WO2001014570A1 - Activatable recombinant neurotoxins - Google Patents

Activatable recombinant neurotoxins Download PDF

Info

Publication number
WO2001014570A1
WO2001014570A1 PCT/US2000/023427 US0023427W WO0114570A1 WO 2001014570 A1 WO2001014570 A1 WO 2001014570A1 US 0023427 W US0023427 W US 0023427W WO 0114570 A1 WO0114570 A1 WO 0114570A1
Authority
WO
WIPO (PCT)
Prior art keywords
chain
neurotoxin
polypeptide
compnsing
sequence region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/023427
Other languages
French (fr)
Inventor
J. Oliver Dolly
Yan Li
Kuo Chion Chan
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Allergan Sales LLC
Original Assignee
Allergan Sales LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=22535688&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2001014570(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to BR0012759-0A priority Critical patent/BR0012759A/en
Priority to JP2001518882A priority patent/JP2003507073A/en
Priority to EP00964920A priority patent/EP1206554B2/en
Priority to CA002380457A priority patent/CA2380457A1/en
Priority to DE60032367T priority patent/DE60032367T3/en
Application filed by Allergan Sales LLC filed Critical Allergan Sales LLC
Priority to KR1020027002270A priority patent/KR100876060B1/en
Priority to HK02107594.3A priority patent/HK1046020B/en
Priority to AU75731/00A priority patent/AU777556B2/en
Publication of WO2001014570A1 publication Critical patent/WO2001014570A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/33Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • A61P21/02Muscle relaxants, e.g. for tetanus or cramps
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/08Antiepileptics; Anticonvulsants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/10Ophthalmic agents for accommodation disorders, e.g. myopia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention concerns methods and compositions useful in the fields of neurobiology, molecular biology, and medicine, as well as methods for the production of potentially toxic therapeutic agents and derivatives thereof.
  • the invention also concerns recombinant clostridial neurotoxins (particular botulinum neurotoxins), modified versions thereof, and methods of making such molecules, for use as therapeutic agents, transporter molecules, adducts, and the like.
  • Neurotoxins such as those obtained from Clostridium botulinum and Clostridium tetani, are highly potent and specific poisons of neural cells, and other cells when delivered within such cells for therapeutic purposes.
  • These Gram positive bacteria express two related but distinct toxins types, each comprising two disulfi de-linked amino acid chains: a light chain (L) of about 50 KDa and a heavy chain (H) of about 100 KDa, which are wholly responsible for the symptoms of these diseases.
  • L light chain
  • H heavy chain
  • the holotoxin is synthesised in vivo as a single chain, then nicked in a post-translational modification to form the active neurotoxin comprising the separate L and H chains.
  • tetanus and botulinum toxms are among the most lethal substances known to man, having a lethal dose in humans of between 0.1 ng and 1 ng per kilogram of body weight. Tonello et al., Adv. Exp. Med. & Biol. 389:251-260 (1996). Both toxins function by inhibiting neurotransmitter release in affected neurons.
  • the tetanus neurotoxin acts mainly in the central nervous system, while botulinum neurotoxin (BoNT) acts at the neuromuscular junction and other chohnergic synapses in the pe ⁇ pheral nervous system; both act by inhibiting neurotransmitter release from the axon of the affected neuron into the synapse, resulting in paralysis.
  • the tetanus neurotoxin is known to exist in one immunologically distinct type; the botulinum neurotoxins (BoNT) are known to occur in seven different lmmunogenic types, termed BoNT/A through BoNT/G. While all of these types are produced by isolates of C. botulinum, two other species, C.
  • the molecular mechanism of intoxication appears to be similar.
  • the toxin binds to the presynaptic membrane of the target neuron through a specific interaction between the heavy (H) chain and a cell surface receptor; the receptor is thought to be different for each type of botulinum toxin and for TeNT.
  • H heavy
  • TeNT TeNT
  • the carboxyl terminus of the heavy chain appears to be important for targeting of the toxin to the cell surface.
  • the toxin crosses the plasma membrane of the poisoned cell.
  • the toxin is first engulfed by the cell through receptor-mediated endocytosis, and an endosome containing the toxm is formed. The toxm then escapes the endosome into the cytoplasm of the cell. This last step is thought to be mediated by the amino terminus of the H chain, which t ⁇ ggers a conformational change of the toxm in response to a pH of about 5.5 or lower. Endosomes are known to possess a proton pump which decreases intra endosomal pH. The conformational shift exposes hydrophobic residues in the toxin, which permits the toxin to embed itself in the endosomal membrane. The toxin then translocates through the endosomal membrane into the cytosol.
  • the last step of the mechanism of botulinum toxin activity appears to involve reduction of the disulfide bond joining the H and light (L) chain.
  • the entire toxic activity of botulinum and tetanus toxins is contained in the L chain of the holotoxin; the L chain is a zinc (Z ⁇ ) endopeptidase which selectively cleaves proteins essential for recognition and docking of neurotransmitter- contaimng vesicles with the cytoplasmic surface of the plasma membrane, and fusion of the vesicles with the plasma membrane.
  • TxNT, BoNT/B BoNT/D, BoNT/F, and BoNT/G cause degradation of synaptobrevm (also called vesicle- associated membrane protein (VAMP)), a synaptosomal membrane protein.
  • VAMP vesicle- associated membrane protein
  • Most of the cytosohc domain of VAMP extending from the surface of the synaptic vesicle is removed as a result of any one of these cleavage events
  • Each toxin (except TeNT and BoNT B) specifically cleaves a different bond.
  • BoNT/A and /E selectively cleave the plasma membrane-associated protein SNAP-25; this protein, which is also cleaved by BoNT/Cl (Foran et al., Biochem. 35:2630-2636 (1996)), is predominantly bound to and present on the cytosohc surface of the plasma membrane.
  • BoNT/C cleaves syntaxm, an integral protein having most of its mass exposed to the cytosol. Syntaxin interacts with the calcium channels at presynaptic terminal active zones. See Tonello et al., Tetanus and Botulinum Neurotoxins in Intracellular Protein Catabohsm 251-260 (Suzuki K. & Bond J. eds. 1996), the disclosure of which is incorporated by reference as part of this specification Both TeNT and BoNT are taken up at the neuromuscular junction.
  • BoNT remains within pe ⁇ pheral neurons, and blocks release of the neurotransmitter acetylchohne from these cells Through its receptor, TeNT enters vesicles that move in a retrograde manner along the axon to the soma, and is discharged into the mtersynaptic space between motor neurons and the inhibitory neurons of the spinal cord At this point, TeNT binds receptors of the inhibitory neurons, is again internalized, and the light chain enters the cytosol to block the release of the inhibitory neurotransmitters 4-am ⁇ nobutync ac ⁇ d(GABA) and glycme from these cells
  • BoNT/A is the most potent of the BoNTs, and the best characterized.
  • Intramuscular injection of spastic tissue with small quantities of BoNT/A has also been used effectively to treat spasticity due to brain injury, spinal cord injury, stroke, multiple sclerosis and cerebral palsy
  • the extent of paralysis depends on both the dose and volume delivered to the target site
  • the L chain is the moiety responsible for neural intoxication, it must be delivered to the neural cytoplasm in order to be toxic Similarly, the single chain holotoxin pro-forms exhibit relatively low toxicity until they are cleaved at one or more peptide bonds in an exposed loop region between their H and L chains to create the fully-active mature neurotoxins.
  • the H chain of each neurotoxin is essential for cell receptor binding and endocytosis, while both the L and the H chains (and an intact disufide bond) are required for translocation of the toxin into the cytoplasm.
  • the L chain alone is responsible for the toxicity caused by inhibition of acetylcholine secretion.
  • the nicked neurotoxin is much more active than the unnicked form.
  • the amount and precise location of nicking varies with the serotypes of the bacteria producing the toxin.
  • the differences in single-chain neurotoxin activation and, hence, the yield of nicked toxin are due to variations in the type and amounts of proteolytic activity produced by a given strain. For example, greater than 99% of C. botulinum type A single-chain neurotoxin is activated by the Hall A C. botulinum strain, whereas type B and E strains produce toxins with lower amounts of activation (0 to 75% depending upon the fermentation time).
  • the high toxicity of the mature neurotoxin plays a major part in the commercial manufacture of neurotoxins as therapeutic agents.
  • engineered clost ⁇ dial toxins The degree of activation of engineered clost ⁇ dial toxins is, therefore, an important consideration for manufacture of these mate ⁇ als. It would be a major advantage if neurotoxins such as BoNT and TeTx could be expressed in high yield in rapidly-growing bacte ⁇ a (such as heterologous E. coli cells) as relatively non-toxic single-chains (or single chains having reduced toxic activity) which are safe, easy to isolate and simple to convert to the fully-active form.
  • neurotoxins such as BoNT and TeTx could be expressed in high yield in rapidly-growing bacte ⁇ a (such as heterologous E. coli cells) as relatively non-toxic single-chains (or single chains having reduced toxic activity) which are safe, easy to isolate and simple to convert to the fully-active form.
  • clostridial neurotoxins as inactive (or less active) single-chain forms, to eliminate the need for the time-consuming and inefficient reconstitution of the constituent chains, to maintain solubility of the protein chains, to reduce protein misfolding and consequent susceptibility to protease attack, to improve toxin yield, and/or to provide a simple method for the purification of the toxin.
  • the present invention is directed to recombinant and isolated proteins comprising a functional binding domain, translocation domain, and therapeutic domain in which such proteins also include an amino acid sequence that is susceptible to specific cleavage in vitro following expression as a single chain.
  • proteins may include clostridial neurotoxins and derivatives thereof, such as those proteins disclosed in U.S. Patent 5,989,545 and International Patent Application WO95/32738, both incorporated by reference herein.
  • the protein comprises the functional domains of a clostridial neurotoxin H chain and some or all of the functions of a clostridial neurotoxin L chain in a single polypeptide chain, and having an inserted proteolytic cleavage site located between the H domain and the L domain by which the single chain protein may be cleaved to produce the individual chains, preferably covalently linked by a disulfide linkage.
  • the invention also includes methods of making such proteins and expressing them within a cell, as well as nucleic acid vectors for the transfer and expression of the nucleotide sequence regions encoding such proteins and cells containing such vectors.
  • the proteolytic cleavage sites comprise amino acid sequences that are selectively recognized and cleaved by a specific enzyme.
  • the expressed single-chain proteins comprise the biologically active domains of the H chain and L chain of a clostridial neurotoxin. Scission at the internal proteolytic cleavage site separating the chain domains thus results in the activation of a neurotoxin having full activity.
  • the single-chain proteins comprise a binding domain targeted to a cell receptor other than one borne by a motor neuron.
  • Such a binding domain may specific bind to, for example, a sensory afferent neuron, or to a non-neuronal cell type or tissue, such as pancreatic acinar cells.
  • the single-chain proteins will contain a translocation domain similar to that of clostridial neurotoxins, and a therapeutic moiety.
  • the therapeutic moiety may be a clostridial neurotoxin light chain, or may be a different therapeutic moiety such as an enzyme, a transcribable nucleotide sequence, growth factor, an antisense nucleotide sequence and the like.
  • the toxins and toxin-based proteins of the present invention will be tailored to contain an additional amino acid sequence comprising a binding tag able to bind a target compound at sufficiently high efficiency to facilitate rapid isolation of the toxin protein.
  • Proteins containing such binding sites are many and well known to those of skill in the art, and may comprise, without limitation, monoclonal antibodies, maltose binding protein, glutathione- S -transferase, protein A, a His 6 tag, and the like.
  • the target compound may be immobilized to a solid support, including without limitation, a chromotography resin or microtiter well and used for affinity purification of the modified toxin.
  • the toxin molecule can then be eluted by standard methods, such as through the use of a high salt solution or specific antagonist.
  • the toxins of the this aspect of the present invention are expressed as their low activity (or inactive) single-chain proforms, then, by a carefully controlled proteolytic reaction in vitro, they are activated, preferably to the same potency level as the native neurotoxin from which they were derived.
  • the engineered proteolytic cleavage sites can be designed to occur in a specially-designed loop between the H and L portions of the single amino acid chain that promotes accessibility of the protease to the holotoxin substrate.
  • the amino acid sequences of the cleavage site are preferably designed to have a high degree of specificity to proteolytic enzymes which do not normally occur in humans (as either human proteases or occurring in part of the foreseeable human fauna and flora).
  • a non-exclusive list of examples of such proteases includes bovine enterokinase, which cleaves the amino acid sequence DDDDK; tobacco etch virus (TEV) protease, which cleaves the sequence EXXYXQS/G; GENENASE ® from Bacillus amyliquifaciens, which cleaves the sequence HY or YH; and PRESCISSION ® protease from human rhinovirus 3C, which cleaves the amino acid sequence LENLFQGP
  • the letter X indicates any amino acid All amino acid sequences shown in the present specification are in the direction from amino terminus to carboxyl terminus, and all nucleotide sequences from 5' to 3', (from left to ⁇ ght) unless otherwise indicated
  • the single-chain polypeptide is an isolated polypeptide
  • isolated is meant removed from its natural environment
  • isolation includes preparation of a cell lysate as well as subsequent pu ⁇ fication steps
  • a protein expressed extracellularly may be isolated by, for example, separation of the supernatant from the cells as well as any subsequent pu ⁇ fication steps.
  • the interchain loop region of the C botulinum subtype E neurotoxin which is normally resistant to proteolytic nicking in the bacte ⁇ um and mammals, is modified to include the inserted proteolytic cleavage site, and this loop region used as the interchain loop region in the single-chain toxin or modified toxin molecules of the present invention It is believed that using the loop from C botulinum subtype E will stabilize the unnicked toxm molecule in vivo, making it resistant to undesired cleavage until activated through the use of the selected protease.
  • recombinant chime ⁇ c and/or modified tox de ⁇ vatives expressed as a single chain polypeptide Such polypeptide may be molecular tranporters, such as, without limitation, those disclosed in Dolly et al., European Patent Specification EP 0 760 681 Bl, incorporated by reference herein
  • the invention includes neurotoxin derivatives comprising at least a portion of a light chain from one clostridial neurotoxin or subtype thereof, and at least a portion of a heavy chain from another neurotoxin or neurotoxin subtype, as well as methods for their production.
  • the hybrid neurotoxin may contain the entire light chain of a light chain from one neurotoxin subtype and the heavy chain from another neurotoxin subtype.
  • a chimeric neurotoxin derivative may contain a portion (e.g., the binding domain) of the heavy chain of one neurotoxin subtype, with another portion of the heavy chain being from another neurotoxin subtype.
  • the therapeutic element may comprise light chain portions from different neurotoxins.
  • Such hybrid or chimeric neurotoxin derivatives are useful, for example, as a means of delivering the therapeutic benefits of such neurotoxins to patients who are immunologically resistant to a given neurotoxin subtype, to patients who may have a lower than average concentration of receptors to a given neurotoxin heavy chain binding moiety, or to patients who may have a protease- resistant variant of the membrane or vesicle toxin substrate (e.g., SNAP-25, VAMP and syntaxin). Creation of recombinant chimeric or hybrid neurotoxin derivatives having a light chain with different substrate would permit such patients to respond to neurotoxin therapy.
  • a hyb ⁇ d or chime ⁇ c neurotoxin such as one containing at least a portion of a heavy chain selected from the group consisting of HC A HC B HC CI , HCp, HC E , HC F and HC G and a at least a portion of a light chain selected from a different clost ⁇ dial neurotoxin subtype, said light chain being selected from the group consisting of LC A LC B LCci, LC D , LC E , LC F and LCQ ) combining the heavy chain of that subtype with the most therapeutically approp ⁇ ate light chain (for example, the BoNT/A light chain) the patient could better respond to neurotoxin therapy
  • Another advantage of the hyb ⁇ d or chime ⁇ c neurotoxin de ⁇ vatives desc ⁇ bed above is related to the fact that certain of the light chains (e.g., LC A ) have a long duration of action, others having a short duration of action
  • Such hyb ⁇ d or chime ⁇ c neurotoxins would also be useful in treating a patient (such as a soldier or laboratory worker) who has been inoculated with the pentavalent BoNT vaccine
  • Such vaccines do not contain BoNT/F; thus, combining the approp ⁇ ate light chain with the BoNT F heavy chain would create a therapeutic agent which is effective in such a patient where current therapeutic neurotoxins may not be
  • the same strategy may be useful in using de ⁇ vatives of clost ⁇ dial neurotoxins with a therapeutic moiety other than an active neurotoxin light chain.
  • the heavy chain of such an agent would be de ⁇ ved from a neurotoxin, it may be advantageous to use a lesser known, or rarer heavy chain to avoid resistance mechanisms neutralizing the effectiveness of the therapeutic neurotoxin de ⁇ vative.
  • the binding moiety may be one other than a binding moiety de ⁇ ved from a clost ⁇ dial neurotoxin heavy chain, thus providing a targeting function to cell types other than motor neurons.
  • Figure 1 A is a diagrammatic view of the single-chain TeTx construct in plasmid pTrcHisA and the nucleotide sequence of the junction region.
  • Figure IB shows the and amino acid sequence connecting the carboxyl terminus of the L chain and the ammo terminus of the H chain and an engineered loop region containing an enterokinase cleavage site
  • Figure 2A is a representation of a Western blot of an SDS-PAGE gel of cell extracts of E. coli JM 109 transformants containing 2 different recombinant single-chain toxins, either before or after induction of plasmid protein expression with IPTG.
  • the antibody used for detection is an ant ⁇ -H ⁇ s 6 monoclonal antibody.
  • Figure 2B is a Western blot of IPTG-induced cell extracts from cells transformed with the E234A construct
  • Figure 3A shows the results of an expe ⁇ ment in which affinity pu ⁇ fied recombinant single-chain (SC) TeTx is nicked with enterokinase, then separated using SDS-PAGE and visualized using Commassie B ⁇ lhant Blue under reducing and non-reducing conditions.
  • Figure 3B shows the results of an experiment in which affinity purified recombinant single-chain (SC) TeTx is nicked with enterokinase, then separated using SDS-PAGE under reducing and non-reducing conditions and subjected to a Western blot using anti TeT%X heavy chain antibody.
  • Figure 4 is a plot of the degree of paralysis induced in a nerve/muscle preparation in vitro using native TeTx, and recombinant single chain neurotoxin before, and after nicking as a function of time.
  • Figure 5 is a depiction of the peptide fragments generated upon incubation of the recombinant single-chain TeTx with trypsin and Arg C protease, and deduction, from the N-terminal sequences of one of the resulting fragments, of the amino acid sequence recognized by these agents.
  • FIG. 6 shows the digestion of unnicked SC WT TeTx and SC R496G TeTx with various concentrations of trypsin.
  • Figure 7 shows the inhibitory effect upon TeTx stimulated inhibition of Ca ⁇ -dependent neurotransmitter release of preincubating cerebellar cells with the E234A mutant TeTx.
  • Figure 8 shows the effect upon Ca ++ -dependent neurotransmitter release of cerebellar neurons upon exposure to native, recombinant E234A mutant single-chain, and the recombinant R496G mutant single chain TeTx.
  • Figure 9 shows the inhibitory effect upon TeTx-stimulated paralytic activity of preincubating mouse hemi diaphrams with the E234A mutant TeTx.
  • Figure 10 shows the scheme for construction of a plasmid encoding single-chain BoNT/E, and an agarose gel electrophoretogram of the PCR fragment obtained during the construction of the plasmid.
  • Figure 11 shows the scheme for construction of a plasmid encoding the
  • Figure 12 shows the expression and pu ⁇ fication scheme for recombinant single-chain BoNT/E, and a SDS-PAGE electrophoretogram and Westerm blot of the purification fractions.
  • Figure 13 shows SDS-PAGE electrophoretograms under reducing and non-reducing conditions of native recombinant unnicked, and recombinant nicked BoNT/E, and Western Blots directed towards the heavy and light chains of the toxin.
  • Figure 14 shows the results of incubating native BoNT/E, recombinant nicked and un-nicked BoNT/E, and the E212Q mutant with a GST-SNAP- 25[ 140-205] protease substrate.
  • Figure 15 shows the effect upon Ca-H-dependent glutamate release of incubating cerebellar cells with native BoNT/E, un-nicked recombinant single chain BoNT/E, and nicked recombinant single chain BoNT/E.
  • Figure 16A shows the effects on muscle tension of incubating mouse phrenic-nerve hemi -diaphragms with 0.2 nM recombinant nicked BoNT/E (O)or 0.2 nM native BoNT/E (D).
  • Figure 16B shows the effects on muscle tension of incubating mouse phrenic-nerve hemi -diaphragms with 1 nM recombinant un-nicked (O), 1 nM recombinant nicked (•) or 0.05 nM recombinant nicked (V) BoNT/E.
  • Figure 17 shows the attenuation of paralytic activity on mouse phrenic- nerve hemi -diaphragms of preincubation with the inactive E212Q mutant p ⁇ or to exposure to native nicked BoNT/E toxin DETAILED DESCRIPTION OF THE INVENTION
  • compositions and methods of the present invention involve modified neurotoxins, their synthesis and use.
  • Di-chain neurotoxins that are normally activated by scission of a single chain polypeptide by indigenous proteases can be modified at the nucleic acid level by alteration or removal of the nucleotide sequence encoding the indigenous protease cleavage site and insertion of a nucleotide sequence encoding another different proteolytic cleavage site resistant to cleavage by host cell or human proteases.
  • the inserted amino acid sequence is designed to be cleaved in vitro through the use of a cleaving agent chosen in advance of expression that is ,absent from both human and host cell tissue.
  • the inserted amino acid sequence may be chosen to confer susceptibility to a chemical agent capable of cleaving peptide bonds, such as cyanogen bromide.
  • the encoded amino acid sequence may comprise a proteolytic cleavage site highly specific for a selected protease.
  • the selected protease is one not normally present in the cell expressing the single chain toxin molecule (for example, E. coli or the native clostridial bacterium).
  • the invention is drawn to recombinant single-chain modified clostridial neurotoxins that may be cleaved at will by a protease to provide an active di-chain molecule.
  • modified neurotoxins need not be toxic; in certain of these proteins the enzymatic activity of the toxin L chain may be abrogated, and the toxin joined to a drug or other bioactive agent having therapeutic activity.
  • the L chain is enzymatically active, but portions of the H chain are modified to provide specificity to target cells other than the natural target of the neurotoxin, while maintaining the translocation and endocytosis-stimulating activities of the native toxin.
  • the invention compnses a modified clost ⁇ dial neurotoxin de ⁇ ved from tetanus tox (TeNT), or one or more of the botulinum toxin (BoNT) subtypes in which the naturally-occur ⁇ ng interchain loop region has been replace with a modified loop region compnsing a different amino acid sequence confernng 1) resistance to cleavage by host proteases or autolytic action, and/or 2) lability to a selected protease.
  • the cleavage site is highly specific for the selected protease.
  • the interchain loop region of certain clostridial neurotoxins is naturally resistant to proteolytic cleavage in vivo.
  • This protease resistance may reflect a secondary or tertiary structure that makes the loop more resistant to indigenous proteases than other clostndial neurotoxins.
  • the ter-chain loop region of BoNT/E is substituted for the natural loop region occurnng an another BoNT having greater therapeutic activity or duration of action, for example BoNT/A or /B.
  • the loop region of BoNT/E is modified to contain a proteolytic cleavage site highly specific to a selected protease p ⁇ or to the subclomng.
  • the otherwise highly conserved BoNT/E loop region would be resistant to indigenous proteases, or those encountered within a human, but would retain the ability to be activated by digestion with the selected protease.
  • the selected protease therefore acts as an "activator" of neurotoxin toxicity (or modified toxin activity) that can be added at will following recombinant expression.
  • the selected protease may be any protease that recognizes a specific amino acid sequence and cleaves a peptide bond near or at that location, but the selected protease is very preferably not a human protease such as human trypsin, chymotrypsin or pepsin, or a host cell protease. Moreover, the selected protease does not recognize the same amino acid sequence as the indigenous proteases. Finally, the selected protease should not be one expressed by the host cell that contains the plasmid encoding the recombinant neurotoxin.
  • proteases to be selected as activators may include any of the following, without limitation: bovine enterokinase, plant proteases such as papain (from Carica papaya)and legumain, insect papain homolog (from the silkworm Sitophilus ze ⁇ m ⁇ tus), and crustacian papain homolog (decapod), Tobacco etch virus (TEV) protease, which cleaves the sequence EXXYXQS/G; GENENASE ® from Bacillus amyliquifaciens, which cleaves the sequence HY or YH; and PRESCISSION ® protease from human rhinovirus 3C, which cleaves the amino acid sequence LEVLFQGP.
  • TMV Tobacco etch virus
  • binding element an amino acid sequence region able to preferentially bind to a cell surface marker characteristic of the target cell under physiological conditions.
  • the cell surface marker may compnse a polypeptide, a polysaccha ⁇ de, a lipid, a glycoprotein, a lipoprotein, or may have structural characte ⁇ stics of more than one of these.
  • the disassociation constant (K d ) of the binding element for the cell surface marker is at least one order of magnitude less than that of the binding element for any other cell surface marker
  • the disassociation constant is at least 2 orders of magnitude less, even more preferably the disassociation constant is at least 3 orders of magnitude less than that of the binding element for any other cell surface marker to which the neurotoxin or modified neurotoxin is exposed.
  • translocation element compnses a portion of a clost ⁇ dial neurotoxin H chain having a translocation activity.
  • translocation is meant the ability to facilitate the transport of a polypeptide through a vesicular membrane, thereby exposing some or all of the polypeptide to the cytoplasm In the va ⁇ ous botulinum neurotoxins translocation is thought to involve an alloste ⁇ c conformational change of the heavy chain caused by a decrease in pH withm the endosome
  • ammo acid sequence of the translocation-mediatmg portion of the botulinum neurotoxin heavy chain is known to those of skill in the art; additionally, those ammo acid residues within this portion that are known to be essential for confer ⁇ ng the translocation activity are also known It would therefore be well within the ability of one of ordinary skill in the art, for example, to employ the naturally occurnng N-terminal peptide half of the heavy chain of any of the vanous Clostridium tetanus or Clostridium botulinum neurotoxin subtypes as a translocation element, or to design an analogous translocation element by aligning the pnmary sequences of the N- terminal halves of the va ⁇ ous heavy chains and selecting a consensus pnmary translocation sequence based on conserved amino acid, polanty, ste ⁇ c and hydrophobicity characten sites between the sequences
  • the "therapeutic element" of the present invention may compnse, without limitation: active or inactive (i.e., modified) hormone receptors (such as androgen, estrogen, retmoid, penoxysome prohferator and ecdysone receptors etc.), and hormone-agonists and antagonists, nucleic acids capable being of being used as replication, transc ⁇ ption, or translational templates (e.g., for expression of a protein drug having the desired biological activity or for synthesis of a nucleic acid drug as an antisense agent), enzymes, toxins (including apoptosis-inducing or -preventing agents), and the like.
  • active or inactive (i.e., modified) hormone receptors such as androgen, estrogen, retmoid, penoxysome prohferator and ecdysone receptors etc.
  • hormone-agonists and antagonists such as androgen, estrogen, retmoid, penoxysome prohferator and ecdysone receptors
  • the therapeutic element is a polypeptide compnsing a clost ⁇ dial neurotoxin light chain or a portion thereof retaining the SNARE-protein sequence-specific endopeptidase activity of a clost ⁇ dial neurotoxin light chain
  • BoNT botulinum neurotoxin
  • Each chain contains the Zn ⁇ -bmdmg motif His-Glu-x-x-His (N terminal direction at the left) charactenstic of Zn ⁇ -dependent endopeptidases (HEL H in TeNT, BoNT/A B and IE, HELNH in BoNT/C; and HELTH in BoNT/D).
  • the catalytic domain of BoNT/A is very specific for the C-terminus of SNAP-25 and appears to require a minimum of 17 SNAP-25 amino acids for cleavage to occur
  • the catalytic site resembles a pocket; when the light chained is linked to the heavy chain via the disulfide bond between Cys 42 9 and Cys 453 , the translocation domain of the heavy chain appears to block access to the catalytic pocket until the light chain gains entry to the cytosol When the disulfide bond is then reduced, the catalytic pocket is "opened" and the light chain is fully active.
  • VAMP and syntaxin are cleaved by BoNT/B, D, F, G and TeNT, and BoNT/C,, respectively, while SNAP-25 is cleaved by BoNT/A E and Cl.
  • the substrate specificities of the vanous clost ⁇ dial neurotoxin light chains other than BoNT/A are known Therefore, the person of ordinary skill in the art could easily determine the toxin residues essential in these subtypes for cleavage and substrate recognition (for example, by site-directed mutagenesis or deletion of va ⁇ ous regions of the toxin molecule followed by testing of proteolytic activity and substrate specificity), and could therefore easily design vanants of the native neurotoxin light chain that retain or lack the same or similar activity.
  • the single chain neurotoxin or neurotoxin de ⁇ vative of the invention is further modified to remove other incidental endogenous proteolytic sites such as those cleaved by trypsin, Arg C protease, chymotrypsm, or host cell proteases.
  • modification of the pnmary amino acid sequences in these regions to confer protease resistance can increase the yield of the neurotoxin and reduce the toxicity of the single chain neurotoxin pnor to cleavage and activation
  • the specificity of a candidate proteolytic site need not be totally exclusive, but merely needs to exclude cleavage sites for human and/or host cell proteases that might be present dunng the handling, storage and punftcation of the single chain neurotoxin
  • the protease site is as specific as possible.
  • the modification of the proteolytic cleavage site need only be sufficient to render the site resistant to the activator protease and to human and host cell proteases.
  • the recombinant modified single chain neurotoxin is further modified by joining the chain to a binding tag compnsing one member of a specific binding complex.
  • specific binding complex is meant two or more chemical or biochemical entities that will bind each other under defined environmental conditions and which will not significantly bind other chemical or biochemical entities present in the environment under the same conditions.
  • members of a specific binding complex include, without limitation, an antibody and its antigen, a lectm and its target carbohydrate, a nucleic acid strand and its complementary nucleic acid strand, a cell surface receptor and its ligand, a metal and a compound able to form a coordination or chelation complex with that metal, and the like.
  • the binding tag may be joined to the single chain toxin through a linker, preferably a cleavable linker.
  • the use of an linker containing an ester permits cleavage of the ester linker following use in the pu ⁇ fication of the single chain neurotoxin under relatively mild acidic conditions
  • the binding tag may compnse some or all of the ammo acid sequence of an appropnately chosen polypeptide coexpressed with the single chain toxin as a fusion protein; such polypeptides may compnse, without limitation, the maltose binding domain of maltose binding protein (MBP); a H ⁇ s 6 tag (a run of 6 histidme residues); the calmodihn binding domain of calmodulin binding protein; and the glutathione binding domain of glutathione-S-transferase
  • MBP maltose binding protein
  • H ⁇ s 6 tag a run of 6 histidme residues
  • glutathione binding domain of glutathione-S-transferase Other polypeptide binding tags are well known to those of skill in the art, and can easily be adapted for use in the present invention.
  • the binding tag may be constructed to have a protease cleavage site between itself and either the amino terminus or the carboxyl terminus of the single chain toxm so as be removable following pu ⁇ fication of the peptide.
  • the proteolytic cleavage site may be designed to be cleaved by the same activator protease chosen to nick the single chain toxin between the H and L chains.
  • the single chain neurotoxin is more easily pu ⁇ fied, is less dangerous to handle in the pu ⁇ fication process, and can be optionally modified to give the toxin more desirable properties
  • a neurotoxin permits the large scale preparation of properly folded highly pure toxin for clinical use
  • Example 1 Construction of an Expression Vector Containing a Single Chain TeTx Coding Region
  • the present invention can be exemplified describing the construction of a plasmid that will express TeTx in E. coli as a single protein that is readily purified, i.e., by affinity chromatography.
  • TeTx can be chosen as a pilot system because (i) the availability of an excellent vaccine greatly reduces the risk of its handling and (ii) it is the most comprehensively studied of the toxins in terms of expressing HC and LC domains.
  • those of skill in the art will understand that the same or similar strategies may be employed using any dichain or binary toxin or other bioactive molecule expressed as a single polypeptide and activated by proteolytic cleavage.
  • Single chain molecules were constructed containing the wild type TeTx L chain and a mutated version of the TeTx light chain wherein a glutamic acid residue at position 234 is changed to an alanine (termed “E234A”, Ala 234 , or "the E234A mutant light chain”), respectively.
  • This latter mutation results in an inactive TeTx light chain, and a plasmid encoding the E234A mutant light chain (pMAL-E234A) was constructed as described in Li et al., Biochemistry 33:7014-7020 (1994)(hereby incorporated by reference herein). The following protocol is used for the construction of each single-chain toxin.
  • the vector pTrcHisA purchased from lnvitrogen, is modified using a Stratagene QuickChange ® site-directed mutagenesis kit (for site-directed mutagenesis techniques, see e.g., Smith et al., J. Biol. Chem. 253:6651-6560 (1979); incorporated by reference herein in its entirety) to create two extra restriction sites (Sail and Hindlll) upstream of the nucleotides encoding a preexisting enterokinase (EK) cleavage site.
  • a Stratagene QuickChange ® site-directed mutagenesis kit for site-directed mutagenesis techniques, see e.g., Smith et al., J. Biol. Chem. 253:6651-6560 (1979); incorporated by reference herein in its entirety
  • the plasmid also contains a translational start codon (ATG) followed by a run of codons encoding 6 histidine residues immediately upstream of the enterokinase cleavage site.
  • a multiple cloning site containing Bam HI, Xhol, Bgl ⁇ , Pst I, Kpn I, Eco RI BstB I and Hind m cleavage sites is located immediately downstream of the EK site; the Hind in site is removed by site-directed mutagenesis
  • the following p ⁇ mers are employed to insert the rest ⁇ ction sites (underlined) upstream of the EK cleavage site:
  • the resulting plasmid contains both Sal I and Hind IJJ sites located at the
  • the nucleotide sequence encoding the wild-type TeTx L chain is obtained from plasmid pMAL-LC, descnbed in Li et al , Biochemistry 33, 7014- 7020 (1994), incorporated by reference herein
  • the plasmid encodes the TeTx light chain as a fusion protein with maltose binding protein (MBP) located immediately upstream of the coding sequence for the L chain
  • MBP maltose binding protein
  • the MBP and L chain portions of the fusion protein are designed to contain the cleavage site for human blood coagulation factor Xa (Ile-Glu-Gly-Arg) to facilitate removal of the MBP once affinity punfication has been performed
  • the DNA fragment containing the coding sequence of the L chain is excised from plasmid pMAL-LC by digesting the plasmid with Sal I and Hind TJJ, gel purifying the resulting DNA fragment containing the L chain, and ligating this fragment into plasmid pTrcHisA at the newly created Sal I and Hind TJJ sites upstream of the EK site. This fragment results in the excission of the maltose binding protein sequences from the N terminus of the L chain.
  • the DNA fragment containing the H chain is obtained from plasmid pMAL-HC; construction of this vector is described in Li et al., J. Biochem. 125:1200-1208(1999), hereby incorporated by reference herein. Briefly, the gene encoding the H chain is constructed by assembling three DNA fragments containing different portions of the H chain coding sequence which had been cloned into separate plasmids. The fragments comprising the amino terminal half of the H are first amplified using standard polymerase chain reaction methods (see, e.g., Mullis, U.S. Patent No. 4,683,202 and Mullis et al., U.S. Patent No.
  • PCR primers a (containing a Xba I cleavage site) and b (containing a Bgl ⁇ cleavage site) (SEQ ID NO: 3 and 4, respectively) are used to amplify the H chain fragment contained in a plasmid termed pTet ⁇ ;
  • PCR primers c (containing a Bgl TJ cleavage site) and d (containing both a Hind III and a Sal I cleavage site)(SEQ ID NO: 5 and 6, respectively) are used to amplify the H chain fragment contained in a plasmid termed pTetl4.
  • the nucleotide sequences of these primer are provided below, with restriction sites underlined.
  • each fragment is digested with Bgl TJ and hgated to yield the complete N terminal half of the H chain coding region
  • This hgation product is then digested with Xba I and Hind HI and subcloned into the multiple cloning site of pMAL-c2-T (the plasmid being also cut with Xba I and Hind HI), which is located downstream of the coding region for MBP and the factor Xa site pMAL-c2 is a commecially available vector well known to those of skill in the art
  • the resulting plasmid is pMAL-H N .
  • the entire H chain coding region is assembled as follows
  • the pMAL- H N plasmid is digested with Sac I and Sal I to yield the DNA fragment encoding the N-terminus of the H chain.
  • Plasmid pTet215 is digested with Sal I and Bam HI to yield the DNA fragment encoding the H chain carboxyl terminus.
  • the vector pMAL-c2-T is digested with Sac I and Bam HI, and hgated to the digested H chain fragments, which will assemble in the proper o ⁇ entation due to the use of distinct endonucleases.
  • the resulting plasmid is pMAL-HC
  • the DNA fragments encoding the H and L chains are cut and punfied directly from pMAL-LC or pMALE234A and pMAL-HC constructs and subcloned into the modified pTrcHisA vector desc ⁇ bed above.
  • the H chain was first hgated into the modified vector at the Bam HI site immediately downstream of the EK site, and the resulting plasmid was gel pu ⁇ fied. Following digestion of this plasmid with Hind TJJ and Sal I, the L chain was hgated at a position just upstream of the EK cleavage site.
  • the resulting plasmid construct contains the nucleotide sequence encoding the single-chain toxin protein, compnsing (from ammo to carboxyl terminus), six histidine residues (the His tag), followed by the L chain, an enterokinase cleavage site, and the H chain
  • the translated junction between the L and H chains containing the EK cleavage site is shown below (in the direction from N-terminus to C-terminus) and in Figure 1.
  • nucleotide sequence compnsing a stop codon present at the 3' end of the L chain coding sequence in the pMAL-LC is removed by site-directed mutagenesis using two p ⁇ mers (SEQ ID NO. 8 and 9), resulting in a single reading frame containing both H and L chains SEQ ID NO: 8
  • the resulting pTrcHisA-based construct is transformed into E. coli strain JM109 by heat shock using the method of Hanahan, and transformant colonies are isolated on Luna agar plates containing 100 ⁇ g/ml ampicilhn Plasmids are punfied from these transformants and the insertions are confirmed by analytical restnction endonuclease digestion and agarose gel electrophoresis
  • the cell pellets are resuspended 30 ml Buffer A (20 mM Na 2 PO , 500 mM NaCl (pH 7.8)), then lysed by ultrasonication at 4°C, using 10-second bursts at a medium setting. Insoluble deb ⁇ s is removed by centnfugation at 9,000 X g for 30 mm at 4°C, and the supernatant recovered by centnfugation. The supernatant containing each single chain construct is incubated for 20 minutes at 22°C with 2 ml of nickel-ion res (Invitrogen Corp.) for affinity punfication by means of chelation between the histidine residues at the amino terminus of the single chain tox molecule and the nickel.
  • Buffer A 20 mM Na 2 PO , 500 mM NaCl (pH 7.8)
  • the resms were then load onto mini columns and washed with 200 ml of washing buffer (20 mM Na PO , 500 mM NaCl (pH 6.0)) to remove any non-specifically bound matenal, the recombinant single-chain proteins are eluted on 0.5 ml fractions with 8-15 ml of 100 mM lmidazole in Buffer A The concentration of the eluted single-chains was measured by Bradford's protein assay (Bio-Rad Laboratones), approximately 1 milligram of the fusion protein was recovered.
  • the single-chain TeTx constructs are grown in Luria broth containing ampicillin at 37°C, and aliquots taken both before and after induction of protein expression with IPTG. Crude cell extracts are prepared for SDS-PAGE by dilution in sample buffer under reducing conditions in the presence of ⁇ - mercaptoethanol (BME). Following SDS-PAGE electrophoresis, the separated proteins are Western-blotted as follows: the proteins are electrophoretically transferred to a polyvinylidenedifluoride (PVDF) membrane using standard methods (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual (2d ed.
  • PVDF polyvinylidenedifluoride
  • the membrane treated to reduce background Ig binding and then probed using an anti-His 6 antibody, followed by detection using an alkaline phosphatase-conjugated secondary antibody and development with a 5- bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium substrate.
  • lanes 1 and 2 of Figure 2A the Western blot revealed no detectable TeTx expression before induction of protein synthesis; by contrast, a single band of approximate molecular weight 150 kDa was revealed in the aliquots taken following protein induction (See lanes 3 and 4.)
  • lanes 1 and 3 are the WT light chain construct and lanes 2 and 4 contain the E234A mutant construct.
  • Fig. 2B is a Western blot of IPTG-induced cell extracts from cells transformed with the E234A construct. Significantly, no discemable lower molecular weight proteolytic cleavage products of the light chain were observed, providing evidence for the relative stability of the single-chain toxin following expression and purification.
  • Figure 3 shows the results of a second expenment, in which affinity punfied recombinant single-chain (SC) TeTx is nicked with enterokinase as follows.
  • SC single-chain
  • the recombinant protein is incubated in the same reaction mixture containing no EK
  • TeTx are subjected to SDS-PAGE in an 8% polyacrylamide gel under either reducing (+BME) or non-reducing (-BME) conditions
  • the resulting gel is used both for a Western blot and subsequent detection using anti-H claim antibodies (Fig 3B), and direct staining with Coomassie Blue (Fig 3A).
  • wild-type and nicked recombinant tox yield an H chain having a molecular weight of about 100 kDa by both Western blot and Coomassie staining
  • both of these samples also show a lower molecular weight species of about 50 kDa, corresponding to the L chain
  • the wild-type L chain will migrate with a lower apparent molecular weight than that of the recombinant L chain, which has 22 additional amino acid residues due to the presence of the His 6 moiety and a modified EK cleavage site -containing interchain junction region.
  • the unnicked recombinant toxin migrates as a single band with an apparent molecular weight of about 150 kDa. Notably, no trace of the unnicked toxin is seen in lane 3, indicating the effectiveness of enterokinase treatment.
  • TeTx The biological activity of the recombinant TeTx is also examined and compared to wild-type toxin using mouse phrenic nerve hemi-diaphragm, since the native toxin is known to cause neuromuscular paralysis, albeit at higher concentrations than act in the CNS.
  • mice left phrenic nerve-hemi diaphragm is dissected from mice (T/O strain, 4-week old and -20 g in weight) and immediately transferred into a closed circulatory superfusion system containing 10 ml of Krebs-Ringer solution (118 mM NaCl, 4.7 mM KC1, 1.2 mM MgSO4, 2.5 mM CaCl2, 23.8 mM NaHCO4, 1.2 mM KH2PO4, 11.7 mM glucose (pH 7.4)), bubbled with 95% O2 and 5% CO2 and supplemented with 0.1 % (w/v) bovine serum albumin to diminish non-specific adsorption of the toxins (Li et al., Biochemistry 33:7014-7020 (1994)).
  • Krebs-Ringer solution 118 mM NaCl, 4.7 mM KC1, 1.2 mM MgSO4, 2.5 mM CaCl2, 23.8 mM NaHCO4, 1.2 mM KH2PO4, 1
  • the hemidiaphragms are kept in a bath containing 10 ml Krebs-Ringer buffer at 37°C for 10 minutes before being exposed to 4 or 10 nM native TeTx ( ⁇ and V, respectively )or 10 nM nicked recombinant TeTx (•) or 10 nM un-nicked recombinant TeTx (O), respectively.
  • Muscle twitch is evoked by supra-maximal stimulation of the phrenic nerve with bipolar electrodes and recorded via a force-displacement transducer (Lectromed, UK) connected to an amplifier and computer system (MacLab, AD Instruments, UK).
  • Parameters of nerve stimulation are 0.2 Hz square waves of 0.1 msec duration with 1.5-2.5 V amplitude Toxm-induced paralysis of neuromuscular transmission is quantified as the time required for nerve-evoked muscle contraction to decrease to 10% (90% reduction) of the onginal value
  • the Western blot reveals that trypsin and Arg C protease yielded a L chain (and thus a H chain) fragment of the same size. Additionally, the transfer of a duplicate gel was stained for protein with Ponceau red and the H chain band of approximate molecular weight 100 kDa was excised from each lane and analysed by N-terminal sequencing
  • the arginme at the carboxy terminus of the EK linker sequence is mutated by site-directed mutagenesis to a glycine (R496G), and the resulting single cnain tox polypeptide is expressed and purified as above.
  • a different assay system is used to measure neurotoxin activity toward CNS neurons, the cells naturally affected by TeTx.
  • the cells used are cerebellar neurons; these cells are disassociated from the cerebella of 7 day old rats.
  • Neurons are suspended at 1-2 x 10 6 /mL in medium consisting of 3 parts Basal Eagle Medium and 1 part of a buffer consisting of 40 mM HEPES-NaOH (pH 7.3), 78.4 mM KC1, 37.6 mM D-glucose, 2.8 mM CaCl 2 , 1.6 mM MgSO 4 and 1.0 mM NaH 2 PO 4 , as well as 1 x N2 supplement, 1.0 mM L-glutamine, 60 units/mL penicillin, 60 ⁇ g/mL streptomycin and 5% (v/v) dialysed horse serum.
  • Cytosine ⁇ -D-arabinofuranoside (Ara-C, 40 ⁇ M) is added after 20- 24 hours in 5% (v/v)CO 2 culture, and neurons are maintained by weekly replacement of the above-noted medium containing 40 ⁇ M Ara-C.
  • neurons are cultured for at least 10 days in vitro are washed four times with O 2 -gassed Krebs-Ringer HEPES buffer (KRH, mM: 20 HEPES.NaOH pH7.4, 128 NaCl, 5 KC1, 1 NaH 2 PO 4 , 1.4 CaCl 2 , 1.2 mM MgSO 4 , 10 D-glucose and 0.05 mg/mL BSA), and 0.5 mL of the latter buffer containing 0.25 ⁇ Ci/mL [14C]-glutam ⁇ ne (i.e. the glutamate precursor) is added. All steps are performed at 37°C.
  • a modified KRH buffer containing 50 mM KC1 (containing a lowered 83 mM NaCl content in order to maintain a normal osmotic potential) and either 1.4 Ca "+ or 0.5 M EGTA are added for a 5 minute stimulation pe ⁇ od.
  • neurons were solubihzed with 20 mM EGTA.NaOH pH 7.5 containing 1% (w/v) SDS, and aliquots subjected to scintillation counting in order to calculate their remaining radioactive contents. The amounts of 14 C-glutamate in basal and stimulated samples are expressed as percentages relative to the calculated total cell content.
  • Cerebellar neurons maintained for 10 days in vitro, were washed twice with ice-cold KRH buffer containing 5 mM Mg" + and 0.5 mM Ca 2+ , then exposed in this buffer to the specified concentrations of (•) native TeTx, (O) EK- nicked TeTx R496G, ( ⁇ ) single chain unnicked TeTx, or (V) EK-mcked TeTx E234A for 60 mm at 4°C (see Fig 8). Native TeTx (0.2 nM) was then added to the wells specified and, after an additional 30 min, the neurons were washed three times with ice-cold KRH buffer and incubated for 30 min at 37°C.
  • toxin activity in the unnicked single chain molecule is not abrogated through the removal of a single trypsin cleavage site, the removal of additional such sites is feasible in regions of the single chain toxin to achieve an activatable single-chain proform of the toxin that exhibits even lower toxicity unless activated in vitro, when its full activity can be achieved
  • Table 1 shows the tabulated results of the indicated TeTx constructs tested in three assays of toxin activity, ability to cleave the HV62 peptide (which measures proteolytic activity only); neuromuscular paralysis (which is an indication of the toxin molecules' ability to enter the cell and thence to inhibit neurotransmitter release), and mouse lethality upon mtrape ⁇ toneal injection of the va ⁇ ous toxin constructs.
  • the first two of these assays was performed as descnbed above.
  • the mouse lethality assay was performed essentially as follows:
  • Samples of recombinant punfied single-chain TeTx, R496G mutant TeTx, and E234A mutant TeTx are each divided into two aliquots and one aliquot treated with enterokinase to nick the tox . All samples are se ⁇ ally diluted into 50 mM phosphate buffer (pH 7.0), 150 mM NaCl and 0.25% (w/v) bovine serum albumin (BSA), and the toxin preparations are injected into mice intrape ⁇ toneally.
  • BSA bovine serum albumin
  • the native and nicked TeTx preparations were comparably active in the mouse lethality assay, having an LD 50 of about 1 X 10 8 /mg
  • the unnicked recombinant toxin and unnicked R496G mutant were both about half as active
  • the nickedf E234A proteolytically inactive toxin was less than 5 X 10 7 fold less active
  • ''LDs i the amount of toxin that killed 507r of the injected mice within 4 days 'Toxin preparations were nicked with EK ( 1 un ⁇ t/30 ⁇ g) at 22°C for 1 h d Th ⁇ s v° value represents the detection limits ot the RP-HPLC assay, no proteolysis of HV62 was observed using prolonged incubations
  • Mouse phrenic-nerve hemi -diaphragm was incubated in KR at 37°C with 20 nM recombinant TeTx E234A ( ⁇ ) whilst stimulating the nerve (0.2 Hz, 1 5- 2 5v) and recording muscle tension
  • hemi- diaphragms were incubated for 60 minutes at 4°C with MKR containing 0.1% BSA only ( ), or the latter plus 100 nM nicked TeTx E234A ( ⁇ ), before the addition of 1 nM native TeTx.
  • the "fusion tags” each compnsed a member of a specific binding complex as a pu ⁇ fication aid and to improve the solubility and stability of the expressed protein
  • the single-chain BoNT/A construct was inserted into plasmid pMAL-c2 between the Bam HI and Hind IJI rest ⁇ ction sites, resulting in a coding sequence for a fusion polypeptide containing the maltose binding protein at the N terminus, followed by a Factor Xa cleavage site Transformant JM 109 colonies were selected in Luna broth containing ampicilhn. Expression was induced by the addition of IPTG to a final concentration of 0.3 mM.
  • TeTx construct As for the TeTx construct, aliquots of the cell culture were collected before and after induction, the cells in each sample lysed by sonication, and the supernatant prepared for SDS-PAGE under both reducing and non-reducing conditions. Following electrophoresis to separate the proteins according to apparent molecular weight, the gel was subjected to a Western blot using an antibody raised against the H chain of BoNT/A.
  • a plasmid expressing a single-chain recombinant version of the neurotoxin from Clostridium botulinum subtype E(stra ⁇ n Beluga) was constructed as follows. PCR p ⁇ mers were designed based on the EMBL database cDNA sequence of the BoNT/E neurotoxin (Genbank accession number X62089) This nucleotide sequence is represented herein as SEQ ID NO: 10
  • the forward pnmer had the following nucleotide base sequence: CCCGGATCC CCA AAA ATT AAT AGT TTT AAT TAT AAT G SEQ ID NO: 11 where the BamHI endonuclease site is underlined and the sequence of the light chain minus the start codon is in bold.
  • the inverse pnmer had the sequence: CCCCTGCAG tea TTT TTC TTG CCA TCC ATG TTC TTC
  • the two pnmers were used in a PCR reaction containing different amounts of Clostridium botulinum type E (strain beluga) chromosomal DNA.
  • the PCR reaction employed a DNA polymerase with proofreading activity (Pfx DNA polymerase, obtained from Life Technology) in order to avoid sequence errors in the amplified gene.
  • the amplification reaction conditions were as follows. 30 cycles of: a 45 second denaturation at 95 °C, followed by a 45 second annealing step at 56 °C. followed by a pnmer extension reaction for 3 minutes 48 seconds at 68 °C.
  • the PCR product was digested with BamHI and Hindffl, and the digest subjected to agarose gel electrophoresis. Staining of the agarose gel with ethidium bromide revealed a major DNA fragment of approximately 3.5 kilobases (see Fig. 10). The band containing this frangment was excised from the gel. and the DNA pu ⁇ fied from the agarose and hgated to BamHI and
  • Hindlll-cut pQE30 vector (Qiagen). The resulting hgated plasmid was used to transform E. coli strain JM 109 as descnbed above, and the transformants plated onto selective LB agar plates. Several clones were recovered and the presence of the co ⁇ ect BoNT/E DNA insert checked by rest ⁇ ction digest. The resultant construct contains the BoNT E gene (minus the first mefhionine) fused to the H ⁇ s 6 tag of the pQE30 vector, and contains 2 extra amino acid residues (glycine, se ⁇ ne), which are cont ⁇ vide by the engineered BamHI site
  • BoNT/E polypeptide construct By mutating the glutamic acid at position 212 (within the active site) of the BoNT/E polypeptide construct to glutamine, a proteolytically-inactive and non-toxic single chain BoNT E polypeptide was obtained
  • the glutamine replacement was introduced on the forward pnmer using routine site directed mutagenesis methods
  • the mutagenic DNA pnmer had the sequence cag TTA ATA CAT TCA TTA CAT GGA CTA TAT G
  • the PCR template was the wild-type single-chain BoNT/E construct (termed pQEESCwt).
  • the cycling parameters (30 cycles) were as follows" 1) a 45 second denaturation step at 95 °C; 2) a 45 second annealing step at 56 °C; ,and 3) a 7 minute 10 second extension step at 68 °C.
  • the DNA template was digested by the rest ⁇ ction enzyme Dpnl to permit selection of mutated clones only.
  • Dpnl Rest ⁇ ction enzyme
  • a band of approximately 7 kilobases was removed and the DNA punfied and used for self- hgation in the presence of T4 DNA hgase (Promega) and polynucleotide kinase (Promega) to permit phosphorylation of the PCR product.
  • the hgation mixture was used to transform E.coli strain DH10B, and the transformants plated onto selective agar plates.
  • the E. coli strain Ml 5 (Qiagen) was used for expression of the BoNT/E single-chain construct This strain car ⁇ es an endogenous plasmid (pREP4, kanamycin resistant) containing a region encoding the lac I q repressor gene in order to prevent transc ⁇ ption of the neurotoxin gene pnor to induction with IPTG.
  • the pQE30 vector contain a T5 bactenophage RNA polymerase promoter, which is also recognized by E. coli RNA polymerase.
  • a colony of Ml 5 cells containing pQEESCwt was grown at 37°C overnight in 5 ml of 2TY medium containing 0.1 mg/ml ampicilhn; 0.025mg/ml kanamycin and 0.2% glucose (w/v), and the resultant culture used to inoculate 500 ml of the same medium.
  • this second culture reached an optical density of 0 5-0.8 at 600nm, IPTG was added to a final concentration of 0.3 mM and the culture incubated at 25°C overnight to permit expression of the neurotoxin.
  • centnfugation of the culture yielded ⁇ 2.3 g of wet cell pellet which was resuspended in 10 ml of extraction buffer (20 mM Hepes pH 7.0, 300 mM NaCl, 5mM benzamidine, 2 ⁇ M pepstatin and 2 ⁇ M E-64). Lysozyme was added to a final concentration of 0.25 mg/ml, and the cell suspension incubated on ice for 60 minutes. Approximately 0.5 ml of glass beads (0.1 mm diameter from Biospec) was added to the cell suspension, followed by vortexing for 2 minutes to break the cells. Cell-free extracts was obtained by centnfugation at 10,000xg for 30 minutes at 4 °C.
  • the supematant was incubated with 0.5 ml of Talon ® cobalt metal affinity resin (Clontech) pre-washed with extraction buffer in a rocking platform for 45 minutes at 4°C.
  • the resin was then loaded into a disposable chromatography column and washed twice with 10 bed volumes of wash buffer (20 mM Hepes pH 7 0, 300 mM NaCl, 2 mM lmidazole) before elut g the bound neurotoxin in 6 bed volumes of elution buffer (20 mM Hepes pH 7 0, 300 mM NaCl, 150 mM lmidazole)
  • Punfied BoNT/E single-chain neurotoxin polypeptide samples were activated by nicking the single chain with trypsin (1.5 ⁇ g/ml final concentration) for 60 minutes at a concentration of lmg tox /ml in 10 mm Hepes (pH 7.0), 150 mM NaCl Following the reaction, the trypsin was inactivated using 0.5 mM PMSF and 10 ⁇ g trypsin inhibitor/ml.
  • the quality of the trypsinization was assessed and venfied by SDS-PAGE under both reducing and non-reducing conditions, then staining with Coomassie staining and Western blotting the polyacrylamide gel using a mouse monoclonal anti-His antibody (Quiagen, diluted 2000-fold) and a mouse monoclonal anti-Hc IgG (diluted 26-fold).
  • the Commassie-stained nicked protein resolves into two bands under reducing conditions, while the heavy and light chains remain disulfide-hnked under non-reducing conditions, similar to the native toxin
  • the antibody-detected recombinant heavy chain is of approximately identical size as its wild-type Clostndium counterpart, whereas the recombinant light chain migrates at a slightly higher molecular weight compared to the native protein This latter characte ⁇ stic is due to the extra residues provided by the H ⁇ s 6 tag at the N-terminus.
  • a recombinant peptide containing amino acids 140-205 of SNAP-25 fused to glutathione-S-transferase was used as a protease substrate to test the proteolytic activity of the recombinant BoNT/E polypeptides
  • Ten micrograms this protease substrate was incubated with the toxin samples The digestion reaction was allowed to proceed for 30 minutes at 37°C in the absence or presence of 2 mM DTT, and stopped by addition of SDS- PAGE sample buffer followed by boiling for 5 minutes The resultant samples were analyzed by SDS-PAGE (3 ⁇ g of GST-
  • KRH Krebs-Ringer HEPES
  • Figure 15 shows that, despite retaining proteolytic activity, the unnicked recombinant BoNT E has markedly less activity than either the native BoNT/E or the nicked recombinant version This finding may reflect the inability of the un-nicked toxin to adequately enter the target cell. Additionally, the nicked recombinant version appears to be more effective in inhibiting glutamate release than the native toxin
  • Recombinant BoNT E has a Neuromuscular Paralytic Activity Equivalent to that of the Native Toxin at Mouse Neuromuscular Endplates- Nicking Increases Potency
  • the in vivo neurotoxicity of the nicked, recombinant neurotoxin was established, by injecting the toxin into mice, to have a specific neurotoxicity of less than 10 7 mouse LD 50 units per mg.
  • mice phrenic-nerve hemi-diaphragm was exposed to 10 nM BoNT E E212Q in KR medium, the nerve was stimulated and evoked muscle tension was recorded As indicated by Figure 17, the BoNT E212Q mutant does not inhibit neurotransmission, as determined by its failure to reduce nerve-evoked muscle tension (O)
  • mouse phrenic-nerve hemi-diaphragms were bathed for 60 minutes at 4°C in MKR supplemented with 0.1 % BSA and saturated with 95 % O 2 /5% CO 2 , without (D) or with (&) the inclusion of 5 nM BoNT/E E212Q.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Neurosurgery (AREA)
  • Biophysics (AREA)
  • Pain & Pain Management (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biotechnology (AREA)
  • Psychiatry (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Hospice & Palliative Care (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Compositions comprising activable recombinant neurotoxins and polypeptides derived therefrom. The invention also comprises nucleic acids encoding such polypeptides, and methods of making such polypeptides and nucleic acids.

Description

ACTIVATABLE RECOMBINANT NEUROTOXINS
This application claims priority pursuant to 35 U.S.C.§ 119(e) to provisional application Serial No. 60/150,710, filed August 25, 1999, hereby incorporated by reference herein.
FIELD OF THE INVENTION
This invention concerns methods and compositions useful in the fields of neurobiology, molecular biology, and medicine, as well as methods for the production of potentially toxic therapeutic agents and derivatives thereof. The invention also concerns recombinant clostridial neurotoxins (particular botulinum neurotoxins), modified versions thereof, and methods of making such molecules, for use as therapeutic agents, transporter molecules, adducts, and the like.
BACKGROUND OF THE INVENTION
Neurotoxins, such as those obtained from Clostridium botulinum and Clostridium tetani, are highly potent and specific poisons of neural cells, and other cells when delivered within such cells for therapeutic purposes. These Gram positive bacteria express two related but distinct toxins types, each comprising two disulfi de-linked amino acid chains: a light chain (L) of about 50 KDa and a heavy chain (H) of about 100 KDa, which are wholly responsible for the symptoms of these diseases. The holotoxin is synthesised in vivo as a single chain, then nicked in a post-translational modification to form the active neurotoxin comprising the separate L and H chains. The tetanus and botulinum toxms are among the most lethal substances known to man, having a lethal dose in humans of between 0.1 ng and 1 ng per kilogram of body weight. Tonello et al., Adv. Exp. Med. & Biol. 389:251-260 (1996). Both toxins function by inhibiting neurotransmitter release in affected neurons. The tetanus neurotoxin (TeNT)acts mainly in the central nervous system, while botulinum neurotoxin (BoNT) acts at the neuromuscular junction and other chohnergic synapses in the peπpheral nervous system; both act by inhibiting neurotransmitter release from the axon of the affected neuron into the synapse, resulting in paralysis. The tetanus neurotoxin (TeNT) is known to exist in one immunologically distinct type; the botulinum neurotoxins (BoNT) are known to occur in seven different lmmunogenic types, termed BoNT/A through BoNT/G. While all of these types are produced by isolates of C. botulinum, two other species, C. baratii and C butyricum also produce toxins similar to /F and IE, respectively. See e.g , Coffield et al., The Site and Mechanism of Action of Botulinum Neurotoxin in Therapy with Botulinum Toxin 3-13(Jankovιc J. & Hallett M eds. 1994), the disclosure of which is incorporated herein by reference.
Regardless of type, the molecular mechanism of intoxication appears to be similar. In the first step of the process, the toxin binds to the presynaptic membrane of the target neuron through a specific interaction between the heavy (H) chain and a cell surface receptor; the receptor is thought to be different for each type of botulinum toxin and for TeNT. Dolly et al., Seminars in Neuroscience 6: 149-158 (1994), incororated by reference herein. The carboxyl terminus of the heavy chain appears to be important for targeting of the toxin to the cell surface. Id In the second step, the toxin crosses the plasma membrane of the poisoned cell. The toxin is first engulfed by the cell through receptor-mediated endocytosis, and an endosome containing the toxm is formed. The toxm then escapes the endosome into the cytoplasm of the cell. This last step is thought to be mediated by the amino terminus of the H chain, which tπggers a conformational change of the toxm in response to a pH of about 5.5 or lower. Endosomes are known to possess a proton pump which decreases intra endosomal pH. The conformational shift exposes hydrophobic residues in the toxin, which permits the toxin to embed itself in the endosomal membrane. The toxin then translocates through the endosomal membrane into the cytosol.
The last step of the mechanism of botulinum toxin activity appears to involve reduction of the disulfide bond joining the H and light (L) chain. The entire toxic activity of botulinum and tetanus toxins is contained in the L chain of the holotoxin; the L chain is a zinc (Zή^) endopeptidase which selectively cleaves proteins essential for recognition and docking of neurotransmitter- contaimng vesicles with the cytoplasmic surface of the plasma membrane, and fusion of the vesicles with the plasma membrane. TxNT, BoNT/B BoNT/D, BoNT/F, and BoNT/G cause degradation of synaptobrevm (also called vesicle- associated membrane protein (VAMP)), a synaptosomal membrane protein. Most of the cytosohc domain of VAMP extending from the surface of the synaptic vesicle is removed as a result of any one of these cleavage events Each toxin (except TeNT and BoNT B) specifically cleaves a different bond.
BoNT/A and /E selectively cleave the plasma membrane-associated protein SNAP-25; this protein, which is also cleaved by BoNT/Cl (Foran et al., Biochem. 35:2630-2636 (1996)), is predominantly bound to and present on the cytosohc surface of the plasma membrane. BoNT/C cleaves syntaxm, an integral protein having most of its mass exposed to the cytosol. Syntaxin interacts with the calcium channels at presynaptic terminal active zones. See Tonello et al., Tetanus and Botulinum Neurotoxins in Intracellular Protein Catabohsm 251-260 (Suzuki K. & Bond J. eds. 1996), the disclosure of which is incorporated by reference as part of this specification Both TeNT and BoNT are taken up at the neuromuscular junction.
BoNT remains within peπpheral neurons, and blocks release of the neurotransmitter acetylchohne from these cells Through its receptor, TeNT enters vesicles that move in a retrograde manner along the axon to the soma, and is discharged into the mtersynaptic space between motor neurons and the inhibitory neurons of the spinal cord At this point, TeNT binds receptors of the inhibitory neurons, is again internalized, and the light chain enters the cytosol to block the release of the inhibitory neurotransmitters 4-amιnobutync acιd(GABA) and glycme from these cells
Because of its specifically localized effects, minute doses of BoNT have been used since 1981 as therapeutic agents in the treatment of patients suffering from dystonias, including strabismus (misalignment of the eye), bephlarospasm (involuntary eyelid closure) and hemifacial spasm See e.g , Borodic et al, Pharmacology and Histology of the Therapeutic Application of Botulinum Toxin in Therapy with Botulinum Toxin 1 19-157 (Jankovic J & Hallett eds 1994), hereby incorporated by reference herein Of the seven toxm types, BoNT/A is the most potent of the BoNTs, and the best characterized. Intramuscular injection of spastic tissue with small quantities of BoNT/A has also been used effectively to treat spasticity due to brain injury, spinal cord injury, stroke, multiple sclerosis and cerebral palsy The extent of paralysis depends on both the dose and volume delivered to the target site
Although the L chain is the moiety responsible for neural intoxication, it must be delivered to the neural cytoplasm in order to be toxic Similarly, the single chain holotoxin pro-forms exhibit relatively low toxicity until they are cleaved at one or more peptide bonds in an exposed loop region between their H and L chains to create the fully-active mature neurotoxins. As implied in the mechanism provided above, the H chain of each neurotoxin is essential for cell receptor binding and endocytosis, while both the L and the H chains (and an intact disufide bond) are required for translocation of the toxin into the cytoplasm. As indicated above, the L chain alone is responsible for the toxicity caused by inhibition of acetylcholine secretion.
Despite the clear therapeutic efficacy of clostridial neurotoxin preparations, industrial production of the toxin is difficult. Production of neurotoxoin from anaerobic Clostridium cultures is a cumbersome and time- consuming process including a multi-step purification protocol involving several protein precipitation steps and either prolonged and repeated crystallisation of the toxin or several stages of column chromatography. Significantly, the high toxicity of the product dictates that the procedure must be performed under strict containment (BL-3). During the fermentation process, the folded single-chain neurotoxins are activated by endogenous clostridial proteases through a process termed nicking. This involves the removal of approximately 10 amino acid residues from the single-chain to create the dichain form in which the two chains remain covalently linked through the interchain disulfide bond.
The nicked neurotoxin is much more active than the unnicked form. The amount and precise location of nicking varies with the serotypes of the bacteria producing the toxin. The differences in single-chain neurotoxin activation and, hence, the yield of nicked toxin, are due to variations in the type and amounts of proteolytic activity produced by a given strain. For example, greater than 99% of C. botulinum type A single-chain neurotoxin is activated by the Hall A C. botulinum strain, whereas type B and E strains produce toxins with lower amounts of activation (0 to 75% depending upon the fermentation time). Thus, the high toxicity of the mature neurotoxin plays a major part in the commercial manufacture of neurotoxins as therapeutic agents. The degree of activation of engineered clostπdial toxins is, therefore, an important consideration for manufacture of these mateπals. It would be a major advantage if neurotoxins such as BoNT and TeTx could be expressed in high yield in rapidly-growing bacteπa (such as heterologous E. coli cells) as relatively non-toxic single-chains (or single chains having reduced toxic activity) which are safe, easy to isolate and simple to convert to the fully-active form.
With safety being a pnme concern, previous work has concentrated on the expression in E.coli and puπfication of individual H and L chains of TeTx and BoNT; these isolated chains are, by themselves, non-toxic; see Li et al., Biochemistry 33:7014-7020 (1994); Zhou et al., Biochemistry 34:15175-15181 (1995), hereby incorporated by reference herein. Following the separate production of these peptide chains and under stπctly controlled conditions the H and L subunits can be combined by oxidative disulphide linkage to form the neuroparalytic di-chains. Unfortunately, this strategy has several drawbacks. Firstly, it is not practical to express and isolate large amounts of the individual chains; in particular, in the absence of the L chain the isolated H chain is quite insoluble in aqueous solution and is highly susceptible to proteolytic degradation. Secondly, the in vitro oxidation of the individually expressed and puπfied H and L chains to produce the active di-chain is very inefficient, and leads to low yields of active toxin and the production of many inactive incoπectly folded or oxidized forms. The purification of the correctly folded and oxidized H and L chain-containing toxin is difficult, as is its separation from these inactive forms and the unreacted separate H and L chains. It would therefore be useful and advantageous to express clostridial neurotoxins as inactive (or less active) single-chain forms, to eliminate the need for the time-consuming and inefficient reconstitution of the constituent chains, to maintain solubility of the protein chains, to reduce protein misfolding and consequent susceptibility to protease attack, to improve toxin yield, and/or to provide a simple method for the purification of the toxin.
Additionally, it would be useful to engineer these toxins to provide single-chain, modified neurotoxin molecules having novel therapeutic properties and/or longer duration of action, or toxic or non-toxic forms for use as transport molecules capable of delivering a therapeutic moiety to nerve or other cell types.
By expressing such proteins as a single chain, the yield and purification of the engineered proteins would be vastly improved.
SUMMARY OF THE INVENTION
The present invention is directed to recombinant and isolated proteins comprising a functional binding domain, translocation domain, and therapeutic domain in which such proteins also include an amino acid sequence that is susceptible to specific cleavage in vitro following expression as a single chain. Such proteins may include clostridial neurotoxins and derivatives thereof, such as those proteins disclosed in U.S. Patent 5,989,545 and International Patent Application WO95/32738, both incorporated by reference herein.
In one embodiment of the invention the protein comprises the functional domains of a clostridial neurotoxin H chain and some or all of the functions of a clostridial neurotoxin L chain in a single polypeptide chain, and having an inserted proteolytic cleavage site located between the H domain and the L domain by which the single chain protein may be cleaved to produce the individual chains, preferably covalently linked by a disulfide linkage. The invention also includes methods of making such proteins and expressing them within a cell, as well as nucleic acid vectors for the transfer and expression of the nucleotide sequence regions encoding such proteins and cells containing such vectors. The proteolytic cleavage sites comprise amino acid sequences that are selectively recognized and cleaved by a specific enzyme. In a preferred aspect of the invention, the expressed single-chain proteins comprise the biologically active domains of the H chain and L chain of a clostridial neurotoxin. Scission at the internal proteolytic cleavage site separating the chain domains thus results in the activation of a neurotoxin having full activity. In another aspect of the invention the single-chain proteins comprise a binding domain targeted to a cell receptor other than one borne by a motor neuron. Such a binding domain may specific bind to, for example, a sensory afferent neuron, or to a non-neuronal cell type or tissue, such as pancreatic acinar cells. The single-chain proteins will contain a translocation domain similar to that of clostridial neurotoxins, and a therapeutic moiety. The therapeutic moiety may be a clostridial neurotoxin light chain, or may be a different therapeutic moiety such as an enzyme, a transcribable nucleotide sequence, growth factor, an antisense nucleotide sequence and the like.
Preferably, the toxins and toxin-based proteins of the present invention will be tailored to contain an additional amino acid sequence comprising a binding tag able to bind a target compound at sufficiently high efficiency to facilitate rapid isolation of the toxin protein. Proteins containing such binding sites are many and well known to those of skill in the art, and may comprise, without limitation, monoclonal antibodies, maltose binding protein, glutathione- S -transferase, protein A, a His6 tag, and the like.
Because such proteins exhibit binding selectivity to a certain compound or compound type, the target compound may be immobilized to a solid support, including without limitation, a chromotography resin or microtiter well and used for affinity purification of the modified toxin. The toxin molecule can then be eluted by standard methods, such as through the use of a high salt solution or specific antagonist. To minimize the safety risk associated with handling neurotoxin, the toxins of the this aspect of the present invention are expressed as their low activity (or inactive) single-chain proforms, then, by a carefully controlled proteolytic reaction in vitro, they are activated, preferably to the same potency level as the native neurotoxin from which they were derived. To improve the efficiency and rate of proteolytic cleavage the engineered proteolytic cleavage sites can be designed to occur in a specially-designed loop between the H and L portions of the single amino acid chain that promotes accessibility of the protease to the holotoxin substrate.
To reduce the risk of unintentional activation of the toxin by human or commonly encountered proteases, the amino acid sequences of the cleavage site are preferably designed to have a high degree of specificity to proteolytic enzymes which do not normally occur in humans (as either human proteases or occurring in part of the foreseeable human fauna and flora). A non-exclusive list of examples of such proteases includes bovine enterokinase, which cleaves the amino acid sequence DDDDK; tobacco etch virus (TEV) protease, which cleaves the sequence EXXYXQS/G; GENENASE® from Bacillus amyliquifaciens, which cleaves the sequence HY or YH; and PRESCISSION® protease from human rhinovirus 3C, which cleaves the amino acid sequence LENLFQGP As used above, the letter X indicates any amino acid All amino acid sequences shown in the present specification are in the direction from amino terminus to carboxyl terminus, and all nucleotide sequences from 5' to 3', (from left to πght) unless otherwise indicated
In an aspect of the invention the single-chain polypeptide is an isolated polypeptide By "isolated" is meant removed from its natural environment For example, for a protein expressed within the cell, isolation includes preparation of a cell lysate as well as subsequent puπfication steps A protein expressed extracellularly may be isolated by, for example, separation of the supernatant from the cells as well as any subsequent puπfication steps.
In another aspect of the invention the interchain loop region of the C botulinum subtype E neurotoxin, which is normally resistant to proteolytic nicking in the bacteπum and mammals, is modified to include the inserted proteolytic cleavage site, and this loop region used as the interchain loop region in the single-chain toxin or modified toxin molecules of the present invention It is believed that using the loop from C botulinum subtype E will stabilize the unnicked toxm molecule in vivo, making it resistant to undesired cleavage until activated through the use of the selected protease In yet another aspect of the invention are contemplated compositions compnsing recombinant forms of BoΝT/E expressed as a single chain polypeptide
In still another aspect are contemplated recombinant chimeπc and/or modified tox deπvatives expressed as a single chain polypeptide Such polypeptide may be molecular tranporters, such as, without limitation, those disclosed in Dolly et al., European Patent Specification EP 0 760 681 Bl, incorporated by reference herein In a further aspect the invention includes neurotoxin derivatives comprising at least a portion of a light chain from one clostridial neurotoxin or subtype thereof, and at least a portion of a heavy chain from another neurotoxin or neurotoxin subtype, as well as methods for their production. In one embodiment the hybrid neurotoxin may contain the entire light chain of a light chain from one neurotoxin subtype and the heavy chain from another neurotoxin subtype. In another embodiment, a chimeric neurotoxin derivative may contain a portion (e.g., the binding domain) of the heavy chain of one neurotoxin subtype, with another portion of the heavy chain being from another neurotoxin subtype. Similarly or alternatively, the therapeutic element may comprise light chain portions from different neurotoxins.
Such hybrid or chimeric neurotoxin derivatives are useful, for example, as a means of delivering the therapeutic benefits of such neurotoxins to patients who are immunologically resistant to a given neurotoxin subtype, to patients who may have a lower than average concentration of receptors to a given neurotoxin heavy chain binding moiety, or to patients who may have a protease- resistant variant of the membrane or vesicle toxin substrate (e.g., SNAP-25, VAMP and syntaxin). Creation of recombinant chimeric or hybrid neurotoxin derivatives having a light chain with different substrate would permit such patients to respond to neurotoxin therapy.
With regard to immunological resistance, it is known that most neurotoxin epitopes exist on the heavy chain portion of the toxin. Thus if a patient has neutralizing antibodies to, for example BoNT/A, a chimeric neurotoxin containing the heavy chain from BoNT/E and the light chain from BoNT/A (which has a longer duration of therapeutic activity than other neurotoxin light chains) would overcome this resistance. Likewise if the patient has few cell surface receptors for BoNT/A, the chance are great that the same patient would have adequate receptors to another BoNT subtype. By creating a hybπd or chimeπc neurotoxin (such as one containing at least a portion of a heavy chain selected from the group consisting of HCA HCB HCCI , HCp, HCE, HCF and HCG and a at least a portion of a light chain selected from a different clostπdial neurotoxin subtype, said light chain being selected from the group consisting of LCA LCB LCci, LCD, LCE, LCF and LCQ ) combining the heavy chain of that subtype with the most therapeutically appropπate light chain (for example, the BoNT/A light chain) the patient could better respond to neurotoxin therapy Another advantage of the hybπd or chimeπc neurotoxin deπvatives descπbed above is related to the fact that certain of the light chains (e.g., LCA) have a long duration of action, others having a short duration of action (e.g , LCE AND LCF) while still others have an intermediate duration of actιvιty(e.g., LCB) Thus, hybπd and chimeπc neurotoxins represent second and third generation neurotoxin drugs in which the neurotoxin activity may be tailored to a specific therapeutic need or condition, with different drugs having different activities, substrate specificities or duration of activity
Such hybπd or chimeπc neurotoxins would also be useful in treating a patient (such as a soldier or laboratory worker) who has been inoculated with the pentavalent BoNT vaccine Such vaccines do not contain BoNT/F; thus, combining the appropπate light chain with the BoNT F heavy chain would create a therapeutic agent which is effective in such a patient where current therapeutic neurotoxins may not be
The same strategy may be useful in using deπvatives of clostπdial neurotoxins with a therapeutic moiety other than an active neurotoxin light chain. As the heavy chain of such an agent would be deπved from a neurotoxin, it may be advantageous to use a lesser known, or rarer heavy chain to avoid resistance mechanisms neutralizing the effectiveness of the therapeutic neurotoxin deπvative.
By the same token, the binding moiety may be one other than a binding moiety deπved from a clostπdial neurotoxin heavy chain, thus providing a targeting function to cell types other than motor neurons.
Also included herein are methods for the construction, expression, and puπfication of such molecules in high yield as biologically active entities.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 A is a diagrammatic view of the single-chain TeTx construct in plasmid pTrcHisA and the nucleotide sequence of the junction region.
Figure IB shows the and amino acid sequence connecting the carboxyl terminus of the L chain and the ammo terminus of the H chain and an engineered loop region containing an enterokinase cleavage site
Figure 2A is a representation of a Western blot of an SDS-PAGE gel of cell extracts of E. coli JM 109 transformants containing 2 different recombinant single-chain toxins, either before or after induction of plasmid protein expression with IPTG. The antibody used for detection is an antι-Hιs6 monoclonal antibody.
Figure 2B is a Western blot of IPTG-induced cell extracts from cells transformed with the E234A construct
Figure 3A shows the results of an expeπment in which affinity puπfied recombinant single-chain (SC) TeTx is nicked with enterokinase, then separated using SDS-PAGE and visualized using Commassie Bπlhant Blue under reducing and non-reducing conditions. Figure 3B shows the results of an experiment in which affinity purified recombinant single-chain (SC) TeTx is nicked with enterokinase, then separated using SDS-PAGE under reducing and non-reducing conditions and subjected to a Western blot using anti TeT%X heavy chain antibody. Figure 4 is a plot of the degree of paralysis induced in a nerve/muscle preparation in vitro using native TeTx, and recombinant single chain neurotoxin before, and after nicking as a function of time.
Figure 5 is a depiction of the peptide fragments generated upon incubation of the recombinant single-chain TeTx with trypsin and Arg C protease, and deduction, from the N-terminal sequences of one of the resulting fragments, of the amino acid sequence recognized by these agents.
Figure 6 shows the digestion of unnicked SC WT TeTx and SC R496G TeTx with various concentrations of trypsin.
Figure 7 shows the inhibitory effect upon TeTx stimulated inhibition of Ca^-dependent neurotransmitter release of preincubating cerebellar cells with the E234A mutant TeTx.
Figure 8 shows the effect upon Ca++-dependent neurotransmitter release of cerebellar neurons upon exposure to native, recombinant E234A mutant single-chain, and the recombinant R496G mutant single chain TeTx. Figure 9 shows the inhibitory effect upon TeTx-stimulated paralytic activity of preincubating mouse hemi diaphrams with the E234A mutant TeTx.
Figure 10 shows the scheme for construction of a plasmid encoding single-chain BoNT/E, and an agarose gel electrophoretogram of the PCR fragment obtained during the construction of the plasmid. Figure 11 shows the scheme for construction of a plasmid encoding the
E212Q proteolytically inactive single-chain BoNT/Tf mutant, and an agarose gel electrophoretogram of the inverse PCR fragment obtained duπng the construction of the plasmid.
Figure 12 shows the expression and puπfication scheme for recombinant single-chain BoNT/E, and a SDS-PAGE electrophoretogram and Westerm blot of the purification fractions.
Figure 13 shows SDS-PAGE electrophoretograms under reducing and non-reducing conditions of native recombinant unnicked, and recombinant nicked BoNT/E, and Western Blots directed towards the heavy and light chains of the toxin. Figure 14 shows the results of incubating native BoNT/E, recombinant nicked and un-nicked BoNT/E, and the E212Q mutant with a GST-SNAP- 25[ 140-205] protease substrate.
Figure 15 shows the effect upon Ca-H-dependent glutamate release of incubating cerebellar cells with native BoNT/E, un-nicked recombinant single chain BoNT/E, and nicked recombinant single chain BoNT/E.
Figure 16A shows the effects on muscle tension of incubating mouse phrenic-nerve hemi -diaphragms with 0.2 nM recombinant nicked BoNT/E (O)or 0.2 nM native BoNT/E (D).
Figure 16B shows the effects on muscle tension of incubating mouse phrenic-nerve hemi -diaphragms with 1 nM recombinant un-nicked (O), 1 nM recombinant nicked (•) or 0.05 nM recombinant nicked (V) BoNT/E.
Figure 17 shows the attenuation of paralytic activity on mouse phrenic- nerve hemi -diaphragms of preincubation with the inactive E212Q mutant pπor to exposure to native nicked BoNT/E toxin DETAILED DESCRIPTION OF THE INVENTION
The compositions and methods of the present invention involve modified neurotoxins, their synthesis and use. Di-chain neurotoxins that are normally activated by scission of a single chain polypeptide by indigenous proteases can be modified at the nucleic acid level by alteration or removal of the nucleotide sequence encoding the indigenous protease cleavage site and insertion of a nucleotide sequence encoding another different proteolytic cleavage site resistant to cleavage by host cell or human proteases. The inserted amino acid sequence is designed to be cleaved in vitro through the use of a cleaving agent chosen in advance of expression that is ,absent from both human and host cell tissue.
The inserted amino acid sequence may be chosen to confer susceptibility to a chemical agent capable of cleaving peptide bonds, such as cyanogen bromide. However, and much more preferably, the encoded amino acid sequence may comprise a proteolytic cleavage site highly specific for a selected protease. The selected protease is one not normally present in the cell expressing the single chain toxin molecule (for example, E. coli or the native clostridial bacterium).
In another aspect, the invention is drawn to recombinant single-chain modified clostridial neurotoxins that may be cleaved at will by a protease to provide an active di-chain molecule. Such modified neurotoxins need not be toxic; in certain of these proteins the enzymatic activity of the toxin L chain may be abrogated, and the toxin joined to a drug or other bioactive agent having therapeutic activity. Alternatively, in certain other modified neurotoxins the L chain is enzymatically active, but portions of the H chain are modified to provide specificity to target cells other than the natural target of the neurotoxin, while maintaining the translocation and endocytosis-stimulating activities of the native toxin.
Modified neurotoxins such as those descπbed in this aspect of the invention are disclosed in, for example, International Patent Publications
WO95/32738, WO 99/55359, WO96/33273, WO98/07864 and WO99/17806, these publications are incorporated by reference herein. The present invention provides single-chain, cleavable versions of these molecules and improved methods of making such molecules. In another aspect, the invention compnses a modified clostπdial neurotoxin deπved from tetanus tox (TeNT), or one or more of the botulinum toxin (BoNT) subtypes in which the naturally-occurπng interchain loop region has been replace with a modified loop region compnsing a different amino acid sequence confernng 1) resistance to cleavage by host proteases or autolytic action, and/or 2) lability to a selected protease. Preferably the cleavage site is highly specific for the selected protease.
The interchain loop region of certain clostridial neurotoxins, for example, BoNT/E, is naturally resistant to proteolytic cleavage in vivo. This protease resistance may reflect a secondary or tertiary structure that makes the loop more resistant to indigenous proteases than other clostndial neurotoxins. In one embodiment of the present invention, therefore, the ter-chain loop region of BoNT/E is substituted for the natural loop region occurnng an another BoNT having greater therapeutic activity or duration of action, for example BoNT/A or /B. In another embodiment of the invention the loop region of BoNT/E is modified to contain a proteolytic cleavage site highly specific to a selected protease pπor to the subclomng. The otherwise highly conserved BoNT/E loop region would be resistant to indigenous proteases, or those encountered within a human, but would retain the ability to be activated by digestion with the selected protease.
Essentially, the selected protease therefore acts as an "activator" of neurotoxin toxicity (or modified toxin activity) that can be added at will following recombinant expression.
The selected protease may be any protease that recognizes a specific amino acid sequence and cleaves a peptide bond near or at that location, but the selected protease is very preferably not a human protease such as human trypsin, chymotrypsin or pepsin, or a host cell protease. Moreover, the selected protease does not recognize the same amino acid sequence as the indigenous proteases. Finally, the selected protease should not be one expressed by the host cell that contains the plasmid encoding the recombinant neurotoxin.
Any non-human protease recognizing a relatively rare amino acid sequence may be used, provided that the amino acid recognition sequence is also known. Examples of proteases to be selected as activators may include any of the following, without limitation: bovine enterokinase, plant proteases such as papain (from Carica papaya)and legumain, insect papain homolog (from the silkworm Sitophilus zeαmαtus), and crustacian papain homolog (decapod), Tobacco etch virus (TEV) protease, which cleaves the sequence EXXYXQS/G; GENENASE® from Bacillus amyliquifaciens, which cleaves the sequence HY or YH; and PRESCISSION® protease from human rhinovirus 3C, which cleaves the amino acid sequence LEVLFQGP. As used above, the letter X indicates any amino acid.
Unless indicated otherwise, the following terms have the following meanings in this specification:
By "binding element" is meant an amino acid sequence region able to preferentially bind to a cell surface marker characteristic of the target cell under physiological conditions. The cell surface marker may compnse a polypeptide, a polysacchaπde, a lipid, a glycoprotein, a lipoprotein, or may have structural characteπstics of more than one of these. By "preferentially interact" is meant that the disassociation constant (Kd) of the binding element for the cell surface marker is at least one order of magnitude less than that of the binding element for any other cell surface marker Preferably, the disassociation constant is at least 2 orders of magnitude less, even more preferably the disassociation constant is at least 3 orders of magnitude less than that of the binding element for any other cell surface marker to which the neurotoxin or modified neurotoxin is exposed.
The "translocation element" compnses a portion of a clostπdial neurotoxin H chain having a translocation activity. By "translocation" is meant the ability to facilitate the transport of a polypeptide through a vesicular membrane, thereby exposing some or all of the polypeptide to the cytoplasm In the vaπous botulinum neurotoxins translocation is thought to involve an allosteπc conformational change of the heavy chain caused by a decrease in pH withm the endosome
This conformational change appears to involve and be mediated by the N terminal half of the heavy chain and to result in the formation of pores in the vesicular membrane; this change permits the movement of the proteolytic light chain from within the endosomal vesicle into the cytoplasm. See e.g., Lacy, et al., Nature Struct. Biol 5:898-902 (October 1998)
The ammo acid sequence of the translocation-mediatmg portion of the botulinum neurotoxin heavy chain is known to those of skill in the art; additionally, those ammo acid residues within this portion that are known to be essential for conferπng the translocation activity are also known It would therefore be well within the ability of one of ordinary skill in the art, for example, to employ the naturally occurnng N-terminal peptide half of the heavy chain of any of the vanous Clostridium tetanus or Clostridium botulinum neurotoxin subtypes as a translocation element, or to design an analogous translocation element by aligning the pnmary sequences of the N- terminal halves of the vaπous heavy chains and selecting a consensus pnmary translocation sequence based on conserved amino acid, polanty, steπc and hydrophobicity characten sties between the sequences
The "therapeutic element" of the present invention may compnse, without limitation: active or inactive (i.e., modified) hormone receptors (such as androgen, estrogen, retmoid, penoxysome prohferator and ecdysone receptors etc.), and hormone-agonists and antagonists, nucleic acids capable being of being used as replication, transcπption, or translational templates (e.g., for expression of a protein drug having the desired biological activity or for synthesis of a nucleic acid drug as an antisense agent), enzymes, toxins (including apoptosis-inducing or -preventing agents), and the like.
In a preferred embodiment, the therapeutic element is a polypeptide compnsing a clostπdial neurotoxin light chain or a portion thereof retaining the SNARE-protein sequence-specific endopeptidase activity of a clostπdial neurotoxin light chain The amino acid sequences of the light chain of botulinum neurotoxin (BoNT) subtypes A-G have been determined, as has the ammo acid sequence of the light chain of the tetanus neurotoxin (TeNT). Each chain contains the Zn^-bmdmg motif His-Glu-x-x-His (N terminal direction at the left) charactenstic of Zn^-dependent endopeptidases (HEL H in TeNT, BoNT/A B and IE, HELNH in BoNT/C; and HELTH in BoNT/D).
Recent studies of the BoNT/A light chain have revealed certain features important for the activity and specificity of the tox towards its target substrate, SNAP-25. Thus, studies by Zhou et al. Biochemistry 34.15175-15181 (1995) have indicated that when the light chain amino acid residue Hιs227 is substituted with tyrosme, the resulting polypeptide is unable to cleave SNAP-25; Kurazono et al., J. Biol. Chem. 14721-14729 (1992) performed studies in the presynaptic chohnergic neurons of the buccal ganglia of Aplysia californica using recombinant BoNT/A light chain that indicated that the removal of 8 N-terminal or 32 C-terminal residues did not abolish toxicity, but that removal of 10 N- terminal or 57 C-terminal residues abolished toxicity in this system Most recently, the crystal structure of the entire BoNT/A holotoxin has been solved; the active site is indicated as involving the participation of H1S222, Glu223, Hιs226, Glu26i and Tyr365. Lacy et al., supra. (These residues correspond to H1S223, Glu224, H1S227, Glu262 and Tyr366 of the BoNT/A L chain of Kurazono et al., supra.) Interestingly, an alignment of BoNT/ A through E and TeNT light chains reveals that every such chain invanably has these residues in positions analogous to BoNT/A Kurazono et al., supra.
The catalytic domain of BoNT/A is very specific for the C-terminus of SNAP-25 and appears to require a minimum of 17 SNAP-25 amino acids for cleavage to occur The catalytic site resembles a pocket; when the light chained is linked to the heavy chain via the disulfide bond between Cys429 and Cys453, the translocation domain of the heavy chain appears to block access to the catalytic pocket until the light chain gains entry to the cytosol When the disulfide bond is then reduced, the catalytic pocket is "opened" and the light chain is fully active.
As descπbed above, VAMP and syntaxin are cleaved by BoNT/B, D, F, G and TeNT, and BoNT/C,, respectively, while SNAP-25 is cleaved by BoNT/A E and Cl. The substrate specificities of the vanous clostπdial neurotoxin light chains other than BoNT/A are known Therefore, the person of ordinary skill in the art could easily determine the toxin residues essential in these subtypes for cleavage and substrate recognition (for example, by site-directed mutagenesis or deletion of vaπous regions of the toxin molecule followed by testing of proteolytic activity and substrate specificity), and could therefore easily design vanants of the native neurotoxin light chain that retain or lack the same or similar activity.
In a particularly preferred embodiment, the single chain neurotoxin or neurotoxin deπvative of the invention, altered as indicated above, is further modified to remove other incidental endogenous proteolytic sites such as those cleaved by trypsin, Arg C protease, chymotrypsm, or host cell proteases. As indicated below, modification of the pnmary amino acid sequences in these regions to confer protease resistance can increase the yield of the neurotoxin and reduce the toxicity of the single chain neurotoxin pnor to cleavage and activation
The amino acid sequences recognized by many proteases, and their cleavage specificity are well-known to those of skill in the art Thus, both the design of a specific proteolytic cleavage site in the loop region between the L and H chain portions of the single-chain toxin and the modification of incidental protease sites in the polypeptide to be protease-resistant is a routine matter of compaπng the specificity and recognition sequences for vanous proteins. In the first case, the specificity of a candidate proteolytic site need not be totally exclusive, but merely needs to exclude cleavage sites for human and/or host cell proteases that might be present dunng the handling, storage and punftcation of the single chain neurotoxin Of course, it is preferable that the protease site is as specific as possible. In the latter case, the modification of the proteolytic cleavage site need only be sufficient to render the site resistant to the activator protease and to human and host cell proteases.
In another preferred embodiment, the recombinant modified single chain neurotoxin is further modified by joining the chain to a binding tag compnsing one member of a specific binding complex. By "specific binding complex" is meant two or more chemical or biochemical entities that will bind each other under defined environmental conditions and which will not significantly bind other chemical or biochemical entities present in the environment under the same conditions. Examples of members of a specific binding complex include, without limitation, an antibody and its antigen, a lectm and its target carbohydrate, a nucleic acid strand and its complementary nucleic acid strand, a cell surface receptor and its ligand, a metal and a compound able to form a coordination or chelation complex with that metal, and the like. In this embodiment, the binding tag may be joined to the single chain toxin through a linker, preferably a cleavable linker. Examples of possible linkers, while not an exhaustive list, include 1) aliphatic dicarboxyhc acids of the formula HOOC-(CH2)n-COOH, where n=l-12 (may be linked at a free amino group); 2) HO-(CH2)n-COOH, where n>10 (suitable for attachment at the ammo terminus of the polypeptide), 3) substituted polybenzene structures, and 4) a N-hydroxysuccmimide (NHS) ester linker. The use of an linker containing an ester permits cleavage of the ester linker following use in the puπfication of the single chain neurotoxin under relatively mild acidic conditions
Alternatively, and most preferably, the binding tag may compnse some or all of the ammo acid sequence of an appropnately chosen polypeptide coexpressed with the single chain toxin as a fusion protein; such polypeptides may compnse, without limitation, the maltose binding domain of maltose binding protein (MBP); a Hιs6 tag (a run of 6 histidme residues); the calmodihn binding domain of calmodulin binding protein; and the glutathione binding domain of glutathione-S-transferase Other polypeptide binding tags are well known to those of skill in the art, and can easily be adapted for use in the present invention.
Additionally, the binding tag may be constructed to have a protease cleavage site between itself and either the amino terminus or the carboxyl terminus of the single chain toxm so as be removable following puπfication of the peptide. The proteolytic cleavage site may be designed to be cleaved by the same activator protease chosen to nick the single chain toxin between the H and L chains.
It is therefore an object of the invention to provide a recombinant activatible single chain neurotoxin molecule that has reduced toxicity compared to the native neurotoxin until activated by reaction with a non-clostπdial protease The single chain neurotoxin is more easily puπfied, is less dangerous to handle in the puπfication process, and can be optionally modified to give the toxin more desirable properties
It is also an object of the invention to provide an method of making a recombinant activatable single chain neurotoxin by modifying the nucleotide sequence encoding the neurotoxin to replace the native amino acid proteolytic cleavage sequence separating the H and L chain with an amino acid sequence stable to indigenous clostπdial or host cell proteases but susceptible to cleavage by chosen protease in vitro
It is further an object of the present invention to provide more stable neurotoxin polypeptides through modification of the nucleotide sequence of the coding region of the H and L chains thereof, removing incidental proteolytic cleavage sites by causing the replacement of labile amino acids with other amino acid residues which confer upon the toxin resistance to undesired proteolytic degradation
Additionally, it is an object of the invention to provide methods of punfymg recombinant neurotoxins as a single chain by joining the expressed single chain neurotoxin to a binding moiety compnsing partner of a specific binding complex which can be used in the affinity punfication with the binding partner compnsing the other half of the binding complex Punfication can be performed batch-wise or in a chromatography column The binding moiety may then be removed following the affinity step, and separated from the neurotoxin It is also an object of the invention to provide single-chain recombinant modified neurotoxin molecules for use as therapeutic agents The modified neurotoxin molecules may have an altered target specificity or an altered activity compared to the native neurotoxin from which it is denved, or both
It is also an object of the invention to provide a single chain activatable recombinant neurotoxin that may be more easily puπfied than the wild type neurotoxin Such a neurotoxin permits the large scale preparation of properly folded highly pure toxin for clinical use
The following Examples serve to illustrate particular embodiments of the invention, and do not limit the scope of the invention defined in the claims
Example 1 Construction of an Expression Vector Containing a Single Chain TeTx Coding Region The present invention can be exemplified describing the construction of a plasmid that will express TeTx in E. coli as a single protein that is readily purified, i.e., by affinity chromatography. TeTx can be chosen as a pilot system because (i) the availability of an excellent vaccine greatly reduces the risk of its handling and (ii) it is the most comprehensively studied of the toxins in terms of expressing HC and LC domains. However, those of skill in the art will understand that the same or similar strategies may be employed using any dichain or binary toxin or other bioactive molecule expressed as a single polypeptide and activated by proteolytic cleavage. Single chain molecules were constructed containing the wild type TeTx L chain and a mutated version of the TeTx light chain wherein a glutamic acid residue at position 234 is changed to an alanine (termed "E234A", Ala234, or "the E234A mutant light chain"), respectively. This latter mutation results in an inactive TeTx light chain, and a plasmid encoding the E234A mutant light chain (pMAL-E234A) was constructed as described in Li et al., Biochemistry 33:7014-7020 (1994)(hereby incorporated by reference herein). The following protocol is used for the construction of each single-chain toxin.
The vector pTrcHisA, purchased from lnvitrogen, is modified using a Stratagene QuickChange® site-directed mutagenesis kit (for site-directed mutagenesis techniques, see e.g., Smith et al., J. Biol. Chem. 253:6651-6560 (1979); incorporated by reference herein in its entirety) to create two extra restriction sites (Sail and Hindlll) upstream of the nucleotides encoding a preexisting enterokinase (EK) cleavage site. The plasmid also contains a translational start codon (ATG) followed by a run of codons encoding 6 histidine residues immediately upstream of the enterokinase cleavage site. A multiple cloning site containing Bam HI, Xhol, Bgl π, Pst I, Kpn I, Eco RI BstB I and Hind m cleavage sites is located immediately downstream of the EK site; the Hind in site is removed by site-directed mutagenesis The following pπmers are employed to insert the restπction sites (underlined) upstream of the EK cleavage site:
SEQ LO NO: 1
GACTGGTGGACAGCAAGTCGACCGGAAGCTTTACGACGATGACG, and
Sal I Hind III
SEQ ID NO: 2
CGTCATCGTCGTAAAGCTTCCGGTCGACTTGCTGTCCACCAGTC Hind III Sal I
The resulting plasmid contains both Sal I and Hind IJJ sites located at the
5' side of the nucleotide sequence encoding the bovine enterokinase (EK) cleavage site
The nucleotide sequence encoding the wild-type TeTx L chain is obtained from plasmid pMAL-LC, descnbed in Li et al , Biochemistry 33, 7014- 7020 (1994), incorporated by reference herein The plasmid encodes the TeTx light chain as a fusion protein with maltose binding protein (MBP) located immediately upstream of the coding sequence for the L chain The MBP and L chain portions of the fusion protein are designed to contain the cleavage site for human blood coagulation factor Xa (Ile-Glu-Gly-Arg) to facilitate removal of the MBP once affinity punfication has been performed
The DNA fragment containing the coding sequence of the L chain is excised from plasmid pMAL-LC by digesting the plasmid with Sal I and Hind TJJ, gel purifying the resulting DNA fragment containing the L chain, and ligating this fragment into plasmid pTrcHisA at the newly created Sal I and Hind TJJ sites upstream of the EK site. This fragment results in the excission of the maltose binding protein sequences from the N terminus of the L chain. An identical procedure is used to subclone the DNA fragment containing a mutant L chain from plasmid pMAL-LC-Ala234, in which a single amino acid change is made at amino acid 234 of the L chain, substituting the native glutamic acid with alanine. This change is sufficient to abrogate the zinc endopeptidase activity of the L chain, and to render non — toxic a reconstituted tetanus toxin containing native H chain and the Ala234 L chain.
The DNA fragment containing the H chain is obtained from plasmid pMAL-HC; construction of this vector is described in Li et al., J. Biochem. 125:1200-1208(1999), hereby incorporated by reference herein. Briefly, the gene encoding the H chain is constructed by assembling three DNA fragments containing different portions of the H chain coding sequence which had been cloned into separate plasmids. The fragments comprising the amino terminal half of the H are first amplified using standard polymerase chain reaction methods (see, e.g., Mullis, U.S. Patent No. 4,683,202 and Mullis et al., U.S. Patent No. 4,800,159, both incorporated by reference herein in their entirety) and the following primers: PCR primers a (containing a Xba I cleavage site) and b (containing a Bgl π cleavage site) (SEQ ID NO: 3 and 4, respectively) are used to amplify the H chain fragment contained in a plasmid termed pTetδ; PCR primers c (containing a Bgl TJ cleavage site) and d (containing both a Hind III and a Sal I cleavage site)(SEQ ID NO: 5 and 6, respectively) are used to amplify the H chain fragment contained in a plasmid termed pTetl4. The nucleotide sequences of these primer are provided below, with restriction sites underlined. SEQ ID NO: 3
AATAGATCTAGATCATTAACAGATTTAGGA (a)
SEQ ID NO: 4
TTCTAAAGATCTATACATTTGATAACT (b)
SEQ ID NO: 5
ATGTATAGATCTTTAGAATATCAAGTA ( C )
SEQ ID NO: 6
ATCGATAAGCTTTTATCAGTCGACCCAACAATCCAGATTTTTAGA ( d )
Following PCR amplification and gel punfication of the amplified H chain fragments, each fragment is digested with Bgl TJ and hgated to yield the complete N terminal half of the H chain coding region This hgation product is then digested with Xba I and Hind HI and subcloned into the multiple cloning site of pMAL-c2-T (the plasmid being also cut with Xba I and Hind HI), which is located downstream of the coding region for MBP and the factor Xa site pMAL-c2 is a commecially available vector well known to those of skill in the art The resulting plasmid is pMAL-HN.
The entire H chain coding region is assembled as follows The pMAL- HN plasmid is digested with Sac I and Sal I to yield the DNA fragment encoding the N-terminus of the H chain. Plasmid pTet215 is digested with Sal I and Bam HI to yield the DNA fragment encoding the H chain carboxyl terminus. The vector pMAL-c2-T is digested with Sac I and Bam HI, and hgated to the digested H chain fragments, which will assemble in the proper oπentation due to the use of distinct endonucleases. The resulting plasmid is pMAL-HC
The DNA fragments encoding the H and L chains (including Ala234 L chain) are cut and punfied directly from pMAL-LC or pMALE234A and pMAL-HC constructs and subcloned into the modified pTrcHisA vector descπbed above. The H chain was first hgated into the modified vector at the Bam HI site immediately downstream of the EK site, and the resulting plasmid was gel puπfied. Following digestion of this plasmid with Hind TJJ and Sal I, the L chain was hgated at a position just upstream of the EK cleavage site. The resulting plasmid construct contains the nucleotide sequence encoding the single-chain toxin protein, compnsing (from ammo to carboxyl terminus), six histidine residues (the His tag), followed by the L chain, an enterokinase cleavage site, and the H chain The translated junction between the L and H chains containing the EK cleavage site (DDDDK) is shown below (in the direction from N-terminus to C-terminus) and in Figure 1.
SEQ ID NO: 7
EK site SKLIGLCKKIIPPTNIRENLYNRTA-GEKLYDDDDKDR GSSR-SLTD GGELCIKNEDLTFIAEKN chain interchain loop H chain
To allow expression of the two chains as a single unit, a nucleotide sequence compnsing a stop codon present at the 3' end of the L chain coding sequence in the pMAL-LC is removed by site-directed mutagenesis using two pπmers (SEQ ID NO. 8 and 9), resulting in a single reading frame containing both H and L chains SEQ ID NO: 8
AATAGAACTGCAGGAGAAAAGCTTTACGACGATGAC , and T6ATAA (deleted stop codon, coding strand)
SEQ ID NO: 9
GTCATCGTCGTAAAGCTTTTCTCCTGCAGTTCTATT TTATCA
(deleted stop codon, non-coding strand)
The resulting pTrcHisA-based construct is transformed into E. coli strain JM109 by heat shock using the method of Hanahan, and transformant colonies are isolated on Luna agar plates containing 100 μg/ml ampicilhn Plasmids are punfied from these transformants and the insertions are confirmed by analytical restnction endonuclease digestion and agarose gel electrophoresis
EXAMPLE 2 Expression and Physical Characteπzation of Single-Cham TeTx
Expression of the pTrcHisA-based single chain TeTx construct (under control of a hybπd trp/lac promoter) is induced by addition of 1 mM IPTG (isopropyl thio-galactopyranoside) to a confluent culture of a representative transformant clone in 200 ml Luna broth containing 100 μg ml ampicilhn and incubating further at 37°C for 16 hours before cell harvest by centnfugation.
The cell pellets are resuspended 30 ml Buffer A (20 mM Na2PO , 500 mM NaCl (pH 7.8)), then lysed by ultrasonication at 4°C, using 10-second bursts at a medium setting. Insoluble debπs is removed by centnfugation at 9,000 X g for 30 mm at 4°C, and the supernatant recovered by centnfugation. The supernatant containing each single chain construct is incubated for 20 minutes at 22°C with 2 ml of nickel-ion res (Invitrogen Corp.) for affinity punfication by means of chelation between the histidine residues at the amino terminus of the single chain tox molecule and the nickel. The resms were then load onto mini columns and washed with 200 ml of washing buffer (20 mM Na PO , 500 mM NaCl (pH 6.0)) to remove any non-specifically bound matenal, the recombinant single-chain proteins are eluted on 0.5 ml fractions with 8-15 ml of 100 mM lmidazole in Buffer A The concentration of the eluted single-chains was measured by Bradford's protein assay (Bio-Rad Laboratones), approximately 1 milligram of the fusion protein was recovered.
Example 3 SDS-PAGE and Western Blot Analysis of Recombinant Single-Chain
TeTx
The single-chain TeTx constructs are grown in Luria broth containing ampicillin at 37°C, and aliquots taken both before and after induction of protein expression with IPTG. Crude cell extracts are prepared for SDS-PAGE by dilution in sample buffer under reducing conditions in the presence of β- mercaptoethanol (BME). Following SDS-PAGE electrophoresis, the separated proteins are Western-blotted as follows: the proteins are electrophoretically transferred to a polyvinylidenedifluoride (PVDF) membrane using standard methods (see, e.g., Sambrook et al., Molecular Cloning, A Laboratory Manual (2d ed. Cold Spring Harbor Laboratory Press 1989), hereby incorporated by reference in its entirety), the membrane treated to reduce background Ig binding, and then probed using an anti-His6 antibody, followed by detection using an alkaline phosphatase-conjugated secondary antibody and development with a 5- bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium substrate.
As shown in lanes 1 and 2 of Figure 2A, the Western blot revealed no detectable TeTx expression before induction of protein synthesis; by contrast, a single band of approximate molecular weight 150 kDa was revealed in the aliquots taken following protein induction (See lanes 3 and 4.) In Fig 2A, lanes 1 and 3 are the WT light chain construct and lanes 2 and 4 contain the E234A mutant construct.
Fig. 2B is a Western blot of IPTG-induced cell extracts from cells transformed with the E234A construct. Significantly, no discemable lower molecular weight proteolytic cleavage products of the light chain were observed, providing evidence for the relative stability of the single-chain toxin following expression and purification. Figure 3 shows the results of a second expenment, in which affinity punfied recombinant single-chain (SC) TeTx is nicked with enterokinase as follows. Thirty micrograms of punfied single chain toxin are incubated with 1 unit of enterokinase in a solution containing 50 mM Tns-HCl (pH 8.0), 1 mM CaCl2 and 0.1% Tween-20(v/v). As a control, the recombinant protein is incubated in the same reaction mixture containing no EK These samples, plus an aliquot of native (non-recombinant) TeTx are subjected to SDS-PAGE in an 8% polyacrylamide gel under either reducing (+BME) or non-reducing (-BME) conditions The resulting gel is used both for a Western blot and subsequent detection using anti-H claim antibodies (Fig 3B), and direct staining with Coomassie Blue (Fig 3A).
As indicated by Figure 3, under non-reducing conditions all three samples (Native TeTx (Lane 1), unnicked recombinant toxin (Lane 2), and enterokinase nicked recombinant toxin (Lane 3)) will migrate as doublets (apparently different conformers that resolve into a single band upon reduction) with essentially indistinguishable apparent molecular weights of about 150 kDa The non-reducing gel confirms that 1) high levels of expression are obtained, 2) the disulfide bonds linking the light and heavy chains are fully formed, and 3) the recombinant single chain toxin is not subject to observable proteolytic degradation
By contrast, under reducing conditions wild-type and nicked recombinant tox yield an H chain having a molecular weight of about 100 kDa by both Western blot and Coomassie staining Additionally, in the Coomassie stained gel, both of these samples also show a lower molecular weight species of about 50 kDa, corresponding to the L chain The wild-type L chain will migrate with a lower apparent molecular weight than that of the recombinant L chain, which has 22 additional amino acid residues due to the presence of the His6 moiety and a modified EK cleavage site -containing interchain junction region. The unnicked recombinant toxin (Lane 2) migrates as a single band with an apparent molecular weight of about 150 kDa. Notably, no trace of the unnicked toxin is seen in lane 3, indicating the effectiveness of enterokinase treatment.
Example 4 In Vitro Toxin-Induced Paralysis by Recombinant Single-Chain TeTx
The biological activity of the recombinant TeTx is also examined and compared to wild-type toxin using mouse phrenic nerve hemi-diaphragm, since the native toxin is known to cause neuromuscular paralysis, albeit at higher concentrations than act in the CNS. For this experiment, mouse left phrenic nerve-hemi diaphragm is dissected from mice (T/O strain, 4-week old and -20 g in weight) and immediately transferred into a closed circulatory superfusion system containing 10 ml of Krebs-Ringer solution (118 mM NaCl, 4.7 mM KC1, 1.2 mM MgSO4, 2.5 mM CaCl2, 23.8 mM NaHCO4, 1.2 mM KH2PO4, 11.7 mM glucose (pH 7.4)), bubbled with 95% O2 and 5% CO2 and supplemented with 0.1 % (w/v) bovine serum albumin to diminish non-specific adsorption of the toxins (Li et al., Biochemistry 33:7014-7020 (1994)). The hemidiaphragms are kept in a bath containing 10 ml Krebs-Ringer buffer at 37°C for 10 minutes before being exposed to 4 or 10 nM native TeTx (ψ and V, respectively )or 10 nM nicked recombinant TeTx (•) or 10 nM un-nicked recombinant TeTx (O), respectively. (See Figure 4). Muscle twitch is evoked by supra-maximal stimulation of the phrenic nerve with bipolar electrodes and recorded via a force-displacement transducer (Lectromed, UK) connected to an amplifier and computer system (MacLab, AD Instruments, UK). Parameters of nerve stimulation are 0.2 Hz square waves of 0.1 msec duration with 1.5-2.5 V amplitude Toxm-induced paralysis of neuromuscular transmission is quantified as the time required for nerve-evoked muscle contraction to decrease to 10% (90% reduction) of the onginal value
As shown in Figure 4, 10 nM recombinant nicked TeTx was found to be as potent as 10 nM native toxm in blocking nerve-induced muscle twitch, with the preparations yielding a 90% reduction in muscle tension in approximately 170 minutes. Thus, this novel preparation of TeTx expressed in E. coli at high level as a single-chain, activatable polypeptide and punfied by a simple affinity chromatography step proved to be fully active by all the cπtena examined.
By contrast, 10 nM of the unnicked TeTx preparation require approximately twice as long to reduce muscle tension, and was approximately as active as 4 nM of the wild-type TeTx As a control, hemidiaphragms incubated with KR buffer and the trace amount of enterokinase present in the expeπmental samples were found to show negligible decrease in muscle tension over 5 hrs
Thus, this expenment indicates that the unnicked TeTx is considerably less toxic that either the wild type or recombinant nicked protein in vitro.
Example 5
Further Modification of Single Chain TeTx to Remove Proteolytic Cleavage Sites Reduces Toxicity of Unnicked Recombinant Toxin
While the unnicked recombinant single-chain form of TeTx displays reduced toxicity as compared to the nicked form, the residual toxm activity probably aπses from activation of the toxm by additional proteases in vivo. To test this possibility, sites in the single chain toxin molecule susceptible to proteolytic cleavage by trypsin and Arg C protease are identified by incubation of single-chain TeTx with these enzymes as follows. Fifty micrograms μg of recombinant single chain TeTx is incubated with 4 μg of Arg-C at 37°C for 4 h; 0.1 μg of trypsin at 37°C for 0.5 h; or buffer without protease as a control. These reactions are terminated by the addition of SDS-PAGE sample buffer containing 0.1% SDS followed by boiling for 5 minutes; then the samples are subjected to SDS-PAGE, followed by a Western electrophoretic transfer to a polyv yhdenedifluonde (PVDF) membrane. The membrane is blotted with IgG specific for the Hιs6-tag and detected using a horseradish peroxidase staining system.
As shown in Figure 5, the Western blot reveals that trypsin and Arg C protease yielded a L chain (and thus a H chain) fragment of the same size. Additionally, the transfer of a duplicate gel was stained for protein with Ponceau red and the H chain band of approximate molecular weight 100 kDa was excised from each lane and analysed by N-terminal sequencing
In the recombinant smgle-cham TeTx, the LC and HC are linked by 17 ammo acids (GEKLYDDDDKDRWGSSR), followed by the beginning of the H chain sequence (SLTDLGGEL . . .) N-terminal amino acid sequencing of the larger fragment produced by both trypsin and Arg C protease reveal that first 5 amino acids of the 100 kDa trypsin and Arg C protease cleavage product protein are SLTDL; thus, these proteases appear to cleave the single — chain tox between the R-S bond (see Figure 1) so as to liberate the H chain and the L chain containing the EK linker at its C terminus, with this vanant therefore yielding a dichain toxm essentially identical to the EK nicked toxm.
The arginme at the carboxy terminus of the EK linker sequence is mutated by site-directed mutagenesis to a glycine (R496G), and the resulting single cnain tox polypeptide is expressed and purified as above.
Titration of the 6 micrograms of the R496G mutated single chain (WT LC) toxin and the SC TeTx lacking such a mutation against 0, 0.01, 0.1, 1, 10 μg/ml of trypsin, followed by SDS-PAGE and staining with Coomassie Brilliant Blue, yields the cleavage pattern seen in Figure 6. As can be seen, both single chain molecules are susceptible to typsin cleavage; however the R496G mutant yields fewer fragments than the SC toxin not containing a mutation in the loop region between the chains. For example, while three trypsin peptide bands can clearly be seen near the light chain band upon trypsin cleavage of the SC WT toxin, only two such bands are seen in the R496G digests.
The fact that there exist remaining trypsin sites in the R496G mutant SC toxin probably accounts for the fact that this mutant does not cause the lowering of toxicity as compared to the un-nicked SC toxin; both preparations give similar values in the mouse lethality and neuromuscular paralysis assays described above.
A different assay system is used to measure neurotoxin activity toward CNS neurons, the cells naturally affected by TeTx. The cells used are cerebellar neurons; these cells are disassociated from the cerebella of 7 day old rats. Neurons are suspended at 1-2 x 106/mL in medium consisting of 3 parts Basal Eagle Medium and 1 part of a buffer consisting of 40 mM HEPES-NaOH (pH 7.3), 78.4 mM KC1, 37.6 mM D-glucose, 2.8 mM CaCl2, 1.6 mM MgSO4 and 1.0 mM NaH2PO4, as well as 1 x N2 supplement, 1.0 mM L-glutamine, 60 units/mL penicillin, 60 μg/mL streptomycin and 5% (v/v) dialysed horse serum. One milliliter of this cell suspension is added to 22 mm diameter poly-D-lysine coated wells. Cytosine β-D-arabinofuranoside (Ara-C, 40 μM) is added after 20- 24 hours in 5% (v/v)CO2 culture, and neurons are maintained by weekly replacement of the above-noted medium containing 40 μM Ara-C.
For each assay, neurons are cultured for at least 10 days in vitro are washed four times with O2 -gassed Krebs-Ringer HEPES buffer (KRH, mM: 20 HEPES.NaOH pH7.4, 128 NaCl, 5 KC1, 1 NaH2PO4, 1.4 CaCl2, 1.2 mM MgSO4, 10 D-glucose and 0.05 mg/mL BSA), and 0.5 mL of the latter buffer containing 0.25 μCi/mL [14C]-glutamιne (i.e. the glutamate precursor) is added. All steps are performed at 37°C. After a 45 minute labeling peπod, the medium is removed and the neurons washed four times as before. Control and tox - treated neurons are incubated for 5 minutes at 37°C in KRH buffer containing either 1.4 mM Ca~+ or 0.5 mM EGTA (i.e. to assess Ca2+-ιndependent release); aliquots are then removed and retained for assessment of [1 C]-glutamate content by scintillation counting. Immediately after removal of the above basal medium, a modified KRH buffer containing 50 mM KC1 (containing a lowered 83 mM NaCl content in order to maintain a normal osmotic potential) and either 1.4 Ca"+ or 0.5 M EGTA are added for a 5 minute stimulation peπod. Finally, neurons were solubihzed with 20 mM EGTA.NaOH pH 7.5 containing 1% (w/v) SDS, and aliquots subjected to scintillation counting in order to calculate their remaining radioactive contents. The amounts of 14C-glutamate in basal and stimulated samples are expressed as percentages relative to the calculated total cell content. The percentage [' C]-glutamate contents in EGTA-containing buffer are subtracted from the values recorded in Ca~+-contaιnιng samples in order to calculate the relevant Ca~+-dependent component of release and in turn the latter basal readings are subtracted from values obtained for 50 mM KC1 samples to yield the K+-evoked Ca~+-dependent glutamate release component Figure 8 demonstrates the ability of the recombinant toxin to inhibit neurotransmitter release. Cerebellar neurons, maintained for 10 days in vitro, were washed twice with ice-cold KRH buffer containing 5 mM Mg"+ and 0.5 mM Ca2+, then exposed in this buffer to the specified concentrations of (•) native TeTx, (O) EK- nicked TeTx R496G, (ψ) single chain unnicked TeTx, or (V) EK-mcked TeTx E234A for 60 mm at 4°C (see Fig 8). Native TeTx (0.2 nM) was then added to the wells specified and, after an additional 30 min, the neurons were washed three times with ice-cold KRH buffer and incubated for 30 min at 37°C. Subsequent assessment of K+-evoked Ca"+-dependent neurotransmitter release was performed as detailed above The results of this assay are shown in Figure 8 When cerebellar neurons are exposed to nicked recombinant TeTx, a dose-dependent inhibition of Ca"1-1" dependent transmitter release is seen with a potency similar to the native toxin. Nicked recombinant SC TeTx, both WT and R496G, gave similar values in this assay. Thus, while toxin activity in the unnicked single chain molecule is not abrogated through the removal of a single trypsin cleavage site, the removal of additional such sites is feasible in regions of the single chain toxin to achieve an activatable single-chain proform of the toxin that exhibits even lower toxicity unless activated in vitro, when its full activity can be achieved
Example 7
Protease-deficient TeTx mutant antagonises the actions of TeTx on peπpheral and central neurons
Table 1 shows the tabulated results of the indicated TeTx constructs tested in three assays of toxin activity, ability to cleave the HV62 peptide (which measures proteolytic activity only); neuromuscular paralysis (which is an indication of the toxin molecules' ability to enter the cell and thence to inhibit neurotransmitter release), and mouse lethality upon mtrapeπtoneal injection of the vaπous toxin constructs. The first two of these assays was performed as descnbed above. The mouse lethality assay was performed essentially as follows:
Samples of recombinant punfied single-chain TeTx, R496G mutant TeTx, and E234A mutant TeTx are each divided into two aliquots and one aliquot treated with enterokinase to nick the tox . All samples are seπally diluted into 50 mM phosphate buffer (pH 7.0), 150 mM NaCl and 0.25% (w/v) bovine serum albumin (BSA), and the toxin preparations are injected into mice intrapeπtoneally.
As shown in Table 1, the native and nicked TeTx preparations were comparably active in the mouse lethality assay, having an LD50 of about 1 X 108/mg The unnicked recombinant toxin and unnicked R496G mutant were both about half as active Finally, the nickedf E234A proteolytically inactive toxin was less than 5 X 107 fold less active
Table 1
Figure imgf000043_0001
"Initial rates of proteolysis were measured using the RP-HPLC-based method detailed in Foran et al ( 1994) Incubations with 15 μM of a synthetic peptide corresponding to residues 33 to 94 of human VAMP-2 (HV62) were performed at 37°C in 50 M HEPES.NdOH pH 7 5 containing 2 mM DTT 0 2 mg ml ' BSA and 50 μM ZnCl2. using the appropriate concentration of each reduced toxin preparation required to proteolyze 10-15 X of the substrate during a 30 min period Data are means (± S D , n = 4)
''LDs i the amount of toxin that killed 507r of the injected mice within 4 days 'Toxin preparations were nicked with EK ( 1 unιt/30μg) at 22°C for 1 h dThιs v° value represents the detection limits ot the RP-HPLC assay, no proteolysis of HV62 was observed using prolonged incubations
Punfied SC E234A TeTx, in which the catalytic E at position 234 was replaced by an A, failed to show any detectable proteolysis of a peptide containing residues 33 to 94 of human VAMP-2 (termed HV62), either before or after nicking with EK Accordingly, nicked TeTx E234A proved to be devoid of toxicity in mice and unable to inhibit transmitter release at the neuromuscular junction or from cerebellar neurons Importantly, however, this mutant toxin retained the ability to bind to the cell surface receptors on peπpheral and central neurons Pre-incubation of cerebellar neurons with nicked ( 10-60 nM) or unnicked (7-40 nM) TeTx E234A at 4°C followed by the addition of 0.2 nM native toxin, antagonized the native toxin's inhibition of transmitter release at 37°C to similar extents (Fig. 7).
As demonstrated in Figure 9, exposure of mouse diaphragm to 100 nM TeTx E234A at 4°C for 60 minutes pπor to adding 1 nM native toxin prolonged the time taken to cause neuromuscular paralysis.
Mouse phrenic-nerve hemi -diaphragm was incubated in KR at 37°C with 20 nM recombinant TeTx E234A (Δ) whilst stimulating the nerve (0.2 Hz, 1 5- 2 5v) and recording muscle tension For assessing competition, hemi- diaphragms were incubated for 60 minutes at 4°C with MKR containing 0.1% BSA only ( ), or the latter plus 100 nM nicked TeTx E234A (<©), before the addition of 1 nM native TeTx. Following 30 minutes exposure to the latter, the tissues were washed three times with MKR and twice with KR The temperature was raised to 37°C and the nerve stimulated with recording of the evoked muscle twitch, as outlined above This apparent competition for toxin binding by the mutant seen with both tissues demonstrates that the recombinant dichain TeTx exhibits much higher affinity for the cell surface receptors than the heavy chain or Hc of TeTx alone These results suggest that the conformation of the recombinant dichain TeTx has high affinity to the cell surface receptor Moreover, and very significantly, these data demonstrate that recombinant molecules can be made according to the inventive methods of the present patent application having specific binding for the same cellular receptor as TeTx However, such molecules may, like the E234A mutant, be inactive as toxin molecules but will retain the ability to be taken up by the target cell, thus serving as potential transporter molecules Example 8
Expression of Single Chain BoNT/A
Using methods similar to those descπbed above, DNA fragments containing the BoNT subtype A neurotoxin H and L chains were hgated together, separated by the EK cleavage site This single-chain toxin coding sequence was inserted into a vanety of expression vectors containing different N terminal sequences and promoters, as shown in Table 2, below.
Table 2
Figure imgf000045_0001
The "fusion tags" each compnsed a member of a specific binding complex as a puπfication aid and to improve the solubility and stability of the expressed protein These plasmids were transformed into the E. coli strains indicated in Table 2 and expression of the single-chain toxin was monitored.
In another expenment. the single-chain BoNT/A construct was inserted into plasmid pMAL-c2 between the Bam HI and Hind IJI restπction sites, resulting in a coding sequence for a fusion polypeptide containing the maltose binding protein at the N terminus, followed by a Factor Xa cleavage site Transformant JM 109 colonies were selected in Luna broth containing ampicilhn. Expression was induced by the addition of IPTG to a final concentration of 0.3 mM. As for the TeTx construct, aliquots of the cell culture were collected before and after induction, the cells in each sample lysed by sonication, and the supernatant prepared for SDS-PAGE under both reducing and non-reducing conditions. Following electrophoresis to separate the proteins according to apparent molecular weight, the gel was subjected to a Western blot using an antibody raised against the H chain of BoNT/A. The Western blot resulted in the appearance of an immunologically reactive single-chain toxin band of apparent molecular weight approximately 200 kDa Further modifications of the single-chain BoNT molecule to eliminate fortuitous protease cleavage sites (similar to those modifications made at the TeTx site labile to trypsin and Arg C protease, descπbed above) will result in even greater stability of the single-chain BoNT/A molecule.
Example 9
Construction of a Plasmid Vector Expressing BoNT/E
A plasmid expressing a single-chain recombinant version of the neurotoxin from Clostridium botulinum subtype E(straιn Beluga) (BoNT/E) was constructed as follows. PCR pπmers were designed based on the EMBL database cDNA sequence of the BoNT/E neurotoxin (Genbank accession number X62089) This nucleotide sequence is represented herein as SEQ ID NO: 10
gaattcaagt agtagataat aaaaataatg ccacagattt ttattattaa taatgatata tttatctcta actgtttaac tttaacttat aacaatgtaa atatatattt gtctataaaa aatcaagatt acaattgggt tatatgtgat cttaatcatg atataccaaa aaagtcatat ctatggatat taaaaaatat ataaatttaa aattaggaga tgctgtatat gccaaaaatt aatagtttta attataatga tcctgttaat gatagaacaa ttttatatat taaaccaggc ggttgtcaag aattttataa atcatttaat attatgaaaa atatttggat aattccagag agaaatgtaa ttggtacaac cccccaagat tttcatccgc ctacttcatt aaaaaatgga gatagtagtt attatgaccc taattattta caaagtgatg aagaaaagga tagattttta aaaatagtca caaaaatatt taatagaata aataataatc tttcaggagg gattttatta gaagaactgt caaaagctaa tccatattta gggaatgata atactccaga taatcaattc catattggtg atgcatcagc agttgagatt aaattctcaa atggtagcca agacatacta ttacctaatg ttattataat gggagcagag cctgatttat ttgaaactaa cagttccaat atttctctaa gaaataatta tatgccaagc aatcaccgtt ttggatcaat agctatagta acattctcac ctgaatattc ttttagattt aatgataatt gtatgaatga atttattcaa gatcctgctc ttacattaat gcatgaatta atacattcat tacatggact atatggggct aaagggatta ctacaaagta tactataaca caaaaacaaa atcccctaat aacaaatata agaggtacaa atattgaaga attcttaact tttggaggta ctgatttaaa cattattact agtgctcagt ccaatgatat ctatactaat cttctagctg attataaaaa aatagcgtct aaacttagca aagtacaagt atctaatcca ctacttaatc cttataaaga tgtttttgaa gcaaagtatg gattagataa agatgctagc ggaatttatt cggtaaatat aaacaaattt aatgatattt ttaaaaaatt atacagcttt acggaatttg atttacgaac taaatttcaa gttaaatgta ggcaaactta tattggacag tataaatact tcaaactttc aaacttgtta aatgattcta tttataatat atcagaaggc tataatataa ataatttaaa ggtaaatttt agaggacaga atgcaaattt aaatcctaga attattacac caattacagg tagaggacta gtaaaaaaaa tcattagatt ttgtaaaaat attgtttctg taaaaggcat aaggaaatca atatgtatcg aaataaataa tggtgagtta ttttttgtgg cttccgagaa tagttataat gatgataata taaatactcc taaagaaatt gacgatacag taacttcaaa taataattat gaaaatgatt tagatcaggt tattttaaat tttaatagtg aatcagcacc tggactttca gatgaaaaat taaatttaac tatccaaaat gatgcttata taccaaaata tgattctaat ggaacaagtg atatagaaca acatgatgtt aatgaactta atgtattttt ctatttagat gcacagaaag tgcccgaagg tgaaaataat gtcaatctca cctcttcaat tgatacagca ttattagaac aacctaaaat atatacattt ttttcatcag aatttattaa taatgtcaat aaacctgtgc aagcagcatt atttgtaagc tggatacaac aagtgttagt agattttact actgaagcta accaaaaaag tactgttgat aaaattgcag atatttctat agttgttcca tatataggtc ttgctttaaa tataggaaat gaagcacaaa aaggaaattt taaagatgca cttgaattat taggagcagg tattttatta gaatttgaac ccgagctttt aattcctaca attttagtat tcacgataaa atctttttta ggttcatctg ataataaaaa taaagttatt aaagcaataa ataatgcatt gaaagaaaga gatgaaaaat ggaaagaagt atatagtttt atagtatcga attggatgac taaaattaat acacaattta ataaaagaaa agaacaaatg tatcaagctt tacaaaatca agtaaatgca attaaaacaa taatagaatc taagtataat agttatactt tagaggaaaa aaatgagctt acaaataaat atgatattaa gcaaatagaa aatgaactta atcaaaaggt ttctatagca atgaataata tagacaggtt cttaactgaa agttctatat cctatttaat gaaaataata aatgaagtaa aaattaataa attaagagaa tatgatgaga atgtcaaaac gtatttattg aattatatta tacaacatgg atcaatcttg ggagagagtc agcaagaact aaattctatg gtaactgata ccctaaataa tagtattcct tttaagcttt cttcttatac agatgataaa attttaattt catattttaa taaattcttt aagagaatta aaagtagttc agttttaaat atgagatata aaaatgataa atacgtagat acttcaggat atgattcaaa tataaatatt aatggagatg tatataaata tccaactaat aaaaatcaat ttggaatata taatgataaa cttagtgaag ttaatatatc tcaaaatgat tacattatat atgataataa atataaaaat tttagtatta gtttttgggt aagaattcct aactatgata ataagatagt aaatgttaat aatgaataca ctataataaa ttgtatgaga gataataatt caggatggaa agtatctctt aatcataatg aaataatttg gacattcgaa gataatcgag gaattaatca aaaattagca tttaactatg gtaacgcaaa tggtatttct gattatataa ataagtggat ttttgtaact ataactaatg atagattagg agattctaaa ctttatatta atggaaattt aatagatcaa aaatcaattt taaatttagg taatattcat gttagtgaca atatattatt taaaatagtt aattgtagtt atacaagata tattggtatt agatatttta atatttttga taaagaatta gatgaaacag aaattcaaac tttatatagc aatgaaccta atacaaatat tttgaaggat ttttggggaa attatttgct ttatgacaaa gaatactatt tattaaatgt gttaaaacca aataacttta ttgataggag aaaagattct actttaagca ttaataatat aagaagcact attcttttag ctaatagatt atatagtgga ataaaagtta aaatacaaag agttaataat agtagtacta acgataatct tgttagaaag aatgatcagg tatatattaa ttttgtagcc agcaaaactc acttatttcc attatatgct gatacagcta ccacaaataa agagaaaaca ataaaaatat catcatctgg caatagattt aatcaagtag tagttatgaa ttcagtagga aattgtacaa tgaattttaa aaataataat ggaaataata ttgggttgtt aggtttcaag gcagatactg tcgttgctag tacttggtat tatacacata tgagagatca tacaaacagc aatggatgtt tttggaactt tatttctgaa gaacatggat ggcaagaaaa ataaaaatta gattaaacgg ctaaagtcat aaattcc
The forward pnmer had the following nucleotide base sequence: CCCGGATCC CCA AAA ATT AAT AGT TTT AAT TAT AAT G SEQ ID NO: 11 where the BamHI endonuclease site is underlined and the sequence of the light chain minus the start codon is in bold. The inverse pnmer had the sequence: CCCCTGCAG tea TTT TTC TTG CCA TCC ATG TTC TTC
SEQ ED NO: 12 where the Pstl endonuclease site is underlined, the end of the coding region of the heavy chain is in bold, and the stop codon is in lower case. These pnmers were made using standard DNA synthesis methodology.
The two pnmers were used in a PCR reaction containing different amounts of Clostridium botulinum type E (strain beluga) chromosomal DNA. The PCR reaction employed a DNA polymerase with proofreading activity (Pfx DNA polymerase, obtained from Life Technology) in order to avoid sequence errors in the amplified gene. The amplification reaction conditions were as follows. 30 cycles of: a 45 second denaturation at 95 °C, followed by a 45 second annealing step at 56 °C. followed by a pnmer extension reaction for 3 minutes 48 seconds at 68 °C.
The PCR product was digested with BamHI and Hindffl, and the digest subjected to agarose gel electrophoresis. Staining of the agarose gel with ethidium bromide revealed a major DNA fragment of approximately 3.5 kilobases (see Fig. 10). The band containing this frangment was excised from the gel. and the DNA puπfied from the agarose and hgated to BamHI and
Hindlll-cut pQE30 vector (Qiagen). The resulting hgated plasmid was used to transform E. coli strain JM 109 as descnbed above, and the transformants plated onto selective LB agar plates. Several clones were recovered and the presence of the coπect BoNT/E DNA insert checked by restπction digest. The resultant construct contains the BoNT E gene (minus the first mefhionine) fused to the Hιs6 tag of the pQE30 vector, and contains 2 extra amino acid residues (glycine, seπne), which are contπbuted by the engineered BamHI site
Example 1 1
Construction Of A Proteolytically-Inactive Mutant Of BoNT E By Site Directed Mutagenesis
By mutating the glutamic acid at position 212 (within the active site) of the BoNT/E polypeptide construct to glutamine, a proteolytically-inactive and non-toxic single chain BoNT E polypeptide was obtained
The glutamine replacement was introduced on the forward pnmer using routine site directed mutagenesis methods The mutagenic DNA pnmer had the sequence cag TTA ATA CAT TCA TTA CAT GGA CTA TAT G
SEQ ED NO: 13 where the codon encoding glutamine at position 212 is indicated in small letters An inverse PCR reaction was performed using the above pnmer, along with the reverse pnmer
ATG CAT TAA TGT AAG AGC AGG ATC TT SEQ ID NO: 14 And Pfx DNA polymerase (Life Technology) as above. The PCR template was the wild-type single-chain BoNT/E construct (termed pQEESCwt). The cycling parameters (30 cycles) were as follows" 1) a 45 second denaturation step at 95 °C; 2) a 45 second annealing step at 56 °C; ,and 3) a 7 minute 10 second extension step at 68 °C.
At the end of the amplification reaction, the DNA template was digested by the restπction enzyme Dpnl to permit selection of mutated clones only. After subjecting the PCR product to agarose gel electrophoresis, a band of approximately 7 kilobases was removed and the DNA punfied and used for self- hgation in the presence of T4 DNA hgase (Promega) and polynucleotide kinase (Promega) to permit phosphorylation of the PCR product. The hgation mixture was used to transform E.coli strain DH10B, and the transformants plated onto selective agar plates. The presence of the correct plasmide construct was veπfied in several representative transformants by restπction digest and the mutation confirmed also by DNA sequencing Figure 1 1 shows the protocol for construction of the mutant BoNT E plasmid, and an ethidium bromide-stained agarose gel of the PCR reaction mixture (lanes 2 and 3) versus molecular weight markers (lane 1)
Example 12
Puπfication of Single Chain Recombinant BoNT/E
The presence of the histidine tag at the N-terminus of the expressed protein allowed a single-step puπfication of the recombinant neurotoxin by metal-affinity chromatography
The E. coli strain Ml 5 (Qiagen) was used for expression of the BoNT/E single-chain construct This strain carπes an endogenous plasmid (pREP4, kanamycin resistant) containing a region encoding the lac Iq repressor gene in order to prevent transcπption of the neurotoxin gene pnor to induction with IPTG. The pQE30 vector contain a T5 bactenophage RNA polymerase promoter, which is also recognized by E. coli RNA polymerase.
A colony of Ml 5 cells containing pQEESCwt was grown at 37°C overnight in 5 ml of 2TY medium containing 0.1 mg/ml ampicilhn; 0.025mg/ml kanamycin and 0.2% glucose (w/v), and the resultant culture used to inoculate 500 ml of the same medium. When this second culture reached an optical density of 0 5-0.8 at 600nm, IPTG was added to a final concentration of 0.3 mM and the culture incubated at 25°C overnight to permit expression of the neurotoxin.
Subsequent centnfugation of the culture yielded ~ 2.3 g of wet cell pellet which was resuspended in 10 ml of extraction buffer (20 mM Hepes pH 7.0, 300 mM NaCl, 5mM benzamidine, 2 μM pepstatin and 2 μM E-64). Lysozyme was added to a final concentration of 0.25 mg/ml, and the cell suspension incubated on ice for 60 minutes. Approximately 0.5 ml of glass beads (0.1 mm diameter from Biospec) was added to the cell suspension, followed by vortexing for 2 minutes to break the cells. Cell-free extracts was obtained by centnfugation at 10,000xg for 30 minutes at 4 °C. The supematant was incubated with 0.5 ml of Talon® cobalt metal affinity resin (Clontech) pre-washed with extraction buffer in a rocking platform for 45 minutes at 4°C. The resin was then loaded into a disposable chromatography column and washed twice with 10 bed volumes of wash buffer (20 mM Hepes pH 7 0, 300 mM NaCl, 2 mM lmidazole) before elut g the bound neurotoxin in 6 bed volumes of elution buffer (20 mM Hepes pH 7 0, 300 mM NaCl, 150 mM lmidazole)
The elute was dialyzed overnight at 4 °C against 10 M Hepes (pH 7 0) containing 150 mM NaCl and concentrated by centπfugal filtration (MW cutoff 10 KDa) to a final concentration of 1 mg/ml protein As shown in Figure 12, the punty of the affinity-punfied toxin was demonstrated by SDS-PAGE under reducing conditions, followed by Coomassie staining and Western-blotting, detecting the N-terminus with a mouse monoclonal anti-His antibody from Quiagen (diluted 2000 fold). Enhanced Chemilummescence solutions (Santa Cruz) and mouse secondary horseradish peroxidase (affinity punfied from Sigma) were used for detection of bound antibody. Approximately 2 μg of protein samples were loaded per well
Example 13 Trypsin activation of Punfied Recombinant BoNT E single-chain Polypeptide
Punfied BoNT/E single-chain neurotoxin polypeptide samples were activated by nicking the single chain with trypsin (1.5 μg/ml final concentration) for 60 minutes at a concentration of lmg tox /ml in 10 mm Hepes (pH 7.0), 150 mM NaCl Following the reaction, the trypsin was inactivated using 0.5 mM PMSF and 10 μg trypsin inhibitor/ml. The quality of the trypsinization was assessed and venfied by SDS-PAGE under both reducing and non-reducing conditions, then staining with Coomassie staining and Western blotting the polyacrylamide gel using a mouse monoclonal anti-His antibody (Quiagen, diluted 2000-fold) and a mouse monoclonal anti-Hc IgG (diluted 26-fold). As shown in Figure 13, the Commassie-stained nicked protein resolves into two bands under reducing conditions, while the heavy and light chains remain disulfide-hnked under non-reducing conditions, similar to the native toxin The antibody-detected recombinant heavy chain is of approximately identical size as its wild-type Clostndium counterpart, whereas the recombinant light chain migrates at a slightly higher molecular weight compared to the native protein This latter characteπstic is due to the extra residues provided by the Hιs6 tag at the N-terminus.
Example 14 Recombinant BoNT E is Proteolytically Active
Stock solutions (1 μM) of native nicked BoNT E toxin, un-nicked single- chain recombinant toxin, nicked di-chain recombinant toxin, and nicked mutant (E212Q) BoNT E were prepared in HEPES-buffered saline (HBS, 150 mM NaCl, 10 mM HEPES, pH 7.4. 10 μg/ml BSA). These samples were incubated for 30 minutes at 37°C in the absence or presence of 20 mM DTT, and then seπally diluted in 0.02 ml of HBS to the final concentrations shown in Figure 14.
A recombinant peptide containing amino acids 140-205 of SNAP-25 fused to glutathione-S-transferase (termed GST-SNAP-25 [ 140-205]) was used as a protease substrate to test the proteolytic activity of the recombinant BoNT/E polypeptides Ten micrograms this protease substrate was incubated with the toxin samples The digestion reaction was allowed to proceed for 30 minutes at 37°C in the absence or presence of 2 mM DTT, and stopped by addition of SDS- PAGE sample buffer followed by boiling for 5 minutes The resultant samples were analyzed by SDS-PAGE (3 μg of GST-
SNAP-25 [ 140-205] per lane) and silver staining As Figure 14 demonstrates, even unnicked recombinant single chain toxin retains proteolytic activity As expected, the mutant E212Q BoNT E construct has no detectable proteolytic activity Figure 14 shows only the GST-SNAP-25[ 140-205] bands
Example 15 Nicking makes Recombinant BoNT/E fully functional
Cerebellar neurons maintained for 10 days in culture (2xl06/22 mm diameter well) were washed with Krebs-Ringer HEPES (KRH) buffer, then exposed to the specified concentrations of BoNT/E native (• ), trypsin-nicked recombinant (O), or un-nicked single-chain (ψ) BoNT E. (See Fig 15). After 60 minutes at 37°C, the toxin-containing buffer was removed and the cells were washed twice, then incubated with KRH buffer containing 0.25 μCi/ml [14C]- labeled glutamine (i.e. the glutamate precursor). After 45 minutes, the latter medium was removed and the neurons were washed four times at 37°C pnor to assessment of transmitter glutamate release. Control and toxin-treated neurons were incubated for 5 minutes at 37°C in KRH buffer containing either 1.4 mM Ca2+ or 0.5 mM EGTA to assess Ca2+ -independent release, aliquots were then removed for determination of their [' C]-glutamate content (see below). Immediately after removal of the basal medium, KRH buffer containing
50 mM KC1 and either 1.4 mM Ca2+ or 0.5 mM EGTA was added; as before, aliquots were removed for [' C]-glutamate assay after a 5 minute stimulation peπod Finally, neurons were solubihzed with 20 mM EGTA.NaOH pH 7.5 containing 1% (w/v) SDS and aliquots were removed to determine the amounts of radioactivity remaining within the cells The amount of [l4C]-glutamate in each of the samples was assayed by scintillation counting and the levels released under basal and stimulated conditions were expressed as percentages relative to the calculated total cell content.
The percent [14C]-glutamate content in the EGTA-contaming buffer for each sample was subtracted from the values recorded in Ca"+-contaιnιng KRH samples in order to obtain the Ca"+-dependent component of release, and the latter basal readings were subtracted from values obtained for 50 mM KC1 samples to yield K+-evoked Ca2+-dependent release The values, thus, obtained from toxin-treated neurons are expressed relative to toxin-free controls
Figure 15 shows that, despite retaining proteolytic activity, the unnicked recombinant BoNT E has markedly less activity than either the native BoNT/E or the nicked recombinant version This finding may reflect the inability of the un-nicked toxin to adequately enter the target cell. Additionally, the nicked recombinant version appears to be more effective in inhibiting glutamate release than the native toxin
Example 16
Recombinant BoNT E has a Neuromuscular Paralytic Activity Equivalent to that of the Native Toxin at Mouse Neuromuscular Endplates- Nicking Increases Potency
Mouse phrenic-nerve hemi-diaphragms were bathed in KR supplemented with 0.1% BSA and saturated with 95% O2 / 5% CO2 The phrenic nerves were stimulated (0 2 Hz, 1 5 - 2 5 mV) and nerve evoked muscle tension was recorded before and after the addition of (Fig 16A) 0.2 nM recombinant nicked BoNT E (O)or 0.2 nM native BoNT E (D), and (Fig 16B) 1 nM recombinant un-nicked (O), 1 nM recombinant nicked (•) or 0 05 nM recombinant nicked (V) BoNT/E As shown in Figures 16A and 16B, the recombinant nicked BoNT/E is an effective paralytic agent, displaying greater activity in this assay that the native toxin The un-nicked toxin displays significantly lower activity than the nicked toxin in this assa> The neuromuscular paralytic activity of recombinant nicked BoNT/E was also demonstrated in mice by lntra-muscular injection into hind-limb muscles This resulted in paralysis, as assessed by the toe spread reflex assay, with a pattern of symptoms typical of botulism.
The in vivo neurotoxicity of the nicked, recombinant neurotoxin was established, by injecting the toxin into mice, to have a specific neurotoxicity of less than 107 mouse LD50 units per mg.
Example 17
The BoNT E E212O Protease Inactive Mutant Antagonises BoNT/E-induced Neuroparalysis
A mouse phrenic-nerve hemi-diaphragm was exposed to 10 nM BoNT E E212Q in KR medium, the nerve was stimulated and evoked muscle tension was recorded As indicated by Figure 17, the BoNT E212Q mutant does not inhibit neurotransmission, as determined by its failure to reduce nerve-evoked muscle tension (O) To assess the ability of this non-toxic mutant to antagonise the activity of the native toxin, mouse phrenic-nerve hemi-diaphragms were bathed for 60 minutes at 4°C in MKR supplemented with 0.1 % BSA and saturated with 95 % O2/5% CO2, without (D) or with (&) the inclusion of 5 nM BoNT/E E212Q. Native nicked BoNT/E was added to each bath (0.05 nM final) and the tissues were incubated for a further 30 min The nerve-muscles were then washed three times each with MKR followed by KR, before the temperature was raised to 37°C, the nerve stimulated and evoked muscle tension recorded
As shown in Figure 17. the onset of native BoNT E activity in this assay was delayed and antagonized when the phrenic-nerve hemi-diaphragms are preincubated with the E212Q protease inactive mutant, thereby indicating that the recombinant mutant faithfully binds to the same cell surface receptor as does the native toxin. Thus, the methods of the present patent application can be used to produce recombinant and modified toxins having fully functional receptor binding domains, and BoNT-related transported molecules for the intracellular delivery of therapeutic agents.
Those of skill in the art will understand that the Examples provided herein descnbe preferred compositions and methods, and that a vanety of different cloning strategies, protease cleavage sites, and specific binding complex members may be employed in the practice and use of the present invention while remaining within the invention's scope. Additionally, different dichain or binary toxin molecules and modified versions thereof (for example, BoNT/B-E and modified vaπants thereof) may be used as the basis for the methods and compositions of the present invention.

Claims

What is claimed is-
1. An isolated single-chain polypeptide compnsing: a) a first amino acid sequence region compnsing a first domain compnsing a binding element able to specifically bind a target cell surface marker under physiological conditions; and n) a second domain compnsing a translocation element able to facilitate the transfer of a polypeptide across a vesicular membrane; and b) a second amino acid sequence region compnsing a therapeutic element having biological activity when released into the cytoplasm of the target cell, wherein said first and second amino acid sequence regions are separated by a third amino acid sequence region compnsing a protease cleavage site which is cleaved when exposed to a protease, provided that said protease is not normally expressed by a cell expressing said single-chain polypeptide
-> The polypeptide of claim 1 wherein said first amino acid sequence region compnses at least a portion of a clostπdial neurotoxin H chain
3 The polypeptide of claim 2 wherein said portion of the clostndial neurotoxin H chain is denved from the neurotoxin heavy chain of C botulinum subtype A.
. The polypeptide of claim 2 wherein said second amino acid sequence region compnses at least a portion of a clostndial neurotoxin L chain.
5. The polypeptide of claim 4 wherein said portion of the clostndial neurotoxin L chain is deπved from that obtained from one of C. botulinum subtype A, B or E.
6 The polypeptide of claim 2 wherein said portion of the clostndial neurotoxin H chain is denved from that obtained from C. tetani.
7 The polypeptide of claim 2 wherein said portion of the clostndial neurotoxin H chain is denved from the neurotoxin heavy chain of an organism selected from the group consisting of C. botulinum subtype B, C. botulinum subtype C, C. botulinum subtype D, C botulinum subtype
E, C. botulinum subtype F, C. botulinum subtype G, C. baratu; and C. bun ricum
8 The polypeptide of claim 1 wherein said first domain compnses a binding element able to bind the surface of pancreatic acinar cells
9 The polypeptide of claim 8 wherein said second domain compnses a clostndial neurotoxin L chain
10 The polypeptide of claim 1 wherein said binding element specifically binds a target cell surface marker of a sensory afferent neuron
1. The polypeptide of any one of claims 1-10 wherein said protease cleavage site is cleaved by a protease selected from the group consisting of: a) A non-human enterokinase; b) tobacco etch virus protease; c) a protease deπved from Bacillus subtilus; d) a protease deπved from Bacillus amyliquifaciens; e) a protease deπved from a rhino virus, 0 papain, g) an insect papain homolog and h) a crustacian papain homolog.
2 The polypeptide of claim 1 wherein said protease cleavage site compnses an amino acid sequence selected from the group consisting of a) DDDDK; b) EXXYXQS/G, c) HY, d) YH, and e) LEVLFQGP, wherein X = any amino acid
3 The polypeptide of claim 1 or claim 1 1 further compnsing a binding tag
14 The polypeptide of claim 13 wherein said binding tag compnses a target- binding portion of a polypeptide selected from the group consisting of
Hιs6, monoclonal antibodies, maltose binding protein, glutathione-S- transferase, protein A, and calmoduhn binding protein. The polypeptide of claim 1 wherein said first amino acid sequence region compnses at least a portion of a heavy chain deπved from a first clostπdial neurotoxin subtype and said second amino acid sequence region compnses at least a portion of a light chain deπved from a second clostπdial neurotoxin subtype, wherein said first and second clostndial neurotoxin subtypes are not the same
The polypeptide of claim 15 wherein said heavy chain portion is from a heavy chain selected from the group consisting of HCA HCn HCci ,
HCD. HCE, HCF and HCG and said light chain portion is from a light chain selected from the group consisting of LCA LCB LCci , LCD, LCE, LCF LCG , and wherein said heavy and light chain portions hare from different clostndial neurotoxin subtypes
The polypeptide of claim 16 wherein at least one of said heavy and light chain portions compnse less than the entire heavy or light chain from said clostndial neurotoxin subtype, respectively
The polypeptide of claim 16 wherein at least one of said heavy and light chain portions compnses the entire heavy or light chain from said clostndial neurotoxin subtype, respectively.
The polypeptide of any of claims 1 , 2, 8, 10 or 15 wherein said first or second amino acid sequence region is modified to eliminate at least one amino acid sequence specifically cleaved by a protease 0 A plasmid having a nucleic acid sequence region compnsing an open reading frame encoding a cleavable single-chain polypeptide, said open reading frame compnsing: a) a first nucleotide sequence region compnsing l) a first portion encoding a first amino acid sequence region compnsing a binding element able to specifically bind a target cell surface marker under physiological conditions; and in) a second portion encoding a second amino acid sequence region compnsing a translocation element able to facilitate the transfer of a polypeptide across a vesicular membrane; b) a second nucleotide sequence region encoding a third amino acid sequence region compnsing a therapeutic element having biological activity when released into the cytoplasm of the target cell, and wherein said first and second nucleotide sequence regions are separated by a third nucleotide sequence region encoding a fourth amino acid sequence compnsing a protease cleavage site which is cleaved when exposed to a protease, provided said protease is not normally expressed by a cell expressing said single-chain polypeptide, and wherein said single-chain polypeptide is expressed by said plasmid within a suitable host cell
21 The plasmid of claim 20 wherein said first or second nucleotide sequence region further encodes an ammo acid sequence region compnsing a binding tag
22 The plasmid of claim 21 wherein said binding tag compnses a target- binding portion of a polypeptide selected from the group consisting of Hιs6, monoclonal antibodies, maltose binding protein, glutathione-S- transferase, protein A, and calmoduhn binding protein.
23. The plasmid of claim 20 wherein said first nucleotide sequence region encodes at least a portion of a clostndial neurotoxin heavy chain.
24 The plasmid of claim 23 wherein said first nucleotide sequence region encodes at least a portion of a Clostridium botulinum neurotoxin heavy chain
25. The plasmid of claim 23 wherein said first nucleotide sequence region encodes at least a portion of a Clostridium tetani neurotoxin heavy chain.
26 The plasmid of either of claims 20 or 23 wherein said second nucleotide sequence region encodes at least a portion of a clostndial neurotoxin light chain
27 The plasmid of claim 26 wherein said second nucleotide sequence region encodes at least a portion of a Clostridium botulinum neurotoxin light chain
28 The plasmid of claim 26 wherein said second nucleotide sequence region encodes at least a portion of a Clostridium tetani neurotoxin light chain
9. The plasmid of claim 20 wherein said first nucleotide sequence region encodes a binding element which will specifically bind a cell type other than a motor neuron
0 The plasmid of claim 29 wherein said first nucleotide sequence region encodes a binding element that will specifically bind a cell type selected from the group consisting of a pancreatic acinar cell and a sensory afferent neuron
1 The plasmid of claim 20 wherein said second nucleotide sequence region encodes a therapeutic element other than a clostndial neurotoxin light chain.
2 A method of making a single-chain polypeptide deπved from a clostndial neurotoxin compnsing a) inserting the plasmid of any one of claims 20-31 into a suitable host cell, b) growing said host cell in culture, and c) permitting or inducing the host cell to express the single chain polypeptide encoded by said plasmid
33 A method of punfying the recombinant single chain polypeptide of claim 13 compnsing the steps lysing a cell expressing said single chain polypeptide to produce a cell lysate, and contacting said cell lysate with a target compound so as to form a specific binding complex capable of being immobilized compnsing said binding tag and said target compound.
4 An isolated single-chain polypeptide compnsing a) a first amino acid sequence region compnsing
0 a first domain compnsing a binding element able to specifically bind a target cell surface marker under physiological conditions, and n) a second domain compnsing a translocation element able to facilitate the transfer of a polypeptide across a vesicular membrane; and b) a second amino acid sequence region compnsing a therapeutic element having biological activity when released into the cytoplasm of the target cell, wherein said first and second amino acid sequence regions are separated by a third amino acid sequence region compnsing the interchain loop region of a BoNT E neurotoxin
PCT/US2000/023427 1999-08-25 2000-08-25 Activatable recombinant neurotoxins Ceased WO2001014570A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
AU75731/00A AU777556B2 (en) 1999-08-25 2000-08-25 Activatable recombinant neurotoxins
JP2001518882A JP2003507073A (en) 1999-08-25 2000-08-25 Activable recombinant neurotoxin
EP00964920A EP1206554B2 (en) 1999-08-25 2000-08-25 Activatable recombinant neurotoxins
CA002380457A CA2380457A1 (en) 1999-08-25 2000-08-25 Activatable recombinant neurotoxins
DE60032367T DE60032367T3 (en) 1999-08-25 2000-08-25 ACTIVE RECOMBINANT NEUROTOXINE
BR0012759-0A BR0012759A (en) 1999-08-25 2000-08-25 Activable recombinant neurotoxins
KR1020027002270A KR100876060B1 (en) 1999-08-25 2000-08-25 Activatable Recombinant Neurotoxins
HK02107594.3A HK1046020B (en) 1999-08-25 2000-08-25 Activatable recombinant neurotoxins

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US15071099P 1999-08-25 1999-08-25
US60/150,710 1999-08-25

Publications (1)

Publication Number Publication Date
WO2001014570A1 true WO2001014570A1 (en) 2001-03-01

Family

ID=22535688

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/023427 Ceased WO2001014570A1 (en) 1999-08-25 2000-08-25 Activatable recombinant neurotoxins

Country Status (13)

Country Link
US (16) US7132259B1 (en)
EP (6) EP1206554B2 (en)
JP (1) JP2003507073A (en)
KR (1) KR100876060B1 (en)
CN (1) CN1214114C (en)
AT (1) ATE348178T1 (en)
AU (1) AU777556B2 (en)
BR (1) BR0012759A (en)
CA (1) CA2380457A1 (en)
DE (1) DE60032367T3 (en)
ES (1) ES2277854T5 (en)
HK (1) HK1046020B (en)
WO (1) WO2001014570A1 (en)

Cited By (57)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001021213A3 (en) * 1999-09-23 2002-07-11 Microbiological Res Authority Inhibition of secretion from non-neuronal cells
WO2002089834A1 (en) * 2001-05-04 2002-11-14 Imperial College Innovations Limited Bont/e or snap-25e for treating botulinum toxin a or c1 poisoning and inhibiting muscle contraction
WO2002044199A3 (en) * 2000-11-29 2003-11-06 Allergan Inc Neurotoxins with enhanced target specificity
WO2004024909A3 (en) * 2002-09-12 2004-07-08 Health Prot Agency Recombinant colstridium neurotoxin fragments
WO2006101809A1 (en) * 2005-03-15 2006-09-28 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems
WO2006076902A3 (en) * 2005-01-21 2006-11-02 Biotecon Therapeutics Gmbh Recombinant expression of proteins in a disulfide-bridged, two-chain form
EP1824971A2 (en) 2004-11-22 2007-08-29 New York University Genetically engineered clostridial genes, proteins encoded by the engineered genes, and uses thereof
WO2007106115A1 (en) * 2006-03-14 2007-09-20 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
WO2008008805A2 (en) 2006-07-11 2008-01-17 Allergan, Inc. Modified clostridial toxins with enhanced translocation capabilities and altered targeting activity for non-clostridial toxin target cells
US7419676B2 (en) 1999-08-25 2008-09-02 Allergan, Inc. Activatable recombinant neurotoxins
EP1982996A1 (en) 2004-09-01 2008-10-22 Allergan, Inc. Degradable clostridial toxins
US7514088B2 (en) 2005-03-15 2009-04-07 Allergan, Inc. Multivalent Clostridial toxin derivatives and methods of their use
US7556817B2 (en) * 2005-09-19 2009-07-07 Allergan, Inc. Clostridial toxin activatable Clostridial toxins
US7658933B2 (en) 2004-12-01 2010-02-09 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US7659092B2 (en) 2004-12-01 2010-02-09 Syntaxin, Ltd. Fusion proteins
US7674470B2 (en) 1996-08-23 2010-03-09 Health Protection Agency Recombinant toxin fragments
US7740868B2 (en) 1999-08-25 2010-06-22 Allergan, Inc. Activatable clostridial toxins
WO2010089120A1 (en) 2009-02-05 2010-08-12 Merz Pharma Gmbh & Co. Kgaa Novel method for the manufacturing of neurotoxins
WO2010105236A1 (en) 2009-03-13 2010-09-16 Allergan, Inc. Immuno-based retargeted endopeptidase activity assays
WO2011020052A1 (en) * 2009-08-14 2011-02-17 Allergan, Inc. Methods of treating cancer using opioid retargeted endpeptidases
US20110070212A1 (en) * 2009-08-14 2011-03-24 Allergan, Inc. Methods of Treating Cancer Using Glucagon-Like Hormone Retargeted Endopeptidases
US8012491B2 (en) 1996-08-23 2011-09-06 Syntaxin, Ltd. Recombinant toxin fragments
US8021859B2 (en) 2005-03-15 2011-09-20 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
WO2011142783A2 (en) 2009-12-16 2011-11-17 Allergan, Inc. Modified clostridial toxins comprising an integrated protease cleavage site-binding domain
US8124405B2 (en) 2004-12-01 2012-02-28 Syntaxin Limited Fusion proteins
WO2012048246A1 (en) 2010-10-08 2012-04-12 Allergan, Inc. Reduction of antibody response against botulinum neurotoxin and variants thereof
EP2046375A4 (en) * 2006-07-20 2012-06-13 Gen Hospital Corp METHODS, COMPOSITIONS, AND KITS FOR SELECTIVE ACTIVATION OF PROTOXINS BY COMBINATION TARGETING
US8399400B2 (en) 2004-12-01 2013-03-19 Syntaxin, Ltd. Fusion proteins
US20130116191A1 (en) * 2004-09-06 2013-05-09 Toxogen Gmbh Transport protein which is used to introduce chemical compounds into nerve cells
WO2013091895A1 (en) 2011-12-23 2013-06-27 Merz Pharma Gmbh & Co. Kgaa Novel method for the manufacturing of di-chain proteins for use in humans
US8512984B2 (en) 2004-12-01 2013-08-20 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US20130315888A1 (en) * 2005-04-26 2013-11-28 Syntaxin Limited Carrier for targeting nerve cells
US8603779B2 (en) 2004-12-01 2013-12-10 Syntaxin, Ltd. Non-cytotoxic protein conjugates
WO2014053651A1 (en) 2012-10-04 2014-04-10 Dublin City University Biotherapy for pain
US8778634B2 (en) 2004-12-01 2014-07-15 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8796216B2 (en) 2008-06-12 2014-08-05 Syntaxin Limited Suppression of neuroendocrine diseases
WO2015132004A1 (en) 2014-03-05 2015-09-11 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US9216210B2 (en) * 2013-12-23 2015-12-22 Dublin City University Multiprotease therapeutics for chronic pain
US9315549B2 (en) 2013-01-28 2016-04-19 New York University Treatment methods using atoxic neurotoxin derivatives
WO2016198163A1 (en) 2015-06-11 2016-12-15 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
WO2017125487A1 (en) 2016-01-20 2017-07-27 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US9849163B2 (en) 2009-02-23 2017-12-26 Ipsen Bioinnovation Limited Modified non-cytotoxic proteases
EP3263710A1 (en) 2016-07-01 2018-01-03 Ipsen Biopharm Limited Production of activated clostridial neurotoxins
EP3290437A1 (en) 2016-08-31 2018-03-07 Merz Pharma GmbH & Co. KGaA Novel recombinant clostridial neurotoxins with decreased duration of effect
EP3312193A1 (en) 2016-10-19 2018-04-25 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum neurotoxins with accelerated onset of effect
EP3333179A1 (en) 2016-12-07 2018-06-13 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum toxin with accelarated onset of effect
EP3335719A1 (en) 2016-12-14 2018-06-20 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum neurotoxins with a stabilized light chain
US10030238B2 (en) 2012-10-31 2018-07-24 Ipsen Bioinnovation Limited Recombinant clostridium botulinum neurotoxins
WO2018233813A1 (en) 2017-06-20 2018-12-27 Merz Pharma Gmbh & Co. Kgaa NOVEL RECOMBINANT BOTULINUM TOXINS WITH INCREASED DURATION
WO2019007509A1 (en) 2017-07-06 2019-01-10 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum neurotoxins with increased duration of effect
WO2019081022A1 (en) 2017-10-26 2019-05-02 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum neurotoxins with increased duration of effect
WO2019101308A1 (en) 2017-11-22 2019-05-31 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum toxin with increased duration of effect
US10900955B2 (en) 2014-12-19 2021-01-26 Merz Pharma Gmbh & Co. Kgaa Means and methods for the determination of the biological activity of BoNT/E in cells
US11104892B2 (en) 2015-08-27 2021-08-31 President And Fellows Of Harvard College Compositions and methods for treatment of pain
WO2023105289A1 (en) 2021-12-06 2023-06-15 Dublin City University Methods and compositions for the treatment of pain
US11897921B2 (en) 2014-12-09 2024-02-13 New York University Propeptide fusion comprising a mutated clostridium botulinum neurotoxin and a VHH domain
US11969461B2 (en) 2016-03-02 2024-04-30 Merz Pharma Gmbh & Co. Kgaa Composition comprising botulinum toxin

Families Citing this family (159)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8790897B2 (en) * 1998-08-25 2014-07-29 Syntaxin Ltd. Treatment of mucus hypersecretion
US20040071736A1 (en) * 1998-08-25 2004-04-15 Health Protection Agency Methods and compounds for the treatment of mucus hypersecretion
US20090018081A1 (en) * 1999-08-25 2009-01-15 Allergan, Inc. Activatable clostridial toxins
US20080032931A1 (en) * 1999-08-25 2008-02-07 Steward Lance E Activatable clostridial toxins
US7138127B1 (en) * 2000-01-19 2006-11-21 Allergan, Inc. Clostridial toxin derivatives and methods for treating pain
US7374896B2 (en) * 2001-08-28 2008-05-20 Allergan, Inc. GFP-SNAP25 fluorescence release assay for botulinum neurotoxin protease activity
US8022172B2 (en) * 2001-08-28 2011-09-20 Allergan, Inc. Luminescence resonance energy transfer (LRET) assays for clostridial toxin activity
US7332567B2 (en) * 2001-08-28 2008-02-19 Allergan, Inc. Fret protease assays for clostridial toxins
US7022329B2 (en) * 2002-02-25 2006-04-04 Allergan, Inc. Method for treating neurogenic inflammation pain with botulinum toxin and substance P components
EP1531859A4 (en) * 2002-05-31 2005-12-07 Univ Jefferson COMPOSITIONS AND METHODS FOR TRANSEPITHELIAL MOLECULAR TRANSPORT
US20090123468A1 (en) 2003-10-24 2009-05-14 Gencia Corporation Transducible polypeptides for modifying metabolism
US8062891B2 (en) 2003-10-24 2011-11-22 Gencia Corporation Nonviral vectors for delivering polynucleotides to plants
US8133733B2 (en) 2003-10-24 2012-03-13 Gencia Corporation Nonviral vectors for delivering polynucleotides to target tissues
US8507277B2 (en) 2003-10-24 2013-08-13 Gencia Corporation Nonviral vectors for delivering polynucleotides
CA2543257C (en) 2003-10-24 2013-12-31 Gencia Corporation Methods and compositions for delivering polynucleotides
US7811584B2 (en) * 2004-06-30 2010-10-12 Allergan, Inc. Multivalent clostridial toxins
US8168206B1 (en) 2005-10-06 2012-05-01 Allergan, Inc. Animal protein-free pharmaceutical compositions
GB0610867D0 (en) * 2006-06-01 2006-07-12 Syntaxin Ltd Treatment of pain
AU2007272515B2 (en) * 2006-07-11 2013-09-26 Allergan, Inc. Modified clostridial toxins with enhanced translocation capabilities and altered targeting activity for clostridial toxin target cells
AU2007347781B2 (en) * 2006-07-11 2013-10-03 Allergan, Inc. Modified clostridial toxins with enhanced translocation capability and enhanced targeting activity
WO2011039584A2 (en) * 2009-10-01 2011-04-07 Nikos Tsopanoglou Peptides
AU2008316989A1 (en) * 2007-10-23 2009-04-30 Allergan, Inc. Methods of treating urogenital-neurological disorders using modified clostridial toxins
CA2703364A1 (en) * 2007-10-23 2009-04-30 Allergan, Inc. Methods of treating chronic neurogenic inflammation using modified clostridial toxins
WO2009114748A1 (en) 2008-03-14 2009-09-17 Allergan, Inc. Immuno-based botulinum toxin serotype a activity assays
KR101604515B1 (en) * 2008-03-14 2016-03-17 알러간, 인코포레이티드 Immuno-Based Botulinum Toxin Serotype A Activity Assays
EP2719392B1 (en) * 2008-06-12 2019-07-24 Ipsen Bioinnovation Limited Fusion proteins for use in the treatment of acromegaly
US20100034854A1 (en) * 2008-08-05 2010-02-11 Solstice Neurosciences, Inc. Compositions of activated botulinum holotoxin type B (150 KD)
EP2315598A1 (en) * 2008-08-05 2011-05-04 Solstice Neurosciences, Inc. Compositions of activated botulinum toxin type b
US20100112006A1 (en) * 2008-11-03 2010-05-06 Solstice Neurosciences, Inc. Compositions of activated botulinum holotoxin type B (150 kD)
US20100112005A1 (en) * 2008-11-03 2010-05-06 Solstice Neurosciences, Inc. Compositions of activated botulinum toxin type B
AU2009339292B2 (en) 2008-12-10 2016-01-21 Allergan, Inc. Clostridial toxin pharmaceutical compositions
EP2202518A1 (en) 2008-12-19 2010-06-30 Merz Pharma GmbH & Co.KGaA In vivo assay for quantifying clostridial neurotoxin activity
US9492505B2 (en) 2009-01-21 2016-11-15 University Of Florida Research Foundation, Inc. Satiation peptide administration
BRPI1008940A2 (en) 2009-03-13 2020-10-27 Allergan, Inc. established clonal cell line susceptible to bont / a poisoning
ES2647243T3 (en) * 2009-04-27 2017-12-20 Merz Pharma Gmbh & Co. Kgaa Means and methods for determining the amount of Neurotoxin polypeptide and its catalytic and proteolytic activities
AU2010282289A1 (en) * 2009-08-14 2012-03-15 Allergan, Inc. Methods of treating cancer using galanin retargeted endpeptidases
WO2011041779A1 (en) 2009-10-02 2011-04-07 Allergan, Inc. In vitro method of determining changes in a protein environment
ES2576059T3 (en) 2010-01-22 2016-07-05 Merz Pharma Gmbh & Co. Kgaa In vitro assay to quantify clostridial neurotoxin activity
NZ601472A (en) 2010-01-25 2013-08-30 Allergan Inc Methods of intracellular conversion of single-chain proteins into their di-chain form
WO2011091419A2 (en) * 2010-01-25 2011-07-28 New York Universiy Recombinant derivatives of botulinum neurotoxins engineered for trafficking studies and neuronal delivery
US8989186B2 (en) 2010-06-08 2015-03-24 Brocade Communication Systems, Inc. Virtual port grouping for virtual cluster switching
US9716672B2 (en) 2010-05-28 2017-07-25 Brocade Communications Systems, Inc. Distributed configuration management for virtual cluster switching
US9461840B2 (en) 2010-06-02 2016-10-04 Brocade Communications Systems, Inc. Port profile management for virtual cluster switching
US9270486B2 (en) 2010-06-07 2016-02-23 Brocade Communications Systems, Inc. Name services for virtual cluster switching
US9001824B2 (en) 2010-05-18 2015-04-07 Brocade Communication Systems, Inc. Fabric formation for virtual cluster switching
US8867552B2 (en) 2010-05-03 2014-10-21 Brocade Communications Systems, Inc. Virtual cluster switching
JP6148979B2 (en) 2010-05-20 2017-06-14 アラーガン、インコーポレイテッドAllergan,Incorporated Degradable clostridial toxin
US9628293B2 (en) 2010-06-08 2017-04-18 Brocade Communications Systems, Inc. Network layer multicasting in trill networks
US9246703B2 (en) 2010-06-08 2016-01-26 Brocade Communications Systems, Inc. Remote port mirroring
US9608833B2 (en) 2010-06-08 2017-03-28 Brocade Communications Systems, Inc. Supporting multiple multicast trees in trill networks
US9807031B2 (en) 2010-07-16 2017-10-31 Brocade Communications Systems, Inc. System and method for network configuration
CA2807488A1 (en) * 2010-08-11 2012-02-16 Merz Pharma Gmbh & Co. Kgaa Selective manufacture of recombinant neurotoxin polypeptides
AU2011315962B2 (en) 2010-10-14 2016-06-02 Allergan, Inc. Targeted delivery of Targeted Exocytosis Modulators to the sphenopalatine ganglion for treatment of headache disorders
US20120207743A1 (en) * 2011-02-14 2012-08-16 Allergan, Inc. Inhibiting Aberrant Blood Vessel Formation Using Retargeted Endopeptidases
US20120207742A1 (en) 2011-02-14 2012-08-16 Allergan, Inc. Treatments Using PSMA Ligand Endopeptidases
US20120207734A1 (en) * 2011-02-14 2012-08-16 Allergan, Inc. Methods of Inhibiting Aberrant Blood Vessel Formation Using Opioid Retargeted Endpeptidases
US20120244188A1 (en) 2011-03-25 2012-09-27 Allergan, Inc. Treatment of Sensory Disturbance Disorders
US20120251575A1 (en) 2011-03-28 2012-10-04 Allergan, Inc. Endopeptidase Treatment of Involuntary Movement Disorders
US20120251573A1 (en) 2011-03-28 2012-10-04 Allergan, Inc. Endopeptidase Treatment of Neuroendocrine Disorders
US20120251574A1 (en) 2011-03-28 2012-10-04 Allergan, Inc. Endopeptidase and Neurotoxin Combination Treatment of Multiple Medical Conditions
US20120251518A1 (en) 2011-03-29 2012-10-04 Allergan, Inc. Endopeptidase Treatment of Sexual Dysfunction Disorders
WO2012135304A1 (en) 2011-03-29 2012-10-04 Allergan, Inc. Vagal nerve-based disorders
US20120251515A1 (en) 2011-03-29 2012-10-04 Allergan, Inc. Endopeptidase Treatment of Cosmesis Disorders
US20120251519A1 (en) 2011-03-29 2012-10-04 Allergan, Inc. Endopeptidase Treatment of Smooth Muscle Disorders
US9270572B2 (en) 2011-05-02 2016-02-23 Brocade Communications Systems Inc. Layer-3 support in TRILL networks
WO2012174123A1 (en) 2011-06-13 2012-12-20 Allergan, Inc. Treatment of psychological trauma
US9401861B2 (en) 2011-06-28 2016-07-26 Brocade Communications Systems, Inc. Scalable MAC address distribution in an Ethernet fabric switch
US8948056B2 (en) 2011-06-28 2015-02-03 Brocade Communication Systems, Inc. Spanning-tree based loop detection for an ethernet fabric switch
US9407533B2 (en) 2011-06-28 2016-08-02 Brocade Communications Systems, Inc. Multicast in a trill network
US8885641B2 (en) 2011-06-30 2014-11-11 Brocade Communication Systems, Inc. Efficient trill forwarding
US9736085B2 (en) 2011-08-29 2017-08-15 Brocade Communications Systems, Inc. End-to end lossless Ethernet in Ethernet fabric
US9699117B2 (en) 2011-11-08 2017-07-04 Brocade Communications Systems, Inc. Integrated fibre channel support in an ethernet fabric switch
US9450870B2 (en) 2011-11-10 2016-09-20 Brocade Communications Systems, Inc. System and method for flow management in software-defined networks
US20130171122A1 (en) 2011-12-29 2013-07-04 Allergan, Inc. Endopeptidase and neurotoxin combination treatment of bladder disorders
EP3279335B1 (en) 2011-12-31 2021-03-10 Allergan, Inc. Highly sensitive cell-based assay to detect the presence of active botulinum neurotoxin serotype-a
US8995272B2 (en) 2012-01-26 2015-03-31 Brocade Communication Systems, Inc. Link aggregation in software-defined networks
US9742693B2 (en) 2012-02-27 2017-08-22 Brocade Communications Systems, Inc. Dynamic service insertion in a fabric switch
US9154416B2 (en) 2012-03-22 2015-10-06 Brocade Communications Systems, Inc. Overlay tunnel in a fabric switch
US9374301B2 (en) 2012-05-18 2016-06-21 Brocade Communications Systems, Inc. Network feedback in software-defined networks
US10277464B2 (en) 2012-05-22 2019-04-30 Arris Enterprises Llc Client auto-configuration in a multi-switch link aggregation
EP2853066B1 (en) 2012-05-23 2017-02-22 Brocade Communications Systems, Inc. Layer-3 overlay gateways
US9602430B2 (en) 2012-08-21 2017-03-21 Brocade Communications Systems, Inc. Global VLANs for fabric switches
US20140056870A1 (en) 2012-08-27 2014-02-27 Allergan, Inc. Fusion proteins
US20140120077A1 (en) 2012-10-28 2014-05-01 Revance Therapeutics, Inc. Compositions and Methods for Safe Treatment of Rhinitis
US9401872B2 (en) 2012-11-16 2016-07-26 Brocade Communications Systems, Inc. Virtual link aggregations across multiple fabric switches
CA2880897C (en) 2012-11-21 2020-01-14 Ipsen Bioinnovation Limited Methods for the manufacture of proteolytically processed polypeptides
US20140170132A1 (en) 2012-12-18 2014-06-19 Allergan, Inc. Prophylatic treatment of herpes recurrence
US9548926B2 (en) 2013-01-11 2017-01-17 Brocade Communications Systems, Inc. Multicast traffic load balancing over virtual link aggregation
US9350680B2 (en) 2013-01-11 2016-05-24 Brocade Communications Systems, Inc. Protection switching over a virtual link aggregation
US9413691B2 (en) 2013-01-11 2016-08-09 Brocade Communications Systems, Inc. MAC address synchronization in a fabric switch
US9565113B2 (en) 2013-01-15 2017-02-07 Brocade Communications Systems, Inc. Adaptive link aggregation and virtual link aggregation
US9565099B2 (en) 2013-03-01 2017-02-07 Brocade Communications Systems, Inc. Spanning tree in fabric switches
WO2014145750A1 (en) 2013-03-15 2014-09-18 Brocade Communications Systems, Inc. Scalable gateways for a fabric switch
US9699001B2 (en) 2013-06-10 2017-07-04 Brocade Communications Systems, Inc. Scalable and segregated network virtualization
US9565028B2 (en) 2013-06-10 2017-02-07 Brocade Communications Systems, Inc. Ingress switch multicast distribution in a fabric switch
JP6608357B2 (en) 2013-06-28 2019-11-20 メルツ ファルマ ゲーエムベーハー ウント コンパニー カーゲーアーアー Means and methods for determining biological activity of neurotoxin polypeptides in cells
GB201312317D0 (en) 2013-07-09 2013-08-21 Syntaxin Ltd Cationic neurotoxins
US9806949B2 (en) 2013-09-06 2017-10-31 Brocade Communications Systems, Inc. Transparent interconnection of Ethernet fabric switches
US9912612B2 (en) 2013-10-28 2018-03-06 Brocade Communications Systems LLC Extended ethernet fabric switches
US9548873B2 (en) 2014-02-10 2017-01-17 Brocade Communications Systems, Inc. Virtual extensible LAN tunnel keepalives
US10581758B2 (en) 2014-03-19 2020-03-03 Avago Technologies International Sales Pte. Limited Distributed hot standby links for vLAG
US10476698B2 (en) 2014-03-20 2019-11-12 Avago Technologies International Sales Pte. Limited Redundent virtual link aggregation group
DK3137053T3 (en) 2014-04-30 2020-09-07 Allergan Inc FORMULATIONS OF BIOLOGICAL MEDICINES FOR INTRAVESICAL INSTALLATION
US10063473B2 (en) 2014-04-30 2018-08-28 Brocade Communications Systems LLC Method and system for facilitating switch virtualization in a network of interconnected switches
US9800471B2 (en) 2014-05-13 2017-10-24 Brocade Communications Systems, Inc. Network extension groups of global VLANs in a fabric switch
US11484580B2 (en) 2014-07-18 2022-11-01 Revance Therapeutics, Inc. Topical ocular preparation of botulinum toxin for use in ocular surface disease
US10616108B2 (en) 2014-07-29 2020-04-07 Avago Technologies International Sales Pte. Limited Scalable MAC address virtualization
US9544219B2 (en) 2014-07-31 2017-01-10 Brocade Communications Systems, Inc. Global VLAN services
RU2720991C2 (en) 2014-07-31 2020-05-15 Аллерган, Инк. Biopreparations compositions for intravesical instillation
US9807007B2 (en) 2014-08-11 2017-10-31 Brocade Communications Systems, Inc. Progressive MAC address learning
US9524173B2 (en) 2014-10-09 2016-12-20 Brocade Communications Systems, Inc. Fast reboot for a switch
US9699029B2 (en) 2014-10-10 2017-07-04 Brocade Communications Systems, Inc. Distributed configuration management in a switch group
US9628407B2 (en) 2014-12-31 2017-04-18 Brocade Communications Systems, Inc. Multiple software versions in a switch group
US9626255B2 (en) 2014-12-31 2017-04-18 Brocade Communications Systems, Inc. Online restoration of a switch snapshot
US9942097B2 (en) 2015-01-05 2018-04-10 Brocade Communications Systems LLC Power management in a network of interconnected switches
US10003552B2 (en) 2015-01-05 2018-06-19 Brocade Communications Systems, Llc. Distributed bidirectional forwarding detection protocol (D-BFD) for cluster of interconnected switches
PT3242884T (en) 2015-01-09 2021-04-22 Ipsen Bioinnovation Ltd Cationic neurotoxins
TWI704156B (en) * 2015-03-04 2020-09-11 德商曼茲法瑪股份有限公司 Methods for enhancing the specific uptake of botulinum neurotoxins into cells
US9807005B2 (en) 2015-03-17 2017-10-31 Brocade Communications Systems, Inc. Multi-fabric manager
US10038592B2 (en) 2015-03-17 2018-07-31 Brocade Communications Systems LLC Identifier assignment to a new switch in a switch group
US10579406B2 (en) 2015-04-08 2020-03-03 Avago Technologies International Sales Pte. Limited Dynamic orchestration of overlay tunnels
US10439929B2 (en) 2015-07-31 2019-10-08 Avago Technologies International Sales Pte. Limited Graceful recovery of a multicast-enabled switch
US10171303B2 (en) 2015-09-16 2019-01-01 Avago Technologies International Sales Pte. Limited IP-based interconnection of switches with a logical chassis
GB201517450D0 (en) 2015-10-02 2015-11-18 Ipsen Biopharm Ltd Method
US9912614B2 (en) 2015-12-07 2018-03-06 Brocade Communications Systems LLC Interconnection of switches based on hierarchical overlay tunneling
US11311633B2 (en) 2016-04-16 2022-04-26 University Of Florida Research Foundation, Incorporated Satiation peptides for weight loss and altered taste sensitivity
CN110072880B (en) * 2016-08-24 2025-02-18 哈佛大学校长及研究员协会 Engineered botulinum neurotoxin
IL308091B1 (en) 2016-09-13 2026-01-01 Allergan Inc Stabilized non-protein clostridial toxin compositions
US12098169B2 (en) * 2017-09-29 2024-09-24 Children's Medical Center Corporation Enterococcus faecium neurotoxin (BoNT/EN) and derivatives thereof
US11491239B2 (en) * 2017-12-15 2022-11-08 The Medical College Of Wisconsin, Inc. Modified clostridial neurotoxins as vaccines and conjugate vaccine platforms
CN112351991A (en) 2017-12-20 2021-02-09 阿勒根公司 Botulinum toxin cell binding domain polypeptides and methods for their use in treating fibrosis related disorders
WO2019243376A1 (en) 2018-06-18 2019-12-26 Ipsen Biopharm Limited Intramuscular injection of botulinum toxin for the treatment of vulvodynia
GB201815817D0 (en) 2018-09-28 2018-11-14 Ispen Biopharm Ltd Clostridial neurotoxins comprising and exogenous activation loop
GB201815844D0 (en) 2018-09-28 2018-11-14 Ipsen Biopharm Ltd Therapeutic & comestic uses of botulinum neurotoxin serotype e
SG11202102111SA (en) 2018-09-28 2021-04-29 Ipsen Biopharm Ltd Cell-based clostridal neurotoxin assays
GB201900621D0 (en) 2019-01-16 2019-03-06 Ipsen Biopharm Ltd Labelled polypeptides
GB201907016D0 (en) 2019-05-17 2019-07-03 Ipsen Biopharm Ltd Screening method to determine suitability for participation in a clinical trial
GB201914034D0 (en) 2019-09-30 2019-11-13 Ipsen Biopharm Ltd Treatment of neurological disorders
GB202001353D0 (en) 2020-01-31 2020-03-18 Ipsen Biopharm Ltd Treatment of skin conditions
US12344635B2 (en) 2020-03-24 2025-07-01 The Medical College Of Wisconsin, Inc. COVID-19 vaccine
GB202100566D0 (en) 2021-01-15 2021-03-03 Ipsen Biopharm Ltd Treatment of brain damage
CN114957482B (en) * 2021-02-26 2024-09-24 重庆誉颜制药有限公司 Single-chain polypeptide of modified neurotoxin and application thereof
GB202103372D0 (en) 2021-03-11 2021-04-28 Ipsen Biopharm Ltd Modified clostridial neurotoxins
GB202104294D0 (en) 2021-03-26 2021-05-12 Ipsen Biopharm Ltd Clostridial neurotoxins comprising an exogenous activation loop
AU2022247196A1 (en) 2021-03-30 2023-10-05 Ipsen Biopharm Limited Treatment of pain & inflammatory disorders
US20250066755A1 (en) 2021-03-30 2025-02-27 Ipsen Biopharm Limited Catalytically inactive clostridial neurotoxins for the treatment of pain & inflammatory disorders
GB202116795D0 (en) 2021-11-22 2022-01-05 Ipsen Biopharm Ltd Treatment of visceral pain
TWI852454B (en) * 2022-04-01 2024-08-11 大陸商重慶譽顏製藥有限公司 A botulinum toxin protein composition, preparation method and application thereof
CN116063535B (en) * 2022-09-14 2023-09-26 北京市疾病预防控制中心 Antibody or antigen binding fragment thereof, and preparation method and application thereof
GB202213479D0 (en) 2022-09-14 2022-10-26 Ipsen Biopharm Ltd Cell-free clostridial neurotoxin assays
GB202214229D0 (en) 2022-09-28 2022-11-09 Ipsen Biopharm Ltd Clostridial neurotoxins comprising an activating endosomal protease cleavage site
GB202214232D0 (en) 2022-09-28 2022-11-09 Ispen Biopharm Ltd Clostridial neurotoxins comprising an activating exogenous protease cleavage site
EP4593873A1 (en) 2022-09-30 2025-08-06 Ipsen Biopharm Limited Clostridial neurotoxin for use in a treatment of bladder pain syndrome
CN115819526A (en) * 2022-12-02 2023-03-21 海雅美生物技术(珠海)有限公司 Recombinant botulinum neurotoxin and preparation method and application thereof
CN119060198A (en) * 2023-05-31 2024-12-03 妍诗美社(海南)医美健康科技有限公司 Single-chain peptide activated at the time of use
CN119823215A (en) * 2023-10-13 2025-04-15 北京博特维克生物技术有限公司 Polypeptide for high-efficiency and rapid recombinant expression of neurotoxin protein and method thereof
GB202318884D0 (en) 2023-12-11 2024-01-24 Ipsen Biopharm Ltd Formulation
GB202320108D0 (en) 2023-12-28 2024-02-14 Ipsen Biopharm Ltd Biosensor
GB202404021D0 (en) 2024-03-20 2024-05-01 Ipsen Biopharm Ltd Cell-based neurotoxin assay

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995032738A1 (en) * 1994-05-31 1995-12-07 Allergan, Inc. Modification of clostridial toxins for use as transport proteins
WO1996033273A1 (en) * 1995-04-21 1996-10-24 The Speywood Laboratory Limited Botulinum toxin derivatives able to modify peripheral sensory afferent functions
WO1998007864A1 (en) * 1996-08-23 1998-02-26 Microbiological Research Authority Camr (Centre For Applied Microbiology & Research) Recombinant toxin fragments
US5939070A (en) * 1996-10-28 1999-08-17 Wisconsin Alumni Research Foundation Hybrid botulinal neurotoxins

Family Cites Families (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4800159A (en) 1986-02-07 1989-01-24 Cetus Corporation Process for amplifying, detecting, and/or cloning nucleic acid sequences
US5135736A (en) 1988-08-15 1992-08-04 Neorx Corporation Covalently-linked complexes and methods for enhanced cytotoxicity and imaging
US5919665A (en) 1989-10-31 1999-07-06 Ophidian Pharmaceuticals, Inc. Vaccine for clostridium botulinum neurotoxin
AU1350792A (en) * 1991-01-16 1992-08-27 General Hospital Corporation, The Human galanin
US7192596B2 (en) 1996-08-23 2007-03-20 The Health Protection Agency Ipsen Limited Recombinant toxin fragments
CA2296765A1 (en) 1996-08-28 1998-03-05 Ophidian Pharmaceuticals, Inc. Soluble recombinant botulinum toxin proteins
GB9721189D0 (en) * 1997-10-08 1997-12-03 Speywood Lab The Limited Analgesic conjugates
WO1999055359A1 (en) 1998-04-29 1999-11-04 Allergan Sales, Inc. Compositions and methods for extending the action of clostridial neurotoxin
GB9818548D0 (en) * 1998-08-25 1998-10-21 Microbiological Res Authority Treatment of mucas hypersecretion
US20040071736A1 (en) * 1998-08-25 2004-04-15 Health Protection Agency Methods and compounds for the treatment of mucus hypersecretion
WO2000023427A1 (en) 1998-10-20 2000-04-27 Basf Aktiengesellschaft Method for producing optionally substituted 1-methyl-6-haloalkyl uracils
US6776990B2 (en) * 1999-04-08 2004-08-17 Allergan, Inc. Methods and compositions for the treatment of pancreatitis
HK1046020B (en) 1999-08-25 2007-05-11 Allergan, Inc. Activatable recombinant neurotoxins
US7740868B2 (en) * 1999-08-25 2010-06-22 Allergan, Inc. Activatable clostridial toxins
US20080032931A1 (en) * 1999-08-25 2008-02-07 Steward Lance E Activatable clostridial toxins
US20030180289A1 (en) * 1999-09-23 2003-09-25 Foster Keith Alan Inhibition of secretion from non-neuronal cells
US6641820B1 (en) * 2000-01-19 2003-11-04 Allergan, Inc. Clostridial toxin derivatives and methods to treat pain
US6500436B2 (en) * 2000-01-19 2002-12-31 Allergan, Inc. Clostridial toxin derivatives and methods for treating pain
US7138127B1 (en) * 2000-01-19 2006-11-21 Allergan, Inc. Clostridial toxin derivatives and methods for treating pain
US6827931B1 (en) * 2000-10-20 2004-12-07 Allergan, Inc. Method for treating endocrine disorders
US6831059B2 (en) * 2000-10-20 2004-12-14 Allergan, Inc. Compositions and methods for treating gonadotrophin related illnesses
AU2003201811A1 (en) 2002-01-10 2003-07-30 Pharmacia & Upjohn Company Use of cox-2 inhibitors in combination with antiviral agents for the treatment of papilloma virus infections
GB0321344D0 (en) 2003-09-11 2003-10-15 Health Prot Agency Re-targeted toxin conjugates
US7811584B2 (en) * 2004-06-30 2010-10-12 Allergan, Inc. Multivalent clostridial toxins
US20060024331A1 (en) * 2004-08-02 2006-02-02 Ester Fernandez-Salas Toxin compounds with enhanced membrane translocation characteristics
DE102004043009A1 (en) 2004-09-06 2006-03-23 Toxogen Gmbh Transport protein for introducing chemical compounds into nerve cells
EP1830872B1 (en) 2004-12-01 2010-11-17 Health Protection Agency Fusion proteins
US7659092B2 (en) * 2004-12-01 2010-02-09 Syntaxin, Ltd. Fusion proteins
GB0426394D0 (en) * 2004-12-01 2005-01-05 Health Prot Agency Fusion proteins
GB0426397D0 (en) 2004-12-01 2005-01-05 Health Prot Agency Fusion proteins
WO2006059105A2 (en) 2004-12-01 2006-06-08 Health Protection Agency Non-cytotoxic Protein Conjugates
CA2601592A1 (en) * 2005-03-15 2006-09-28 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995032738A1 (en) * 1994-05-31 1995-12-07 Allergan, Inc. Modification of clostridial toxins for use as transport proteins
WO1996033273A1 (en) * 1995-04-21 1996-10-24 The Speywood Laboratory Limited Botulinum toxin derivatives able to modify peripheral sensory afferent functions
WO1998007864A1 (en) * 1996-08-23 1998-02-26 Microbiological Research Authority Camr (Centre For Applied Microbiology & Research) Recombinant toxin fragments
US5939070A (en) * 1996-10-28 1999-08-17 Wisconsin Alumni Research Foundation Hybrid botulinal neurotoxins

Cited By (127)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8454976B2 (en) 1996-08-23 2013-06-04 Syntaxin Limited Recombinant toxin fragments
US7674470B2 (en) 1996-08-23 2010-03-09 Health Protection Agency Recombinant toxin fragments
US7897158B2 (en) 1996-08-23 2011-03-01 Syntaxin, Ltd Recombinant toxin fragments
US8012479B2 (en) 1996-08-23 2011-09-06 Health Protection Agency Recombinant toxin fragments
US8012491B2 (en) 1996-08-23 2011-09-06 Syntaxin, Ltd. Recombinant toxin fragments
US8017134B2 (en) 1996-08-23 2011-09-13 Syntaxin Limited Recombinant toxin fragments
US7419676B2 (en) 1999-08-25 2008-09-02 Allergan, Inc. Activatable recombinant neurotoxins
US7985411B2 (en) 1999-08-25 2011-07-26 Allergan, Inc. Activatable recombinant neurotoxins
US8119370B2 (en) 1999-08-25 2012-02-21 Allergan, Inc. Activatable recombinant neurotoxins
US7749514B2 (en) 1999-08-25 2010-07-06 Allergan, Inc. Activatable clostridial toxins
US7740868B2 (en) 1999-08-25 2010-06-22 Allergan, Inc. Activatable clostridial toxins
US7709228B2 (en) 1999-08-25 2010-05-04 Allergan, Inc. Activatable recombinant neurotoxins
US8211671B2 (en) 1999-08-25 2012-07-03 Allergan, Inc. Activatable recombinant neurotoxins
US7959933B2 (en) 1999-08-25 2011-06-14 Allergan, Inc. Activatable recombinant neurotoxins
US7422877B2 (en) 1999-08-25 2008-09-09 Allergan, Inc. Activatable recombinant neurotoxins
US8003351B2 (en) 1999-08-25 2011-08-23 Allergan, Inc. Activatable recombinant neurotoxins
WO2001021213A3 (en) * 1999-09-23 2002-07-11 Microbiological Res Authority Inhibition of secretion from non-neuronal cells
WO2002044199A3 (en) * 2000-11-29 2003-11-06 Allergan Inc Neurotoxins with enhanced target specificity
US7456272B2 (en) 2000-11-29 2008-11-25 Allergan, Inc. Neurotoxins with enhanced target specificity
US7273722B2 (en) 2000-11-29 2007-09-25 Allergan, Inc. Neurotoxins with enhanced target specificity
US8309686B2 (en) 2000-11-29 2012-11-13 Allergan, Inc. Neurotoxins with enhanced target specificity
WO2002089834A1 (en) * 2001-05-04 2002-11-14 Imperial College Innovations Limited Bont/e or snap-25e for treating botulinum toxin a or c1 poisoning and inhibiting muscle contraction
US9006395B2 (en) 2002-09-12 2015-04-14 The Secretary Of State For Health Recombinant toxin fragments
EP2280066A3 (en) * 2002-09-12 2011-05-11 Health Protection Agency Recombinant clostridium neurotoxin fragments
JP2011045377A (en) * 2002-09-12 2011-03-10 Health Protection Agency Recombinant toxin fragment
WO2004024909A3 (en) * 2002-09-12 2004-07-08 Health Prot Agency Recombinant colstridium neurotoxin fragments
US20110028691A1 (en) * 2002-09-12 2011-02-03 The Health Protection Agency Recombinant toxin fragments
JP2005537809A (en) * 2002-09-12 2005-12-15 ヘルス プロテクション エージェンシー Recombinant toxin fragment
EP1982996A1 (en) 2004-09-01 2008-10-22 Allergan, Inc. Degradable clostridial toxins
EP1982997A1 (en) 2004-09-01 2008-10-22 Allergan, Inc. Degradable clostridial toxins
US9422344B2 (en) 2004-09-06 2016-08-23 Ipsen Bioinnovation Limited Transport protein which is used to introduce chemical compounds into nerve cells
US20130116191A1 (en) * 2004-09-06 2013-05-09 Toxogen Gmbh Transport protein which is used to introduce chemical compounds into nerve cells
US9234011B2 (en) * 2004-09-06 2016-01-12 Ipsen Bioinnovation Limited Transport protein which is used to introduce chemical compounds into nerve cells
EP1824971B1 (en) * 2004-11-22 2016-01-13 New York University Genetically engineered clostridial genes, proteins encoded by the engineered genes, and uses thereof
EP1824971A2 (en) 2004-11-22 2007-08-29 New York University Genetically engineered clostridial genes, proteins encoded by the engineered genes, and uses thereof
JP2008520252A (en) * 2004-11-22 2008-06-19 ニューヨーク・ユニバーシティ Genetically engineered clostridial genes, proteins encoded by the engineered genes, and uses thereof
US8865186B2 (en) * 2004-11-22 2014-10-21 New York University Genetically engineered clostridial genes, proteins encoded by the engineered genes, and uses thereof
US8778634B2 (en) 2004-12-01 2014-07-15 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8067200B2 (en) 2004-12-01 2011-11-29 Syntaxin Ltd. Fusion proteins
US7658933B2 (en) 2004-12-01 2010-02-09 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8399400B2 (en) 2004-12-01 2013-03-19 Syntaxin, Ltd. Fusion proteins
US7659092B2 (en) 2004-12-01 2010-02-09 Syntaxin, Ltd. Fusion proteins
US8399401B2 (en) 2004-12-01 2013-03-19 Syntaxin, Ltd. Fusion proteins
US9012195B2 (en) 2004-12-01 2015-04-21 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US9474807B2 (en) 2004-12-01 2016-10-25 Ipsen Bioinnovation Limited Non-cytotoxic protein conjugates
US10619146B2 (en) 2004-12-01 2020-04-14 Ipsen Bioinnovation Limited Non-cytotoxic protein conjugates
US8372615B2 (en) 2004-12-01 2013-02-12 Syntaxin, Limited Fusion proteins
US9139635B2 (en) 2004-12-01 2015-09-22 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8187834B2 (en) 2004-12-01 2012-05-29 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8603779B2 (en) 2004-12-01 2013-12-10 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8940870B2 (en) 2004-12-01 2015-01-27 Syntaxin, Ltd. Fusion proteins
US8512984B2 (en) 2004-12-01 2013-08-20 Syntaxin, Ltd. Non-cytotoxic protein conjugates
US8956847B2 (en) 2004-12-01 2015-02-17 Syntaxin Limited Fusion proteins
US8124405B2 (en) 2004-12-01 2012-02-28 Syntaxin Limited Fusion proteins
US8124074B2 (en) 2004-12-01 2012-02-28 Syntaxin Limited Fusion proteins
WO2006076902A3 (en) * 2005-01-21 2006-11-02 Biotecon Therapeutics Gmbh Recombinant expression of proteins in a disulfide-bridged, two-chain form
RU2412253C2 (en) * 2005-01-21 2011-02-20 Мерц Фарма Гмбх Унд Ко.Кгаа Recombinant protein expression in double-strand c form
US8128940B2 (en) 2005-03-15 2012-03-06 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems
EP2316847A3 (en) * 2005-03-15 2012-01-18 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems
US8052979B2 (en) 2005-03-15 2011-11-08 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
US8460682B2 (en) 2005-03-15 2013-06-11 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
WO2006099590A3 (en) * 2005-03-15 2007-03-15 Allergan Inc Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
WO2006101809A1 (en) * 2005-03-15 2006-09-28 Allergan, Inc. Modified clostridial toxins with enhanced targeting capabilities for endogenous clostridial toxin receptor systems
US8021859B2 (en) 2005-03-15 2011-09-20 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
US7514088B2 (en) 2005-03-15 2009-04-07 Allergan, Inc. Multivalent Clostridial toxin derivatives and methods of their use
US9650622B2 (en) 2005-04-26 2017-05-16 Ipsen Bioinnovation Limited Carrier for targeting nerve cells
US10266816B2 (en) 2005-04-26 2019-04-23 Ipsen Bioinnovation Limited Carrier for targeting nerve cells
US9115350B2 (en) * 2005-04-26 2015-08-25 Syntaxin Limited Carrier for targeting nerve cells
US20150038401A1 (en) * 2005-04-26 2015-02-05 Syntaxin Limited Carrier for targeting nerve cells
US20130315888A1 (en) * 2005-04-26 2013-11-28 Syntaxin Limited Carrier for targeting nerve cells
US10883096B2 (en) 2005-04-26 2021-01-05 Ipsen Bioinnovation Limited Carrier for targeting nerve cells
US7556817B2 (en) * 2005-09-19 2009-07-07 Allergan, Inc. Clostridial toxin activatable Clostridial toxins
EP2377881A2 (en) 2005-09-19 2011-10-19 Allergan, Inc. Clostridial toxin activatable clostridial toxins
EP2154151A2 (en) 2005-09-19 2010-02-17 Allergan, Inc. Clostridial toxin activatable clostridial toxins
US7815917B2 (en) 2005-09-19 2010-10-19 Allergan, Inc. Botulinum neurotoxin serotype B activatable Botulinum neurotoxin serotype Bs
EP1926744B2 (en) 2005-09-19 2018-10-24 Allergan, Inc. Clostridial toxin activatable clostridial toxins
WO2007106115A1 (en) * 2006-03-14 2007-09-20 Allergan, Inc. Modified clostridial toxins with altered targeting capabilities for clostridial toxin target cells
WO2008008805A2 (en) 2006-07-11 2008-01-17 Allergan, Inc. Modified clostridial toxins with enhanced translocation capabilities and altered targeting activity for non-clostridial toxin target cells
WO2008008805A3 (en) * 2006-07-11 2008-04-10 Allergan Inc Modified clostridial toxins with enhanced translocation capabilities and altered targeting activity for non-clostridial toxin target cells
EP2046375A4 (en) * 2006-07-20 2012-06-13 Gen Hospital Corp METHODS, COMPOSITIONS, AND KITS FOR SELECTIVE ACTIVATION OF PROTOXINS BY COMBINATION TARGETING
US8993295B2 (en) 2006-07-20 2015-03-31 The General Hospital Corporation Methods, compositions, and kits for the selective activation of protoxins through combinatorial targeting
US8796216B2 (en) 2008-06-12 2014-08-05 Syntaxin Limited Suppression of neuroendocrine diseases
EP2218783A1 (en) 2009-02-05 2010-08-18 Merz Pharma GmbH & Co. KGaA Novel method for the manufacturing of neurotoxins
WO2010089120A1 (en) 2009-02-05 2010-08-12 Merz Pharma Gmbh & Co. Kgaa Novel method for the manufacturing of neurotoxins
US10744190B2 (en) 2009-02-23 2020-08-18 Ipsen Bioinnovation Limited Method for suppressing spasmodic torticollis
US9849163B2 (en) 2009-02-23 2017-12-26 Ipsen Bioinnovation Limited Modified non-cytotoxic proteases
WO2010105236A1 (en) 2009-03-13 2010-09-16 Allergan, Inc. Immuno-based retargeted endopeptidase activity assays
EP2568285A1 (en) 2009-03-13 2013-03-13 Allergan, Inc. Immuno-based retargeted endopeptidase activity assays
EP3281953A1 (en) 2009-03-13 2018-02-14 Allergan, Inc. Immuno-based retargeted endopeptidase activity assays
EP2570809A1 (en) 2009-03-13 2013-03-20 Allergan, Inc. Immuno-based retargeted endopeptidase activity assays
WO2011020119A3 (en) * 2009-08-14 2011-06-09 Allergan, Inc. Methods of treating cancer using glucagon-like hormone retargeted endopeptidases
CN102574900A (en) * 2009-08-14 2012-07-11 阿勒根公司 Methods of treating cancer using opioid retargeted endpeptidases
US20110070212A1 (en) * 2009-08-14 2011-03-24 Allergan, Inc. Methods of Treating Cancer Using Glucagon-Like Hormone Retargeted Endopeptidases
WO2011020052A1 (en) * 2009-08-14 2011-02-17 Allergan, Inc. Methods of treating cancer using opioid retargeted endpeptidases
WO2011142783A2 (en) 2009-12-16 2011-11-17 Allergan, Inc. Modified clostridial toxins comprising an integrated protease cleavage site-binding domain
WO2012048246A1 (en) 2010-10-08 2012-04-12 Allergan, Inc. Reduction of antibody response against botulinum neurotoxin and variants thereof
WO2013091895A1 (en) 2011-12-23 2013-06-27 Merz Pharma Gmbh & Co. Kgaa Novel method for the manufacturing of di-chain proteins for use in humans
WO2014053651A1 (en) 2012-10-04 2014-04-10 Dublin City University Biotherapy for pain
US10030238B2 (en) 2012-10-31 2018-07-24 Ipsen Bioinnovation Limited Recombinant clostridium botulinum neurotoxins
US9315549B2 (en) 2013-01-28 2016-04-19 New York University Treatment methods using atoxic neurotoxin derivatives
US9216210B2 (en) * 2013-12-23 2015-12-22 Dublin City University Multiprotease therapeutics for chronic pain
US10457927B2 (en) 2013-12-23 2019-10-29 Dublin City University Multiprotease therapeutics for chronic pain
WO2015132004A1 (en) 2014-03-05 2015-09-11 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US11897921B2 (en) 2014-12-09 2024-02-13 New York University Propeptide fusion comprising a mutated clostridium botulinum neurotoxin and a VHH domain
US10900955B2 (en) 2014-12-19 2021-01-26 Merz Pharma Gmbh & Co. Kgaa Means and methods for the determination of the biological activity of BoNT/E in cells
US11874273B2 (en) 2014-12-19 2024-01-16 Merz Pharma Gmbh & Co. Kgaa Means and methods for the determination of the biological activity of BoNT/E in cells
US10603353B2 (en) 2015-06-11 2020-03-31 Merz Pharma Gmbh & Co. Kgaa Recombinant clostridial neurotoxins with increased duration of effect
US11357821B2 (en) 2015-06-11 2022-06-14 Merz Pharma Gmbh & Co. Kgaa Recombinant clostridial neurotoxins with increased duration of effect
WO2016198163A1 (en) 2015-06-11 2016-12-15 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US11753633B2 (en) 2015-08-27 2023-09-12 President And Fellows Of Harvard College Compositions and methods for treatment of pain
US11104892B2 (en) 2015-08-27 2021-08-31 President And Fellows Of Harvard College Compositions and methods for treatment of pain
WO2017125487A1 (en) 2016-01-20 2017-07-27 Merz Pharma Gmbh & Co. Kgaa Novel recombinant clostridial neurotoxins with increased duration of effect
US11969461B2 (en) 2016-03-02 2024-04-30 Merz Pharma Gmbh & Co. Kgaa Composition comprising botulinum toxin
WO2018002348A1 (en) 2016-07-01 2018-01-04 Ipsen Biopharm Limited Production of activated clostridial neurotoxins
EP3263710A1 (en) 2016-07-01 2018-01-03 Ipsen Biopharm Limited Production of activated clostridial neurotoxins
US11453903B2 (en) 2016-07-01 2022-09-27 Ipsen Biopharm Limited Production of activated clostridial neurotoxins
EP3290437A1 (en) 2016-08-31 2018-03-07 Merz Pharma GmbH & Co. KGaA Novel recombinant clostridial neurotoxins with decreased duration of effect
EP3312193A1 (en) 2016-10-19 2018-04-25 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum neurotoxins with accelerated onset of effect
EP3333179A1 (en) 2016-12-07 2018-06-13 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum toxin with accelarated onset of effect
EP3335719A1 (en) 2016-12-14 2018-06-20 Merz Pharma GmbH & Co. KGaA Novel recombinant botulinum neurotoxins with a stabilized light chain
US11952601B2 (en) 2017-06-20 2024-04-09 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum toxin with increased duration of effect
WO2018233813A1 (en) 2017-06-20 2018-12-27 Merz Pharma Gmbh & Co. Kgaa NOVEL RECOMBINANT BOTULINUM TOXINS WITH INCREASED DURATION
US11155802B2 (en) 2017-07-06 2021-10-26 Merz Pharma Gmbh & Co. Kgaa Recombinant botulinum neurotoxins with increased duration of effect
WO2019007509A1 (en) 2017-07-06 2019-01-10 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum neurotoxins with increased duration of effect
WO2019081022A1 (en) 2017-10-26 2019-05-02 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum neurotoxins with increased duration of effect
WO2019101308A1 (en) 2017-11-22 2019-05-31 Merz Pharma Gmbh & Co. Kgaa Novel recombinant botulinum toxin with increased duration of effect
WO2023105289A1 (en) 2021-12-06 2023-06-15 Dublin City University Methods and compositions for the treatment of pain

Also Published As

Publication number Publication date
EP2267008A3 (en) 2011-04-20
US20090004224A1 (en) 2009-01-01
EP2267009B1 (en) 2014-10-29
EP2267010A2 (en) 2010-12-29
DE60032367T3 (en) 2011-03-10
US20090030182A1 (en) 2009-01-29
US7419676B2 (en) 2008-09-02
US20090042270A1 (en) 2009-02-12
US20090087458A1 (en) 2009-04-02
US7959933B2 (en) 2011-06-14
ES2277854T5 (en) 2011-02-04
US7897157B2 (en) 2011-03-01
EP2267008B1 (en) 2014-07-02
DE60032367D1 (en) 2007-01-25
EP1206554A1 (en) 2002-05-22
US20080081355A1 (en) 2008-04-03
US8273358B2 (en) 2012-09-25
US7709228B2 (en) 2010-05-04
US20080182294A1 (en) 2008-07-31
US20090005313A1 (en) 2009-01-01
US20070259401A1 (en) 2007-11-08
AU7573100A (en) 2001-03-19
US20060099672A1 (en) 2006-05-11
EP2267009A2 (en) 2010-12-29
US20090030188A1 (en) 2009-01-29
US7749514B2 (en) 2010-07-06
CN1371424A (en) 2002-09-25
ES2277854T3 (en) 2007-08-01
HK1046020A1 (en) 2002-12-20
EP2267010A3 (en) 2011-04-20
AU777556B2 (en) 2004-10-21
US7132259B1 (en) 2006-11-07
JP2003507073A (en) 2003-02-25
US20080161226A1 (en) 2008-07-03
EP1700918A2 (en) 2006-09-13
KR100876060B1 (en) 2008-12-26
EP2264052A3 (en) 2011-04-20
US8003351B2 (en) 2011-08-23
EP1206554B2 (en) 2010-10-20
BR0012759A (en) 2002-04-02
EP1206554B1 (en) 2006-12-13
EP2267010B1 (en) 2014-05-07
US7422877B2 (en) 2008-09-09
US8211671B2 (en) 2012-07-03
US20090081730A1 (en) 2009-03-26
CA2380457A1 (en) 2001-03-01
US20080221012A1 (en) 2008-09-11
ATE348178T1 (en) 2007-01-15
US20090069238A1 (en) 2009-03-12
CN1214114C (en) 2005-08-10
EP1700918A3 (en) 2007-09-05
US20080311622A1 (en) 2008-12-18
KR20020034178A (en) 2002-05-08
US8071110B2 (en) 2011-12-06
HK1046020B (en) 2007-05-11
EP1700918B1 (en) 2014-01-15
EP2264052A2 (en) 2010-12-22
EP2267008A2 (en) 2010-12-29
DE60032367T2 (en) 2007-09-27
US8119370B2 (en) 2012-02-21
EP2267009A3 (en) 2011-04-20
US7985411B2 (en) 2011-07-26

Similar Documents

Publication Publication Date Title
US7132259B1 (en) Activatable recombinant neurotoxins
US7740868B2 (en) Activatable clostridial toxins
US20090018081A1 (en) Activatable clostridial toxins
HK1046020C (en) Activatable recombinant neurotoxins

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000964920

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2380457

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 1020027002270

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 008120099

Country of ref document: CN

Ref document number: 75731/00

Country of ref document: AU

WWP Wipo information: published in national office

Ref document number: 1020027002270

Country of ref document: KR

WWP Wipo information: published in national office

Ref document number: 2000964920

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 75731/00

Country of ref document: AU

WWG Wipo information: grant in national office

Ref document number: 2000964920

Country of ref document: EP