WO2001009180A1

WO2001009180A1 - Creating novel biosensors from natural biological receptors

Info

Publication number: WO2001009180A1
Application number: PCT/US2000/021056
Authority: WO
Inventors: Deborah A. Lannigan; Ian G. Macara; Quansheng Du
Original assignee: University Of Virginia Patent Foundation
Priority date: 1999-08-02
Filing date: 2000-08-02
Publication date: 2001-02-08
Also published as: AU6618300A

Abstract

The present invention relates to modified natural receptors that are modified to bind to new compounds and the use of those modified receptors to prepare detection systems for identifying compounds present in a complex mixture.

Description

Creating Novel Biosensors from Natural Biological Receptors

US Government Rights

This invention was made with United States Government support under Grant No. DAAG55-97- 1 -0008, awarded by the Army Research Office. The United States Government has certain rights in the invention.

Field of the Invention

The present invention is directed to recombinant receptors that have been modified relative to their corresponding native receptors to specifically interact with a ligand that does not bind to the native receptor.

Background of the Invention

Present technologies for the detection of organic compounds in complex mixtures usually require the extraction of the organic compound followed by high performance liquid chromatography and gas chromatography/mass spectrometry, or specialized tests for a restricted number of compounds. It is highly desirable to have a single assay system that can rapidly and simultaneously detect thousands of different chemicals from complex mixtures in the environment. The present invention provides a detection system that can rapidly and simultaneously detect thousands of different and chemically diverse compounds from complex mixtures in the environment. Living organisms use protein receptors to detect these compounds. Given the complexity of protein structure, it is anticipated that receptors could be created that are specific for any organic compound, either synthetic or natural.

Although no previous studies have ever attempted or proposed to create biological receptors with novel specificities to xenobiotics by mutagenesis and in vitro evolution, extensive work in protein engineering has been done to improve enzyme efficiencies and to create enzymes with modified specificities. For example, by directed mutagenesis of the substrate binding pocket lactate dehydrogenase has been reengineered to convert the substrate specificity to malate [ Wilks et al. Science 242, 1541-1544 (1988); Wilks et al. Curr. Opin. Biotech. 2, 561-567 (1991)] and the bacterial xylose isomerase has been altered to a glucose isomerase [Meng et al. Proc. Natl. Acad. Sci. USA 88, 4015-4019 (1991)]. Random mutagenesis of a serine protease has been used to create new enzymes with altered specificities [Graham et al. Biochem. 32, 6250-6258 (1993)] and the substrate preferences of carboxypeptidase Y have also been modified [Oleson et al, Protein Engin. 6, 409-415 (1993)].

Additionally, random mutant libraries have been used in a phage display system to identify antibody fragments that possess increased affinities for their antigen [Deng et al. J. Biol. Chem. 269, 9533-9538 (1994); Glaser et al. J. Immunol. 149, 3903-3913 (1992)]. Finally, point mutations have been introduced into the fibroblast and glucocorticoid receptors that alter their affinities and specificities for a series of agonists [Seddon et al. Biochem. 34,731-736 (1995); Chen et al. Molec. Endocrinol. 8,422-430 (1994)], and a point mutation in the androgen receptor (T868 - >A) reduces specificity for androgen and allows the binding of other steroids such as estrogen [Ris-Stalpers et al. Biochem. Biophys. Res. Commun. 196, 173-180 (1993)]. Point mutations in the estrogen receptor are also known that interfere with estradiol binding or alter the affinity for the antagonist, tamoxifen [Catherino et al. Molec. Endocrinol. 9:1053-1063 (1995); Wrenn et al. J. Biol. Chem. 268, 24089-24098 (1993); Ekena et al. j. Biol. Chem. 272, 5069-5075 (1999)]. Finally, U.S. Patent 5,874,534, the disclosure of which is incorporated herein by reference, discloses the use of mutated steroid hormone receptors as genetic switches for regulating expression in gene therapy applications.

There exists a need for a detection system that can screen a sample for the presence of one or more analytes. The present invention is directed to a novel detection system that uses biological receptors modified to have novel specificities for xenobiotics/non-native ligands. In particular, the present invention describes the development of "designer receptors" by in vitro evolution and selection, using endogenous biological receptor proteins as a starting point. The receptor specificity of endogenous receptor proteins is altered to bind to the desired target compound through the process of re-iterative random mutagenesis and selection. The designer receptors can be arrayed on a solid matrix, and form the basis of a multiplex biosensor, or artificial "nose". Such biosensors have a wide range of applications in the real-time detection of target organic compounds in the pharmaceutical, environmental, agricultural, defense and medical diagnostics industries.

Summary of the Invention The present invention is directed to novel binding entities and the use of those entities to detect the presence of an analyte in a sample. In particular, the invention is directed to novel signaling complexes that comprising a novel binding substrate in combination with a signaling system. The novel binding entity is preferably a native receptor that has been modified to alter its ligand specificity, and the signaling system comprises one or more compounds that produce a detectable signal upon binding of the specific ligand to the novel receptor. In accordance with one embodiment, one or more of the signaling complexes are bound to a solid matrix to form an analyte detector.

The present invention advantageously provides for custom development of receptors that detect a target compound, and the ability to create multiple receptors/sensing elements for each target. In addition, detection devices constructed from the modified receptors of the present invention allow for multiplexing - detection of many targets simultaneously and custom modification of the concentration range that can be detected. Furthermore the detection devices of the present invention can utilize a common signaling system for detecting analytes, so a standard detector is used for detecting a broad range of analytes.

Brief Description of the Drawings

Fig. 1 is a schematic representation of the functional domains of the estrogen receptor.

Fig. 2 is a graph demonstrating the growth response of yeast transformed with the indicated estrogen receptor (A430D, N519H or wild type) and cultured in Trp-, His- media containing 25 μM methoxychlor.

Fig. 3 is a graph demonstrating the growth response of yeast transformed with the indicated receptor in Trp- , His- media containing 5μM dieldrin, DDT or methoxychlor. Fig. 4 displays the sequence of the junctions between the 3' end of the Gal4-DNA binding domain and the C-terminal region of the estrogen receptor (ACTGTATCGCCGGAATTAGGATCCGGGTCTGCT; SEQ ID NO: 1) and the junction between the C-terminal region of the estrogen receptor and the VP16 activation domain (GCCACAGTCGAATTCGTACCGAGC; SEQ ID NO: 2). The remaining 3' end of the VP16 gene sequence containing the Pst I restriction site is also shown (TACGGTGGGTAACTGCAGCCAAGC; SEQ ID NO: 3)

Detailed Description of the Invention In describing and claiming the invention, the following terminology will be used in accordance with the definitions set forth below.

As used herein, "nucleic acid," "DNA," and similar terms also include nucleic acid analogs, i.e. analogs having other than a phosphodiester backbone. For example, the so-called "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention.

This invention also encompasses nucleic acid molecules characterized by changes in non-coding regions that do not alter the phenotype of the polypeptide produced therefrom when compared to the nucleic acid molecule of the present invention. As used herein, the term "nucleic acid" encompasses RNA as well as single and double-stranded DNA and cDNA.

The term "peptide" encompasses a sequence of 3 or more amino acids wherein the amino acids are naturally occurring or synthetic (non-naturally occurring) amino acids. Peptide mimetics include peptides having one or more of the following modifications:

1. peptides wherein one or more of the peptidyl ~C(O)NR~ linkages (bonds) have been replaced by a non-peptidyl linkage such as a ~CH₂-carbamate linkage (-CH₂OC(O)NR~), a phosphonate linkage, a -CH₂-sulfonamide (-CH₂~S(O)₂NR~) linkage, a urea (~NHC(O)NH~) linkage, a ~CH₂ -secondary amine linkage, or with an alkylated peptidyl linkage (~C(O)NR~) wherein R is C,-C₄ alkyl;

2. peptides wherein the N-terminus is derivatized to a --NRR, group, to a ~NRC(O)R group, to a -NRC(O)OR group, to a ~NRS(O)₂R group, to a ~ NHC(O)NHR group where R and R, are hydrogen or C,-C₄ alkyl with the proviso that R and R, are not both hydrogen;

3. peptides wherein the C terminus is derivatized to ~C(O)R₂ where R₂ is selected from the group consisting of C,-C₄ alkoxy, and ~NR₃R₄ where R₃ and R₄ are independently selected from the group consisting of hydrogen and C,-C₄ alkyl.

Synthetic or non-naturally occurring amino acids refer to amino acids which do not naturally occur in vivo but which, nevertheless, can be incorporated into the peptide structures described herein. The resulting "synthetic peptide" contain amino acids other than the 20 naturally occurring, genetically encoded amino acids at one, two, or more positions of the peptides. For instance, naphthylalanine can be substituted for trytophan to facilitate synthesis. Other synthetic amino acids that can be substituted into peptides include L-hydroxypropyl, L-3,4-dihydroxyphenylalanyl, alpha-amino acids such as L-alpha-hydroxylysyl and D-alpha-methylalanyl, L-alpha.- methylalanyl, beta.-amino acids, and isoquinolyl. D amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides. Other derivatives include replacement of the naturally occurring side chains of the 20 genetically encoded amino acids (or any L or D amino acid) with other side chains. As used herein, the term "conservative amino acid substitution" are defined herein as exchanges within one of the following five groups: I. Small aliphatic, nonpolar or slightly polar residues:

Ala, Ser, Thr, Pro, Gly;

II. Polar, negatively charged residues and their amides:

Asp, Asn, Glu, Gin;

III. Polar, positively charged residues: His, Arg, Lys;

IV. Large, aliphatic, nonpolar residues:

Met Leu, He, Val, Cys

V. Large, aromatic residues:

Phe, Tyr, Trp

As used herein the term "analyte" refers to any compound that is capable of specifically binding to another molecule, including organic compounds, for example alkanes, alkenes, alkynes, dienes, alicyclic hydrocarbons, arenes, alcohols, ethers, ketones, aldehydes, carbonyls, carbanions, polynuclear aromatics and derivatives of such organics, e.g., halide derivatives, etc., and biomolecules, such as proteins, sugars, isoprenes and isoprenoids, fatty acids, industrial pollutants, herbicides, pesticides, drugs, and metabolites of such biomolecules, chemical warfare agents and explosives residues and derivatives thereof.

The term "steroid hormone receptor" as used herein refers to the superfamily of steroid receptors and their biofunctional equivalents. Representative examples of such receptors include the estrogen, progesterone, glucocorticoid-alpha, glucocorticoid-beta, mineralocorticoid, androgen, thyroid hormone, retinoic acid, retinoid X, Vitamin D, COUP-TF, ecdysone, Nurr-1 and orphan receptors. Steroid hormone receptors are composed of a transactivation domain, a DNA binding domain and a ligand binding domain. The transactivation domain regulates transcriptional activity, the DNA binding domain binds to the upstream activation sequence and the ligand binding domain binds the specific biological compound (ligand) to activate the receptor.

As used herein, the term "ligand binding domain" of a receptor encompasses the natural or synthetic portions of the full-length receptor that are capable of specific binding to the receptor's ligand. As used herein, the term "biofunctional equivalents" of a protein encompasses derivatives of the protein that contain deletions, insertions or conservative amino acid substitution relative to the native protein, yet retain the activity of the native protein. For example a biofunctional equivalent of an estrogen receptor ligand binding domain would include any derivative protein that retained its ability to specifically bind to estradiol.

As used herein, the term "non-native ligand" refers to compounds that do not detectably bind, or bind weakly to the ligand binding domain of a natural receptor.

As used herein, the term "signaling entity" refers to an entity that provides a detectable signal when certain conditions are met. The detectable signal may be a change in the quantity/level of the signal or in the quality of the signal. For example, the level of fluorescence or the wavelength emitted by a fluorophore. As used herein the term "fluorophore" will be understood to refer to both fluorophores and luminophores and chemical agents that quench fluorescent or luminescent emissions.

As used herein a "FRET pair" refers to an acceptor and donor fluorophore wherein the emission wavelength of the donor fluorophore overlaps with the excitation wavelength of the acceptor fluorophore.

As used herein the term "self activating" refers to a receptor that activates the expression of a gene linked to the receptors' corresponding UAS regardless of whether or not the receptor is bound to its ligand. As used herein the term "DNA binding domain" refers to a protein domain that interacts with a specific DNA sequence.

As used herein the term "UAS" refers to a genetic regulatory sequence that interacts with the DNA binding domain.

As used herein the term "solid support" relates to a solvent insoluble substrate that is capable of forming linkages (preferably covalent bonds) with soluble molecules. The support can be either biological in nature, such as, without limitation, a cell or bacteriophage particle, or synthetic, such as, without limitation, an acrylamide derivative, agarose, cellulose, nylon, silica, or magnetized particles. The solid support can be in particulate form or can be monolythic. As used herein the term "transactivation protein" relates to a protein that is capable of binding to a specific upstream activation sequence and activating the expression of a gene operably linked to the upstream activation sequence. A transactivation protein comprises a DNA binding domain and an activation domain. An upstream activation sequence is a synthetic or naturally occurring DNA sequence that, when functionally inserted into a heterologous promotor can regulate expression of the operably linked gene based on whether the transactivation protein is bound to the upstream activation sequence.

As used herein the term "pro-toxin" refers to a compound that becomes toxic to a cell after coming in contact with an activator. In the absence of the activator the pro-toxin has no toxicity or only a low level of toxicity. In one example the pro- toxin is a harmless compound that is converted into a toxic compound by the action of a specific enzyme. In the absence of the enzyme, no toxin is produced. The term "ligand" refers to any compound which binds to the ligand binding domain of a receptor and which may alter the activity of the receptor positively or negatively.

A "mutant" receptor refers to an alteration of the primary sequence of a receptor such that it differs from the wild type or naturally occurring sequence. A "modified" receptor refers to a receptor that has been mutated to bind a non-native ligand and includes the entire receptor (comprising the transactivation, DNA binding and ligand domains) as well as functionally active portions of the receptor such as the ligand binding domain. As used herein the term "expression vector" refers to a DNA plasmid that contains all of the information necessary to produce a recombinant protein in a heterologous cell.

The term "permissive conditions" refers to cell culture conditions that allow a cell to grow whereas the term "restrictive conditions" refers to culturing cells under conditions that would prevent cell replication absent of some further modification of the cell. For example in the case of an auxotrophic mutant cell, permissive conditions would mean culturing the cell in the presence of nutrient the cell can not manufacture, whereas the restrictive conditions would mean culturing the cell in the absence of that nutrient.

Detailed Description of the Invention

Living organisms have produced many polypeptides the function of which is to recognize small organic molecules with exquisite specificity and selectivity. For example, a family of closely related G-protein coupled receptors present in the nasal epithelium has evolved to detect many thousands of different odorants. This observation led to the realization that, in principle, a similar type of evolution could be undertaken in the laboratory, so that a single receptor could be modified in order to create many new receptors with altered specificity. Such a process requires an existing receptor as the starting point, the development of libraries of mutant receptors, and an efficient screen.

In accordance with the present invention, a known receptor is modified, allowing the receptor to specifically bind to a non-native ligand, wherein binding of the non-native ligand activates the receptor. In accordance with one embodiment, the receptor is modified to change its affinity from its natural ligand to a ligand that the natural receptor normally does not specifically bind (i.e. the modified receptor binds the non-native ligand instead of its natural ligand). One preferred group of receptors suitable for modification in accordance with the present invention includes the steroid hormone receptors and their functional equivalents.

Steroid hormone receptors have protein domains for 1) binding to a specific DNA sequence (the upstream activation sequence), 2) binding to a specific ligand (the ligand binding domain) and 3) a transactivation domain (see Fig. 1). Steroid hormone receptors are capable of regulating the expression of genes that are operably linked to the upstream activation sequence (UAS) specific for that steroid hormone receptor. After the receptor binds to its ligand, the receptor becomes "activated" and becomes able to bind to the UAS and initiate expression of the linked gene. The ability of the steroid hormone receptors to regulate gene expression has been used in accordance with the present invention to prepare the modified receptors that are activated by non-native ligands.

The process of creating novel, specific receptors against chosen target compounds is conducted by using the re-iterative in vitro evolution and selection (IVES) of existing biological receptors. This process is referred to as an IVES engine. In accordance with one embodiment, the IVES engine used to create and select the desired receptor utilizes an auxotrophic host cell, wherein the host cell contains a gene necessary for the host cell to grow under restrictive conditions, and the necessary gene is under the control of an inducible promoter. The inducible promoter is selected from those promoters that can be transactivated by a receptor when the receptor has interacted with its corresponding specific ligand. Receptor proteins that activate genes after interacting with a specific ligand are known to those skilled in the art, and include the steroid hormone receptors.

Suitable auxotrophic host cells for use in the present invention include any eukaryotic host cell that contains a single gene defect that prevents the cells from being grown under restrictive conditions without the expression of an exogenously introduced gene construct. In particular, useful cells include yeast, mammalian and insect cells, and in one preferred embodiment the host cell is an obligatory facultative yeast mutant wherein the mutant yeast cells can grow only under permissive conditions or upon the expression of an inducible gene. The necessary gene is activated only after the preselected target ligand binds to the modified receptor. Accordingly, detection of receptors having the desired modification can be detected by transforming such auxotrophic host cells with modified receptors and screening for cells that survive when cultured under the restricted conditions and in the presence of the target non-native ligand.

In accordance with one embodiment of the invention, a method is provided for preparing a library of nucleic acid sequences that encode for modified receptor binding domains. The method comprises the steps of identifying the specific regions of the receptor that are important in binding to the natural ligand and generating random mutations to the nucleic acid sequences encoding those regions. Identification of the regions within the ligand binding domain that play an important role in ligand binding can be achieved by several different techniques known to those skilled in the art. For example, sequences corresponding to the hormone-binding domains of different members of the family of steroid hormone receptors can be compared, and regions of low similarity chosen for modification. In addition comparison of receptor sequences from different species can be used to identify residues that are not important in determining specificity and help identify regions for modification. In addition crystallography or crosslinking experiments may identify important peptide sequences for ligand specificity. The nucleic acid sequences can then be modified using standard recombinant DNA technology, including site directed mutagenesis and PCR. The modified sequences can be inserted into a suitable vector to form a library. In one preferred embodiment the nucleic acid sequences encoding the modified receptor ligand binding domains are inserted into an expression vector. In particular, the mutated nucleic acid sequences are inserted into an expression vector wherein the receptor ligand binding sequences are joined in frame (operably linked) to nucleic acid sequences that encode a DNA binding domain and a transcriptional activation protein. The expression vector contains all the regulatory elements necessary for expression of a fusion protein consisting of a receptor ligand binding domain, a DNA binding domain and a transcriptional activation domain. This resulting fusion protein specifically interacts with the corresponding UAS site of the DNA binding domain and expresses an operably linked gene when the receptor ligand binding domain binds the ligand.

Auxotrophic host cells are then transformed with the nucleic acid constructs encoding the receptor fusion protein, wherein the host cell comprises a gene operably linked to an upstream activating sequence that binds to the DNA binding domain of the fusion protein. The gene linked to the UAS is necessary for survival of the cell when the cell is cultured under restrictive conditions, and that gene is only expressed when the receptor ligand binding domain becomes activated. Therefore, after the host cell is transformed with the fusion protein constructs and cultured under restrictive conditions and in the presence of the target analyte, which is a non-native ligand, those cells that contain an expressed fusion protein that binds to the target ligand and activates the necessary gene will survive and reproduce. Cells that do not induce the expression of the necessary gene will be unable to reproduce. Growing cells are then isolated and the nucleic acid sequences encoding the receptor fusion protein are isolated from the cells to obtain the modified receptor ligand binding domain having the desired analyte specificity.

In accordance with one embodiment the method of isolating modified receptors that bind to non-native ligands can be modified to eliminate fusion proteins that can transactivate genes in the absence of the non-native ligand. When the auxotrophic host cells are transformed with the fusion protein library, only those cells that are capable of expressing the necessary gene will survive. This includes cells that express the necessary gene as a result of the non-native ligand binding to fusion protein, as well as and cells that constitutively express the necessary gene due to a modification to the receptor ligand binding domain that activates the gene regardless of ligand binding to the fusion protein. Transformed cells that constitutively express the necessary gene are undesirable for the purpose of the present invention, and those cells will be removed by screening or selecting against cells that express the necessary gene in the absence of the target ligand. After removal of the cells that constitutively express the necessary gene, the remaining cells that survive when cultured under restrictive conditions should include cells that express novel receptors that bind the target non-native ligand. In one embodiment, cells containing a modified receptor that constitutively expresses the necessary gene can be selected against by further including in the host cell a gene construct that encodes an activator of a pro-toxin. The gene construct comprises a nucleic acid sequence encoding the activator wherein the expression of the activator is operably linked to an UAS that is activated by the modified receptor fusion protein. The pro-toxin is an organic chemical that is lethal to the cell when the cells express the activator. To eliminate the cells that contain a receptor fusion protein that transactivates genes regardless of the presence or absence of the ligand for that receptor, the cells are first cultured under permissive conditions in the presence of the pro-toxin and in the absence of the target analyte. Only those cells that constitutively express the activator will die. The surviving cells can then be cultured under restrictive conditions and in the presence of the target ligand to identify cells harboring the desired modified receptor binding ligand domain.

In accordance with one embodiment, the modified receptor library can be "cleaned" to remove constitutively active receptors through the use of a gene encoding orotidine-5'-phosphate decarboxylase (Ura3) as the activator. For example, using a yeast strain as the host cell, the original Ura3 gene can be replaced by a copy of a Gall promoter-controlled Ura3 gene cassette. The Ura3 gene encodes orotidine- 5'-phosphate decarboxylase, an enzyme required for the biosynthesis of uracil. It can also convert the pro-toxin, 5-fluoroorotic acid (5-FOA) to a toxic product, 5- fluorouracil, killing yeast cells. The Gall promoter is transactivated by the Gal4 DNA binding domain-estrogen receptor fusion protein, however certain modified estrogen receptors may be capable of transactivating the Gall promoter in the absence of the analyte (i.e. the receptor is self activating). Yeast cells transformed by library plasmid DNA encoding modified estrogen receptor constructs that are self-activating, will promote the expression of Ura3 gene and won't be able to grow on media containing 5-FOA. On the contrary, yeast cells transformed by non-self-activating plasmids will not be able to produce Ura3 and will grow on media containing 5-FOA. These yeast colonies are collected and pooled for use in subsequent screens against target compounds of interest. In addition to the Ura3/5-FOA system, other enzyme/toxic metabolite systems can be used to eliminate constitutively active mutants in an appropriately engineered yeast strain. Additional systems include the LYS2/α-aminoadipate or CANl/canavanine systems. (Sikorski et al. Method in Enzymology 194: 302-318 (1991).)

To isolate a recombinant yeast cell that expresses a modified receptor capable of binding to the preselected target analyte, a population of the facultative yeast cells (grown under permissive conditions) are transformed with the library of modified receptor encoding genes. A yeast host cell is selected that contains a gene whose expression is necessary for the cell's survival, when the cell is grown under restrictive conditions, wherein the necessary gene is expressed only after the modified receptor binds to the target analyte. For example, in one embodiment the receptor selected for modification is the estrogen receptor and the host cell used is a yeast strain that is defective in the production of an essential amino acid, such as histidine. This yeast cannot grow under restrictive conditions (i.e. using medium lacking histidine). The selection system is based on the ability of the receptor to activate a gene (HIS3) that allows for the production of histidine by the yeast. In accordance with one preferred embodiment, each member of the library of estrogen receptor mutant genes is ligated into a yeast vector so as to form a fusion protein with the Gal4 DNA binding domain. In this embodiment, the HIS3 gene is under the control of the Gall promoter which contains a Gal4 UAS. The fusion protein can activate transcription from the Gall promoter, but only in the presence of ligand. This type of construct provides a very sensitive and specific switch: in the absence of ligand, the fusion protein is inactive and the HIS3 gene is not expressed. On binding ligand, the fusion protein can induce transcription from the HIS3 gene, which permits the yeast to grow under restrictive conditions. Other transactivation systems that require ligand-receptor interaction to express a gene product are known to those skilled in the art and can be used in accordance with the present invention.

To select for modified receptors that can recognize new types of ligand (non-native ligands) the library is plated onto Trp-, His- medium containing the target compound of interest. Many hundreds of thousands of mutants can be screened simultaneously. Only yeast containing a modified receptor that can bind the target analyte and activate transcription of the HIS3 gene will grow. Using this procedure allows for the selection of a gene encoding a modified receptor. By repeating the procedure but altering the analyte present in the media different modified receptor can be identified from the same pool of transformed yeast cells and thus generating a library of modified receptor genes. After those cells expressing the modified receptors are identified, the gene encoding the mutated estrogen receptor can be isolated.

The present invention also encompasses the nucleic acid sequences that encode for the modified receptors of the present invention. In accordance with one embodiment, a DNA construct is provided wherein the construct comprises nucleic acid sequences encoding a modified receptor ligand binding domain. The DNA construct may further comprise the necessary sequences for replicating the DNA in a host cell and in one embodiment the nucleic acid sequence further comprises the necessary regulatory sequences for expressing the modified receptor ligand binding domain in a host cell. In one preferred embodiment the nucleic acid sequence encodes a fusion protein comprising the modified receptor ligand binding domain fused to the UAS binding domain of a transactivation protein.

One innovative feature of the present invention is the modification of the mutant receptors so that they generate a detectable signal upon ligand binding. The unique ligand binding substrates of the present invention can be selected to have specificities against a broad range of compounds and thus can be used to form detection systems for determining the presence and concentration of one or more analytes in a complex mixture. The analyte detection systems of the present invention comprises a modified receptor in combination with a signaling entity. The modified receptor is typically a modified steroid hormone receptor, wherein the receptor specifically binds to a non-native ligand. The signaling entity is one or more compounds that provide a detectable signal upon binding of the non-native ligand to the modified receptor.

In one preferred embodiment the modified receptor is a modified estrogen receptor wherein the modified estrogen receptor is covalently linked to a solid support. The signaling entity can be covalently linked to the modified receptor or it can be a separate compound. In accordance with one embodiment the signaling entity may comprise a compound that produces a signal only after the modified receptor binds to its specific ligand and undergoes a conformational change. For example the signaling entity may be a fluorophore (such as the green fluorescent protein) or a signaling protein, for example the Raf protein kinase (see Pritchard et al., Mol Cell Biol 15:6430-6442 (1995)) that is linked to, or otherwise associated with, the modified receptor so that the signal produced by the signaling entity is initially "quenched", but the signal becomes detectable after the modified receptor binds to its specific ligand and undergoes a conformational change.

The detection system of the present invention can be either cellular based or noncellular. In accordance with one embodiment the detection system comprises a eukaryotic host cell having a first nucleic acid sequence that encodes a modified receptor and a second nucleic acid sequence encoding a marker gene, wherein the expression of the marker gene is regulated by the modified receptor. In particular, the marker gene is operably linked to an upstream activating sequence that is activated by the modified receptor when the modified receptor is bound to the analyte. The marker gene can be any of the visible markers that have been previously used and are known to those skilled in the art including but not limited to fluorescent and luminescent proteins, luciferase and β-galactosidase based systems. One preferred marker gene is the green fluorescent protein.

In one preferred embodiment the host cell is a yeast cell that contains first a nucleic acid sequence that encodes a modified estrogen receptor, wherein the modified estrogen receptor specifically binds to an analyte other than estradiol. The yeast cell further contains a second nucleic acid sequence that encodes a fluorescent or luminescent protein, wherein the expression of the fluorescent or luminescent protein is under the control of the modified estrogen receptor. In this embodiment the fluorescent or luminescent protein is expressed only when the modified estrogen receptor specifically binds to its non-native ligand.

In accordance with one embodiment, the modified estrogen receptor encoded by the host cell comprises the entire receptor (including the estrogen transactivation, DNA binding and ligand binding domains). Alternatively, the modified estrogen receptor may be a recombinant fusion protein that only includes a portion of the estrogen receptor, such as the ligand binding domain, coupled to the DNA binding domain and transactivation domain of another transactivation protein. In particular, amino acid residues 283-595 or a smaller functional fragment thereof of the estrogen receptor can be fused to the DNA binding domain and transactivation domain of another transactivation protein. Alternatively, a recombinant fusion protein can be generated wherein the DNA binding domain of the estrogen receptor has been replaced with another transactivation protein DNA binding domain. In one embodiment, a fusion protein is prepared that comprises the Gal4 DNA binding domain fused to the estrogen ligand binding domain wherein the estrogen ligand binding domain is fused to the VP16 activation domain.

To screen for the presence of a particular analyte in a sample, the sample is contacted with the cellular based detection system and the sample is screened for the presence of the marker. For example, a transgenic yeast cell containing a modified receptor specific for the analyte to be detected can be contacted with the sample to determine the presence of that analyte. The sample, may constitute a large area of land suspected of containing a contaminant. The entire area can be sprayed with the transgenic yeast and the presence of the analyte can be detected by screening for the expression of the marker gene.

The present invention also encompasses non-cellular based detection systems. In creating a non-cellular biosensor it is important that the signaling system be intrinsic to the detector, and not depend on indirect readouts such as transcriptional activation (gene switch systems). In particular, the modified receptors can be further modified to include a signaling system that produces a direct signal upon binding of the target ligand. Advantageously, in this system the modified receptor can be limited to just the ligand binding domain. There is no need to include the DNA binding region or transactivation domain from the receptor or any other tranactivation protein. For example, when a modified estrogen receptor is used in the non-cellular biosensor, the modified receptor may comprise the entire receptor (including the estrogen transactivation, DNA binding and ligand binding domains) or more preferably the simply includes the estrogen ligand binding domain, in particular, amino acid residues 283-595 or a smaller functional fragment thereof. In accordance with one embodiment this process involves protein engineering to permit attachment of the receptors to a solid matrix, and covalent modification of the receptors so as to produce a signal by fluorescence energy transfer FRET or by fluorescence quenching. There are several strategies that can be used in the absence of living cells to generate a signal based on ligand binding to the receptor. The first approach utilizes the ability of the mutant receptors to bind both the target compound and the natural ligand. Using a modified estrogen receptor as an example, fluorescent analogs of estradiol can be mixed in solution with the test sample, then incubated with the modified receptor. The receptor will be attached to a solid surface, such as a silica chip and after contact with the test sample it will be washed to remove unbound and non-specific bound material. Target compound in the sample will compete for binding of the fluorescent estradiol to the receptor. The fluorescence emission from the estradiol analog bound to the receptor will then be quantitated. By comparison of the fluorescence in the presence and absence of the test sample to a standard curve, the concentration of target compound in the test sample can be calculated.

In another approach, the mutant receptor will be engineered to create an intrinsic signaling device. There are several methods by which this goal may be achieved. These methods use fluorescence energy transfer to detect a change in the conformation or quaternary structure of the receptor on binding the target compound. For example, it is known that the estrogen receptor dimerizes upon binding ligand. The mutant receptors can be modified such that they are linked to an acceptor or donor fluorophore. When mixed in the presence of the target compound, dimerization will occur, bringing a significant fraction of the donor and acceptor fluorophores into proximity. Fluorescence resonance energy transfer from the donor to acceptor can then be detected.

In an alternative embodiment, the modified receptor ligand binding domains can be covalently linked, at or near each end of the polypeptide chain, to fluorescent or luminescent moieties, such that a conformational change induced by ligand binding will change the efficiency of energy transfer between the two moieties, and hence change the photon emission characteristics of those moieties. For example, in one embodiment of the invention, a mutated nuclear receptor ligand binding domain, selected for binding the target chemical of interest, is engineered so that a fluorescent protein (such as green fluorescent protein) is fused to the N-terminus of the ligand binding domain. The C-terminus of the expressed protein is modified by a process termed enzyme-assisted reverse proteolysis (EARP) (Rose et al. Bioconjug Chem 2:154-159 (1991)). In this process, a lyso-endopeptidase is used to conjugate a carbohydrazide to the carboxyl terminus of a protein. Suitable fluorescent carbohydrazides are available commercially. In this implementation, a tetramethylrhodamine hydrazide will be used. In an alternative implementation, the C-terminus of the mutated estrogen receptor domain will be engineered to remove a Cys residue at position 530, and to add a Cys residue at the C-terminus (after Leu554). Tetramethylrhodamine maleimide will then be reacted with the modified receptor domain. This reagent reacts specifically with SH groups (on the Cys residue) to form a covalent adduct. We note that there are two other Cys residues within the estrogen receptor domain. One is within helix 5 and one in helix 7, which are both regions to which mutant libraries have been or are being constructed. Both Cys residues are partially buried and are less likely to react with the maleimide reagent than is the added Cys at the C-terminus. If necessary, in another implementation, these two additional Cys residues are removed, to ensure unique modification of the C-terminus. Energy transfer measurements in the presence and absence of ligand are conducted by the excitation of the green fluorescent protein, and measurement of the emission characteristics of the tetramethylrhodamine.

In another implementation, different derivatives of the green fluorescent protein (for example, the cyan and yellow derivatives, CBP and YBP) are engineered into each end of the mutated receptor, to create a fusion protein that possesses CBP at one end and YBP at the other. Energy transfer is measured by changes in the emission characteristics of the YBP upon excitation of the CBP. In other, similar implementations, other paired derivatives of green fluorescent protein, or other fluorescent proteins, are used in a similar manner.

In one embodiment, advantage can be taken of the discovery that alpha helix 12, located within the hormone binding domain of the estrogen receptor, changes conformation upon binding of the ligand to the receptor. Helix 12 is situated at the C-terminal end of the ligand binding domains of the nuclear receptors. It is ideally suited for a signal generation mechanism based on conformational changes, because it undergoes large changes in position relative to the N-terminus upon ligand binding. Using the estrogen receptor as an example, when bound to estradiol, the distance between the N- and C-termini of the domain (Leu306 - Ala551) is 63 Angstroms. When bound to the antagonist, tamoxifen, that distance is only 20 Angstroms, and when bound to another antagonist, raloxifen, the distance is 24 Angstroms. These data suggest that helix 12 acts as a flexible "lid" that closes over the ligand binding pocket. Helix 12 has also been implicated as a binding site for other proteins that act as transcriptional cofactors.

Molecular engineering can be used to modify helix 12 such that a donor or acceptor fluorophore pair is attached to it. In one embodiment, an acceptor fluorophore is attached to the C-terminus of helix 12 and the donor fluorophore is attached to the N-terminus of the ligand binding domain. Binding of the target compound to the receptor will change the distance between the donor and acceptor fluorophores, thus altering the efficiency of energy transfer, and producing a change in the acceptor emission amplitude.

In another embodiment, a fusion protein is created combining the mutant ligand binding domain and a signaling molecule such as (but not limited to) the Raf protein kinase. Ligand binding unmasks the signaling function of the fusion protein.

The present invention provides a device for detecting and quantitating an analyte in a complex mixture. The device comprises a modified steroid hormone receptor, wherein the modified steroid hormone receptor consists of the ligand binding region of the receptor and specifically binds to the analyte that is to be detected. Furthermore, the modified receptor is covalently linked to a solid support. In one preferred embodiment the modified receptor is a modified estrogen receptor that has been modified to specifically bind to an analyte other than estradiol. In one embodiment the modified receptor is further modified to comprise one or more fluorophores covalently bound to the receptor.

In accordance with one embodiment an analyte detector is provided that can be used to simultaneously screen a given sample for multiple analytes. The detector comprises a solid matrix and a plurality of detection complexes. The detection complexes are linked to the solid matrix and comprise a library of modified receptors wherein each mutant receptor is engineered to produce a fluorescence signal on binding its specific compound. The analyte detector is used to detect analytes in a sample by contacting the sample with the detector, optionally washing the detector to remove unbound material, illuminating the detector and detecting the emission from the detector. The intensity of the illumination can also be used to quantitate the amount of analyte present in a sample based on a standard curve generated for that analyte.

In accordance with one embodiment the position of the emitting detection complex on the solid matrix is determined and used to identify the specific analyte present in the sample. Advantageously, the detection complexes may not need to be specific to only one analyte, but rather a combination of detection complexes can be used to identify the presence of an analyte in a sample. In other words confirmation of the presence of an analyte may require a signal to be generated from two or more detection complexes identified by their location on the solid matrix.

It is anticipated that the analyte detectors of the present invention can be utilized as disposable sensors to detect industrial pollutants, herbicides, pesticides, drugs and their metabolites as well as the detection of chemical warfare agents and explosives residues in complex mixtures. Furthermore the sensors can be designed in compact form for use as handheld devices for use in the field. The novel detection complexes can also be used in solution assays for diagnostic use, using competition for estradiol binding to mutant receptors with dual specificity. The detection device can also be used to concentrate/recover a target analyte from a dilute or complex mixture. The modified receptors themselves can also be used as an alternative to antibodies for numerous types of applications.

Example 1 Creation of receptor mutant libraries.

To demonstrate proof of principle, the estrogen receptor (Fig. 1) was selected for modification to isolate modified receptors that can specifically recognize the pesticide methoxychlor, but not the closely related compound, DDT. The estrogen receptor is a ligand-activated transcription factor that has been well characterized. The full sequence of the estrogen receptor was previously described (see Green et al., Nature 320 (6058): 134-9 (1986)). It binds estradiol and related estrogens but not other steroids such as androgen or glucocorticoid. To create useful libraries, it was necessary to select regions of the protein sequence that have a high probability of containing residues which bind the ligand (estradiol) but which do not play essential structural roles in maintaining the correct fold of the protein. To identify these regions, sequences corresponding to the hormone-binding domains of different members of the family of nuclear receptors were compared, and regions of low similarity were chosen. Estrogen receptor sequences from different species were then compared to identify residues that were not important in determining specificity. From these considerations, 5 regions of about 20 residues each were selected. Since that time, the crystal structure of the estradiol binding domain has been solved and confirms the accuracy of these predictions. A similar approach could therefore be used for other receptors.

The ligand binding domains of the nuclear receptor family possess significant sequence similarities, and the X-ray structures of 4 of these domains shows that they possess similar folds. The ligand binding domains form a "helix sandwich", into which the ligands fit. Importantly, the same regions of the domains are involved in ligand binding for all of the receptors for which structures have been determined. Mutations within the helices that form the binding site can therefore be used to alter the binding specificities of each of the receptors. The mutant libraries are defined by the helix number in the structures (based on ref: Williams , S.P. and Sigler, P.B. (1998) Atomic structure of progesterone complexed with its receptor., Nature 393: 392-393). Estrogen receptor libraries are as follows:

Library structural location residues

A: helix 3 340 - 355

B: helix 5 380 - 405

C: helix 7 410 - 431

D: helix 11 + 12 512 - 529

As a second example, the thyroid receptor libraries, built along similar principles, would include residues:

A:213 - 235; B: 255 - 280; C: 290 - 310; D: 380 - 3407. Mutant estrogen receptor libraries were created using doped oligonucleotides, designed to introduce an average of 8 base pair changes per molecule. This mutation rate leads to an average of about 3 to about 5 amino acid residue changes per molecule. This was determined to be the optimal frequency. The doped oligonucleotide is used as a PCR primer to generate part of the estrogen receptor. In particular, the "part" generated in the first round of PCR is from a unique restriction site (Ncol) 5' to the region to be mutagenized, to the 3' end of the region being mutagenized (i.e. to residue 431 or 529 depending on the region being modified). The PCR generated fragments are then used as a megaprimer [(as described in Barik, S. (1993) Methods in Molec. Biol. 15: 277-288 (1993)] in a second round of PCR, to produce the complete hormone binding domain of the estrogen receptor or the entire estrogen receptor.

If the entire modified estrogen receptor was intended to be cloned, then in the second PCR reaction, the "megaprimer"which is the PCR product from the first round, is used as the 5' primer, and an oligonucleotide that hybridizes to the 3' end of the full-length estrogen receptor was used as the 3' primer. This 3' primer included a BamHl site to facilitate cloning into plasmid vector pAS [Steven Elledge (Baylor College of Medicine, TX].

Two estrogen receptor libraries have been constructed so far. One (library C) contains mutations between residues 410 - 431. It was created using a "doped" oligonucleotide strategy, with a doping rate of 7% per base (eg., if the first base encoding residue 410 is a G, then instead of 100% G the oligo synthesizer is programmed to use 79% G, 7% C, 7% A, 7% T. and so on for each base encoding the sequence up to amino acid residue 431). The doped oligonucleotide is used as a PCR primer to generate a part of the estrogen receptor. This part is then used as a megaprimer in a second round of PCR, to produce the complete hormone binding domain of the estrogen receptor. The theoretical mutation rate in amino acids, calculated using a program called RAMHA, is about 3-5 changes per individual estrogen receptor molecule. Because the introduction of mutations is random, there is actually a Gaussian distribution of mutations within the 410 - 431 region.

A mutant library C with a size of about 7 x 10⁵ individual mutants was created. Estimating from randomly sequenced clones picked from the library, the frequency of wild type receptors was about 15%. Thus the library contains about 600,000 mutants.

The second library that was created for residues 512 - 529 (library D). This library was made in a similar way to that described above. It contains about 6 x 10⁴ receptors.

Library Screening Assay

A new procedure was designed to permit rapid and stringent screening of the libraries against analytes of interest, using a modification of the yeast one- hybrid system. In this extension of the yeast one-hybrid system, a ligand-bound estrogen receptor enhances the expression of a gene involved in histidine biosynthesis (HIS3) and allow the yeast to grow in a synthetic medium that lacks histidine (His- medium). The library of estrogen receptor mutants is ligated into a yeast vector so as to form a fusion protein with the Gal4 DNA binding domain. This domain is unable to function alone (lacking an activation domain). The estrogen receptor can provide this activation function but only in the presence of ligand. This specific type of construct provides a very sensitive and specific switch: in the absence of estradiol (ligand), the fusion protein is inactive and the HIS3 gene is not expressed. Hence the yeast cannot grow in His- medium. On binding estradiol, the Gal4 DNA binding domain-estrogen receptor fusion is activated and can induce transcription from HIS3, which permits the yeast to grow.

To select for mutant receptors that can recognize new types of ligand (target analyte) the library is plated onto Tip-, His- medium containing the target compound of interest. Many hundreds of thousands of mutants can be screened simultaneously. Only yeast containing a mutant that can bind the target compound and activate transcription of the HIS3 gene will grow.

As a test of the procedure, mutant receptors were screened for the ability to recognize the pesticide methoxychlor. Wild type receptor did not support the growth of yeast in Trp-, His- medium containing methoxychlor. Therefore, only yeast that contain mutant receptors capable of activating transcription of the HIS3 gene (presumably resulting from the receptor binding to methoxychlor) should grow in Trp- , His- medium containing methoxychlor. However, there is the possibility that some modified receptors may be capable of activating the HIS3 gene in the absence of ligand binding due to the modification of the receptor.

The DNA encoding the mutant receptors was isolated from yeast colonies that grew in the presence of 25 μM methoxychlor. The mutant DNA was subsequently transformed into bacteria, purified and sequenced. Table 1 lists the mutant receptors that have been identified to date. One of these mutants R548H contains a mutation outside of the regions that were targeted for mutagenesis.

Table 1. Identification and characterization of mutant receptors.

Example 2 Gal4DBD/CER/VP16 Construct

In another implementation, a fusion protein was constructed, which consists of the Gal 4 DNA binding domain fused to the N-terminus of the estrogen receptor ligand binding domain, which was fused through its C-terminus to the VP16 activation domain. To create the libraries, a site-directed, silent mutation was introduced into the CER at base positions 1021-1023 (numbers are for the full length receptor) so as to destroy the Hindlll site, and create a Nhel site. We then used "doped" oligonucleotides as 5' PCR primers that include a Nhel site, and a 3' end of the CER which contained an EcoRI site. The PCR products were ligated into the pGBT9-CER-VP16 plasmid that had been digested with Nhel and EcoRI to create a mutant library. The sequences of the Gal4 DNA binding domain and the VP 16 activation domains have been previously published and the nucleic acid sequences encoding the junctions regions between these three protein domains is shown in Fig. 4. The nucleic acid sequence of the junction between the 3' end of the Gal4 DNA binding domain and the C-terminal region of the estrogen receptor is shown as SEQ ID NO: 1 (ACTGTATCGCCGGAATTAGGATCCGGGTCTGCT; ) and the junction between the C-terminal region of the estrogen receptor and the VP16 activation domain is shown as SEQ ID NO: 2 (GCCACAGTCGAATTCGTACCGAGC; ). The remaining 3' end of the VP16 gene sequence containing the Pst I restriction site is also shown (TACGGTGGGTAACTGCAGCCAAGC; SEQ ID NO: 3).

The sensitivity of the Gal4DBD/CER/VP16 fusion protein (new construct) and the Gal4DBD/ER fusion protein (old construct) was compared (Table 2). The constructs were transformed into yeast and the optical density (O.D.) at 600 was measured 46 hours after innoculation into Trp-, His- media with or without 0.1 μM estradiol. The O.D. 600 is used as a measure of growth. Wild type estrogen receptor response showed increased sensitivity with the new fusion construct compared to the old fusion construct.

Table 2 Wild type estrogen receptor shows enhanced sensitivity to estradiol with the new construct relative to the old construct.

Table 3 The methoxychlor receptor (A430D) response shows enhanced signal-to- noise with the new construct relative to the old construct.

As a further test, the mutation A430D (which allows activation by methoxyclor) was subcloned into pGBT9-CER-VP16. The new fusion construct showed enhanced signal-to-noise in response to methoxyclor compared to the old construct when expressed in yeast strain Hf7c (Table 3). The optical density (O.D.) at 600 was determined 46 hours after innoculation into Trp- , His- media with or without methoxychlor. The data are expressed as the fold increase by dividing by the O.D. measured in the absence of 25 μM methoxychlor.

Example 3

Cleaning of the Library

Some mutations in estrogen receptor (ER) ligand binding domain lead to constitutively transcriptional activation of the Gal4DBD-ER fusion protein (i.e. the Gal 4 DNA binding domain fused to the N-terminus of the estrogen receptor) in yeast, independent of ligand binding. This can result in a large number of false positives. In an effort to reduce the false positives in the screening system, a method was developed to selectively remove the constitutively active modified receptors ("cleaning the library") before compound screening. A yeast strain was utilized in which the original Ura3 gene was replaced by a copy of the Gall promoter-controlled Ura3 gene cassette. The Ura3 gene encodes orotidine-5'-phosphate decarboxylase, an enzyme required for the biosynthesis of uracil. It can also convert 5-fluoroorotic acid (5-FOA) to a toxic product, 5-fluorouracil, killing yeast cells. Yeast cells transformed by library plasmid DNA which are self-activating, will promote the expression of Ura3 gene and won't be able to grow on media containing 5-FOA. On the contrary, yeast cells transformed by non-self-activating plasmids will not be able to produce Ura3 and will grow on media containing 5-FOA. These yeast colonies are cellected and pooled for use in subsequent screens against target compounds of interest. By using this method, we can eliminate most, if not all, the false positives that would show up in our subsequent screening.

In an initial test of this method, yeast transformed with either wild type estrogen receptor or the methoxychlor mutant A430D grew on Trp- plates that contained 0.05% (w/v) 5-FOA, whereas yeast transformed with a constitutively active mutant of the receptor did not grow on these plates. When these 3 yeast stains were combined and treated with 5-FOA, no colonies appeared on Trp- , Ura- plates. However, colonies did grow on Trp- , Ura- plates with methoxyclor. The library was estimated to be cleaned up approximately 50 fold using 5-FOA. This estimate is based on comparing the number of transformants obtained on Trp-, Ura- plates from an aliquot of the library that has been treated versus an aliquot that has not been treated with 5-FOA.

Example 4

Characterization of Mutant Estrogen Receptors

To ensure that the mutant receptors were responsible for the enhanced growth in methoxychlor, the mutant receptors and the wild type receptor were again transfected into yeast and tested in the appropriate medium. In liquid culture all of the mutants exhibited robust growth in medium containing either methoxychlor or estradiol. No growth was detected in the vehicle control. Fig. 2 illustrates the growth curves that were obtained in 25 μM methoxychlor for yeast transformed with the mutants A430D, N519H or the wild type receptor. Table 4 shows that yeast containing the mutants A430D or R548H grow equally well in 25 or 5 μM methoxychlor or 0.1 μM estradiol. Yeast transformed with the wild type receptor only grew in the presence of estradiol. These results strongly suggest that the mutant receptors have an altered affinity for methoxychlor compared to the wild type receptor. Table 4 also shows that combining the double mutations, A430D with N519H, or N519H with R548H, did not further enhance the affinity for methoxychlor (MC) compared to the individual mutations.

Table 4 Doubling time of yeast transformed with the indicated receptors in His-media supplemented as shown. N.D. not determined. In the crystal structure His 524 directly interacts with estradiol. To determine if the affinity of the mutants A430D/N519H or N519H/R548H could be decreased for estradiol His 524 was mutated to Ala. Yeast transformed with either of the triple mutants A430D/N519H/H524A or N519H/R548H/H524A did not grow in the presence of methoxychlor but did grow in the presence of high concentrations of estradiol. These results suggest that the ligand binding pocket is not misfolded in the receptors containing the H524A mutation but that His 524 is important for both methoxychlor and estradiol binding.

To determine if the mutant receptors specifically interact with methoxychlor a number of the mutants as well as the wild type receptor were transformed into yeast and the ability of methoxychlor, DDT and dieldrin to stimulate growth in Trp- , His- media was determined. Methoxychlor, DDT and dieldrin are chlorinated hydrocarbons. DDT is structurally similar to methoxychlor except that it has chlorine groups in place of the methoxy groups on the aromatic rings. The structures of methoxychlor, DDT and dieldrin are shown below:

Dieldrin

Figure 3 shows that, for the mutants tested, only methoxychlor was able to significantly stimulate growth. A control experiment in His+ medium demonstrated that the DDT was not toxic to the yeast. Therefore, the mutant receptors are capable of distinguishing methoxychlor from the closely related DDT molecule, and only methoxychlor can activate the receptor. These results demonstrate that it is possible to create mutant receptors specific for the target analyte of interest.

It is important to note that the same receptor mutant libraries can be used to screen for as many different compounds as is required. One advantage of the technology of creating mutant receptors from a single parent receptor (such as the estrogen receptor) is that the identical method for signal production can be used for each mutant receptor that is created. Thus, if a hundred new receptors are created, against a hundred different target compounds, they can all be engineered in the same way to produce a fluorescence signal on binding the compounds, and arrayed on a chip, so that the hundred compounds can all be detected simultaneously, using the same detection technology.

Claims

1. An analyte detection system comprising a modified steroid hormone receptor, wherein the modified receptor specifically binds to said analyte, and said analyte is a non-native ligand of the modified receptor; and a signaling entity, wherein the signaling entity provides a detectable signal upon binding of said analyte to said modified receptor.

2. The analyte detection system of claim 1 wherein the modified receptor is a modified estrogen receptor that specifically binds an analyte other than estradiol.

3. The analyte detection system of claim 2 wherein the modified estrogen receptor is covalently linked to a solid support.

4. The analyte detection system of claim 3 wherein the modified receptor further comprises a first fluorophore covalently linked to said receptor, and the signaling entity comprises a second estrogen receptor that is covalently linked to a second flourophore, wherein the formation of a dimer between the modified receptor and the second estrogen receptor brings the first and second fluorphores in close enough proximity to allow fluorescent energy transfer between the first and second fluorophores.

5. The analyte detection system of claim 3 wherein the signaling entity is covalently linked to the modified receptor to form a signaling complex, wherein specific binding of an analyte to the receptor results in a conformational change in the signaling complex and generates a detectable signal.

6. The analyte detection system of claim 5 wherein the signaling entity comprises the ligand binding domain of the estrogen receptor, wherein a first fluorophore is linked to the N-terminus of said domain; and a second fluorophore is linked to the C-terminus of said domain.

7. A biological sensor for detecting an analyte, said sensor comprising a eukaryotic host cell, wherein said host cell comprises a nucleic acid sequence that encodes a modified steroid hormone receptor, wherein said modified receptor specifically binds to the analyte, and the analyte is a non-native ligand of the modified receptor; and a nucleic acid sequence encoding a marker gene, wherein said marker gene is operably linked to an upstream activating sequence that is activated by the modified receptor when the modified receptor is bound to the analyte.

8. The biological sensor of claim 7 wherein the marker gene encodes a protein that is not native to the host cell.

9. The biological sensor of claim 8 wherein the marker gene is a fluorophore.

10. The biological sensor of claim 6 wherein the host cell is a yeast cell and the marker gene is a fluorophore.

11. The biological sensor of claim 7 wherein the receptor is a modified estrogen receptor, wherein the modified estrogen receptor specifically binds to an analyte other than estradiol.

12. The biological sensor of claim 11 wherein the host cell is a yeast cell and the marker gene is a fluorophore.

13. The biological sensor of claim 12 wherein the modified estrogen receptor comprises a portion of the the estrogen receptor, consisting of the estrogen ligand binding domain, fused to a DNA binding domain and a transactivation domain isolated from one or more non-estrogen receptor transactivation proteins.

14. A method for detecting the presence of an analyte in a sample, said method comprising the steps of contacting the sample with the host cell of claim 7 or 11 ; and screening for the production of the marker product.

15. A device for detecting an analyte, said device comprising a modified steroid hormone receptor, wherein the modified steroid hormone receptor specifically binds to said analyte, and said analyte is a non-native ligand of the modified receptor; and a solid support, wherein said modified receptor is covalently linked to said solid support.

16. The device of claim 15 wherein the modified steroid hormone receptor is an estrogen receptor that has been modified to specifically bind to an analyte other than estradiol.

17. The device of claim 16 wherein the modified estrogen receptor is incapable of binding to estradiol.

18. The device of claim 16 wherein the modified estrogen receptor further comprises a fluorophore covalently linked to the receptor.

19. The device of claim 16 wherein the modified estrogen receptor comprises a first fluorophore and a second fluorophore linked to said receptor wherein upon specific binding of an analyte to the modified estrogen receptor, conformation of the receptor is altered resulting in a detectable change in energy transfer from the first fluorphore to the second fluorophore.

20. The device of claim 19 wherein the altered conformation of the receptor brings the first and second fluorphores in close enough proximity to enhance fluorescent energy transfer between the first and second fluorophores.

21. A method of preparing a novel receptor derivative that specifically binds to a non-native ligand, said method comprising the steps of modifying the nucleic acid sequence encoding the ligand binding site of the receptor; fusing the coding sequences of the modified ligand binding site of the receptor to nucleic acid sequences that encode the DNA binding domain of a transactivation protein to prepare a nucleic acid sequence that encodes a receptor fusion protein; transforming host cells with the nucleic acid sequences encoding the receptor fusion protein, wherein said host cell comprises a gene necessary for survival of the cell when cultured under restrictive conditions and said necessary gene is operably linked to an upstream activating sequence that binds to said DNA binding domain, wherein said necessary gene is only expressed when the receptor fusion protein binds to a non-native ligand for the modified receptor; culturing the transformed host cells under restrictive conditions in the presence of said non-native ligand; and recovering the nucleic acid sequences encoding the receptor fusion protein from the cells that survive the step of culturing under restrictive conditions.

22. The method of claim 21 further comprising the steps of screening against cells that express a receptor fusion protein that constitutively activates the necessary gene, said steps comprising providing a host cell that comprises a gene that encodes a pro-toxin activator, wherein said activator gene is operably linked to an upstream activating sequence that binds to said DNA binding domain; culturing the cells under permissive conditions in the presence of a pro-toxin compound prior to culturing the cell under the restrictive conditions.

23. The method of claim 22 wherein the activator gene encodes orotidine- 5'-phosphate decarboxylase and the pro-toxin compound is 5-fluoroorotic acid.

24. A signaling entity for detecting the presence of an analyte in a sample, said entity comprising the ligand binding domain of the estrogen receptor; a first fluorophore linked to the N-terminus of said domain; and a second fluorophore linked to the C-terminus of said domain.

25. The signaling entity of claim 24 further comprising the amino acid sequence of a modified ligand binding site of a steroid hormone receptor, wherein the modified ligand binding site specifically binds to a non-native ligand, and said binding alters the conformation of the signaling entity resulting in a detectable change in energy transfer from the first fluorophore to the second fluorophore.

26. The signaling entity of claim 25 wherein the altered conformation of the signaling entity brings the first and second fluorophores in close enough proximity to enhance fluorescent energy transfer between the first and second fluorophores.

27. The signaling entity of claim 25 wherein the modified ligand binding site is a modified estrogen receptor ligand binding site.