mL), and the aqueous phase was adjusted to pH = 5.5 with 1.0 N aqueous HCl. After extraction, the CH2C12 layer was washed with H2O (200 mL), then brine (200 mL), then dried over Na2SO4, filtered, and concentrated in vacuo. The cmde solid was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 0% to 3% MeOH to yield the titled product.
Step B: α,α-Dibromo-4-cyano-3-fluorotoluene To a solution of 4-cyano-3 -fluoro toluene, as described in Example
127, Step C, (4.0 g, 29.6 mmol) in carbon tetrachloride (250 mL) was added N- bromosuccinimide (10.5 g, 59.2 mmol) and 2,2'-azobisisobutyronitrile (490 mg, 3.0 mmol). The reaction mixture was heated to reflux under argon for 24 hrs, then cooled to room temperature, filtered, and concentrated under reduced pressure. The residue was purified by silica gel chromatography, eluting with a gradient of hexane - 3% to 7% EtOAc, to yield the titled product as a yellow-brown solid.
Step C: 4-Cyano-3-fluorobenzaldehyde
To a solution of α,α-dibromo-4-cyano-3-fluorotoluene, as described above in Step B, (5.60 g, 19.1 mmol) in EtOH (255 mL) and water (45 mL) was added AgNO3. The mixture was heated to reflux for 3 hrs, then stood at ambient temperature for 18 hrs, then the solid was removed by filtration and the filtrate was concentrated under reduced pressure to a volume of approximately 20 mL. Water (30 mL) was added, and the mixture was concentrated to dryness in vacuo. The residue was partitioned between saturated aqueous NaHCO3 (20 mL) and CH2C12 (50 mL). The aqueous layer was extracted further with CH2C12 (2 x 50 mL). The combined organic extracts were dried over Na SO4, filtered, and concentrated in vacuo. The residue was dried for several days at ca. 0.5 mm Hg to yield the desired aldehyde as a pale solid.
Step D: 4-Cyano-3-fluorobenzyl alcohol
To a stiπed solution of 4-cyano-3-fluorobenzaldehyde, as described above in Step C, (620 mg, 4.16 mmol) in EtOH (30 mL) at 0°C was added NaBH4
(157 mg, 4.16 mmol) in one portion. The reaction mixture was stiπed at 0°C for 10 min, then 10% aqueous citric acid (10 mL) was added and the solvent was removed under reduced pressure. The residue was partitioned between saturated aqueous NaHCO3 (10 mL) and CH2C12 (30 mL). The aqueous layer was extracted further with CH2C12 (30 mL). The combined organic extracts were dried over MgSO4, filtered, and concentrated in vacuo to provide the titled compound as a white solid.
Step E: 5-[2-(tert-Butoxycarbonylamino)ethyl]- 1 -(4-cyano-3 -fluorobenzyl) imidazole
To a stiπed solution of 4-cyano-3-fluorobenzyl alcohol, as described above in Step D, (18.9 g, 125 mmol) and N,/V-diisopropylethylamine (28.3 mL, 163 mmol) in CH2C12 (500 mL), at -78°C, under argon, was added trifluoromethane- sulfonic anhydride (21.1 mL, 125 mmol), dropwise. The reaction mixture was stirred at -78°C for 15 min, then a solution of l-(tert-butoxycarbonyl)-4-[2-(tert- butoxycarbonylamino)ethyl]imidazole, as described above in Step A, (39.0 g, 125 mmol) in CH2C12 (300 mL) was added slowly. The reaction mixture was allowed to warm slowly to ambient temperature, then stiπed for 18 hrs, then saturated aqueous NaHCO3 (250 mL) was added. After 4 hrs, the organic layer was extracted, washed with H2O (2 x 200 mL), then brine (200 mL), then dried over NajSO.,, filtered, and concentrated in vacuo. The cmde product was purified by flash column chroma- tography on silica, eluting with a gradient of CH2C12 - 0% to 5% MeOH - 0% to 0.5% NH4OH, to yield the titled product.
Step F: 5-(2-Aminoethyl)-l-(4-cyano-3-fluorobenzyl)imidazole
A solution of 5-[2-(tert-butoxycarbonylamino)ethyl]-l-(4-cyano-3- fluorobenzyl)imidazole, as described above in Step E, (41.8 g, 121 mmol) in EtOAc (500 mL) was saturated with HCl (g) at 0°C. The mixture was stood at 0°C for 10 min, then concentrated under reduced pressure. The residue was partitioned between saturated aqueous Na2CO3 (250 mL) and CH2C12 (500 mL). The aqueous layer was saturated with NaCl and extracted further with CHC13 (4 x 800 mL). The combined organic extracts were dried over Na2SO4, filtered, and concentrated in vacuo to afford the titled product as an oil.
Step G: 2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyπolidin-3- ylamino)ethyl]imidazol-l -ylmethyljbenzonitrile hydrochloride A mixture of 5-(2-aminoethyl)-l-(4-cyano-3-fluorobenzyl) imidazole, as described above in Step F, (105 mg, 0.43 mmol), 3-bromo-l-phenyl-2- pyπolidinone (52 mg, 0.215 mmol), and K2CO3 (33 mg, 0.236 mmol) in dry DMF (0.5 mL) was stiπed at ambient temperature for 24 hrs. The reaction mixture was poured into saturated aqueous NaHCO3 (5 mL) and extracted with CH2C12 (15 mL). The organic extract was dried over Na^O^ filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1% to 6% MeOH - 0.1% to 0.6% NH4OH to yield the desired product, which was converted to the hydrochloride salt by treatment with HCl in EtOAc.
Elemental analysis calculated for C23H24FN5O*2 HOl.3 H2O*l.l EtOAc:
C:55.15; H:5.98; N:11.74 Found: C:55.19; H:5.58; N: 11.70 FAB MS: 404 (MH+).
EXAMPLE 174
4-(5-{[l-(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyπolidin-3-ylamino] ethyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile hydrochloride
Step A: 3-(tert-Butoxycarbonylamino)-2-oxopyπolidine
3-Amino-2-oxopyπolidine was prepared according to the procedure described by R. Pellegata et al, Synthesis, 22, 614-616 (1978). To a solution of 3- amino-2-oxopyπolidine (6.96 g, 69.5 mmol) in DMF (30 mL) was added triethylamine (7.03 g, 69.5 mmol) and di-tert-butyl dicarboxylate (15.2 g, 69.5 mmol). The reaction mixture was stiπed at ambient temperature for 18 hrs, then concentrated in vacuo. The residue was partitioned between saturated aqueous NaHCO3 and EtOAc. The layers were separated and the organic extract was washed with H2O, then brine, then dried over Na2SO4, filtered, and concentrated in vacuo to provide the titled product.
Step B: Methanesulfonic acid 4-bromo-3-methylphenyl ester
To a stiπed solution of 4-bromo-3-methylphenol (9.87 g, 52.8 mmol) and triethylamine (10.70 g, 106 mmol) in CH2C12 (50 mL) at 0°C was added methane- ulfonyl chloride (7.25 g, 63.3 mmol), dropwise. After 30 min at 0°C, the reaction mixture was concentrated in vacuo. The residue was partitioned between saturated aqueous NaHCO3 and EtOAc. The layers were separated and the organic extract was washed with aqueous NaHCO3, then 3 N aqueous HCl, then brine, then dried over N^SO,, filtered, and concentrated in vacuo to provide the titled product.
Step C: Methanesulfonic acid 4-bromo-3-bromomethylphenyl ester
A mixture of methanesulfonic acid 4-bromo-3-mefhylphenyl ester, as described above in Step B, (14.3 g, 53.9 mmol), N-bromosuccinimide (14.4 g, 80.9 mmol), and 2,2'-azobts,isobutyronitrile (1.34 g, 8.16 mmol) in CC14 was heated at 80°C for 18 hrs. The solvent was removed under reduced pressure and the residue was purified by silica gel chromatography, eluting with a gradient of hexane - 5% to 20% EtOAc, to yield the titled product.
Step D: Methanesulfonic acid 4-bromo-3-(3-tert-butoxycarbonylamino-2- oxopyπolidin- 1 -ylmethyljphenyl ester
To a solution of 3-(tert-butoxycarbonylamino)-2-oxopyπolidine , as described above in Step A, (1.00 g, 4.99 mmol) in THF (10 mL) was added sodium hydride (230 mg of a 60% dispersion in oil, 5.75 mmol) in THF (5 mL), dropwise. The resulting mixture was stiπed for 30 min at ambient temperature, then a solution of methanesulfonic acid 4-bromo-3-bromomethylphenyl ester, as described above in Step C, (1.96 g, 5.70 mmol) in THF (6 mL) was added dropwise and stiπing was continued for 2 hrs. The reaction was quenched with saturated aqueous NH4C1 (3 mL), then concentrated in vacuo. The residue was partitioned between saturated aqueous NaHCO3 and EtOAc. The layers were separated and the organic extract was washed with H2O, then brine, then dried over Na^O,,, filtered, and concentrated in vacuo. The residue was purified by silica gel chromatography, eluting with CH2C12 - 5% MeOH, to yield the titled product.
Step E: 3-Amino-l-(2-bromo-5-methanesulfonyloxybenzyl)-2-oxopyπolidine hydrochloride
A solution of methanesulfonic acid 4-bromo-3-(3-tert-butoxycarbonyl- mino-2-oxopyrrolidin-l-ylmethyl)phenyl ester, as described above in Step D, (720 mg, 1.55 mmol) in EtOAc (40 mL) at 0°C was saturated with HCl (g). After 15 min, the mixture was concentrated in vacuo to yield the above-titled amine hydrochloride.
Step F: 4-(5-{[l-(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyπolidin-
3-ylamino]methyl} imidazol- l-ylmethyl)-2-fluorobenzonitrile hydrochloride
3-Amino-l-(2-bromo-5-methanesulfonyloxybenzyl)-2-oxopyπolidine, as described above in Step E, (640 mg, 1.12 mmol), l-(4-cyano-3-fluorobenzyl)-5- imidazolecarboxaldehyde, as described above in Example 127, Step G, (333 mg, 1.45 mmol) were stirred in MeOH (8 mL) and the solution was acidified to pH = 5-6, as judged by wetted pH indicator paper, with acetic acid. Stirring was continued for 30 min, then NaCNBH3 (118 mg, 1.88 mmol) was added. Stiπing was continued for 18 hrs, then the reaction was quenched with saturated aqueous NaHCO3 (2 mL) and most of the MeOH was removed under reduced pressure. The residual solution was partitioned between saturated aqueous NaHCO3 (10 mL) and EtOAc (20 mL). The aqueous layer was extracted further with EtOAc (2 x 20 mL). The combined organic extracts were washed with brine, dried over Na;,SO4, filtered, and concentrated in vacuo. The cmde product was purified by flash column chromatography on silica, eluting with a gradient of CH2C12 - 1% to 5% MeOH, to yield the desired product which was converted to the hydrochloride salt by treatment with HCl in ether.
Elemental analysis calculated for C24H23BrFN5O4S*2 H02.5 CH3CN*1.25 CH2C12: C: 42.33; H: 4.11; N: 12.24 Found: C: 42.36; H: 4.03; N: 12.26
FAB MS: 576 (79BrMH+).
EXAMPLE 175
(5)-3-{[l-(4-Cyanobenzyl)imidazol-5-yl]methylamino}-l-[(2-ethoxybenzyl) oxycarbonyljpyπolidine trifluoroacetate
Step A: (5)-l -[(2-Ethoxybenzyl)oxycarbonyl]-3-(trifluoroacetamido) pyπolidine (5)-3-(Trifluoroacetamido)pyπolidine hydrochloride (219 mg,1.0 mmol) was added to a solution of 2-ethoxybenzyl 4-nitrophenyl carbonate (317 mg, 1.0 mmol) and 4-dimethylaminopyridine (120 mg, 1.0 mmol) in DMF (1 mL). The mixture was heated to 75°C for 1 hr then stiπed overnight at ambient temperature. The cmde mixture was partitioned between H2O and CHC13 and the CHC13 extract was dried (Na^OJ, filtered and concentrated in vacuo to provide the titled product.
Step B: (5)-3-Amino-l-[(2-ethoxybenzyl)oxycarbonyl]pyrrolidine
(5)-l-[(2-Ethoxybenzyl)oxycarbonyl]-3-(trifluoroacetamido) pyπolidine, as described above in Step A, (360 mg, 1.0 mmol) was dissolved in
MeOH (1 mL) and aqueous NaOH (2 mL of a 1.25 N solution, 2.5 mmol) and stiπed at ambient temperature until starting amide disappeared, as judged by HPLC analysis. The reaction mixture was extracted with CH2C12 (3 x 5 mL) and the combined organic extracts were dried over
Figure imgf000223_0001
filtered, and concentrated in vacuo to afford the titled product.
Step C: (5 3 - { [ 1 -(4-Cyanobenzyl)imidazol-5 -yl]methylamino } - 1 - [(2- ethoxybenzyl)oxycarbonyl]pyπolidine trifluoroacetate
(5)-3-Amino-l -[(2-ethoxybenzyl)oxycarbonyl]pyrrolidine, as described above in Step B, (260 mg, 0.98 mmol) was treated with Ti(z'-PrO)4 (0.3 mL, 1.0 mmol) and l-(4-cyanobenzyl)-5-imidazolecarboxaldehyde, as described in Example 1, Step E, (200 mg, 0.97 mmole) for 2 hrs at ambient temperature. Ethanol (1 drop) and NaCNBH3 (75 mg, 1.2 mmol) were added. The mixture was stiπed for 4 hrs at ambient temperature then treated with additional NaCNBH3 (50 mg, 0.8 mmol) and stiπed overnight. The reaction mixture was partitioned between aqueous NaOH and CH2C12. The CH2C12 extract was dried over Na^O.,, filtered, and concentrated in vacuo. The cmde mixture was purified by preparative HLPC system on a C-18 column, eluting with a gradient of 0.1% aqueous trifluoroacetic acid - 5% to 95% CH3CN, to afford the above-titled compound.
Elemental analysis calculated for C26H31N5O3*2.35 CF3CO2H:
C:50.56; H:4.36; N:9.60 Found: C:50.57; H:4.08; N:9.34 EXAMPLE 176
3-{[l-(4-Cyanobenzyl)-2-methylimidazol-5-yl]methylamino}-l-[(2- trifluoromethoxybenzyl)oxycarbonyl]pyπolidine hydrochloride
Step A: 4-Nitrophenyl 2-trifluoromethoxybenzyl carbonate
A solution of 2-trifluoromethoxybenzyl alcohol (353 mg, 1.84 mmol) and 4-nitrophenyl chloroformate (409 mg, 2.03 mmol) in 7:1 THF/acetonitrile (5 mL), under a nitrogen atmosphere, are treated with pyridine (0.164 mL, 2.03 mmol) and the resulting suspension is stiπed vigorously at ambient temperature for 18 hrs. The reaction is concentrated in vacuo to give a clear oil, which is purified by flash column chromatography on silica, eluting with hexanes - 10% EtOAc to yield the desired product.
Step B: 3-Amino-l-[(2-trifluoromethoxybenzyl)oxycarbonyl]pyπolidine
To a solution of 3-(tert-butoxycarbonylamino)pyπolidine (0.135 g, 0.724 mmol) in CH2C12 (4 mL) is added N,N-diisopropylethylamine (0.132 mL, 0.759 mmol) and 4-nitrophenyl 2-(trifluoromefhoxy)benzyl carbonate, as described above in Step A, (284 mg, 0.796 mmol). The reaction is stiπed at ambient temperature for 18 hrs and then is purified by flash column chromatography on silica, eluting with hexanes - 30% EtOAc to yield a white solid. This solid is treated with neat trifluoroacetic acid and is isolated as the free base form upon partitioning with dilute Νa^O-, and CH2C12. The titled product is isolated by drying (ΝajSO^ and concentrating to a yellow oil.
Step C: 4-Bromo-2-methylimidazole-5-carboxaldehyde _^___^
4-Bromo-5-hydroxymethyl-2-methylimidazole is prepared according to the procedure described by S. P. Watson, Synthetic Communications, 22, 2971- 2977 (1992). A solution of 4-bromo-5-hydroxymethyl-2-methylimidazole (4.18 g, 21.9 mmol) is refluxed with manganese dioxide (16.1 g) in 1 :1 CH2Cl2:dioxane (200 mL) for 16 hrs. The cooled reaction is filtered through celite and is concentrated to yield the title compound as a pale yellow solid.
Step D: 4-Bromo- 1 -(4-cyanobenzyl)-2-methylimidazole-5 -carboxaldehyde 4-Cyanobenzylbromide (1.05 g, 5.39 mmol) is added to a solution of 4-bromo-2-methylimidazole-5-carboxaldehyde, as described above in Step C, (1.02 g, 5.39 mmol) in dimethylacetamide (15 mL). The solution is cooled to -10°C and powdered potassium carbonate (0.745 g, 5.39 mmol) is added. The reaction mixture is stiπed at -10°C for 2 hrs, and a further 4 hrs at 20°C. The reaction mixture is diluted with water and extracted with ethyl acetate. The organic phase is washed with water, then brine, and is dried over MgSO4. Solvent evaporation yields the titled product.
Step E: l-(4-Cyanobenzyl)-2-methylimidazole-5-carboxaldehyde
A solution of 4-bromo-l-(4-cyanobenzyl)-2-methylimidazole-5- carboxaldehyde, as described above in Step D, (1.33 g, 4.37 mmol) and imidazole (0.600 g, 8.74 mmol) in 1 :1 ethyl acetate-alcohol (150 mL) is stiπed with 10% palladium on carbon (0.020 g) under 1 atm hydrogen. After 2 hrs, the reaction is filtered through celite and is concentated in vacuo to give the title compound.
Step F: 3 - { [ 1 -(4-Cyanobenzyl)-2-methylimidazol-5-yl]methylamino } - 1 - [(2- trifluoromethoxybenzyl)oxycarbonyl]pyrrolidine hydrochloride
Following the procedures described in Example 1, Step J, but using 3- amino- l-[(2-trifluoromethoxybenzyl)oxycarbonyl]pyπolidine (as described above in Step B) in place of (R)-3-amino-2-oxo-l-phenylpyπolidine, and 1 -(4-cyanobenzyl)- 2-methylimidazole-5-carboxaldehyde (as described above in Step E) in place of l-(4- cyanobenzyl)-5-imidazole-carboxaldehyde, the above-titled compound is obtained.
EXAMPLE 177
In vitro inhibition of Ras famesyl transferase
Transferase Assays. Isoprenyl-protein transferase activity assays are carried out at 30°C unless noted otherwise. A typical reaction contains (in a final volume of 50 μL): [3H]farnesyl diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl2, 5 mM dithiothreitol, 10 μM ZnCl2, 0.1% polyethyleneglycol (PEG)
(15,000-20,000 mw) and isoprenyl-protein transferase. The FPTase employed in the assay is prepared by recombinant expression as described in Omer, C.A., Krai, A.M., Diehl, R.E., Prendergast, G.C., Powers, S., Allen, CM., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry 32:5167-5176. After thermally pre-equilibrating the assay mixture in the absence of enzyme, reactions are initiated by the addition of isoprenyl- protein transferase and stopped at timed intervals (typically 15 min) by the addition of 1 M HCl in ethanol (1 mL). The quenched reactions are allowed to stand for 15 m (to complete the precipitation process). After adding 2 mL of 100% ethanol, the reactions are vacuum-filtered through Whatman GF/C filters. Filters are washed four times with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL) and then counted in a Beckman LS3801 scintillation counter.
For inhibition studies, assays are mn as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 20-fold into the enzyme assay mixture. Substrate concentrations for inhibitor IC50 determinations are as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 25), 100 nM famesyl diphosphate.
The compounds of the instant invention are tested for inhibitory activity against human FPTase by the assay described above. The compounds of the instant invention described in the above
Examples 1-175 were tested for inhibitory activity against human FPTase by the assay described above and were found to have an IC50 of < 10 μM.
EXAMPLE 178
Modified In vitro GGTase inhibition assay
The modified geranylgeranyl-protein transferase inhibition assay is carried out at room temperature. A typical reaction contains (in a final volume of 50 μL): [3H]geranylgeranyl diphosphate, biotinylated Ras peptide, 50 mM HEPES, pH 7.5, a modulating anion (for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl2, 10 μM ZnCl2, 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol, and geranylgeranyl-protein transferase type I(GGTase). The GGTase-type I enzyme employed in the assay is prepared as described in U.S. Patent No. 5,470,832, incoφorated by reference. The Ras peptide is derived from the K4B-Ras protein and has the following sequence: biotinyl-GKKKKKKSKTKCVIM (single amino acid code) (SEQ.ID.NO.: 2). Reactions are initiated by the addition of GGTase and stopped at timed intervals (typically 15 min) by the addition of 200 μL of a 3 mg/mL suspension of streptavidin SPA beads (Scintillation Proximity Assay beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50 mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand for 2 hours before analysis on a Packard TopCount scintillation counter.
For inhibition studies, assays are run as described above, except inhibitors are prepared as concentrated solutions in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme assay mixture. IC5o values are determined with Ras peptide near K]yχ concentrations. Enzyme and substrate concentrations for inhibitor IC50 determinations are as follows: 75 pM GGTase-I, 1.6 mM Ras peptide, 100 nM geranylgeranyl diphosphate.
The compounds of the instant invention, including those compounds described in the above Examples 1-176, are tested for inhibitory activity against human GGTase-type I by the assay described above.
EXAMPLE 179
Cell-based in vitro ras famesylation assay
The cell line used in this assay is a v-ras line derived from either Ratl or NIH3T3 cells, which expressed viral Ha-ras p21. The assay is performed essentially as described in DeClue, J.E. et al., Cancer Research 51 :712-717, (1991). Cells in 10 cm dishes at 50-75% confluency are treated with the test compound (final concentration of solvent, methanol or dimethyl sulfoxide, is 0.1%). After 4 hours at 37°C, the cells are labeled in 3 ml methionine-free DMEM supple-mented with 10% regular DMEM, 2% fetal bovine serum and 400 μCi[35S]methionine (1000 Ci/mmol). After an additional 20 hours, the cells are lysed in 1 ml lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/lmM DTT/10 mg/ml aprotinen/2 mg/ml leupeptin 2 mg/ml antipain 0.5 mM PMSF) and the lysates cleared by centrifugation at 100,000 x g for 45 min. Aliquots of lysates containing equal numbers of acid- precipitable counts are bought to 1 ml with IP buffer (lysis buffer lacking DTT) and immuno-precipitated with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J. Virol. 43:294-304, (1982)). Following a 2 hour antibody incubation at 4°C, 200 ml of a 25% suspension of protein A-Sepharose coated with rabbit anti rat IgG is added for 45 min. The immuno-precipitates are washed four times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA 1% Triton X-100.0.5% deoxycholate/0.1%/SDS/ 0.1 M NaCl) boiled in SDS-PAGE sample buffer and loaded on 13% acrylamide gels. When the dye front reached the bottom, the gel is fixed, soaked in Enlightening, dried and autoradiographed. The intensities of the bands coπesponding to farnesylated and nonfamesylated ras proteins are compared to determine the percent inhibition of famesyl transfer to protein.
EXAMPLE 180
Cell-based in vitro growth inhibition assay
To determine the biological consequences of FPTase inhibition, the effect of the compounds of the instant invention on the anchorage-independent growth of Ratl cells transformed with either a v-ras, v-raf, or v-mos oncogene is tested. Cells transformed by v-Raf and v-Mos maybe included in the analysis to evaluate the specificity of instant compounds for Ras-induced cell transformation. Rat 1 cells transformed with either v-ras, v-raf, or v-mos are seeded at a density of 1 x 104 cells per plate (35 mm in diameter) in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine semm) over a bottom agarose layer (0.6%). Both layers contain 0.1% methanol or an appropriate concentration of the instant compound (dissolved in methanol at 1000 times the final concentration used in the assay). The cells are fed twice weekly with 0.5 ml of medium A containing 0.1% methanol or the concentration of the instant compound. Photomicrographs are taken 16 days after the cultures are seeded and comparisons are made.
EXAMPLE 181
Constmction of SEAP reporter plasmid pDSElOO The SEAP reporter plasmid, pDSElOO was constructed by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV- RE-AKI. The SEAP gene is derived from the plasmid pSEAP2 -Basic (Clontech, Palo Alto, CA). The plasmid pCMV-RE-AKI was constmcted by Deborah Jones (Merck) and contains 5 sequential copies of the 'dyad symmetry response element' cloned upstream of a 'CAT-TATA' sequence derived from the cytomegalovims immediate early promoter. The plasmid also contains a bovine growth hormone poly-A sequence.
The plasmid, pDSElOO was constmcted as follows. A restriction fragment encoding the SEAP coding sequence was cut out of the plasmid pSEAP2- Basic using the restriction enzymes EcoRl and Hpal. The ends of the linear DNA fragments were filled in with the Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA containing the SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1694 base pair fragment. The vector plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II and the ends filled in with Klenow DNA Polymerase I. The SEAP DNA fragment was blunt end ligated into the pCMV-RE-AKI vector and the hgation products were transformed into DH5-alpha E. coli cells (Gibco-BRL). Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constmcts were sequenced across the cloning junctions to verify the coπect sequence. The resulting plasmid contains the SEAP coding sequence downstream of the DSE and CAT-TATA promoter elements and upstream of the BGH poly-A sequence.
Alternative Constmction of SEAP reporter plasmid, pDSElOl
The SEAP repotrer plasmid, pDSElOl is also constmcted by ligating a restriction fragment containing the SEAP coding sequence into the plasmid pCMV-RE-AKI. The SEAP gene is derived from plasmid pGEM7zf(-)/SEAP. The plasmid pDSElOl was constructed as follows: A restriction fragment containing part of the SEAP gene coding sequence was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction enzymes Apa I and Kpnl. The ends of the linear DNA fragments were chewed back with the Klenow fragment of E. coli DNA Polymerase I. The "blunt ended" DNA containing the truncated SEAP gene was isolated by electrophoresing the digest in an agarose gel and cutting out the 1910 base pair fragment. This 1910 base pair fragment was ligated into the plasmid pCMV-RE-AKI which had been cut with Bgl-II and filled in with E. coli Klenow fragment DNA polymerase. Recombinant plasmids were screened for insert orientation and sequenced through the ligated junctions. The plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796-
1807) by removing an EcoRI fragment containing the DHFR and Neomycin markers. Five copies of the fos promoter semm response element were inserted as described previously (Jones, R.E., Defeo- Jones, D., McAvoy, E.M., Vuocolo, G.A., Wegrzyn, R.J., Haskell, K.M. and Oliff, A. (1991) Oncogene, 6, 745-751) to create plasmid pCMV-RE-AKI. The plasmid pGEM7zf(-)/SEAP was constmcted as follows. The SEAP gene was PCRed, in two segments from a human placenta cDNA library (Clontech) using the following oligos.
Sense strand N-terminal SEAP : 5' GAGAGGGAATTCGGGCCCTTCCTGCAT GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.NO. :3)
Antisense strand N-terminal SEAP: 5 ' GAGAGAGCTCGAGGTTAACCCGGGT GCGCGGCGTCGGTGGT 3' (SEQ.ID.NO. :4)
Sense strand C-terminal SEAP: 5' GAGAGAGTCTAGAGTTAACCCGTGGTCC CCGCGTTGCTTCCT 3' (SEQ.ID.NO.: 5)
Antisense strand C-terminal SEAP: 5' GAAGAGGAAGCTTGGTACCGCCACTG GGCTGTAGGTGGTGGCT 3' (SEQ.ID.NO. :6)
The N-terminal oligos (SEQ.ID.NO.: 3 and SEQ.ID.NO.: 4) were used to generate a 1560 bp N-terminal PCR product that contained EcoRI and Hpal restriction sites at the ends. The Antisense N-terminal oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon within the SEAP gene along with the Hpal site. The
C-terminal oligos (SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 bp C-terminal PCR product containing Hpal and Hindlll restriction sites. The sense strand C-terminal oligo (SEQ.ID.NO.: 5) introduces the internal STOP codon as well as the Hpal site. Next, the N-terminal amplicon was digested with EcoRI and Hpal while the C-terminal amplicon was digested with Hpal and Hindlll. The two fragments comprising each end of the SEAP gene were isolated by electrophoresing the digest in an agarose gel and isolating the 1560 and 412 base pair fragments. These two fragments were then co-ligated into the vector pGEM7zf(-) (Promega) which had been restriction digested with EcoRI and Hindlll and isolated on an agarose gel. The resulting clone, pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from amino acids.
Constmction of a constitutively expressing SEAP plasmid pCMV-SEAP-A
An expression plasmid constitutively expressing the SEAP protein was created by placing the sequence encoding a tmncated SEAP gene downstream of the cytomegalovims (CMV) IE-1 promoter. The expression plasmid also includes the CMV intron A region 5' to the SEAP gene as well as the 3' untranslated region of the bovine growth hormone gene 3' to the SEAP gene.
The plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61 :1796-1807) containing the CMV immediate early promoter was cut with EcoRI generating two fragments. The vector fragment was isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI. Next, the cytomegalovims intron A nucleotide sequence was inserted downstream of the CMV IE1 promter in pCMV-AKI. The intron A sequence was isolated from a genomic clone bank and subcloned into pBR322 to generate plasmid pl6T-286. The intron A sequence was mutated at nucleotide 1856 (nucleotide numbering as in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L., Nuc.Acids Res. 19, 3979-3986) to remove a Sad restriction site using site directed mutagenesis. The mutated intron A sequence was PCRed from the plasmid pl6T-287 using the following oligos.
Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3' (SEQ.ID.NO.: 7)
Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3' (SEQ.ID.NO.: 8)
These two oligos generate a 991 base pair fragment with a Sad site incoφorated by the sense oligo and a Bgl-II fragment incoφorated by the antisense oligo. The PCR fragment is trimmed with Sad and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI is cut with Sad and Bgl-II and the larger vector fragment isolated by agarose gel electrophoresis. The two gel isolated fragments are ligated at their respective Sad and Bgl-II sites to create plasmid pCMV-AKI-InA.
The DNA sequence encoding the tmncated SEAP gene is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector. The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above) using EcoRI and Hindlll. The fragment is filled in with Klenow DNA polymerase and the 1970 base pair fragment isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI- InA vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final constmct is generated by blunt end ligating the SEAP fragment into the pCMV-AKI-InA vector. Transformants were screened for the proper insert and then mapped for restriction fragment orientation. Properly oriented recombinant constmcts were sequenced across the cloning junctions to verify the correct sequence. The resulting plasmid, named pCMV-SEAP-A (deposited in the ATCC under Budapest Treaty on August 27, 1998, and designated ATCC), contains a modified SEAP sequence downstream of the cytomegalovims immediately early promoter IE-1 and intron A sequence and upstream of the bovine growth hormone poly-A sequence. The plasmid expresses SEAP in a constitutive manner when transfected into mammalian cells.
Alternative constmction of a constitutively expressing SEAP plasmid pCMV-SEAP- B
An expression plasmid constitutively expressing the SEAP protein can be created by placing the sequence encoding a tmncated SEAP gene downstream of the cytomegalovims (CMV) IE-1 promoter and upstream of the 3' unstranslated region of the bovine growth hormone gene.
The plasmid pCMVIE-AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny, A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61:1796-1807) containing the CMV immediate early promoter and bovine growth hormone poly-A sequence can be cut with EcoRI generating two fragments. The vector fragment can be isolated by agarose electrophoresis and religated. The resulting plasmid is named pCMV-AKI. The DNA sequence encoding the tmncated SEAP gene can be inserted into the pCMV-AKI plasmid at a unique Bgl-II in the vector. The SEAP gene is cut out of plasmid pGEMzf(-)/SEAP (described above) using EcoRI and Hindlll. The fragments are filled in with Klenow DNA polymerase and the 1970 base pair fragment is isolated from the vector fragment by agarose gel electrophoresis. The pCMV-AKI vector is prepared by digesting with Bgl-II and filling in the ends with Klenow DNA polymerase. The final construct is generated by blunt end ligating the SEAP fragment into the vector and transforming the ligation reaction into E. coli DH5a cells. Transformants can then be screened for the proper insert and mapped for restriction fragment orientation. Properly oriented recombinant constmcts would be sequenced across the cloning junctions to verify the coπect sequence. The resulting plasmid, named pCMV-SEAP-B contains a modified SEAP sequence downstream of the cytomegalo virus immediate early promoter, IE1, and upstream of a bovine growth hormone poly-A sequence. The plasmid would express SEAP in a constitutive nammer when transfected into mammalian cells. Cloning of a Myristylated viral-H-ras expression plasmid pSMS600
A DNA fragment containing viral-H-ras can be PCRed from plasmid "HB-11 (deposited in the ATCC under Budapest Treaty on August 27, 1997, and designated ATCC 209,218) using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAAGGACCC CAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTGG 3'. (SEQ.ID.NO.: 9)
Antisense:
5'CACATCTAGATCAGGACAGCACAGACTTGCAGC 3'. (SEQ.ID.NO.: 10)
A sequence encoding the first 15 aminoacids of the v-src gene, containing a myristylation site, is incoφorated into the sense strand oligo. The sense strand oligo also optimizes the 'Kozak' translation initiation sequence immediately 5 ' to the ATG start site. To prevent prenylation at the viral-rαs C-terminus, cysteine 186 would be mutated to a serine by substituting a G residue for a C residue in the C-terminal antisense oligo. The PCR primer oligos introduce an Xhol site at the 5' end and a Xbal site at the 3 'end. The Xhol-Xbal fragment can be ligated into the mammalian expression plasmid pCI (Promega) cut with Xhol and Xbal. This results in a plasmid, pSMS600, in which the recombinant myr-viral-H-ras gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of a viral-H-ms-CVLL expression plasmid pSMS601
A viral-H-ras clone with a C-terminal sequence encoding the amino acids CVLL can be cloned from the plasmid "HB-11" by PCR using the following oligos.
Sense strand:
5 'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3 '
(SEQ.ID.NO.: 11) Antisense strand:
5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3' (SEQ.ID.NO.: 12)
The sense strand oligo optimizes the 'Kozak' sequence and adds an
Xhol site. The antisense strand mutates serine 189 to leucine and adds an Xbal site. The PCR fragment can be trimmed with Xhol and Xbal and ligated into the Xhol- Xbal cut vector pCI (Promega). This results in a plasmid, pSMS601, in which the mutated viral-H-ras-CVLL gene is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of cellular-H-ra,s-Leu61 expression plasmid pSMS620
The human cellular-H-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5 '-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3 '
(SEQ.ID.NO.: 13)
Antisense strand:
5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ.ID.NO.: 14)
The primers will amplify a c-H-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-H-ras fragment can be ligated ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of glutamine-61 to a leucine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: 15)
After selection and sequencing for the coπect nucleotide substitution, the mutated c-H-rαs-Leu61 can be excised from the p Alter- 1 vector, using EcoRI and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid, pSMS620, will constitutively transcribe c-H-r s-Leu61 from the CMV promoter of the pCI vector.
Cloning of a c-N-ra.s-Val-12 expression plasmid pSMS630 The human c-N-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5 '-GAGAGAATTCGCCACCATGACTGAGTACAAACTGGTGG-3 ' (SEQ.ID.NO.: 16)
Antisense strand:
5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ.ID.NO.: 17)
The primers will amplify a c-N-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, an EcoRI site at the N-terminus and a Sal I site at the C-terminal end. After trimming the ends of the PCR product with EcoRI and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal I cut mutagenesis vector p Alter- 1 (Promega). Mutation of glycine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18)
After selection and sequencing for the coπect nucleotide substitution, the mutated c-N-ras-Val-12 can be excised from the p Alter- 1 vector, using EcoRI and
Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with EcoRI and Sal I. The new recombinant plasmid, pSMS630, will constitutively transcribe c-N-ra.s-Val-12 from the CMV promoter of the pCI vector.
Cloning of a c-K4B-ras-Val-12 expression plasmid pSMS640
The human c-K4B-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5 '-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3 ' (SEQ.ID.NO.: 19) Antisense strand:
5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3' (SEQ.ID.NO.: 20)
The primers will amplify a c-K4B-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I site at the C-terminal end. After trimming the ends of the PCR product with Kpn I and Sal I, the c-K4B-r .s fragment can be ligated into a Kpnl -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine-12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.NO.: 21)
After selection and sequencing for the coπect nucleotide substitution, the mutated c-K4B-r s-Val-12 can be excised from the pAlter-1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I. The new recombinant plasmid will constitutively transcribe c-K4B-rø.s-Val-12 from the CMV promoter of the pCI vector.
Cloning of c-K-ras4A-Val-12 expression plasmid pSMS650
The human c-K4A-ras gene can be PCRed from a human cerebral cortex cDNA library (Clontech) using the following oligonucleotide primers.
Sense strand:
5 '-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3 ' (SEQ.ID.NO.: 22)
Antisense strand: 5 '-CTCTGTCGACAGATTACATTATAATGCATTTTTTAATTTTCACAC-3 ' (SEQ.ID.NO.: 23)
The primers will amplify a c-K4A-Ras encoding DNA fragment with the primers contributing an optimized 'Kozak' translation start sequence, a Kpnl site at the N-terminus and a Sal I stite at the C-terminal end. After trimming the ends of the PCR product with Kpn I and Sal I, the c-K-ras4A fragment can be ligated into a
Kpnl -Sal I cut mutagenesis vector pAlter-1 (Promega). Mutation of cysteine- 12 to a valine can be accomplished using the manufacturer's protocols and the following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.NO.: 24)
After selection and sequencing for the correct nucleotide substitution, the mutated c-K4A-ras-Val-12 can be excised from the p Alter- 1 vector, using Kpnl and Sal I, and be directly ligated into the vector pCI (Promega) which has been digested with Kpnl and Sal I. The new recombinant plasmid, pSMS650, will constitutively transcribe c-K4A-r<zs-Val-12 from the CMV promoter of the pCI vector.
SEAP assay
Human C33A cells (human epitheial carcenoma - ATTC collection) are seeded in 10cm tissue culture plates in DMEM + 10% fetal calf serum + IX Pen/Strep + IX glutamine + IX NEAA. Cells are grown at 37°C in a 5% CO2 atmosphere until they reach 50 -80% of confluency.The transient transfection is performed by the CaPO4 method (Sambrook et al., 1989). Thus, expression plasmids for H-ras, N-ras, -ras, Myτ-ras or H-ras-CVLL are co-precipitated with the DSE- SEAP reporter constmct. (A ras expression plasmid is not included when the cell is transfected with the pCMV-SEAP plasmid.) For 10cm plates 600μl of CaCl2 -DNA solution is added dropwise while vortexing to 600μl of 2X HBS buffer to give 1.2ml of precipitate solution (see recipes below). This is allowed to sit at room temperature for 20 to 30 minutes. While the precipitate is forming, the media on the C33A cells is replaced with DMEM (minus phenol red; Gibco cat. No. 31053-028)+ 0.5% charcoal stripped calf semm + IX (Pen Strep, Glutamine and nonessential aminoacids). The CaPO4-DNA precipitate is added dropwise to the cells and the plate rocked gently to distribute. DNA uptake is allowed to proceed for 5-6 hrs at 37°C under a 5% CO2 atmosphere.
Following the DNA incubation period, the cells are washed with PBS and trypsinized with 1ml of 0.05% trypsin. The 1 ml of trypsinized cells is diluted into 10ml of phenol red free DMEM + 0.2% charcoal stripped calf semm + IX (Pen/Strep, Glutamine and NEAA ). Transfected cells are plated in a 96 well micro- titer plate (lOOml/well) to which dmg, diluted in media, has already been added in a volume of lOOμl. The final volume per well is 200μl with each d g concentration repeated in triplicate over a range of half-log steps.
Incubation of cells and drugs is for 36 hrs at 37° under CO2- At the end of the incubation period, cells are examined microscopically for evidence of cell distress. Next, lOOμl of media containing the secreted alkaline phosphatase is removed from each well and transfeπed to a microtube array for heat treatment at 65°C for 1 hr to inactivate endogenous alkaline phosphatases (but not the heat stable secreted phosphatase). The heat treated media is assayed for alkaline phosphatase by a luminescence assay using the luminescence reagent CSPD® (Tropix, Bedford, Mass.). A volume of 50 μl media is combined with 200 μl of CSPD cocktail and incubated for 60 minutes at room temperature. Luminesence is monitored using an ML2200 microplate luminometer (Dynatech). Luminescence reflects the level of activation of the fos reporter constmct stimulated by the transiently expressed protein.
DNA-CaPO4 precipitate for 10cm. plate of cells Ras expression plasmid (1 μg/μl) lOμl
DSE-SEAP Plasmid (1 μg/μl) 2μl Sheared Calf Thymus DNA (1 μg/μl) 8μl
2M CaCl2 74μl dH2O 506μl
2X HBS Buffer 280mM NaCl lOmM KCl
1.5mM Na2HPO4 2H2O
12mM dextrose
50mM HEPES Final pH = 7.05
Luminesence Buffer (26ml)
Assay Buffer 20ml
Emerald Reagent™ (Tropix) 2.5ml lOOmM homoarginine 2.5ml CSPD Reagent® (Tropix) 1.0ml
Assay Buffer
Add 0.05M Na2CO3 to 0.05M NaHCO3 to obtain pH 9.5. Make lmM in MgCl2
EXAMPLE 182
The processing assays employed are modifications of that described by DeClue et al [Cancer Research 51, 712-717, 1991].
K4B-Ras processing inhibition assay
PSN-1 (human pancreatic carcinoma) or viral-K4B-ras-transformed Ratl cells are used for analysis of protein processing. Subconfluent cells in 100 mm dishes are fed with 3.5 ml of media (mefhionine-free RPMI supplemented with 2% fetal bovine semm or cysteine-free/methionine-free DMEM supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine semm, respectively) containing the desired concentration of test compound, lovastatin or solvent alone. Cells treated with lovastatin (5-10 μM), a compound that blocks Ras processing in cells by inhibit- ing a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a positive control. Test compounds are prepared as lOOOx concentrated solutions in DMSO to yield a final solvent concentration of 0.1%. Following incubation at 37°C for two hours 204 μCi/ml [35s]Pro-Mix (Amersham, cell labeling grade) is added.
After introducing the label amino acid mixture, the cells are incubated at 37°C for an additional period of time (typically 6 to 24 hours). The media is then removed and the cells are washed once with cold PBS. The cells are scraped into 1 ml of cold PBS, collected by centrifugation (10,000 x g for 10 sec at room temperature), and lysed by vortexing in 1 ml of lysis buffer (1% Nonidet P-40, 20 mM HEPES, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% deoxycholate, 0.1% SDS, 1 mM DTT, 10 μg/ml AEBSF, 10 μg/ml aprotinin, 2 μg/ml leupeptin and 2 μg/ml antipain). The lysate is then centrifuged at 15,000 x g for 10 min at 4°C and the supernatant saved.
For immunoprecipitation of Ki4B-Ras, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine semm albumin as a standard. The appropri- ate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 8 μg of the pan Ras monoclonal antibody, Y13-259, added. The protein/antibody mixture is incubated on ice at 4°C for 24 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antisemm to rat IgG (Cappel) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 μl elution buffer (10 mM Tris pH 7.4, 1% SDS). The Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature). The supernatant is added to 1 ml of Dilution Buffer 0.1% Triton
X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 μg Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1 (Calbiochem). The second protein antibody mixture is incubated on ice at 4°C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) coated with rabbit antisemm to rat IgG (Cappel) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Ras is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1 :100), and the Ras visualized by fluorography.
hDJ Processing Inhibition Assay
PSN-1 cells are seeded in 24- well assay plates. For each compound to be tested, the cells are treated with a minimum of seven concentrations in half-log steps. The final solvent (DMSO) concentration is 0.1%. A vehicle-only control is included on each assay plate. The cells are treated for 24 hours at 37°C / 5% CO2.
The growth media is then aspirated and the samples are washed with PBS. The cells are lysed with SDS-PAGE sample buffer containing 5% 2-mercapto- ethanol and heated to 95°C for 5 minutes. After cooling on ice for 10 minutes, a mixture of nucleases is added to reduce viscosity of the samples.
The plates are incubated on ice for another 10 minutes. The samples are loaded onto pre-cast 8% acrylamide gels and electrophoresed at 15 m A/gel for 3-4 hours. The samples are then transfeπed from the gels to PVDF membranes by Western blotting. The membranes are blocked for at least 1 hour in buffer containing 2% nonfat dry milk. The membranes are then treated with a monoclonal antibody to hDJ-2 (Neomarkers Cat. # MS-225), washed, and treated with an alkaline phosphatase-conjugated secondary antibody. The membranes are then treated with a fluorescent detection reagent and scanned on a phosphorimager.
For each sample, the percent of total signal coπesponding to the unprenylated species of hDJ (the slower-migrating species) is calculated by densitometry. Dose-response curves and EC50 values are generated using
4-parameter curve fits in SigmaPlot software.
EXAMPLE 183
Rapl processing inhibition assay
Protocol A:
Cells are labeled, incubated and lysed as described in Example 182. For immunoprecipitation of Rapl, samples of lysate supernatant containing equal amounts of protein are utilized. Protein concentration is determined by the bradford method utilizing bovine semm albumin as a standard. The appropri- ate volume of lysate is brought to 1 ml with lysis buffer lacking DTT and 2 μg of the Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech), is added. The protein/ antibody mixture is incubated on ice at 4°C for 1 hour. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in 100 ml elution buffer (10 mM Tris pH 7.4, 1% SDS). The Rapl is eluted from the beads by heating at 95 °C for 5 minutes, after which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec. at room temperature).
The supernatant is added to 1 ml of Dilution Buffer (0.1% Triton X-100, 5 mM EDTA, 50 mM NaCl, 10 mM Tris pH 7.4) with 2 mg Rapl antibody, Rapl/Krevl (121) (Santa C z Biotech). The second protein/antibody mixture is incubated on ice at 4°C for 1-2 hours. The immune complex is collected on pansorbin (Calbiochem) by tumbling at 4°C for 45 minutes. The pellet is washed 3 times with 1 ml of lysis buffer lacking DTT and protease inhibitors and resuspended in Laemmli sample buffer. The Rapl is eluted from the beads by heating at 95°C for 5 minutes, after which the beads are pelleted by brief centrifugation. The supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-acrylamide:acrylamide, 1 :100), and the Rapl visualized by fluorography.
Protocol B:
PSN-1 cells are passaged every 3-4 days in 10 cm plates, splitting near-confluent plates 1 :20 and 1 :40. The day before the assay is set up, 5x 106 cells are plated on 15 cm plates to ensure the same stage of confluency in each assay. The media for these cells is RPMI 1640 (Gibco), with 15% fetal bovine semm and lx Pen/Strep antibiotic mix.
The day of the assay, cells are collected from the 15 cm plates by trypsinization and diluted to 400,000 cells/ml in media. 0.5 ml of these diluted cells are added to each well of 24-well plates, for a final cell number of 200,000 per well. The cells are then grown at 37°C overnight. The compounds to be assayed are diluted in DMSO in 1/2-log dilutions. The range of final concentrations to be assayed is generally 0.1-100 μM. Four concentrations per compound is typical. The compounds are diluted so that each concentration is lOOOx of the final concentration (i.e., for a 10 μM data point, a 10 mM stock of the compound is needed). 2 μL of each lOOOx compound stock is diluted into 1ml media to produce a 2X stock of compound. A vehicle control solution (2 μL DMSO to 1ml media), is utilized. 0.5 ml of the 2X stocks of compound are added to the cells.
After 24 hours, the media is aspirated from the assay plates. Each well is rinsed with 1 ml PBS, and the PBS is aspirated. 180 μL SDS-PAGE sample buffer (Novex) containing 5% 2-mercaptoethanol is added to each well. The plates are heated to 100°C for 5 minutes using a heat block containing an adapter for assay plates. The plates are placed on ice. After 10 minutes, 20 μL of an RNAse/DNase mix is added per well. This mix is lmg/ml DNasel (Worthington Enzymes), 0.25 mg/ml Rnase A (Worthington Enzymes), 0.5M Tris-HCl pH8.0 and 50 mM MgCl2. The plate is left on ice for 10 minutes. Samples are then either loaded on the gel, or stored at -70°C until use.
Each assay plate (usually 3 compounds, each in 4-point titrations, plus controls) requires one 15-well 14% Novex gel. 25 μl of each sample is loaded onto the gel. The gel is n at 15mA for about 3.5 hours. It is important to mn the gel far enough so that there will be adequate separation between 21kd (Rapl) and 29kd
(Rab6).
The gels are then transfeπed to Novex pre-cut PVDF membranes for
1.5 hours at 30V (constant voltage). Immediately after transfeπing, the membranes are blocked overnight in 20ml Western blocking buffer (2% nonfat dry milk in
Western wash buffer (PBS + 0.1% Tween-20). If blocked over the weekend, 0.02% sodium azide is added. The membranes are blocked at 4°C with slow rocking.
The blocking solution is discarded and 20ml fresh blocking solution containing the anti Rapla antibody (Santa Cmz Biochemical SC1482) at 1 :1000 (diluted in Western blocking buffer) and the anti Rab6 antibody (Santa Cmz
Biochemical SC310) at 1 :5000 (diluted in Western blocking buffer) are added. The membranes are incubated at room temperature for 1 hour with mild rocking. The blocking solution is then discarded and the membrane is washed 3 times with Western wash buffer for 15 minutes per wash. 20 ml blocking solution containing 1 :1000 (diluted in Western blocking buffer) each of two alkaline phosphatase conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cmz Biochemical]) is then added. The membrane is incubated for one hour and washed 3x as above.
About 2 ml per gel of the Amersham ECF detection reagent is placed on an overhead transparency (ECF) and the PVDF membranes are placed face down onto the detection reagent. This is incubated for one minute, then the membrane is placed onto a fresh transparency sheet.
The developed transparency sheet is scanned on a phosphorimager and the Rapla Minimum Inhibitory Concentration is determined from the lowest concentration of compound that produces a detectable Rapla Western signal. The
Rapla antibody used recognizes only unprenylated/unprocessed Rapla, so that the precence of a detectable Rapla Western signal is indicative of inhibition of Rapla prenylation.
Protocol C:
This protocol allows the determination of an EC50 for inhibition of processing of Rapla. The assay is n as described in Protocol B with the following modifications. 20 μl of sample is mn on pre-cast 10-20% gradient acrylamide mini gels (Novex Inc.) at 15 mA/gel for 2.5-3 hours. Prenylated and unprenylated forms of Rapla are detected by blotting with a polyclonal antibody (Rapl/Krev-1 Ab#121; Santa Cmz Research Products #sc-65), followed by an alkaline phosphatase-conjugated anti-rabbit IgG antibody. The percentage of unprenylated Rapla relative to the total amount of Rapla is determined by peak integration using Imagequant" software (Molecular Dynamics). Unprenylated Rapla is distinguished from prenylated protein by virtue of the greater apparent molecular weight of the prenylated protein. Dose-response curves and EC50 values are generated using 4-parameter curve fits in SigmaPlot software.
EXAMPLE 184
In vivo tumor growth inhibition assay (nude mouse)
In vivo efficacy as an inhibitor of the growth of cancer cells may be confirmed by several protocols well known in the art. Examples of such in vivo efficacy studies are described by N. E. Kohl et al. (Nature Medicine, 1 : 792-797 (1995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci. U.S.A., 91:9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated human Haras or Ki-ras (10 cells/animal in 1 ml of DMEM salts) are injected subcutaneously into the left flank of 8-12 week old female nude mice (Harlan) on day 0. The mice in each oncogene group are randomly assigned to a vehicle, compound or combination treatment group. Animals are dosed subcutaneously starting on day 1 and daily for the duration of the experiment. Alternatively, the famesyl-protein transferase inhibitor may be administered by a continuous infusion pump. Compound, compound combination or vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and weighed when all of the vehicle-treated animals exhibited lesions of 0.5-1.0 cm in diameter, typically 11-15 days after the cells were injected. The average weight of the tumors in each treatment group for each cell line is calculated.

Claims

WHAT IS CLAIMED IS:
1. A compound of the formula A:
Figure imgf000245_0001
A
wherein
X1 is (C(Rla)2) A1(C(Rla)2)nA2;
X2 is (C(Rlb)2) A3(C(Rlb) 22)^,p'
X3 is (C(R,C)2) A4(C(Rlc)2 2)Λ,)'
R la , R lb and R lc are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R 1'0"O, -,
R 6a S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-,
(R10)2NC(O)NR10-, R10C(O)-, -N(R10)2, R10OC(O)-, and R10OC(O)NR10-, and c) unsubstituted or substituted Cj-C6 alkyl, wherein the substituent on the substituted C[-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C]0cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R'°C(O)-, R'°OC(O) , halo, -N(R'°)2, and R'°OC(O)NR10-;
1 3 4
A , A and A are independently selected from a) a bond, b) -C(O)-, c) -HC=CH-, d) -C≡C-, e) O, f) NR10, g) NR10C(O), h) C(O)NR10, i) OC(O)NR10, j) NR10C(O)O, k) s(=o)m,
1) C(O)O, and m) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) NR10C(O), d) S(=O)m, and e) OC(O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted. h) OR10, i) N3, j) R aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R,0)2NC(O)NR10-, o) R,0C(O)-, p) R'°C(O)NR10-, q) R10OC(O)-, r) -N(R,0)2, s) R10OC(O)NR10-, and t) -(CrC6 alkyl)NR10C(O)R,3 ;
R3 is independently selected from: H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, O R10, NRV, OR6, -C(O)R10, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -OS(O)mR6a, -C(O)NRV, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(CrC6 alkyl)C(O)R10;
4 5
R and R are independently selected from: H, OR10, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted
C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle,
Figure imgf000247_0001
wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6,
Figure imgf000248_0001
d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR6a,
2) C3-C6 cycloalkyl,
3) OR6,
4) S(O)mRa,
5) — NR6R7
Figure imgf000248_0002
— ( .NR6R7
8) T O
9) — 0-. .OR6
T O
10) NR ,6D7
Y R o
11) — S02-NR6R7
R6
12) — T N-S02— R6a
13) _ ^R6
O 14> - -OR6
O 15) N3,
16) halo, and
17) perfluoro-C,.4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
P11 e) Ύ 0
Figure imgf000249_0001
g) -S(0)mR6a or h) N(R10)2; or
6 7
. and R may be joined in a ring;
7 7a R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following: 1) C alkoxy, 2) aryl or heterocycle,
3) halogen,
Figure imgf000250_0001
6) SO2R6a,
7) N(R'°)6; and b) C,- ; alkyl, unsubstituted oi the following:
1) -C(R10)2C1-4 alkoxy,
2) aryl or heterocycle,
3) -C(R )2halogen,
4) -C(R10)2OH,
Figure imgf000250_0002
6) -C(R10)2SO2R6a, and
7) -C(R10)2N(R10)2;
R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl, unsubstituted or substituted C C4 perfluoroalkyl, F, CI, Br,
R10O-, CN, R6aS(O)m-, -C(O)NR6R7, R, 0C(O)NR10-, NO2, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, R10OC(O)NR10-,
N3, or -N(R10)2, and c) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
Figure imgf000250_0003
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, Nv -N(R10)2, and R10OC(O)NR10-;
9
R is independently selected from 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C,-C4 alkyl, i) S(O)mR6a, j) N(R10)2, k) NR10C(O)Rπ,
1) NR10C(O)R"N(R10)2, m) -R,0(CH2)nRπ,
2) C3-C !6 cycloalkyl,
3) S(O) τ?6a
Figure imgf000251_0001
5) — SO2-NR6R7
6) Rfc
O
ORfc
7)
O and
8) -(Ci-C6 alkyl)NR10C(O)R13 ; R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) unsubstituted or substituted C,-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted C,-^ alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C,0 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-, 1) CF3CH2-,
10 m) OR , n) -C(O)R10, o) -O(C,-C6 alkyl)OR10,
Figure imgf000252_0001
q) -(C,-C6 alkyl)OR10, and r) -(C1-C6 alkyl)C(O)R1°;
I 2
G and G are independently selected from oxygen or H2;
V is selected from a) hydrogen, b) heterocycle, c) aryl, d) Cj-C^ alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and e) C2-C20 alkenyl, provided that V is not hydrogen if A is S(O)m and q is 0;
W is a heterocycle;
Y is selected from a) H, b) C,-C8 alkyl, c) C2-C8 alkenyl, d) C2-C8 alkynyl, e) C3-C20 cycloalkyl, f) aryl, and g) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, 4, 5 or 6; q is 0, 1, 2, 3, 4, 5 or 6; r is 0 to 5, provided that r is 0 when V is hydrogen; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen u is 4 or 5; v is 0, 1, 2, 3 or 4; and W IS 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
2. The compound according to Claim 1 illustrated by formula A:
Figure imgf000254_0001
A
wherein
Figure imgf000254_0002
X3 is (C(R1C)2) A4;
R and R , 1b are independently selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted
10, heterocycle, unsubstituted or substituted C3-C,0 cycloalkyl, R'"O-
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R'°C(O)-, -N(R10)2, R'°OC(O)-, and
R10OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, -C(O)NR6R7, R10C(O)NR10-, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-, halo, -N(R,0)2, and R10OC(O)NR10-;
R lc is selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C[-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C,0cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-,
R10OC(O)-, halo, -N(R10)2, and R10OC(O)NR, 0-;
A and A 3 are independently selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), ) C(O)NR10, g) OC(O)NR10, h) NR10C(O)O, i) s(=o) m , j) OC(O), and k) C(O)O;
2
. is selected from a) a bond, b) -C(=O)-, c) NR10C(O), and d) S(=0)m; A is a bond;
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) Cj-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted, 1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R'°OC(O)-, r) -N(R10)2, s) R10OC(O)NR10-, and t) -(CrC6 alkyl)NR10C(O)R13 ;
R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl, CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NR6R7, OR6, -C(O)R10, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -OS(O)mR6a, -C(O)NR6R7, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10; R and R are independently selected from:
H, OR , unsubstituted or substituted C]-C6 alkyl, unsubstituted or substituted
C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle,
Figure imgf000257_0001
wherein the substituted group is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR6R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C1-C4 alkyl, h) S(O)mR6a,
2) 3-C6 cycloalkyl,
3) OR6,
4) S(O)mR6a,
5) — R 6R7
Figure imgf000257_0002
— f /NR6R7
8) T 0
9) — C .OR6
T 0
10) \ ^NR6R7 0
11 ) — S02-NR6R7
12) — f N-S02— R6a
Figure imgf000258_0001
14)
-X0R6
O
15) N3,
16) halo, and
17) perfluoro-C,.4-alkyl; or
R and R are attached to the same C atom and are combined to form -(CH2)U- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
R , R and R a are independently selected from: H, Cj-C8 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C[-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) t-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
R11 e) Y 0 f) Y 0 OR'°
g) -S(0)mR6a or
10 h) N(R )2; or
R
Figure imgf000259_0001
may be joined in a ring;
R 7 and R 7a may be joined in a ring;
R 6a is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C1-4 alkoxy,
2) aryl or heterocycle,
3) halogen, 4) HO,
> 11
5) o
6) SO2R6a,
7) N(R10)2; and b) c,-c< , alkyl, unsubstituted or substituted with one or more of the following:
1) -C(R10)2C1 -4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" .
6) -C(R10)2SO2R6a, and
Figure imgf000259_0002
R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl, unsubstituted or substituted C C4 perfluoroalkyl, F, CI, Br, R10O-, CN, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR'°-, NO2, (R10)2NC(O)NR10-, R'°C(O)-, R'°OC(O)-, R10OC(O)NR10-, N3, or -N(R )2, and c) j-C8 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R'°O-, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR'°-, CN, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-, N3, -N(R10)2, and
10 10
R OC(O)NR -; q R is independently selected from
1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR , c) (CH2) nNR R7, d) halogen, e) CN, ) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted. h) perfluoro-C1-C4 alkyl, i) S(O)mR6a, j) N(R10)2, k) NR10C(O)Rn,
1) NR10C(O)RnN(R10)2, m) -R,0(CH2)nRH, 2) C3-C6 cycloalkyl,
3) S(O) Rc
Figure imgf000261_0001
5) — SO2-NR6R7
6) Rb
O
ORb
7)
O and
8) -(CrC6 alkyl)NR,0C(O)R13 ;
R , 10 is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) unsubstituted or substituted 0,-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl; 1 ^
R is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-,
10 m) OR , n) -C(O)R'°, o) -O(C,-C6 alkyl)OR10,
Figure imgf000262_0001
q) -(C,-C6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
1 2
G and G are independently selected from oxygen or H2
V is selected from a) heterocycle, b) aryl, and c) j-C20 alkyl wherein from 0 to 4 carbon atoms are replaced with a heteroatom selected from O, S(O)m, and N, and
W is a heterocycle;
Y is selected from a) H, b) C,-C8 alkyl, c) C3-C20 cycloalkyl, d) aryl, or e) heterocycle;
m is 0, 1 or 2; n is 0, 1,2, 3, 4, 5 or 6; p is 0, 1,2, 3,4, 5 or 6; q is 0, 1,2, or 3; r is 0to5; s is 0, 1,2, 3 or 4; tis 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen: u is 4 or 5; v is 0, 1,2, 3 or 4; and w is 0, 1,2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
3. The compound according to Claim 1, as illustrated by formula
B:
Figure imgf000263_0001
B
wherein
X1is(C(Rla)2)nA1(C(Rla)2)nA2;
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C,0 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, -C(O)NR6R7, R10C(O)NR10-, (R, 0)2NC (O)NR10-, R'°C(O)-, -N(R'°)2, R10OC(O)-, and R,0OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R'°O-, R6aS(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-
, halo, -N(R10)2, and R'°OC(O)NR10-;
R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R'°O-, R6aS(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-
, halo, -N(R10),, and R10OC(O)NR10-;
lected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f> C(O)NR10, g) OC(O)NR10, h) NRi0C(O)O, i) S(=0)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond,
Figure imgf000265_0001
c) NR10C(O), and d) S(=0)m;
A is selected from a bond or C(=O);
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R'°C(O)NR10-, q) R'°OC(O)-, r) -N(R'°)2, s) R10OC(O)NR10-, and t) -(C , -C6 alkyl)NR! °C(O)R13.
R is independently selected from: H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, Cj-C6 perfluoroalkyl; CF3O-, CF3CH2-, unsubstituted or substituted C3-C,0 cycloalkyl, OR10, NRV, OR6, -C(O)R'°, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5 R and R are independently selected from:
H, OR , unsubstituted or substituted Cj-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C]-C4 alkyl, h) S(O)mR6a,
2) C3-C6 cycloalkyl,
3) OR6, 4) S(O) R6a,
6D 7
5) — NRDR 6
6)
Figure imgf000266_0001
— C .NR6R7
8) T 0
9) — ( .OR6 T o
10) \ ^.NR6R7 0
11 ) — S02-NR6R7
12) — N-S02— R6a
13)
^r O R6
Figure imgf000267_0001
15) N3,
16) halo, and
17) perfluoro-C,.4-alkyl; or
4
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR'°)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from: H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
E> 1 1 e)
0 f) γ o 0R,°
g) — S(0)mR6a or
10 h) N(R )2; or
R and R may be joined in a ring;
7 7a
R and R may be joined in a πng;
6a
R is selected from a) C3-( 5 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C] -4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5) Y o R" .
6) SO2R6a,
7) N(R10)2; and b) Cr C6 alkyl, unsubstituted or substituted with one or more of the following:
1) -C(R10)2C1-4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" .
6) -C(Ri°)2SO2R6a, and
7) -C(R'°)2N(R'0)2; R is independently selected from a) hydrogen, b) unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted C3-C6 cycloalkyl,
10 unsubstituted or substituted C C perfluoroalkyl, F, CI, Br, R O-,
CN, R6aS(O)m-, -C(O)NR6R7, R'°C(O)NR10-, NO2, (R,0)2NC(O)NR10-,
10 10 10 10 10
R C(O)-, R OC(O)-, R OC(O)NR -, N3, or -N(R )2, and c) C,-C6 alkyl, unsubstituted or substituted by Cι-C perfluoroalkyl, F, CI, Br, R'V, R6aS(O)m-, -C(O)NR6R7, R'0C(O)NR10-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R'°OC(O)-, N3, -N(R'°)2, and
10 10
R OC(O)NR -;
9
R is independently selected from 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR6R?, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C]-C4 alkyl, i) S(O)mR6a, j) N(R10)2, k) NR10C(O)RU,
1) NR10C(O)RUN(R10)2, m) -R10(CH2)nRn, 2) C3-C6 cycloalkyl, 6a
3) S(0) JR.
Figure imgf000270_0001
5) — SO,-NR6R7
6) Rfc
O
OR6
7)
O and
8) -(Cι-C6 alkyl)NR10C(O)R13 ;
10
R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1
R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted 0,-C8 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted,
J) CF3, k) CF3O-,
1) CF3CH2-,
10 m) OR , n) -C(O)R'°, o) -O(CrC6 alkyl)OR10, p) -C(O)NR6R7, q) -(C,-C6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
G is selected from oxygen or H 2;
V is aryl or heteroaryl;
W is a heterocycle selected from pyπolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl;
Y is selected from a) H, b) C,-C8 alkyl, c) C3-C20 cycloalkyl, d) aryl or e) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6: p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1, 2, 3 or 4; and w is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
4. The compound according to Claim 1, as illustrated by formula
C:
Figure imgf000272_0001
wherein
Figure imgf000272_0002
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-, -N(R10)2, R10OC(O)-, and
R10OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-,
RI0OC(O)-, halo, -N(R10)2, and RI OOC(O)NR10-;
R and R are independently selected from a) hydrogen and b) unsubstituted or substituted Cj-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C]0cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R10C(O)-,
R10OC(O)-, halo, -N(R10)2, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10 h) NR10C(O)O i) s o)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) NR, 0C(O), and d) S(=0)m;
A3 is selected from a) a bond, or b) C(=O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) 6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted, 1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R'°C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R'°)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR10C(O)R,3 ;
3 R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C^Cg perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NRV, OR6, -C(O)R10, -O(CrC6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5
R and R are independently selected from:
H, OR10, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C]-C4 alkyl, h) S(O) R6a,
2) C3-C6 cycloalkyl,
6
3) OR ,
4) — NR6R7
Figure imgf000275_0001
8) halo, and
9) perfluoro-Cl-4-alkyl; or 4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR'°)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, Cj-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
5) Y 0 R
OR 10
Y o g) -S(0)mRba or 10 h) N(R ),; or
6 7 R and R may be joined in a ring;
7 7a
R and R may be joined in a πng;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C]-4 alkoxy,
2) aryl or heterocycle,
3) halogen, 4) HO,
Figure imgf000277_0001
6) SO2R6a,
7) N(R'°)2; and b) c,-c« , alkyl, unsubstituted or substituted with one or more of the following:
1) -C(R10)2C alkoxy,
2) aryl or heterocycle,
3) -C(R'°)2halogen,
4) -C(R10)2OH,
5) Y 0 R" .
6) -C(R10)2SO2R6a, and
Figure imgf000277_0002
8
R is independently selected from a) hydrogen, b) F, CI, Br, R'°O-, CN, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR °-, NO2, (R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, R10OC(O)NR10-, N3, or
-N(R'°)2, and c) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl, F, CI, Br, R'V, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR'°-, CN,
(R10)2NC(O)NR10-, R10C(O)-, R10OC(O)-, N3, -N(R10)2, and
10 10
R OC(O)NR -;
9
R is independently selected from 1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) Cj-C8 alkyl, unsubstituted or substituted, b) (CH2)nOR6,
Figure imgf000278_0001
d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C]-C4 alkyl, i) S(0)mR a, j) N(R10)2, k) NR10C(O)Rπ,
1) NR,0C(O)RπN(R10)2, m) -R,0(CH2)nRn,
2) C3-C6 cycloalkyl,
3) S(0) R6a,
Figure imgf000278_0002
5) — SO2-NR6R7
6) Rfc
O
ORfc
7)
O and
8) -(C i -C6 alky 1) R' °C(0)R13
10
R is independently selected from a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
I I
R is independently selected from a) unsubstituted or substituted 0,-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
13
R is independently selected from a) H, b) unsubstituted or substituted Ct-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C]0 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(C,-C6 alkyl)OR10, p) -C(O)NR6R7, q) -(CrC6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
G is selected from oxygen or H2;
W is a heterocycle selected from pyπolidinyl, imidazolyl, pyridinyl, thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, isoquinolinyl, and thienyl; Yis selected from a) H, b) C,-C8 alkyl, c) C3-C20 cycloalkyl, d) aryl, or e) heterocycle;
m is 0, 1 or 2; n is 0, 1,2, 3,4, 5 or 6; p is 0, 1,2, 3, or 4; q is 0,1, 2, or 3; r is 0to5; s is 0, 1,2, 3 or 4; tis 0, 1, 2, 3 or 4; provided that t is 0 when Y is hydrogen; u is 4 or 5; v is 0, 1 , 2, 3 or 4; and w is 0, 1,2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
5. The compound according to Claim 1, as illustrated by formula
D:
Figure imgf000280_0001
wherein
x'is^R'^A'^R'^A2; la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10 cycloalkyl, R O-,
6a
R S(O)m, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R'°C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)(NR10)-, R'°C(O)-, -N(R'°)2, R'°OC(O)-, and
R10OC(O)NR10-; and c) unsubstituted or substituted Cj-C8 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R10C(O)-,
R10OC(O)-, halo, -N(R, 0)2, and R10OC(O)NR10-;
R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C1Qcycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)(NR10)-, R10C(O)-,
R10OC(O)-, halo, -N(R'°)2, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NR,0C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
A is selected from a) a bond, b) -C(=O)-, c) NR,0C(O), and d) s(=o) m ;
3
. is selected from a) a bond or b) C(=O);
2
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted, g) C,-C6 alkyl, unsubstituted or substituted, h) OR10, i) N3, j) R6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R10OC(O)-, r) -N(R10)2, s) R,0OC(O)NR10-, and t) -(C , -C, alky 1)NR' °C(O)R' 3.
3
R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, C,-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NRV, OR , -C(O)R10, -O(C,-C6 alkyl)
OR10, -S(O)mR6a, -C(O)NR6R7, -NHC(O)R10, -(C,-C6 alkyl)OR10, and -(CrC6 alkyl)C(O)R10;
4 5 R and R are independently selected from:
H, OR , unsubstituted or substituted C,-C6 alkyl, wherein the substituted group is substituted with one or more of:
1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR6a,
2) C3-C6 cycloalkyl,
3) OR6, 6D7
4) — N R°R
Figure imgf000284_0001
8) halo, and
9) perfluoro-C1_4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom;
6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO, •> Y o 1
Y OR10 o g) -S(0)mR° or
10 h) N(R )2; or
R and R may be joined in a ring;
7 7a
R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C1 -4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
5) Y o R" ,
6) SO2R6a,
7) N(R10)2; and b) CrC6 , alkyl, unsubstituted oi the following:
1) -C(RI0)2C1-4 alkoxy,
2) aryl or heterocycle,
3) -C(R10)2halogen,
4) -C(R10)2OH,
5) Y o R" .
6) -C(R10)2SO2R6a, and
7) -C(R'0)2N(Rio)2;
R is independently selected from a) hydrogen, and b) C,-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R'V, R6aS(O)m-,-C(O)NR6R7, RI0C(O)NR'°-, CN, (R10)2NC(O)NR10-, R'°C(O)-, R'°OC(O)-, N3, -N(R'°)2, and
10 10
R OC(O)NR -;
9
R is independently selected from
1) H, unsubstituted or substituted C,-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) Cj-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted, h) perfluoro-C,-C4 alkyl, i) S(O)mR6a, j) N(R,0)2, k) NR10C(O)RU, 1) NR10C(O)RnN(R10)2, m) -R10(CH2)nRπ,
2) C3-C6 cycloalkyl,
3) S(O) R6a,
Figure imgf000287_0001
OR*
7)
O and
8) -(CrC6 alkyl)NR10C(O)R13 ;
10 R is independently selected from a) hydrogen, b) unsubstituted or substituted Cj-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1 R is independently selected from a) unsubstituted or substituted Cj-C6 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
13
R is independently selected from a) H, b) unsubstituted or substituted C,-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C10 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-, 1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(CrC6 alkyl)OR10,
Figure imgf000288_0001
q) -(C,-C6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
G is selected from oxygen or H •
Y is selected from a) CrCg alkyl, b) C3-C20 cycloalkyl, c) aryl, or d) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; u is 4 or 5; v is 0, 1, 2, 3 or 4; and W IS 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
6. The compound according to Claim 1, as illustrated by formula
Figure imgf000289_0001
wherein
X1 is (C(Rla)2)nA1(C(Rla)2)nA2;
la
R is selected from: a) hydrogen; b) unsubstituted or substituted aryl, unsubstituted or substituted
10. heterocycle, unsubstituted or substituted C3-C]0 cycloalkyl, R O-,
6a
R (O)m' unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R10C(O)NR10-, -C(O)NR6R7, (R10)2NC (O)(NR10)-, R10C(O)-, -N(R10)2, R10OC(O)-, and R10OC(O)NR10-, and c) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
R10C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R10C(O)-, RI0OC(O)-
, halo, -N(R'°)2, and RI0OC(O)NR10-; R and R are independently selected from a) hydrogen and b) unsubstituted or substituted C,-C6 alkyl, wherein the substituent on the substituted C,-C6 alkyl is selected from unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C3-C10cycloalkyl, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, R O-, R S(O)m,
RI0C(O)NR10-, -C(O)NR6R7, (R10)2NC(O)NR10-, R'°C(O)-, R10OC(O)-
, halo, -N(R, 0)2, and R10OC(O)NR10-;
A is selected from a) a bond, b) -C(=O)-, c) O, d) NR10, e) NR10C(O), f) C(O)NR10, g) OC(O)NR10, h) NR10C(O)O, i) s(=o)m, j) C(O)O, and k) OC(O);
2
A is selected from a) a bond, b) -C(=O)-, c) NR10C(O), and d) S(=0)m;
A is selected from a) a bond, or b) C(=O);
R is independently selected from: a) hydrogen, b) CN, c) NO2, d) halogen, e) aryl, unsubstituted or substituted, f) heterocycle, unsubstituted or substituted. g) C,-C6 alkyl, unsubstituted or substituted. h) OR*0, i) N3, j) R6aS(O)m, k) C3-C10 cycloalkyl, unsubstituted or substituted,
1) C2-C6 alkenyl, unsubstituted or substituted, m) C2-C6 alkynyl, unsubstituted or substituted, n) (R10)2NC(O)NR10-, o) R10C(O)-, p) R10C(O)NR10-, q) R,0OC(O)-, r) -N(R,0)2, s) R10OC(O)NR10-, and t) -(C,-C6 alkyl)NR, 0C(O)R13 ;
3
R is independently selected from:
H, CN, NO2, halo, unsubstituted or substituted C,-C6 alkyl, N3, oxido, unsubstituted or substituted aryl, unsubstituted or substituted heterocycle, unsubstituted or substituted C2-C6 alkenyl, unsubstituted or substituted C2-C6 alkynyl, unsubstituted or substituted aralkyl, unsubstituted or substituted heterocyclylalkyl, Cj-C6 perfluoroalkyl^ CF3O-, CF3CH2-, unsubstituted or substituted C3-C10 cycloalkyl, OR10, NR R , OR6, -C(O)R'°, -O(C,-C6 alkyl)OR10, -S(O)mR6a, -C(O)NRV, -NHC(O)R10, -(CΓC6 alkyl)OR10, and -(C,-C6 alkyl)C(O)R10;
4 5
R and R are independently selected from:
H, OR , unsubstituted or substituted 0,-C8 alkyl, wherein the substituted group is substituted with one or more of: 1) aryl or heterocycle, unsubstituted or substituted with: a) C,-C6 alkyl, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl or heteroaryl, g) perfluoro-C,-C4 alkyl, h) S(O)mR6a,
2) C3-C6 cycloalkyl,
6
3) OR ,
4) — NR6R7
Figure imgf000292_0001
7) R6
0
8) halo, and
9) perfluoro-C,.4-alkyl; or
4 5
R and R are attached to the same C atom and are combined to form -(CH2)u- wherein one of the carbon atoms is optionally replaced by a moiety selected from: O, S(O)m, NR10, -NC(O)-, and -N(COR10)- ;
4 5 and any of R and R are optionally attached to the same carbon atom; 6 7 7a
R , R and R are independently selected from:
H, C,-C6 alkyl, C3-C6 cycloalkyl, heterocycle, aryl, aralkyl, aroyl, heteraroyl, arylsulfonyl, heteroarylsulfonyl, C,-C4 perfluoroalkyl, unsubstituted or substituted with one or two substituents selected from: a) C,-C6 alkoxy, b) substituted or unsubstituted aryl or substituted or unsubstituted heterocycle, c) halogen, d) HO,
Figure imgf000293_0001
f) γ O 0R,°
g) -S(O)mR6a or
10 h) N(R )2; or
6 7
R and R may be joined in a ring;
7 7a
R and R may be joined in a ring;
6a
R is selected from a) C3-6 cycloalkyl, heterocycle, aryl, unsubstituted or substituted with one or more of the following:
1) C]-4 alkoxy,
2) aryl or heterocycle,
3) halogen,
4) HO,
* Y O R" .
6) SO2R6a,
7) N(Riθ)2; and b) Cr ; alkyl, unsubstituted oi the following:
1) -C(R,0)2C1 -4 alkoxy,
2) aryl or heterocycle,
3) -C(R'°)2halogen,
4) -C(R'°)2OH,
R11
5) Y 0
6) -C(R10)2SO2R6a, and
7) -C(R'0)2N(Ri°)2;
8
R is independently selected from a) hydrogen, and b) C]-C6 alkyl, unsubstituted or substituted by C C4 perfluoroalkyl,
F, CI, Br, R'V, R6aS(O)m-, -C(O)NR6R7, R10C(O)NR10-, CN, (R10)2NC(O)NR10-, R,0C(O)-, R10OC(O)-, N3, -N(R10)2, and
10 10
R OC(O)NR -;
9
R is independently selected from
1) H, unsubstituted or substituted Cj-C6 alkyl, unsubstituted or substituted C2-C8 alkenyl, unsubstituted or substituted C2-C8 alkynyl, unsubstituted or substituted aryl, and unsubstituted or substituted heterocycle, wherein the substituted group is substituted with one or more of: a) C,-C6 alkyl, unsubstituted or substituted, b) (CH2)nOR6, c) (CH2) nNR R7, d) halogen, e) CN, f) aryl, unsubstituted or substituted, g) heterocycle, unsubstituted or substituted. h) perfluoro-C,-C4 alkyl, i) S(0)mR6a, j) N(R,0)2, k) NR10C(O)Rn,
1) NR10C(O)RUN(R10)2; m) -R,0(CH2)nRπ,
2) C3-C6 cycloalkyl,
3) S(0)mR a,
\ ^NR6R7
4)
O
5) SO2-NR6R7
6) Rc
O
ORc
7)
O and
8) -(CrC6 alkyl)NR10C(O)R13 ;
10 R is independently selected from a) hydrogen, b) unsubstituted or substituted C,-C6 alkyl, c) C3-C6 cycloalkyl, d) 2,2,2-trifluoroethyl, e) unsubstituted or substituted heteroaryl, f) unsubstituted or substituted aryl, g) unsubstituted or substituted aralkyl, and h) unsubstituted or substituted heterocyclylalkyl;
1 1 R is independently selected from a) unsubstituted or substituted Cj-C8 alkyl, b) unsubstituted or substituted aralkyl, c) unsubstituted or substituted heterocycle, d) unsubstituted or substituted aryl, and e) unsubstituted or substituted heterocyclylalkyl;
R is independently selected from a) H, b) unsubstituted or substituted Cj-C6 alkyl, c) unsubstituted or substituted aryl, d) unsubstituted or substituted heterocycle, e) aralkyl, unsubstituted or substituted, f) heterocyclylalkyl, unsubstituted or substituted, g) C2-C6 alkynyl, unsubstituted or substituted, h) C2-C6 alkenyl, unsubstituted or substituted, i) C3-C,0 cycloalkyl, unsubstituted or substituted, j) CF3, k) CF3O-,
1) CF3CH2-, m) OR10, n) -C(O)R10, o) -O(C,-C6 alkyl)OR10, p) -C(O)NR6R7, q) -(CrC6 alkyl)OR10, and r) -(CrC6 alkyl)C(O)R10;
1
G is selected from oxygen or H •
Y is selected from a) C,-C8 alkyl, b) C3-C20 cycloalkyl, c) aryl, or d) heterocycle;
m is 0, 1 or 2; n is 0, 1, 2, 3, 4, 5 or 6; p is 0, 1, 2, 3, or 4; q is 0, 1, 2, or 3; r is 0 to 5; s is 0, 1, 2, 3 or 4; t is 0, 1, 2, 3 or 4; u is 4 or 5; v is 0, 1, 2, 3 or 4; and w is 0, 1, 2, 3 or 4;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
7. A compound which is selected from the group consisting of:
(R)-4-{5-[(2-Oxo-l-phenylpyrrolidin-3-ylamino)methyljimidazol-l -ylmethyl} benzonitrile,
(S)-4- {5-[(2-Oxo- 1 -phenylpyrrolidin-3-ylamino)methyl]imidazol- 1 -ylmethyl) benzonitrile,
(R)-4-{5-[(l-Benzyl-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l-ylmethyl) benzonitrile,
(S)-4- {5-[(l -Benzyl-2-oxopyπolidin -3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-(5- { [ 1 -(2-Chlorophenyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 - ylmethyl) benzonitrile,
(5)-4-(5-{[l-(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(3-Chlorophenyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(3-Chlorophenyl)-2-oxopyπolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile, (R)-4-(5-{[l-(4-Chlorophenyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(4-Chlorophenyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5- { [ 1 -(2-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[l-(2-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5 - { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5-{[l-(4-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(S)-4-(5- { [ 1 -(4-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 - ylmefhyl)benzonitrile,
(R)-4- { 5 - [(2-Oxo- 1 -phenethylpyrrolidin-3 -y lamino)methyl]imidazol- 1 -ylmethyl } benzonitrile,
(5)-4-{5-[(2-Oxo-l-phenethylpyπolidin-3-ylamino)methyljimidazol-l-ylmethyl) benzonitrile,
(R)-2- [ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5 -yl] -N-(2-oxo- 1 -phenylpyπolidin-3 -yl) acetamide,
(S)-2-[l-(4-Cyanobenzyl)-lH-imidazol-5-yl]-N-(2-oxo-l-phenylpyπolidin-3-yl) acetamide, (R)-N-( 1 -Benzyl-2-oxopyπolidin-3-yl)-2-[ 1 -(4-cyanobenzyl)- lH-imidazol-5-yl] acetamide,
(5)-N-(l-Benzyl-2-oxopyπolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-ylj acetamide,
(R)-N-(l-Benzyl-2-oxopyπolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]-N- methylacetamide,
(5)-N-(l-Benzyl-2-oxopyπolidin-3-yl)-2-[l -(4-cyanobenzyl)- lH-imidazol-5-ylj-N- methylacetamide,
(R)-4-{5-[(l-Benzylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl) benzonitrile,
(5)-4-{5-[(l-Benzylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-(5-{[Benzyl(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl)imidazol-l- ylmethyl)benzonitrile,
(5)-4-(5-{[Benzyl(l-benzyl-2-oxopyrrolidin-3-yl)aminojmethyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5 - { [( 1 -Benzyl-2-oxopyπolidin-3 -y l)phenethylamino]methyl) imidazol- 1 - ylmefhyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)phenethylaminojmethyl) imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)(3-phenylpropyl)amino]methyl)imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)(3-phenylpropyl)amino]methyl}imidazol- 1 -ylmethyl)benzonitrile, (R)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)(4-phenylbutyl)amino]methyl)imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)(4-phenylbutyl)amino]methyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)propylaminojmethyl)imidazol-l- ylmethyl) benzonitrile,
(iS)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)propylamino]methyl)imidazol-l-ylmethyl) benzonitrile,
(R)-4-(5- {[(1 -Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl) imidazol- 1 -ylmethyl) benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)butylamino]methyl)imidazol-l-ylmethyl) benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyrrolidin-3-yl)pyridin-2-ylmethylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
(5)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)pyridin-2-ylmethylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
(R)-4-(5- {[(1 -Benzyl-2-oxopyrrolidin-3-yl)pyridin-3-ylmethylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
( )-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)pyridin-3-ylmethylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
(R)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)pyridin-4-ylmethylaminojmethyl) imidazol- 1 -ylmethyl)benzonitrile,
(ιS)-4-(5-{[(l-Benzyl-2-oxopyπolidin-3-yl)pyridin-4-ylmethylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile, (R)-4-(5-{[(3-Aminopropyl)(l-benzyl-2-oxopyπolidin-3-yl)amino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
(S)-4-(5-{[(3-Aminopropyl)(l-benzyl-2-oxopyπolidin-3-yl)amino]methyl) imidazol- 1 -ylmefhyl)benzonitrile,
(R)-4-(5 - { [(2- Aminoethyl)( 1 -benzyl-2-oxopyrrolidin-3 -yl)amino]methyl } imidazol- 1 - ylmethyl)benzonitrile,
(5)-4-(5-{[(2-Aminoethyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl) imidazol- 1- ylmethyl)benzonitrile,
(R)-4-(5-{[(4-Aminobutyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl) imidazol-1 - ylmethyl)benzonitrile,
(5)-4-(5-{[(4-Aminobutyl)(l-benzyl-2-oxopyrrolidin-3-yl)amino]methyl) imidazol-1 - ylmethyl)benzonitrile,
(R)-4- {5-[2-(l -Benzyl-2-oxopyπolidin-3-ylamino)ethyl]imidazol-l -ylmethyl) benzonitrile,
(5)-4-{5-[2-(l-Benzyl-2-oxopyπolidin-3-ylamino)ethyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-{5-[2-(2-Oxo-l-phenylpyπolidin-3-ylamino)ethyl]imidazol-l-ylmethyl) benzonitrile,
(5)-4-{5-[2-(2-Oxo-l-phenylpyπolidin-3-ylamino)ethyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-{5-[2-(2-Oxo-l-phenethylpyπolidin-3-ylamino)ethyl]imidazol-l -ylmethyl) benzonitrile, (5)-4-{5-[2-(2-Oxo-l-phenethylpyrrolidin-3-ylamino)ethyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-(5-{[l -(Naphthalene- l-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(Naphthalene-l-carbonyl)pyπolidin-3-ylamino]methyl) imidazol- 1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Naphthalene-2-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(iS)-4-(5-{[l-(Naphthalene-2-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(R)-4-{5-[(l-Benzoylpyrrolidin-3-ylamino)methyljimidazol-l-ylmethyl)benzonitrile,
(S)-4- { 5 - [( 1 -Benzoylpyπolidin-3 -ylamino)methyl jimidazol- 1 -ylmethyl } benzonitrile,
(R)-N-(l-Benzoylpyπolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetamide,
(5)-N-(l-Benzoylpyπolidin-3-yl)-2-[l-(4-cyanobenzyl)-lH-imidazol-5-yl]acetamide,
(R)-2-[l-(4-Cyanobenzyl)-lH-imidazol-5-yl]-7 -[l-(naphthalene-l-carbonyl) pyrrolidin-3-yl]acetamide,
(S)-2-[ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5 -yl]-N- [ 1 -(naphthalene- 1 -carbonyl) pyrrolidin-3-yl]acetamide,
(R)-4-(5-{[l-(3-Chlorobenzoyl)pyπolidin-3-ylamino]methyl)imidazol-l-ylmethyl) benzonitrile,
(S)-4-(5- { [ 1 -(3-Chlorobenzoyl)pyrrolidin-3-ylamino]methyl) imidazol- 1 -ylmethyl) benzonitrile, (R)-4- {5-[(l -Benzoylpyπolidin-3-ylamino)methyl]imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-(5-{[l-(2-Chlorobenzoyl)pyπolidin-3-ylaminojmethyl)imidazol-l-ylmethyl) benzonitrile,
(R)-4-(5-{[l-(2-Methylpyridine-3-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(2-Methylpyridine-3-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Isoquinoline-4-carbonyl)pyπolidin-3-ylamino]methyl) imidazol- 1- ylmethyl)benzonitrile,
(S)-4-(5 - { [ 1 -(Isoquinoline-4-carbonyl)pyπolidin-3 -ylaminojmethyl) imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5-{[l-(5-Bromopyridine-3-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(<S)-4-(5 - { [ 1 -(5 -Bromopyridine-3 -carbonyl)pyrrolidin-3-ylamino jmethyl } imidazol- 1 - ylmethyl)benzonitrile,
(R)-4-(5-{[l-(2-Methylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl) imidazol- l-ylmethyl)benzonitrile,
(5)-4-(5 - { [ 1 -(2 -Methylsulfanylpyridine-3 -carbonyl)pyrrolidin-3 -ylaminojmethyl) imidazol- 1 -ylmefhyl)benzonitrile,
(R)-4-(5-{[l-(2-Ethylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl) imidazol- l-ylmethyl)benzonitrile,
(5)-4-(5-{[l-(2-Ethylsulfanylpyridine-3-carbonyl)pyrrolidin-3-ylamino]methyl) imidazol- l-ylmethyl)benzonitrile, 4-(5-{[(3R)-l-(trα«5-Cotinine-4-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1 - ylmethyl)benzonitrile,
4-(5- {[(35)-l-(trα«5-Cotinine-4-carbonyl)pyπolidin-3-ylamino]methyl) imidazol-1- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Biphenyl-2-carbonyl)pyrrolidin-3-ylamino]methyl) imidazol- 1- ylmethyl)benzonitrile,
(5)-4-(5-{[l-(Biphenyl-2-carbonyl)pyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)benzonitrile,
(R)-4-(5-{[l-(Adamantan-l-ylacetyl)pyrrolidin-3-ylaminojmefhyl) imidazol-1 - ylmethyl)benzonitrile,
(S)-4-(5-{[\ -(Adamantan- l-ylacetyl)pyπolidin-3-ylamino]methyl) imidazol-1 - ylmethyl)benzonitrile,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)-2-phenoxybenzonitrile,
(S)-4-(5 - { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -ylaminojmethyl } imidazol- 1 - ylmethyl)-2-phenoxybenzonitrile,
(R)-4-(5 - { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3 -ylaminojmethyl } imidazol- 1 - ylrnethyl)-2-phenefhyloxybenzonitrile,
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl)imidazol-l- ylmethyl)-2-phenethyloxybenzonitrile,
(R)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile,
(5)-2-Benzyloxy-4-(5-{[l-(3-chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 -ylmethyl)benzonitrile, (R)-4-(5- { [ 1 -(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl) imidazol- 1 - ylmethyl)-2-(3-phenylpropoxy)benzonitrile,
(^^-(S-lfl^S-Chlorobenzy^^-oxopyπolidin-S-ylaminojmethyl) imidazol- 1- ylmethyl)-2-(3-phenylpropoxy)benzonitrile,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)imidazol-l- ylmethyl)-2-methoxybenzonitrile,
(<S)-4-(5- { [ 1 -(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methyl) imidazol- 1 - ylmethyl)-2-methoxybenzonitrile,
(R)-4-{5-[(2-oxo-l-pyridin-2-ylp)ττolidin-3-ylamino)methyljimidazol-l-ylmethyl} benzonitrile,
(S)-4-{5-[(2-oxo-l-pyridin-2-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile,
(R)-4-[5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -yl] (3 -phenylpropyl) amino) methyl) imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](3-phenylpropyl) aminojmethyl) imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({(3-Aminopropyl)[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl]amino)methyl) imidazol-1 -ylmethyljbenzonitrile,
(5)-4-[5-({(3-Aminopropyl)[l-(3-chlorobenzyl)-2-oxopyrrolidin-3-yl]amino)methyl) imidazol-1 -ylmethyljbenzonitrile,
(R)-N-(3-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl][l-(4-cyanobenzyl)-lH- imidazol-5-ylmethyl]amino)propyl)nicotinamide, (S)-N-(3- {[ 1 -(3-Chlorobenzyl)-2-oxopyπolidin-3-yl][ 1 -(4-cyanobenzyl)- lH-imidazol- 5 -ylmethyl] amino } propyl)nicotinamide,
(R)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](2-morpholin-4-ylethyl)amino) methyl)imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylj(2-morpholin-4-ylethyl)amino) methyl)imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](2-piperazin-l-ylethyl)amino) methyl)imidazol- 1 -ylmethyljbenzonitrile,
(S)-4- [5 -( { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -yl] (2-piperazin- 1 -ylethyl)amino } methyl)imidazol- 1 -ylmethyljbenzonitrile,
(R)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl][2-(pyridin-2-ylamino) ethyl] amino ) methyl)imidazol- 1 -ylmethyljbenzonitrile,
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-yl][2-(pyridin-2-ylamino) ethyl] amino)methyl)imidazol-l-ylmethyl]benzonitrile,
(R)-6- Amino- V-(3 - { [ 1 -(3 -chlorobenzyl)-2-oxopyrrolidin-3 -yl] [ 1 -(4-cyanobenzyl)- 1H- imidazol-5-ylmethyl]amino)propyl)nicotinamide,
(ιS)-6-Amino-N-(3-{[l-(3-chlorobenzyl)-2-oxopyπolidin-3-yl][l-(4-cyanobenzyl)-lH- imidazol-5 -ylmethyl] amino } propyl)nicotinamide,
(3.S)-4-[5-({l-[(5)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile,
(35)-4-[5-({l-[(R)-(3-Chloroρhenyl)(3-hydroxyphenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol- 1 -ylmethyl]-2-fluorobenzonitrile,
(3R)-4-[5-({l-[(R)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile, (3R)-4-[5-( { 1 -[(S)-(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopynolidin-3- ylamino)methyl)imidazol-l-ylmethyl]-2-fluorobenzonitrile,
(35)-2-Fluoro-4-[5-( { 1 -[(5)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol-l -ylmethyljbenzonitrile,
(3,S)-2-Fluoro-4-[5-({l-[(R)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol-l -ylmethyljbenzonitrile,
(3R)-2-Fluoro-4-[5-({l-[(R)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3- ylamino ) methyl)imidazol- 1 -ylmethyljbenzonitrile,
(3R)-2-Fluoro-4-[5-( { 1 -[(5)-(3-hydroxyphenyl)(phenyl)methyl]-2-oxopyπolidin-3- ylamino)methyl)imidazol- 1 -ylmethyljbenzonitrile,
(R)-2-Fluoro-4-(5- {[ 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyrrolidin-3-ylamino] methyl)imidazol-l-ylmethyl)benzonitrile,
(5)-2-Fluoro-4-(5-{[l-(7-hydroxynaphthalen-l-yl)-2-oxopyπolidin-3-ylamino] methyl) imidazol- l-ylmethyl)benzonitrile,
(R)-2-Fluoro-4- [ 1 -(5 - { [ 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyπolidin-3 -ylamino] methyl) imidazol- 1 -yl)eth- 1 -yl]benzonitrile,
(<S)-2-Fluoro-4-[ 1 -(5 - { [ 1 -(7-hydroxynaphthalen- 1 -yl)-2-oxopyrrolidin-3 -ylamino] methyl) imidazol- 1 -yl)eth- 1 -yljbenzonitrile,
(R)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]amino)pyrrolidine-l-carboxylic acid (adamantan- l-yl)amide,
(5)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyljamino)pyπolidine-l-carboxylic acid (adamantan- l-yl)amide, (R)-3-{[l-(4-Cyanobenzyl)-lH-imidazol-5-ylmethyl]amino)pyπolidine-l -carboxylic acid (2,6-difluorophenyl)amide,
(S)-3 - { [ 1 -(4-Cyanobenzyl)- 1 H-imidazol-5 -ylmethyl] amino } pyπolidine- 1 -carboxylic acid (2,6-difluorophenyl)amide,
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)pyridin-3- ylmethyl)benzonitrile,
(S)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methyl)pyridin-3- ylmethyl)benzonitrile,
(R)-4- { 5 - [(2-Oxo- 1 -pyridin-4-ylpyπolidin-3 -ylamino)methyl] imidazol- 1 -ylmethyl) benzonitrile;
(5)-4-{5-[(2-Oxo-l-pyridin-4-ylpyπolidin-3-ylamino)methyl]imidazol-l-ylmethyl) benzonitrile;
(R)-4-{5-[(2-Oxo-l-pyridin-3-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(1S)-4-{5-[(2-Oxo-l-pyridin-3-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(R)-4-{5-[(2-Oxo-l-pyrazin-2-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(5)-4-{5-[(2-Oxo-l-pyrazin-2-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(R)-4-{5-[(2-Oxo-l-tetrahydrofuran-3-ylpyπolidin-3-ylamino)methyl]imidazol-l- ylm ethyl) benzonitrile;
(1S)-4-{5-[(2-Oxo-l-tetrahydrofuran-3-ylpyπolidin-3-ylamino)methyl]imidazol-l- ylmethyljbenzonitrile; (R)-4-{5-[(2-Oxo-l-thiazol-2-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(5)-4-{5-[(2-Oxo-l-thiazol-2-ylpyπolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(R)-4-{5-[(l-(4-Mo holinophenyl)-2-oxopyrrolidin-3-ylamino)methyl]imidazol-l- ylmethyljbenzonitrile;
(5)-4-{5-[(l-(4-Morpholinophenyl)-2-oxopyπolidin-3-ylamino)methyl]imidazol-l- y lmethyl } benzonitrile ;
(R)-4- { 5- [( 1 -( 1 -Benzylpyrrolidin-3 -yl-2-oxopyrrolidin-3 -ylamino )methyl]imidazol- 1 - ylmethyljbenzonitrile;
(5)-4-{5-[(l-(l-Benzylpyrrolidin-3-yl-2-oxopyπolidin-3-ylamino)methyl]imidazol-l- ylmethyl) benzonitrile;
(R)-4-{5-[(2-Oxo-l-quinolin-5-ylpyrrolidin-3-ylamino)methyl]imidazol-l -ylmethyl) benzonitrile;
(5)-4-{5-[(2-Oxo-l-quinolin-5-ylpyπolidin-3-ylamino)methyljimidazol-l-ylmethyl) benzonitrile;
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methanoyl)imidazol- 1 -ylmethyl)benzonitrile;
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]methanoyl)imidazol- l-ylmethyl)benzonitrile;
(S)-4-{[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-ylamino]mefhanoyl}-3- (4-cyanophenyl)-2,3-dihydroimidazo[2,l-bjthiazole;
(R)-4- { [ 1 -(3 -Chlorobenzyl)-2-oxopyπolidin-3 -ylaminojmethanoyl } -3 - (4-cyanophenyl)-2,3-dihydroimidazo[2,l-b]thiazole,;
(R)-2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyπolidin-3-ylamino)ethyl]imidazol-l- ylmethyl) benzonitrile;
(ιS)-2-Fluoro-4-{5-[2-(2-oxo-l-phenylpyπolidin-3-ylamino)ethyl]imidazol-l- ylmethyl) benzonitrile;
(R)-4-(5-{[l-(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyrrolidin-3-ylamino] ethyl) imidazol- 1 -ylmethyl)-2-fluorobenzonitrile;
(5)-4-(5- {[ 1 -(2-Bromo-5-methanesulfonyloxybenzyl)-2-oxopyπolidin-3-ylaminoj ethyl)imidazol-l-ylmethyl)-2-fluorobenzonitrile;
(R)-3-{[l-(4-Cyanobenzyl)imidazol-5-yl]methylamino)-l-[(2-ethoxybenzyl) oxycarbonyljpyπolidine;
(S)-3- { [ 1 -(4-Cyanobenzy l)imidazol-5 -yljmethylamino } - 1 - [(2-ethoxybenzyl) oxycarbonyljpyπolidine;
(R)-3 - { [ 1 -(4-Cyanobenzyl)-2-methylimidazol-5 -yljmethylamino } - 1 -[(2- trifluoromethoxybenzyl)oxycarbonyl]pyπolidine;
(5)-3-{[l-(4-Cyanobenzyl)-2-methylimidazol-5-yl]methylamino)-l-[(2- trifluoromethoxybenzyl)oxycarbonyl]pyπolidine;
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
8. The compound according to Claim 7 which is:
Figure imgf000310_0001
(S)-4-(5-{[l-(2-Chlorophenyl)-2-oxopyrrolidin-3-ylamino]methyl}imidazol-l- ylmethyl)benzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
9. The compound according to Claim 7 which is:
Figure imgf000311_0001
(R)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylamino]methylJimidazol-l- ylmethyl)-2-phenoxybenzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
10. The compound according to Claim 7 which is:
Figure imgf000311_0002
(5)-4-(5-{[l-(3-Chlorobenzyl)-2-oxopyrrolidin-3-ylaminoJmethyl}imidazol-l- ylmethyl)-2-mefhoxybenzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
11. The compound according to Claim 7 which is:
Figure imgf000312_0001
(5)-4-[5-({[l-(3-Chlorobenzyl)-2-oxopyπolidin-3-yl](2-morpholin-4- ylethyl)amino} methyl)imidazol- 1 -ylmethyljbenzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
12. The compound according to Claim 7 which is:
Figure imgf000312_0002
(35)-4-[5-({l-[(3-Chlorophenyl)(3-hydroxyphenyl)methyl]-2-oxopyπolidin-3- ylamino}methyl)imidazol-l-ylmethylJ-2-fluorobenzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
13. The compound according to Claim 7 which is:
Figure imgf000313_0001
4-(5-{[(3iS)-l-(2-Ethylsulfanylpyridine-3-carbonyl)pyπolidin-3-ylamino]methylJ imidazol- l-ylmethyl)benzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
14. The compound according to Claim 7 which is:
Figure imgf000313_0002
(S)-4-(5- { [ 1 -(Adamantan- 1 -ylacetyl)pyπolidin-3-ylamino]methylJ imidazol- 1 - ylmethyl)benzonitrile
or a pharmaceutically acceptable salt, an optical isomer or stereoisomer thereof.
15. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of
Claim 1.
16. A pharmaceutical composition comprising a pharmaceutical caπier, and dispersed therein, a therapeutically effective amount of a compound of Claim 2.
17. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 3.
18. A pharmaceutical composition comprising a pharmaceutical carrier, and dispersed therein, a therapeutically effective amount of a compound of Claim 7.
19. A method for inhibiting famesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
20. A method for inhibiting farnesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 2.
21. A method for inhibiting famesyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 3.
22. A method for inhibiting fa esyl-protein transferase which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 7.
23. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
24. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim
2.
25. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 3.
26. A method for treating cancer which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim
7.
27. A method for treating neurofibromen benign proliferative disorder which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
28. A method for treating blindness related to retinal vascularization which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
29. A method for treating infections from hepatitis delta and related vimses which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
30. A method for preventing restenosis which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
31. A method for treating polycystic kidney disease which comprises administering to a mammal in need thereof a therapeutically effective amount of a compound of Claim 1.
32. A pharmaceutical composition made by combining the compound of Claim 1 and a pharmaceutically acceptable carrier.
33. A process for making a pharmaceutical composition comprising combining a compound of Claim 1 and a pharmaceutically acceptable caπier.
34. A method of conferring radiation sensitivity on a tumor cell using a therapeutically effective amount of a compound of Claim 1 in combination with radiation therapy.
35. A method of treating cancer using a therapeutically effective amount of a compound of Claim 1 in combination with an antineoplastic.
36. A method according to Claim 33 wherein the antineoplastic is paclitaxel.
PCT/US2000/024542 1999-09-09 2000-09-07 Inhibitors of prenyl-protein transferase WO2001017992A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU73549/00A AU7354900A (en) 1999-09-09 2000-09-07 Inhibitors of prenyl-protein transferase

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15298999P 1999-09-09 1999-09-09
US60/152,989 1999-09-09

Publications (1)

Publication Number Publication Date
WO2001017992A1 true WO2001017992A1 (en) 2001-03-15

Family

ID=22545317

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/024542 WO2001017992A1 (en) 1999-09-09 2000-09-07 Inhibitors of prenyl-protein transferase

Country Status (2)

Country Link
AU (1) AU7354900A (en)
WO (1) WO2001017992A1 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001076694A1 (en) * 2000-04-10 2001-10-18 Merck & Co., Inc. Inhibitors of prenyl-protein transferase
WO2004048363A1 (en) * 2002-11-22 2004-06-10 Takeda Pharmaceutical Company Limited Imidazole derivative, process for producing the same, and use
JP2004182730A (en) * 2002-11-22 2004-07-02 Takeda Chem Ind Ltd Imidazole derivative, its manufacturing method and use
US7163937B2 (en) 2003-08-21 2007-01-16 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US7629351B2 (en) 2006-07-28 2009-12-08 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-2-oxo-3-(6-(trifluoromethyl)quinazolin-4-ylamino) pyrrolidin-1-yl)cyclohexyl)acetamide and other modulators of chemokine receptor activity, crystalline forms and process
US7671062B2 (en) 2006-07-28 2010-03-02 Bristol-Myers Squibb Company Modulators of chemokine receptor activity, crystalline forms and process
US7687508B2 (en) 2006-07-28 2010-03-30 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US7745623B2 (en) 2004-05-21 2010-06-29 Takeda Pharmaceutical Company Limited Cyclic amide derivative, and its production and use
US7767699B2 (en) 2003-07-03 2010-08-03 Purdue Pharma, L.P. Therapeutic agents useful for treating pain
WO2010141932A1 (en) * 2009-06-05 2010-12-09 Link Medicine Corporation Aminopyrrolidinone derivatives and uses thereof
EP2303021A2 (en) * 2008-06-16 2011-04-06 University of Tennessee Research Foundation Compounds for the treatment of cancer
US8383812B2 (en) 2009-10-13 2013-02-26 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-3-(7-tert-butylpyrazolo[1,5-A][1,3,5]triazin-4-ylamino)-2-oxopyrrolidin-1-yl)cyclohexyl)acetamide, a dual modulator of chemokine receptor activity, crystalline forms and processes
US8822513B2 (en) 2010-03-01 2014-09-02 Gtx, Inc. Compounds for treatment of cancer
US9029408B2 (en) 2008-06-16 2015-05-12 Gtx, Inc. Compounds for treatment of cancer
US9334242B2 (en) 2008-06-16 2016-05-10 Gtx, Inc. Compounds for treatment of cancer
US9447049B2 (en) 2010-03-01 2016-09-20 University Of Tennessee Research Foundation Compounds for treatment of cancer
US11180473B2 (en) 2020-03-27 2021-11-23 Landos Biopharma, Inc. PLXDC2 ligands

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5756528A (en) * 1995-06-06 1998-05-26 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
US5939557A (en) * 1996-04-03 1999-08-17 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5756528A (en) * 1995-06-06 1998-05-26 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase
US5939557A (en) * 1996-04-03 1999-08-17 Merck & Co., Inc. Inhibitors of farnesyl-protein transferase

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001076694A1 (en) * 2000-04-10 2001-10-18 Merck & Co., Inc. Inhibitors of prenyl-protein transferase
WO2004048363A1 (en) * 2002-11-22 2004-06-10 Takeda Pharmaceutical Company Limited Imidazole derivative, process for producing the same, and use
JP2004182730A (en) * 2002-11-22 2004-07-02 Takeda Chem Ind Ltd Imidazole derivative, its manufacturing method and use
US8058292B2 (en) 2003-07-03 2011-11-15 Purdue Pharma L.P. Therapeutic agents useful for treating pain
US7767699B2 (en) 2003-07-03 2010-08-03 Purdue Pharma, L.P. Therapeutic agents useful for treating pain
US7829571B2 (en) 2003-08-21 2010-11-09 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US7163937B2 (en) 2003-08-21 2007-01-16 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US7482335B2 (en) 2003-08-21 2009-01-27 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US8697865B2 (en) 2004-05-21 2014-04-15 Takeda Pharmaceutical Company Limited Cyclic amide derivative, and its production and use
US7745623B2 (en) 2004-05-21 2010-06-29 Takeda Pharmaceutical Company Limited Cyclic amide derivative, and its production and use
US7629351B2 (en) 2006-07-28 2009-12-08 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-2-oxo-3-(6-(trifluoromethyl)quinazolin-4-ylamino) pyrrolidin-1-yl)cyclohexyl)acetamide and other modulators of chemokine receptor activity, crystalline forms and process
US8049019B2 (en) 2006-07-28 2011-11-01 Bristol-Myers Squibb Company Substituted pyrrolidine-2-one compounds
US7687508B2 (en) 2006-07-28 2010-03-30 Bristol-Myers Squibb Company Cyclic derivatives as modulators of chemokine receptor activity
US7671062B2 (en) 2006-07-28 2010-03-02 Bristol-Myers Squibb Company Modulators of chemokine receptor activity, crystalline forms and process
US10865196B2 (en) 2008-06-16 2020-12-15 University Of Tennessee Research Foundation Compounds for treatment of cancer
EP2303021A2 (en) * 2008-06-16 2011-04-06 University of Tennessee Research Foundation Compounds for the treatment of cancer
EP2303021A4 (en) * 2008-06-16 2012-03-14 Univ Tennessee Res Foundation Compounds for the treatment of cancer
US10301285B2 (en) 2008-06-16 2019-05-28 Gtx, Inc. Compounds for treatment of cancer
US9334242B2 (en) 2008-06-16 2016-05-10 Gtx, Inc. Compounds for treatment of cancer
US8592465B2 (en) 2008-06-16 2013-11-26 University Of Tennessee Research Foundation Compounds for treatment of cancer
US9029408B2 (en) 2008-06-16 2015-05-12 Gtx, Inc. Compounds for treatment of cancer
AU2009330686B2 (en) * 2008-06-16 2014-07-03 The Ohio State University Research Foundation Compounds for the treatment of cancer
CN102548986A (en) * 2009-06-05 2012-07-04 链接医药公司 Aminopyrrolidinone derivatives and uses thereof
US8252829B2 (en) 2009-06-05 2012-08-28 Link Medicine Corporation Aminopyrrolidinone derivatives and uses thereof
WO2010141932A1 (en) * 2009-06-05 2010-12-09 Link Medicine Corporation Aminopyrrolidinone derivatives and uses thereof
US8906920B2 (en) 2009-10-13 2014-12-09 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-3-(7-tert-butylpyrazolo[1,5-A][1,3,5]triazin-4-ylamino)-2-oxopyrrolidin-1-yl)cyclohexyl)acetamide, a dual modulator of chemokine receptor activity, crystalline forms and processes
US8618101B2 (en) 2009-10-13 2013-12-31 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-3-(7-tert-butylpyrazolo[1,5-a][1,3,5]triazin-4-ylamino)-2-oxopyrrolidin-1-yl)cyclohexyl)acetamide, a dual modulator of chemokine receptor activity, crystalline forms and processes
US8383812B2 (en) 2009-10-13 2013-02-26 Bristol-Myers Squibb Company N-((1R,2S,5R)-5-(tert-butylamino)-2-((S)-3-(7-tert-butylpyrazolo[1,5-A][1,3,5]triazin-4-ylamino)-2-oxopyrrolidin-1-yl)cyclohexyl)acetamide, a dual modulator of chemokine receptor activity, crystalline forms and processes
US8822513B2 (en) 2010-03-01 2014-09-02 Gtx, Inc. Compounds for treatment of cancer
US9447049B2 (en) 2010-03-01 2016-09-20 University Of Tennessee Research Foundation Compounds for treatment of cancer
US11465987B2 (en) 2010-03-01 2022-10-11 Oncternal Therapeutics, Inc. Compounds for treatment of cancer
US11180473B2 (en) 2020-03-27 2021-11-23 Landos Biopharma, Inc. PLXDC2 ligands
US11597717B2 (en) 2020-03-27 2023-03-07 Landos Biopharma, Inc. Substituted imidazoles as PLXDC2 ligands

Also Published As

Publication number Publication date
AU7354900A (en) 2001-04-10

Similar Documents

Publication Publication Date Title
US6358956B1 (en) Inhibitors of prenyl-protein transferase
US6358985B1 (en) Inhibitors of prenyl-protein transferase
AU2002211828A1 (en) Inhibitors of prenyl-protein transferase
AU4845099A (en) Inhibitors of prenyl-protein transferase
WO2001017992A1 (en) Inhibitors of prenyl-protein transferase
US6284755B1 (en) Inhibitors of prenyl-protein transferase
US20020052380A1 (en) Inhibitors of prenyl-protein transferase
US20020010184A1 (en) Inhibitors of prenyl-protein transferase
US6441017B1 (en) Inhibitors of prenyl-protein transferase
AU760028B2 (en) Inhibitors of prenyl-protein transferase
WO2001051128A1 (en) Inhibitors of prenyl-protein transferase
WO2001045707A1 (en) Inhibitors of prenyl-protein transferase
AU3386600A (en) Inhibitors of prenyl-protein transferase
US6525074B2 (en) Inhibitors of prenyl-protein transferase
WO2002060868A2 (en) Inhibitors of prenyl-protein transferase
US6316436B1 (en) Inhibitors of prenyl-protein transferase
US6566385B2 (en) Inhibitors of prenyl-protein transferase
US6413964B1 (en) Inhibitors of prenyl-protein transferase
WO2002079147A2 (en) Inhibitors of prenyl-protein transferase
AU762440B2 (en) Inhibitors of prenyl-protein transferase
US6355643B1 (en) Inhibitors of prenyl-protein transferase
US20040110764A1 (en) Inhibitors of prenyl-protein transferase
US20020022633A1 (en) Inhibitors of prenyl-protein transferase
WO2002020015A1 (en) Inhibitors of prenyl-protein transferase
WO2002078702A1 (en) Inhibitors of prenyl-protein transferase

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP