WO2001011065A2 - Hepatitis a virus clones adapted for growth in agmk cells - Google Patents

Abstract

The present invention discloses hepatitis A virus biological clones adapted for growth in AGMK cells and the nucleic acid sequences which encode these hepatitis A viruses. The present invention further discloses the use of these viruses or the nucleic acid sequences encoding them as vaccines. The invention also discloses the use of these nucleic acid sequences to produce genomes encoding chimeric hepatitis A viruses.

Description

TITLE OF INVENTION

Hepatitis A virus clones adapted for growth in African Green Monkey Kidney (AGMK) cells and vaccines comprising said clones.

Field of Invention

The present invention relates to the field of hepatitis A vaccines. More specifically, the invention relates to the production and isolation of hepatitis A virus clones from a cell line certified for vaccine production where the clones are useful as vaccines, preferably as live vaccines in methods of vaccinating primates, including humans, against HAV infection. The clones are also useful as starting material for the production of additional attenuated hepatitis A virus clones via passage in cell culture or via production of chimeric viruses.

Background of the Invention

Several cell culture-adapted strains of hepatitis A virus (HAV) are currently being used as inactivated vaccines. However, the inactivated vaccines have the limitation that multiple doses are required for effective immunization and it is not known yet if protection conferred by the inactivated vaccines is comparable to that following natural infection. Thus, a live vaccine could have the advantage of inducing life-long immunity following administration of only a single dose.

Summary of the Invention

The present invention relates to hepatitis A virus clones adapted to growth in AGMK cells. Preferably, the HAV clones are characterized by attenuation which makes them suitable for vaccine administration to primates, preferably humans, without inactivation.

The invention also relates to the nucleic acid sequences of the genomes of the hepatitis A virus clones of the invention and the use of these sequences to recombinantly produce hepatitis A virus. The invention further relates to the production of chimeric hepatitis

A viruses which are optimally adapted to growth in cell culture and suitably attenuated for use as a vaccine by incorporating into a selected area of the genome of a hepatitis A virus one or more of the specific nucleotide differences between the genomes of the HAV clones of the invention and the genome of the wild-type HM- 175 virus. o The invention further relates to vaccines comprising the hepatitis A viruses of the invention, where the vaccines are useful for protecting humans or other primates against hepatitis A virus infection.

The present invention therefore provides a method for protecting primates, including humans, against hepatitis A virus infection which comprises 5 administering to the primate an effective amount of the vaccine composition of this invention.

The invention further relates to the use of the HAV clones of the invention or of the chimeric viruses of the invention as starting materials for the 0 production of additional attenuated virus clones via passage in suitable cell lines.

Finally, the present invention also relates to AGMK cloned cell lines that replicate HAV with good efficiency and the use of these cell lines in vaccine production.

⁵ DESCRIPTION OF FIGURES

Figure 1 shows the virus passage history of HM-175 P39 virus isolates.

Figure 2 shows a comparison of the sizes of the foci formed by HM- 0 175 P39 clones 8, 13, 15, 16 and 17 in AGMK cells.

Figure 3 shows kinetic growth assays of HM-175 P39 virus clones in AGMK cells, as measured by slot blot hybridization of viral RNA followed by autoradiography and densitometry analysis. O.D. indicates optical density. _<r Figures 4A-4K show biochemical (ICD), serological (α-HAV), and histopathological (0 to 4+) responses and virus excretion in feces (PCR) of tamarins inoculated with HM-175 P39 virus isolates clone 8 (Figs. 4A and 4B), clone 13 (Figs. 4C and 4D), clone 15 (Figs. 4E, 4F and 4K), clone 16 (Figs. 4G and 4H) and clone 17 (Figs. 41 and 4J). The ICD serum enzyme levels were measured in 0 international units/ml (IU/ml). The preinoculation ICD value is the geometric mean of three values prior to inoculation. The dotted line marks the value corresponding to twice the geometric mean preinoculation value. A positive anti-HAV titer signifies a value greater than or equal to 1.0. Stool samples positive for HAV after 5 one round of PCR are indicated with solid black circles. Stool samples positive for o HAV only after two rounds of PCR are indicated with half black circles. Stool samples negative for HAV even after two rounds of PCR are indicated with white circles. Histopathology scores: 1+, mild hepatitis; 2+, mild to moderate hepatitis; 3+, moderately severe hepatitis; 4+, severe hepatitis. A designation of NA for liver histology indicates that no liver sample was available for analysis.

5

Figures 5A-5J show biochemical (ALT), serological (anti-HAV), and histopathological (0 to 4+) responses and virus excretion in feces (PCR) of chimpanzees inoculated with HM-175 P39 virus isolates clone 8 (Figs. 5A and 5B), clone 13 (Figs. 5C and 5D), clone 15 (Figs. 5E and 5F), clone 16 (Figs. 5G and 5H) 0 and clone 17 (Figs. 51 and 5J). The ALT serum enzyme levels were measured in units/ml (U/ml). A positive anti-HAV titer signifies a value greater than or equal to 1.0. Stool samples positive for HAV after one round of PCR are indicated with solid black circles. Stool samples positive for HAV only after two rounds of PCR are indicated with half-black circles. Stool samples negative for HAV even after two rounds of PCR are indicated with white circles. Histopathology scores: 1+, mild hepatitis; 2+, mild to moderate hepatitis; 3+, moderately severe hepatitis; 4+, severe hepatitis. The designation NA for liver histology indicates the liver sample was not available for analysis.

Figure 6 shows the results of end-point dilution studies of HM-175 P32 virus in uncloned AGMK cells and in AGMK #11, #7, #45, #33 and #50 clonal cell lines where total viral RNA was analyzed by slot blot hybridization. The negative log value of the dilution is shown at the side of the panel. 5 Figure 7 shows kinetic studies of replication of the HAV/7 virus in uncloned AGMK cells and in AGMK #50 cells as measured by slot blot hybridization of viral RNA followed by autoradiography and densitometry analysis. O.D. indicates optical density.

Figure 8 shows end-point dilution studies of HM-175 P32 virus in 0 uncloned AGMK cells and in AGMK #33, AGMK #45 and AGMK #50 clonal cell lines where viral RNA from cell-associated virus (cells) and virus released into the medium (media) was analyzed by slot blot hybridization. The negative log value of the dilution is shown at the side of the panel. 5 DESCRIPTION OF INVENTION

The present invention relates to the identification of hepatitis A virus clones that grow well in cell culture and have biological properties in primates that are desirable in a live attenuated vaccine candidate. In particular, the present invention relates to HM-175 pass 39 (P39) virus biological clones 8, 13, 15, 16, and 17 where clones 8, 13 and 15 have been deposited with American Type Culture Collection (ATCC) on April 23, 1999 and have ATCC numbers VR-2646 (clone 8), VR-2645 (clone 13) and VR-2644 (clone 15).

The clones of the present invention are based on the wild-type HAV, strain HM-175, whose sequence is shown in Figure 1 of Cohen et al., (J. Virol., 61 :50-59 (1987)) and in Figure 1 of U.S. Patent No. 4,894,228, both of which are hereby incorporated by reference. Thus, these documents, incorporated by reference, provide the nucleotide sequence of wild-type HM-175. The passage histories of the pass 39 biological clones of this invention are illustrated in Figure 1 and the establishment of master seed stocks of these clones is described in the Example.

The genomes of the five clones of the invention have been sequenced and their sequences are identical to the sequence of wild-type HM-175 except for the nucleotide difference shown in Tables 3 and 4, where the nucleotide numbers used in Tables 3 and 4 are the nucleotide numbers assigned to positions of the wild-type sequence of Fig. 1 from U.S. Patent 4,894,228.

The present invention therefore relates to the hepatitis A viruses of P39 biological clones 8, 13, 15, 16 and 17 and to the nucleic acid sequences which encode these viruses.

The present invention also relates to chimeric hepatitis A viruses produced using the nucleic acid sequences which encode the viruses of the biological clones of the invention.

In one embodiment, such a chimeric HAV may be constructed by insertion of one or more of the specific nucleotide changes between the clones of the invention and wild-type HM-175 into the genome of a hepatitis A virus via site- directed mutagenesis. In producing the chimeric viruses of the invention, the HAV into which the changes are to be introduced is preferably a human hepatitis A virus and more preferably an attenuated human HAV such as MRC5 or HAV/7. The mutations may therefore be made into HM-175 viruses of different passages as well as into HAV strains other than HM-175 by introducing these nucleotides into homologous nucleotide positions in the other strains. By the phrase "homologous nucleotide position" is meant a nucleotide in an HAV other than HAV HM-175 which is present in the same viral region (e.g., 2C, 3D) at a position in the region similar to that of the nucleotide in Tables 3 and 4. In other words, the nucleotide position may differ in position number due to deletions in other regions of the virus; but one of skill in the art could readily determine its functional similarity to the nucleotide position in wild-type HM- 175.

In an alternative embodiment, the chimeric HAV is produced by replacing a portion of the genome of a hepatitis A virus with a corresponding portion of the genome of a hepatitis A virus clone of the invention.

In yet another embodiment, chimeric hepatitis A viruses are produced by "reverse engineering" the clones of the invention to change one or more of the nucleotide differences between the clones and wild-type HM-175 to the wild-type nucleotide. For example, one might revert one or more of the mutations in the 2A or 2C genes (nucleotides 3025, 3196, 4043, 4087, 4222 and 4563) back to the wild-type sequence.

The mutagenic and genetic engineering techniques employed to construct chimeric or recombinant HAVs which incorporate one or more of these mutations are conventional and known to those of skill in the art [see, for example, Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring

Harbor Laboratory, Cold Spring Harbor, New York, (1980)]. Other conventional techniques, including polymerase chain reactions and chemical synthetic techniques may also be used to design chimeric HAVs of this invention

The present invention therefore relates to the production of hepatitis A viruses and chimeric hepatitis A viruses from the nucleic acid sequences described herein.

In one embodiment, the hepatitis A virus or chimeric hepatitis A virus genomes of the invention can be inserted into an expression vector that functions in eukaryotic cells. Examples, of such vectors include, but are not limited to, plasmid expression vectors and vaccinia virus vectors.

The genome contained in the recombinant expression vector can also be transcribed in vitro by methods known to those of ordinary skill in the art in order to produce RNA transcripts which encode the hepatitis A viruses of the invention. The hepatitis A viruses of the invention may then be produced by transfecting cells by methods known to those of ordinary skill in the art with either the in vitro transcription mixture containing the RNA transcripts or with the recombinant expression vectors containing the genome. Such methods include, but are not limited to, electroporation, and lipofection and transfection with DEAE- dextran. Cells suitable for in vitro transfection with the RNA transcripts and recombinant expression vectors of the present invention include eukaryotic cell lines, cells put into primary culture from a host, or cells resulting from passage of the primary culture. Examples of preferred cells are MRC-5, AGMK, FRhK-4, Vero and BSC-1 cells.

The viruses or chimeric viruses so generated can be tested for virulence phenotype by administering the virus to tamarins and examining the livers of the tamarins for evidence of pathology and/or the serum for biochemical evidence of hepatitis as measured by levels of liver enzymes such as isocitrate dehydrogenase and alanine aminotransferase and the viruses can be tested for their growth in cell culture by techniques such as RIFA or slot blot hybridization as described in Examples section. The viruses produced from the sequences of the invention may be purified or partially purified from the transfected cells by methods known to those of ordinary skill in the art such as those described in Andre et al. lϊProg. Med. Virol.. (1990) 37:72-95)] and Provost et al. \( Med. Virol.. (1986) 19:23-20], both of which are hereby incorporated by reference. In a preferred embodiment, the viruses are partially purified prior to their use as immunogens in the pharmaceutical compositions and vaccines of the present invention.

The present invention therefore relates to the use of the viruses and chimeric viruses of the invention as immunogens in live vaccines to prevent hepatitis A in a mammal. When used as a live vaccine, the viruses can be administered alone or in a suitable diluent such as saline or water. The vaccine of the invention may be administered to the mammal by a variety of routes including, but not limited to, orally, subcutaneously, intramuscularly or intravenously. A preferred route of administration is orally. Suitable amounts of hepatitis A virus may range from about approximately 10 to about 10 tissue culture infectious doses (TCID), more preferably, from about 10⁴ to about 10⁷ TCID. Those of ordinary skill in the art would readily understand that suitable concentrations of virus to include in the vaccines of the invention will vary depending on the route of administration chosen. The immunogens of the invention may be administered once or at periodic intervals until a protective titer of anti-HAV antibody is produced. In a preferred embodiment, the vaccine of the invention is administered to mammals selected from the group consisting of humans, apes and monkeys.

In an alternative embodiment, the immunogen of the present invention may be a nucleic acid sequence which encodes a clone of the invention or a chimeric HAV. Where the sequence is a cDNA sequence, the cDNAs and their

RNA transcripts may be used to transfect a mammal by direct injection into the liver tissue or into other tissues of the mammal [(Emerson, S.U. et al. (1992) J.

Virol., 66:6649-6654, and Mandl, C.W. et al. (1998) Nature Medicine 4: 1438-

1440) both of which are incorporated herein by reference)].

Alternatively, direct gene transfer may be accomplished via administration of a eukaryotic expression vector containing a nucleic acid sequence of the invention. Suitable routes of administration for a nucleic acid immunogen include, but are not limited to, intramuscular, subcutaneous or intradermal administration. Eukaryotic expression vectors suitable for producing high efficiency gene transfer in vivo are known to those of ordinary skill in the art and include, but are not limited to, plasmid-based expression vectors and retroviral and adeno viral vectors.

Doses of nucleic acid sequence effective to elicit a protective antibody response against hepatitis A range from about 250 ug to about 5 mg, more preferably from about 1 mg to 2 mg. The viruses and the nucleic acid sequences encoding these viruses may be supplied in the form of a kit, alone, or in the form of a pharmaceutical composition.

The administration to mammals of either the viruses of the invention or their genomic sequences may be for either a prophylactic or therapeutic purpose.

When provided prophylactically, the viruses or nucleic acid sequences are provided in advance of any exposure to HAV or in advance of any symptom due to HAV infection. The prophylactic administration therefore serves to prevent or attenuate any subsequent infection of the mammal with HAV. When provided therapeutically, the viruses or nucleic acid sequences are provided at, or shortly after, the onset of infection or disease caused by HAV. The therapeutic administration of the viruses or nucleic acid sequences of the invention thus attenuates the infection or disease.

In addition to use as a vaccine, the genomes and viruses of the invention can be used to prepare antibodies to HAV. These antibodies can be used directly as antiviral agents or they may be used in immunoassays such as ELISA, Western blotting and immunohistochemistry to detect HAV or HAV proteins.

The antibodies of the present invention may be contained in antiserum obtained from a mammal immunized with the genomes or viruses of the invention. Alternatively the antibodies may be polyclonal antibodies purified or partially purified from the antiserum or monoclonal antibodies. The antibodies of the invention may be utilized for pre- or post-exposure passive immunoprophylaxis.

The present invention also relates to the use of the viruses of the invention as starting materials for the production of additional attenuated virus clones via passage in suitable cells such as MRC-5, Vero and AGMK cells.

All articles or patents mentioned herein are hereby incorporated by reference. The following examples illustrate various aspects of the invention but are in no way intended to limit the scope thereof. EXAMPLES Materials and Methods

Passage of HM-175 Virus to Generate HM-175 P35A Virus Stock

This protocol was employed according to Good Manufacturing

Practice requirements to passage hepatitis A virus strain HM-175 pass 30 clone 7

(master seed, deposited with the ATCC on October 5, 1984 and having ATCC accession number VR2099) in a certified line of African green monkey kidney

(AGMK) cells. Sufficient AGMK cells to seed two T-25 flasks to 70-80% confluence were suspended in one ml of complete growth medium (E-MEM ,

Biowhitaker, Inc., Walkersville, MD). The cells were mixed with 500 μl of the

HM-175 pass 30 clone 7 (master seed) and the suspension was incubated at 37°C in a CO₂ incubator for one hour. A volume of 12 ml of complete growth media with

10% fetal calf serum and 2 mM glutamine was added to the infected cells and one ml aliquots were dispensed to six wells of a 24-well tissue culture plate containing glass coverslips. The remaining cells were maintained in a T-25 flask at 37°C in a

CO₂ incubator. The cells on glass coverslips were monitored for production of

HAV by standard immunofluorescence assay techniques [(Emerson et al., (1991) J. Virol.. 65:4882-4886)]. When sufficient virus replication had occurred, the cells were harvested from the T-25 flask by trypsinization followed by suspension of the cells in one ml of complete growth media. The cells were lysed by three cycles of alternately freezing them on dry ice and thawing them in a 37°C water bath. An aliquot of this lysate was subsequently used to initiate the infection for the next passage. This procedure was repeated four more times. Thus, the HM-175 P30 clone 7 (master seed) virus stock was passaged a total of five times in the certified

AGMK cell line and the resulting virus stock was labelled

HM-175 P35A (Figure 1).

Isolation and Purification of HM-175 P39 Virus Clones

AGMK cells were plated on 1 -chamber culture slides (Nunc Lab-

Tek) and incubated at 37°C in a CO₂ incubator. When the cells were just confluent, they were infected with 500 μl of a dilution of HM-175 P35A virus in complete growth medium. The cells were incubated with virus for 1-2 hours at 37°C in a CO o incubator. At the end of this incubation period, 4 ml of an agar overlay solution was added to the chamber. The agar overlay solution consisted of 1% Sea Plaque agar diluted with 2X E-MEM (Quality Biologicals, Inc., Gaithersburg, MD), glutamine and fetal calf serum so that the final composition of overlay solution was

0.5% Sea Plaque agar, IX E-MEM, 2 mM glutamine, 2% fetal calf serum. The agar 5 was allowed to solidify at room temperature after which time the slide chambers were transferred to a CO₂ incubator and incubated at 37°C for 10 days.

At the end of the 10 day incubation period, the agarose overlay was removed and transferred to the slide chamber cover and the orientation of the 0 agarose overlay with respect to the slide chamber cover was noted. The adherent cells on the slides were fixed with acetone and the cells were air dried. The slides were briefly dipped in a solution of PBS-glycine-Tween [phosphate buffered saline (PBS) with 10 mM glycine and 0.1% Tween-20 (Sigma, St. Louis, MO)] and inverted over 400-500 μl of an anti-HAV antibody solution (chimp 1442 5 hyperimmune serum) diluted 1:500 in a 1:1 solution of PBS-glycine and 10% bovine serum albumin [final concentration was 0.5X PBS, 5 mM glycine and 5% bovine serum albumin (BSA)]. The slides were incubated with the antibody solution at 37°C in a CO₂ incubator for 30 minutes. The slides were washed 3X 0 each with PBS-glycine for 5 minutes and the staining reaction was performed using a phosphatase anti-human Vectastain kit (Vector Laboratories, Burlingame, CA) according to the manufacturer's instructions. Development of the color reaction signal was performed as outlined in the Vectastain kit protocol and when the foci 5 were clearly visible, the reaction was terminated by removing the staining solution and washing the slides with water. The slides were air dried. The agarose overlay was oriented properly over the stained slide and the region of the agarose that was in direct contact with the stained focus of interest on the slide was removed using a sterile pipet. The agarose plug was transferred from the pipet to a sterile screw capped tube (Sarstedt, Newton, NC) containing 200 μl of complete growth media.

The agar plug in media was vortexed gently and incubated in a 37°C water bath overnight to melt the agarose and elute the virus particles which were present in the agarose plug. The virus suspension was again gently vortexed and stored at - 70°C. 5 o This procedure was repeated 2 additional times to establish virus stocks which were biologically cloned a total of three times (HM-175 Pass 38; Figure 1).

Establishment of Master Seed Stocks of HM-175 P39 Virus Isolates

The following protocol was employed according to Good Manufacturing Practice requirements to establish seed stocks of clones of hepatitis A virus strain HM-175 P35A which had been plaque-purified in AGMK cells three times (HM-175 Pass 38). AGMK cells were seeded in 10 T-25 flasks and grown at 37°C in a CO₂ incubator. When the cells in the T-25 flasks were 70-80% confluent, they were inoculated with virus from the agar plugs containing HM-175 Pass 38 0 virus . The virus samples were thawed in a 37°C water bath until the entire sample, including the agarose, had completely liquified. The volume of each sample was measured using a 1 ml pipet and half of the sample was removed and placed in a sterile 1 ml tube. Sufficient complete growth medium was added to each virus , sample so that the final volume of each inoculum was ~0.5 ml. Medium was removed from each T-25 flask and inoculum was added to the flask and gently distributed over the cells. The infected cells were incubated for 2-3 hours at 37°C in a CO incubator. At the end of the 2-3 hour incubation, 5 ml of complete growth medium was added to the infected cells and the T-25 flasks were incubated at 37°C 0 in a CO incubator for 10 days. At the end of the 10 day incubation period, cells in each flask were trypsinized and resuspended in 14 ml complete growth medium.

One ml aliquots were dispensed to 4 wells of a 24- well tissue culture plate containing glass coverslips. The remaining 10 ml of cells were divided equally into 5 two T-25 flasks and incubation was continued at 37°C. The coverslips were monitored for virus replication using a standard immunofiuorescence assay

[(Emerson et al., (1991) J. Virol.. 65:4882-4886)]. When sufficient virus replication had occurred, the cells in the T-25 flasks were harvested.

The cells and media containing virus were harvested for each sample 0 and master seed stocks were established as follows: The media in the T-25 flask was removed and saved in a sterile tube. The cells in each T-25 flask were trypsinized and the dislodged cells were resuspended in the 5 ml of medium that had originally been removed from the same T-25 flask. The harvested samples 5 were alternately frozen on dry ice and thawed in a 37°C water bath three times. The o two ~5 ml aliquots of virus sample for each clone were added to 90 ml of complete growth medium so that the total volume of the master seed stock was 100 ml. The master seed stock was divided into 100 x 1 ml aliquots and stored in sterile cryo tubes at -70°C.

Radioimmunofocus Assay (RIFA)

RIFA was used to determine focus size and to quantify virus titers. RIFA was performed essentially as previously described by Raychaudhuri et al. (J. Virol. 72:7467-7475) (1998). FRhK cells were grown on Thermolux round 25mm coverslips fixed to the bottom of each well in 6-well plates. Virus was adsorbed to

10 cells for 2-4 hours at 34.5°C in a CO incubator. Infected cells were overlaid with

5 ml of agarose medium (0.5% Sea Plaque agar with IX E-MEM, 2mM glutamine, 2% fetal calf serum, 0.25 mg/ml gentamycin) and incubated at 34.5°C in a CO incubator for 10 days. Cells were fixed with acetone and were either processed

, _<- immediately or stored at -20°C. Viral antigen was detected with a primary antibody consisting of chimpanzee hyperimmune serum (Chimp 1442) and a secondary antibody of ¹²⁵I-labelled sheep anti-human IgG F(ab')₂ fragment (Amersham Corporation, Arlington Heights, IL). Foci were visualized by autoradiography.

Growth Curves

20

Growth curve assays were performed to evaluate the relative rates of replication of viruses in AGMK cells. Cell monolayers which were >80% confluent in 96- well plates (Falcon) were infected with 0.2 ml of virus diluted in 10% DMEM

[Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf

25 serum, 2mM glutamine and non-essential amino acids] at a multiplicity of infection of 10 radioimmunofocus-forming units (RFU) per cell. Cells were incubated with virus for 2-4 hours at 34.5°C in a CO₂ incubator after which the cells were washed 4 times with 10% DMEM and overlaid with 0.2 ml 10% DMEM. At various times, the medium overlaying the cells, which contained virus released from cells, was

30 removed and saved and the volume was adjusted to 0.3 ml with 10% DMEM. The adherent cells in the wells were washed once with 0.2 ml trypsin solution at room temperature and were subsequently incubated with 0.1 ml trypsin solution at 34.5°C until the cells exhibited a rounded morphology and detached from the plastic 5 substrate. The trypsinized cells were then harvested by vigorous pipetting and o combined with the medium that had been previously removed. The total virus sample (0.4 ml) was stored at -80°C. Cells were lysed by at least three cycles of freeze-thawing and total virus harvested at each time point was quantified by slot blot hybridization.

When virus in cells and in medium were quantified separately, the

5 medium was removed and the volume was adjusted to 0.4 ml with 10% DMEM.

This sample was analyzed to determine the fraction of virus that was released into the medium. The cells were washed with 0.2 ml trypsin solution and were subsequently incubated with 0.1 ml trypsin solution as outlined above. The cells in

10 0.1 ml trypsin were harvested and were added to 0.3 ml 10% DMEM. This sample was analyzed to determine the fraction of the virus that was cell-associated.

Slot Blot Hybridization

RNA was isolated from growth curve samples using Trizol reagent , - (Gibco-BRL) according to the manufacturer's instructions with the following modifications: A 130 μl aliquot of sample was extracted with an equal volume of Trizol. After the 15 minute centrifugation step to separate the aqueous and organic phases, 100 μl of the aqueous phase was removed and added to 320 μl of a 1:1 solution of 10X SSC [IX SSC is 0.15 M NaCl and 0.015 M sodium citrate (pH

20

7.0)] and formaldehyde. Viral RNA was quantified by slot blot analysis using a negative strand P-labelled RNA probe spanning the complete HAV genome.

Hybridization was at 50°C for at least 16 hours. Blots were washed three times for

30 minutes each with 2X SSPE [IX SSPE is 10 mM sodium phosphate, 0.18 M

25 NaCl, 1 mM EDTA (pH 7.4)] with 0.1% sodium dodecyl sulphate (SDS) at room temperature and once with 0.1X SSPE, 0.1% SDS at 64°C for one hour.

Autoradiography was performed, and the viral RNA from each time point in the growth curve was analyzed with a Deskscan II scanner (Hewlett-Packard) and a

Macintosh computer, using the public domain NIH Image program developed at the

30

U.S. National Institutes of Health.

Virulence Studies in Tamarins and Chimpanzees

Each of two animals (either tamarins or chimpanzees) was inoculated intravenously with approximately 10³ tissue culture infectious doses

35 (TCID) of virus in a 0.5 ml volume of inoculum. The number of TCID in the ⁰ inoculum was determined by RIFA. Blood samples were collected and needle liver biopsies were performed weekly on each animal for at least 2 weeks before and either 16 weeks (tamarins) or 24 weeks (chimpanzees) after inoculation with virus. The blood samples were analyzed for seroconversion to anti-HAV with a commercial assay (Abbott Laboratories, North Chicago, IL) and for serum alanine amino transferase (ALT) and isocitrate dehydrogenase (ICD) levels with standard techniques (Metpath, Rockville, MD). Histopathology was determined under code and scored on a scale of 1 to 4 depending on the severity of the hepatitis; 1 corresponded to mild hepatitis and 4 to severe hepatitis. Stool samples of tamarins and chimpanzees inoculated with virus were analyzed for the presence of excreted virus by reverse transcription-polymerase chain reaction (RT-PCR) and by RIFA analysis. The housing, maintenance, and care of the animals met or exceeded all requirements for primate husbandry. Analysis of Stool Samples for the Presence of Excreted Virus

RT-PCR

Briefly, a 10% (w/v) suspension of stool in 10 mM Tris (pH 7.0) and 0.135 M NaCl was prepared in a stomacher and clarified by low-speed centrifugation to remove large particulate matter. Viral RNA was extracted from a 0 100 μl aliquot of clarified sample with 1 ml of Trizol reagent following the manufacturer's instructions. Glycogen (20 μg; Boehringer Mannheim, Indianapolis, IN) was added as a carrier prior to precipitation with isopropanol. The RNA was resuspended in 9.5 μl of a 10.5 mM DTT solution with 20 U RNasin (Promega 5 Biotech, Madison, WI) to which 1 μl of a 10 μM stock of reverse primer [5'

ATCTGAATAGAAACCAATCCA 3' SEQ ID NO: l] was added. The solution was heated at 65°C for 3 minutes, cooled on ice and an additional 20 U of RNasin was added to the sample. The reverse transcription reaction was performed in a r final volume of 20 μl in a reaction mixture consisting of 10 mM Tris-HCl (pH 8.3),

50 mM KCl, 2.5 mM MgCl , 40 U RNasin, 1 mM of each deoxynucleoside triphosphate (dNTP) and 10 U avian myeloblastosis virus reverse transcriptase (Promega Biotech, Madison, WI). After synthesis of cDNA at 42°C for 60 minutes, PCR amplification was performed in a total volume of 50 μl of 10 mM Tris-HCl 5 (pH 8.3), 50 mM KCl, 2.5 mM MgCl₂, 0.2 mM of each dNTP, 2.5 U Amplitaq Gold polymerase (Perkin-Elmer Corp, Norwalk, CT) and 0.5 mM each of forward [5' TCAACACTGAGGTGGTTTTTC 3' SEQ ID NO:2] and reverse primer [5' ATCTGAATAGAAACCAATCCA 3' SEQ ID NO:3]. PCR reaction consisted of 1 cycle of 10 minutes of incubation at 94°C followed by 35 cycles of 1 minute of incubation at 94°C, 30 seconds of incubation at 45°C and 1 minute of incubation at 72°C followed by a single cycle at 72°C for 20 minutes. A second round of PCR using nested primers [forward 5' CAGGAGCAACTGATGTAG 3' SEQ ID NO:4; reverse 5' CTTGTCACCCAAACCATCCAG 3' SEQ ID NO:5] was performed if necessary.

10 RIFA

For each animal, the stool samples which had the highest levels of excreted virus as determined by RT-PCR analysis were pooled and the virus titer of the pooled samples was determined by RIFA. If there were stool samples which ι c were positive for HAV after one round of PCR, these samples were pooled and the virus titer in the pooled sample was quantified. If there was no week during which the stool sample was positive for HAV after one round of PCR, then samples which were positive for HAV after two rounds of nested PCR were pooled and the titer of virus in this sample was determined by RIFA. 20

Sequencing the Virus Clones

RNA was isolated from 100 μl of the master seed stock of each virus isolate using Trizol reagent according to the manufacturer's instructions. After the

15 minute centrifugation step to separate the aqueous and organic phases, 600 μl of

25 the aqueous phase was removed. Glycogen (20 μg) was added as a carrier prior to precipitation with 500 μl of isopropanol and the samples were stored at -80°C. The RNA was resuspended in 11 μl of 10 mM DTT with 40 U RNasin to which 1 μl of a 10 μM stock of reverse primer [5' ATCTGAATAGAAACCAATCCA 3' SEQ ID

,« NO:6] was added. The solution was heated at 65°C for 10 minutes and cooled on ice. The reverse transcription reaction was performed in a final volume of 20 μl in a reaction mixture consisting of 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl₂, 10 mM DTT, 40 U RNasin, 0.5 mM of each dNTP and 200 U Superscript II RNase H- reverse transcriptase (Gibco BRL, Bethesda, MD). After synthesis of

35 cDNA at 42°C for 50 minutes, the sample was incubated with 3.5 U RNase H (Gibco-BRL, Bethesda, MD) for 20 minutes at 37°C. PCR amplification was performed in a total volume of 50 μl of 40 mM Tricine-KOH (pH 9.5), 15 mM KOAc, 3.5 mM Mg(OAc)₂, 75 μg/ml BSA, 0.2 mM of each dNTP with 1 μl Advantage Klentaq (Clontech, Palo Alto, CA) and 0.2 mM each of forward [5' TCAACACTGAGGTGGTTTTTC 3' SEQ ID NO:7] and reverse [5' ATCTGAATAGAAACCAATCCA 3' SEQ ID NO:8] primer. PCR reaction consisted of 1 cycle of 30 seconds at 94°C followed by 35 cycles of 30 seconds of incubation at 94°C and 11 minutes of incubation at 68°C. The PCR products were purified from agarose gels using a Geneclean kit (BIO 101, La JoUa, CA) following the manufacturer's instructions. A second round of PCR was performed using the purified product of the 1st round PCR reaction as the template and appropriate primers [forward 5' CAGGAGCAACTGATGTAG 3' SEQ ID NO:9; reverse 5' CTTGTCACCCAAACCATCCAG 3' SEQ ID NO:10] to amplify either the PI region, P2 region or P3 region of the genome. This PCR reaction was performed in a final volume of 50 μl using Pfu DNA polymerase (Stratagene, La Jolla, CA) following the manufacturer's instructions. These PCR products were purified either from low melting agarose gels using a gel purification kit (Qiagen, Chatsworth, CA) or directly using a Wizard PCR purification kit (Promega Biotech, Madison WI). The purified PCR products were sequenced using the Applied Biosystems 373 A automated DNA sequencer using a modified Sanger method.

EXAMPLE 1

Replication Properties of HM-175 P39 Clones in AGMK Cells

Radioimmunofocus assays (RIFA) demonstrated that the size of foci formed by the HM-175 P39 clones differed (Figure 2). Virus clone 13 formed, on average, smaller sized foci relative to the foci formed by the other HM-175 P39 virus isolates.

Kinetic assays in which cells were infected at a high multiplicity of infection (MOI) were also performed to evaluate the relative rates of replication of the HM-175 P39 virus isolates in AGMK cells. Results of these studies demonstrated that all of the HM-175 P39 virus isolates replicated in AGMK cells at comparable rates and at a rate similar to that observed for HAV/7 (Figure 3). EXAMPLE 2

Virulence Studies in Tamarins

The biological properties of five different HM-175 P39 virus isolates (clones 8, 13, 15, 16 and 17) were evaluated in tamarins. Each virus isolate was inoculated into two tamarins and the biochemical (ICD levels), serological (anti- HAV) and histopathological responses, as well as the level of virus excretion in the feces, were evaluated. HM-175 P39 clone 13 was only partially attenuated for tamarins. Both tamarins inoculated with clone 13 showed significant increases in serum liver enzyme levels either just prior to, or concurrent with seroconversion for anti-HAV (Figures 4C and 4D). In each case, seroconversion occurred 3 weeks after inoculation and the peak anti-HAV titer was 1 :6,400. Liver histology showed signs of mild to moderate hepatitis and virus specific RT-PCR amplification of fecal samples and RIFA analysis of stool suspensions demonstrated that a significant amount of virus was being excreted just prior to, and at the time of peak serum liver enzyme elevations (Figures 4C and 4D; Table 1). The virus isolate HM-175 P39 clone 15 was also inoculated orally (10^{6 7} TCID) into two tamarins. Serconversion to anti-HAV positivity was observed in one of the two tamarins (mystax 849; Figure 4K) while the second tamarin did not seroconvert during the 24 week period that the animals were monitored. The response of mystax 849 infected orally with clone 15 was similar to that observed when the virus was inoculated intravenously; a slight increase in serum enzyme levels was observed (as in mystax 822; Figure 4F) concurrent with seroconversion for anti-HAV (week 8) and liver histology showed signs of mild to moderate hepatitis.

Table 1 Infection of Tamarins with HM-175 P39 Virus Isolates

SeroconPeak Peak anti- Peak virus excretion'

Mvstax Virus version" Peak ICD^b ICD value HAV titer (number of weeks pooled)

816 clone 8 4 4 1965(1 )^c 1 12,800 1 8 x l0⁵ (2)

817 clone 8 4 none base lιne^d 1 640 99 x l0⁴ (2)

819 clone 13 3 3 5090(1 )^c 1 6,400 3 0 x l0⁶ (2)

820 clonel3 3 4 3740(2)^c 1 6,400 3 0 x l0⁶ (4)

821 clone 15 4 none base lιne^d 1 640 1 6 l0³ (3)

822 clone 15 4 4 1 187(l )^c 1 3.200 6 7 x l0⁵ (l )

823 clone 16 6 none base ne^d 1 320 1 7 x l0⁴ (4)

824 clone 16 7 none base lιne^d 1 1,280 3 2 x l0⁵ (4)

825 clone 17 6 6 1476(1) 1 12,800 2 0 x l0⁶ (2)

827 clone 17 5 none base line 1 320 6 3 x 10³ (1)

* First week that a positive anti-HAV titer was observed ^b Week postmoculation ^c Values in parentheses are number of weeks above baseline levels (two times the geometric mean preinoculation level) d Value was less than or equal to two times the geometric mean of three preinoculation values ^e RFU per gram of stool

Virus clones 8, 15, and 17 appeared to be at least partially attenuated for tamarins. One of two tamarins inoculated with either virus clone 8 (mystax 816), clone 15 (mystax 822) or clone 17 (mystax 825) showed minimal increases in serum liver enzyme levels (Figures 4A, F, I) whereas the second tamarin in each pair showed no significant increase in serum liver enzyme levels (Figure 4B, E, J). Tamarins infected with clones 8 or 15 seroconverted 4 weeks after inoculation whereas tamarins infected with clone 17 seroconverted at a slightly later time (5 to 6 weeks after inoculation). Excreted virus in stool samples was detected in tamarins inoculated with virus clones 8. 15 or 17 although the levels of excreted virus were usually lower than those observed in tamarins inoculated with clone 13 (Table 1). The peak anti-HAV titer differed significantly in the paired animals infected with either clone 8 or clone 17. The peak anti-HAV titers for the two animals infected with clone 8 were 1 : 12,800 (mystax 816) and 1 :640 (mystax 817) (Table 1). Similarly, the peak anti-HAV titers in the two animals infected with clone 17 were 1 : 12,800 (mystax 825) and 1 :320 (mystax 827) (Table 1). In each case, the animal in the pair that had a slight increase in serum liver enzyme levels had the higher anti-HAV titer in serum.

Neither tamarin infected with clone 16 demonstrated any significant increase in serum liver enzyme levels (Figures 4G and 4H). Seroconversion for HAV occurred 6 to 7 weeks after inoculation and excreted virus was detected in both animals (Figures 4G and 4H). These studies demonstrate that HM-175 P39 clone 13 is partially attenuated for tamarins whereas clones 8, 15, 16 and 17 are more highly attenuated.

EXAMPLE 3

Virulence Studies in Chimpanzees

HM-175 P39 virus clones 8, 13, 15, 16 and 17 were all attenuated for chimpanzees as shown in Table 2.

Table 2 Infection of Chimpanzees with HM-175 P39 Virus Isolates

SeroconPeak Peak anti- Peak virus excretion⁰

Chimpanzee Virus version² Peak ALT ALT value^b HAV titer (number of weeks pooled)

1573 clone 8 none none base line negative ND^d

1574 clone 8 none none base line negative ND^d

1578 clone 13 8 none base line 1 320 < 400 (2)

1579 clone 13 12 none base line 1 320 < 400 (6)

1580 clone 15 6 none base line 1 80 ND^e

1581 clone 15 12 none base line 1 80 ND^C

5829 clone 16 none none base line negative ND^d

5835 clone 16 15 none base line 1 80 ND^e

5852 clone 17 22 none base line 1 80 < 400 (1)

5867 clone 17 17 none base line 1 80 ND^e

First week that a positive anti-HAV titer was observed

Base line refers to a value less than or equal to two times the geometric mean of 3 preinoculation values

RFU per gram of stool

ND PCR and RIFA analyses not done since animal did not seroconvert to anti-HAV positivity

ND RIFA analysis not done since all stool samples were negative for HAV by PCR No significant increase in serum liver enzyme levels or histopathological changes associated with hepatitis was detected in chimpanzees inoculated with any of these virus isolates (Figures 5 A - 5J). Both chimpanzees inoculated with clone 13 seroconverted; one animal seroconverted 8 weeks after inoculation (Chimp 1578) and the second animal seroconverted at week 12 (Chimp 1579). Similarly, both animals inoculated with clone 15 seroconverted for anti-HAV (Chimp 1580 at week 6 and Chimp 1581 at week 12). Both chimpanzees inoculated with clone 17 seroconverted although the time to seroconversion was delayed (week 17 in Chimp 5867 and week 22 in Chimp 5852). Clone 16 appeared to be more highly attenuated for chimpanzees; one animal seroconverted 15 weeks after inoculation while the second animal did not seroconvert during the 24 week period post- inoculation that the animals were monitored. Neither animal inoculated with clone 8 seroconverted, indicating that this virus clone was over-attenuated for chimpanzees. Thus, although virus clones 8 and 15 appeared to have a similar phenotype in tamarins, the biological response of chimpanzees to inoculation with these two virus isolates was different.

EXAMPLE 4

Nucleotide Sequence Analysis of HM-175 P39 Virus Clones

The PCR consensus sequences corresponding to the complete nucleotide sequences of HM-175 P39 clones 8, 13, 15, 16 and 17 were determined and differences among the virus clones were identified. The differences in nucleotide sequence of the HM-175 P39 virus isolates when compared to the sequence of wild-type HM-175 (see Figure 1 of Cohen et al., (1987) J. Virol. 61 :50-

59, and U.S. Patent 4.898,228) are shown in Table 3. Table 3

Common Nucleotide Differences Between Wild-Type HM-175 and the HM-175 P39 Virus Clones 8, 13, 15, 16 and 17

Nucleotides Amino acid

Nucleotide Position in Wild-Type HM-175 Wild-Type HM-175 position HAV HM-175 P39 Clones HM-175 P39 Clones

124 5' NC T C

131 5' NC T d

132 5' NC T d

133 5' NC T d

134 5' NC G d

152 5' NC A G

203-207 5' NC T d

964 VP2 A G Lys Arg

1742 VP3 G A

3025 VP1 A T Glu Val

3196 2A A G Asn Ser

3889 2B C T Ala Val

3919 2C G c Gly Ala

4043 2C T c

4087 2C A T Lys Met

4222 2C T c Phe Ser

4563 2C G A Val He

5204 3A G A

5232 3B C T His Tyr

6147 3D G A Asp Asn

6522 3D T A Ser Thr

7032 3D T C

7430 3' NC A G

All five HM-175 P39 isolates sequenced have all 23 nucleotide changes that were previously identified between wild-type HM-175 (Cohen et al., (1987) J. Virol. 61- 50-59) and the cell culture-adapted variant, pHAV/7 (ATCC accession no. 67495). The nucleotide residues at positions 2864, 4185 and 6216 in all five HM-175 P39 virus isolates differ from the residues at these positions in the published sequence for wild-type HM-175 [(Cohen et al., (1987) J. Virol 61 :50-59)]. The nucleotide residues present in the HM-175 P39 clones at positions 2864, 4185 and 6216 were present in some wild-type HM-175 cDNA clones and represent microheterogeneity [(Cohen et al., (1987) PNAS 84:2497-2501; (1987) J. Virol 61 :50-59)]. Therefore, the nucleotide residues at positions 2864, 4185 and 6216 in the HM-175 P39 clones are considered to be wild-type. The residues in the HM-175 P39 isolates at these 3 positions most likely represent the majority wild-type population.

HM-175 P39 clone 17 had no additional nucleotide changes. The remaining four virus isolates (clones 8, 13, 15 and 16) however did have additional nucleotide changes as shown in Table 4.

Table 4

Additional Nucleotide Differences Unique to Each HM-175 P39 Virus Clone

Nucleotide Amino acid

Virus Nucleotide Wild-Type HM-175 Wild-Type HM-175 Clone Position (sene) HM-175 P39 Clones HM-175 P39 Clone 0 clone 8 366 (5'NC) C T

2268 (VPl) C T Proline Serine

3314 (2A) T C

5690 (3C) C T clone 13 461 1 (2C) T G Serine Alanine 4730 (2C) A C 5 clone 15 857 (VP2) T A clone 16 5606 (3C) G A clone 17 no changes

HM-175 P39 clone 8 had four nucleotide changes (nucleotide residues 366, 2268, 0

3314 and 5690), only one of which resulted in an amino acid change; the C -> T mutation at nucleotide residue 2268 in VPl resulted in a proline to serine change in the predicted amino acid sequence. The HM-175 P39 clone 13 isolate had two unique nucleotide changes in 2C (nucleotide residues 461 1 and 4730). The 5 mutation at nucleotide residue 461 1 resulted in a change in predicted amino acid sequence (serine -> alanine) while the change at nucleotide residue 4730 was a silent mutation. HM-175 P39 clone 15 had a single nucleotide change at residue 857 which was a silent mutation in VP2. HM-175 P39 clone 16 also had a single Q additional change which was a silent mutation at nucleotide residue 5606 in the 3C gene.

Conclusions

Virus isolates were biologically cloned from AGMK cells in order to c select virus clones that replicated well in the AGMK cell line that is certified for vaccine production. Kinetic assays demonstrated that all the virus isolates ⁰ replicated in AGMK cells at comparable rates. RIFA analysis demonstrated that, on average, four of the virus isolates (clones 8, 15, 16 and 17) formed large foci while the fifth isolate (clone 13) formed smaller foci. All the virus isolates were at least partially attenuated for tamarins. Clone 13 was less attenuated than the other isolates. Interestingly, sequence analysis showed that there was a single unique amino acid change in the clone 13 isolate and this change was in 2C. Previous studies have demonstrated the importance of 2C sequence for virulence of HM-175 in tamarins. All of the HM-175 P39 isolates studied were attenuated for chimpanzees. Clone 8 was overattenuated for chimpanzees as inoculation with

10 clone 8 virus did not result in seroconversion to anti-HAV positivity in either animal. Preliminary observations suggest that some of the HM-175 P39 virus isolates analyzed in this study may be promising candidates for use as a live attenuated vaccine. HM-175 P39 clone 15 appears to have the growth and _j r attenuation properties that are desirable in a live vaccine for HAV as it is partially attenuated for tamarins and fully attenuated for chimpanzees. HM-175 39 clone 13 may also be a potential vaccine candidate as it replicates efficiently in tamarins, resulting in moderate increases in serum liver enzyme levels and early seroconversion to anti-HAV positivity (week 3) (although the levels of enzyme 0 elevations are not as high as those observed in tamarins infected with wild-type HM-175, in which peak ICD levels are typically between 8,000-15,000 u/ml) but is still fully attenuated for chimpanzees. Moreover, HM-175 P39 clone 13 replicates to higher levels in chimpanzees than does clone 15; virus was detected in feces of 5 both chimpanzees inoculated with clone 13 (Figure 5C and 5D) whereas the levels of virus excreted in chimpanzees inoculated with clone 15 was too low to be detected by the standard PCR assay (Figure 5E and 5F).

EXAMPLE 5 0 Identification of Cell Line Clones That Replicate HAV With Greater Efficiency

In order to identify cell line clones that replicate HAV with greater efficiency, the ability of HAV to replicate in clonal populations of AGMK cells 5 derived from a certified cell line was examined. Clonal cell lines were established from the population of certified

AGMK cells these cells are publicly available (see U.S. Patent No. 5,646,033) by limit dilution. Cells were plated in 100 mm tissue culture dishes at limiting concentrations so that individual colonies of cells were well separated from each other. When the isolated colonies of cells were visible by eye, the locations of the colonies were marked on the bottom of the culture dish, the medium was removed and the cells were overlaid with 2% Sea Plaque Agar diluted 1 : 1 with 2x MEM containing 2x glutamine. When the agar had solidified at room temperature, an agar plug directly above each colony was removed using a sterile glass tube or pipette and 100-300 μl of trypsin solution was added into the well to detach the cells. The cells from each colony were plated in one well each of a 24-well plate and the cells were grown in a 37°C CO incubator. When the cells were confluent, they were trypsinized and were passed to one well of a 6-well plate. When the cells were confluent in the 6-well plate, they were again trypsinized and 80% of the cells were passed to a T-25 flask and the rest were plated on glass coverslips in 3 wells of a 24-well plate. The cells on coverslips were infected with HAV and growth of virus was monitored using an immunofluorescence assay [Emerson et al., (1991) J. Virol 65:4882-4886]. The cells in the T-25 flasks were amplified and cell line stocks were generated.

The ability of 56 different AGMK clonal cell lines established by limit dilution to replicate HAV (HM-175 pass 32) was first evaluated using an immunofluorescence assay [Emerson et al., (1991), J. Virol 65:4882-4886]. The criteria used to evaluate the relative growth efficiency of HM- 175 P32 in these clonal cell lines included how quickly HAV-positive cells appeared, how quickly the virus spread from cell to cell and the intensity of the staining reaction.

The most promising clonal cell lines (as determined from the immunofluorescence analysis) were further analyzed by end-point dilution analysis for their abilities to replicate HAV. A stock of HM-175 P32 virus was serially diluted and cells in a 96-well plate were incubated with 200 μl of diluted virus suspension for 2 to 4 hours at 34.5°C in a CO₂ incubator. At the end of the incubation period, the virus suspension was removed and the cells were washed 3 times each with 10% DMEM (Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum, glutamine and nonessential amino acids). Fresh medium ( 200 μl) was added to each well and the cells were incubated at 34.5°C in a CO₂ incubator for 10 days. The cells and medium were harvested in a total volume of 400 μl and the cells were lysed by at least 3 cycles of freeze/thawing. Extraction of RNA with Trizol reagent (Gibco-BRL) and quantification of RNA by slot blot analysis were performed as outlined in Raychaudhuri et al. (1998 J. Virol. 72:7467- 7475). End-point dilution analysis demonstrated that several clonal AGMK cell lines (AGMK #7, #45, #33, #50) replicated HM-175 P32 virus more efficiently than did the uncloned AGMK cells (Figure 6).

As the AGMK #50 cell line was representative of a clonal cell line that replicated HAV significantly more efficiently than did the uncloned AGMK cells kinetic studies were performed to evaluate the ability of the HAV/7 strain (which is produced from the plasmid pHAV/7 having ATCC accession number 67495; pHAV/7 differs from the P-32 virus in that it has wild-type nucleotides at positions 7032 and 7430) of HAV to replicate in the uncloned AGMK cells and in the AGMK #50 cell line. In the kinetic assay, cells were infected at a high multiplicity of infection (MOI) to ensure that almost every cell was infected (Raychaudhuri et al., (1998)). Results from these studies demonstrated that the HAV/7 virus replicated more efficiently in AGMK#50 cells than it did in the uncloned AGMK cells (Figure 7). Thus, The yields of potential vaccine strains are likely to be improved by growing the viruses in AGMK #50 cells.

EXAMPLE 6

Analysis of Virus Distribution in Cells and in Media

The relative distribution of intracellular virus and virus released into the medium is important if only cell-associated virus is retained during the vaccine purification process. For example, only cell-associated virus is retained during the purification process used to produce the MRC-5 virus of the HM-175 strain marketed under the brand name HAVRIX^®. In order to determine whether there were any differences among the cell line clones in the amount of virus that remained associated with the cells, the end-point dilution assay was repeated and the amounts of cell-associated virus and virus in the medium were quantified separately. The results of this analysis demonstrated that there were differences in the relative distribution of virus among the different AGMK clonal cell lines. Approximately 60% of the virus harvested from the uncloned AGMK cells was cell-associated and the remaining 40% was present in the medium (Figure 8). The results shown in Figure 8 again demonstrate that the clonal cell lines #33, #45 and #50 replicated HAV significantly more efficiently than did the uncloned AGMK cells. However, while the distribution of virus between cells and medium in the clonal cell lines #33 and #45 was comparable to that seen in the uncloned AGMK cells (~60 - 70% of the virus was cell-associated and -30 - 40% was present in the media), -95% of the virus harvested from AGMK#50 cells was cell-associated while only -5% was present in the medium (Figure 8). Thus, since the cell substrate and not the medium is the source of virus for the vaccine purification process used for the HM-175 [D'Hondt, E. et al (1990) Prog Med Virol 37: 72-95] and CR326 [Provost et al (1986) J. Med Virol 19:23-31] vaccines that are currently on the market, the yield of virus may be improved by utilizing AGMK #50 cells as the substrate for production of virus since HM-175 P32 virus replicated more efficiently in AGMK#50 cells than it did in the uncloned AGMK cells and the vast majority of the virus synthesized in AGMK #50 cells (95%) remained cell- associated.

EXAMPLE 7

Relative Titers of Virus Harvested From Uncloned AGMK Cells and AGMK #50 Cells

Cells were cultured in T-25 flasks and when they were confluent, they were infected with either the GR4 chimera [Raychaudhuri et al., (1998) J. Virol. 72:7467-7475], HM-175 P39 clone 15 isolate or the MRC-5 virus [Funkhouser et al., (1994) J. Virol. 68:148-157] at a low MOI. Cells in the T-25 were incubated with 2.0 x 10⁵ or 4.0 x 10⁵ radioimmunofocus forming units (RFU) of virus in 2 ml of 10% DMEM for 2 - 4 hours at either 34.5°C or 37°C in a CO₂ incubator. After incubating for 7 or 10 days in the CO incubator, the cells were trypsinized and diluted either 2-fold (total volume of 12 ml) or 3-fold (total volume of 18 ml) with 10% DMEM. The diluted cells were distributed either onto glass ° coverslips in 24-well plates or into T-25 flask(s) as follows: 6 aliquots of 1 ml each onto glass coverslips and 6 ml into T-25 ml flask(s). Incubation was continued in the CO₂ incubator as before and periodically, the cells on glass coverslips were analyzed for presence of HAV by an immunofluorescence assay [Emerson et al., (1991) J. Virol. 65:4882-4886]. When the cells were >80% positive for HAV, the cells in the T-flask were trypsinized and were harvested in a total volume of 1 ml. Virus was typically harvested from uncloned AGMK cells and AGMK #50 cells between 14 and 18 days after infection. The cells were lysed by at least 3 cycles of freeze/thawing to release virus and the virus titer was quantified by

10 radioimmunofocus assay [RIFA; Raychaudhuri et al., (1998) J. Virol. 72:76-7467-

7475]. As shown in Table 5, the GR4 chimera, HM-175 P39 clone 15 virus or the MRC-5 HAV-4380 virus (Institut Pasteur accession number 1-936) replicated to approximately 2-fold higher titers in the AGMK #50 cells than in the uncloned

, _c AGMK cells at 37 °C in medium containing serum.

Table 5

Virus Titers As Determined By RIFA For Viruses Harvested From Uncloned AGMK Cells And From AGMK #50 Cells Grown In Serum-Containing Medium

Average virus Average of 0 Virus Cells Temperature titer (RFU/ml) no. ofexDts

GR4 uncloned AGMK 37°C 4.44 x 10⁷ 3

GR4 AGMK #50 37°C 7.82 x 10⁷ 3

HM-175 P39 clone 15 uncloned AGMK 37°C 7.54 x lO⁷ 3 5 HM-175 P39 clone 15 AGMK #50 37°C 1.61 x lO⁸ 3

MRC-5 uncloned AGMK 37°C 6.43 x 10⁷ 2

MRC-5 AGMK #50 37°C 1.38 x 10⁸ 2

MRC-5 uncloned AGMK 34.5°C 1.13 x 10^s 2

30 MRC-5 AGMK #50 34.5°C 1.40 x lO⁸ 2

MRC-5 MRC-5¹ 34.5°C 7.62 x 10⁷ 2

5 EXAMPLE 8

Virus replication in AGMK cells in serum-free medium

In an effort to produce vaccine strains of virus in the absence of bovine products in order to eliminate the possibility of introducing pathogens into the vaccine preparations, virus replication of GR4 and HM-175 P39 clone 15 was examined in uncloned AGMK cells and in AGMK #50 cells grown in serum-free medium. Both the parent uncloned AGMK cells as well as the clonal AGMK #50 cells grew in serum-free medium.

Table 6

Virus Titers As Determined By RIFA For Viruses Harvested From Uncloned AGMK Cells And AGMK #50 Cells Grown In Serum-Free Medium

Average of

Virus Cells Temperature Virus Titer (RFU/ml) no of exots

GR4 uncloned AGMK 37°C 3 25 x l0⁷ 2

GR4 AGMK #5Q 37°C 5 19 x l0⁷ 2

HM-17₅ P39 clone uncloned AGMK 37°C 1 18 x 10* 2

15 AGMK #50 37°C 1 45 x 10* 2

HM-175 P39 clone uncloned AGMK 37°C 945 x l0⁷ 2

15 AGMK #50 37°C 7 77 x l0⁷ 2

MRC-5

MRC-5

GR4 uncloned AGMK 34 5°C 3 53 xlO⁷ 2

GR4 AGMK #50 34 5°C 4 ₅6 x 10⁷ 2

HM-175 P39 clone uncloned AGMK 34 5°C 8 88 10⁷ 2

15 AGMK #50 34 5°C 1 38 x 10⁸ 2

HM-175 P39 clone uncloned AGMK 34 5°C 4 ό9 x 10⁷ 2

15 AGMK #50 34 5°C 6 12 x 10⁷ 2

MRC-5

MRC-5

In particular, the GR4 chimera and the HM-175 P39 clone 15 virus replicated to 1.2-fold to 1.6-fold higher titers in AGMK #50 cells than in the uncloned AGMK cells at either 37°C or 34.5°C, respectively (Table 6). The MRC-5 ° virus also replicated in AGMK #50 cells in serum-free medium to titers that were

1.3-fold and 0.8-fold the titers obtained from harvests from uncloned AGMK cells at 34.5°C and 37°C, respectively (Table 6). In addition, the MRC-5 virus HAV- 4380, which is the virus strain used as an inactivated vaccine, also replicated in both the uncloned and cloned (#50) AGMK cells and in the absence of serum (Table 6). Moreover, a comparison of the data presented in Tables 5 and 6 revealed that the titers of the two different strains of HAV (GR4 and HM-175 P39 clone 15) did not differ greatly when virus was harvested from cells grown either in the presence (Table 5) or absence of (Table 6) fetal bovine serum. 10 By comparison, the MRC-5 cells that are currently the substrate for production of inactivated HAV vaccines do not grow in the absence of serum. Thus, the ability of both the parent and clonal populations of AGMK cells to grow in serum-free medium is therefore a significant advantage that these cell lines have

15 over the MRC-5 cells.

CONCLUSION

With the availability of a continuous AGMK cell line that is acceptable for vaccine production, the number of HAV strains that can be considered for vaccine development has been greatly expanded. Methods that

20 increase the yield of virus obtained during the vaccine production process should decrease the cost of production of the vaccine. Results of our studies have shown that several clonal cell lines replicate HAV more efficiently than does the parent uncloned AGMK cell line. Harvesting of only the cell-associated virus makes

25 AGMK #50 a promising cell substrate for maximizing virus yield since >90% of the virus remains cell-associated. Moreover, potential HAV vaccine candidates replicate in uncloned AGMK cells and in AGMK #50 in the absence of serum. Thus, clonal cell lines such as AGMK #50 that replicate potential HAV vaccine

-_ strains more efficiently than do parental uncloned AGMK cells could be used as the cell substrate for manufacturing vaccines, thereby making production and administration of the vaccine less expensive, and hence, more available for use worldwide. In addition, the AGMK #50 cells would not be limited to use for HAV vaccine production as other viruses e.g., human rotavirus) that replicate in the

35 licensed AGMK cells may also replicate more efficiently in this clonal cell line.

Claims

1. An attenuated hepatitis A virus whose genome has a nucleotide sequence corresponding to the sequence of wild-type HM-175 except for nucleotide positions 131-134 which are deleted; nucleotide positions 203-207 from which a single thymine is deleted; nucleotide positions 124, 3919, 4043, 4222 and 7032 which have cytosines as bases; nucleotide positions 152, 964, 3196 and 7430 which have guanines as bases; nucleotide positions 3025, 3889, 4087 and 5232 which have thymines as bases; and nucleotide positions 1742, 4563, 5204, 6147 and 6522 which have adenines as bases.

2. An attenuated hepatitis A virus whose genome has a nucleotide sequence corresponding to the sequence of wild-type HM-175 except for nucleotide positions 131-134 which are deleted; nucleotide positions 203-207 from which a single thymine is deleted; nucleotide positions 124, 3919, 4043, 4222 and 7032 which have cytosines as bases; nucleotide positions 152, 964, 3196 and 7430 which have guanines as bases; nucleotide positions 3025, 3889, 4087 and 5232 which have thymines as bases; and nucleotide positions 1742, 4563, 5204, 5606, 6147 and 6522 which have adenines as bases.

3. An attenuated hepatitis A virus whose genome has a nucleotide sequence corresponding to the sequence of wild-type HM-175 except for nucleotide positions 131 -134 which are deleted; nucleotide positions 203-207 from which a single thymine is deleted; nucleotide positions 124, 3919, 4043, 4222 and 7032 which have cytosines as bases; nucleotide positions 152, 964, 3196 and 7430 which have guanines as bases; nucleotide positions 3025, 3889, 4087 and 5232 which have thymines as bases; and nucleotide positions 857, 1742, 4563, 5204, 6147 and 6522 which have adenines as bases.

4. An attenuated hepatitis A virus whose genome has a nucleotide sequence corresponding to the sequence of wild-type HM-175 except for nucleotide positions 131-134 which are deleted; nucleotide positions 203-207 from which a single thymine is deleted; nucleotide positions 124, 3919, 4043, 4222, 4730 and 7032 which have cytosines as bases; nucleotide positions 152, 964, 3196, 4611 and 7430 which have guanines as bases; nucleotide positions 3025, 3889, 4087 and

10 5232 which have thymines as bases; and nucleotide positions 1742, 4563, 5204, 6147 and 6522 which have adenines as bases.

5. An attenuated hepatitis A virus whose genome has a

15 nucleotide sequence corresponding to the sequence of wild-type HM-175 except for nucleotide positions 131-134 which are deleted; nucleotide positions 203-207 from which a single thymine is deleted; nucleotide positions 124, 3314, 3919, 4043, 4222

7 ^ΔVJ and 7032 which have cytosines as bases; nucleotide positions 152, 964, 3196 and

7430 which have guanines as bases; nucleotide positions 366, 2268 3025, 3889,

4087, 5232 and 5690 which have thymines as bases; and nucleotide positions 1742,

25 4563, 5204, 6147 and 6522 which have adenines as bases.

6. The virus of claim 3, wherein said virus has ATCC accession number VR-2644.

30 7. The virus of claim 4, wherein said virus has ATCC accession number VR-2645.

8. The virus of claim 5, wherein said virus has ATCC accession

35 number VR-2646.

9. An isolated nucleic acid molecule encoding the attenuated hepatitis A virus of claim 1.

10. An isolated nucleic acid molecule encoding the attenuated hepatitis A virus of claim 2.

11. An isolated nucleic acid molecule encoding the attenuated hepatitis A virus of claim 3.

12. An isolated nucleic acid molecule encoding the attenuated hepatitis A virus of claim 4.

13. An isolated nucleic acid molecule encoding the attenuated hepatitis A virus of claim 5.