WO2001007614A1 - Polynucleotides differentially expressed in adenocarcinomas, polypeptides encoded thereby, and methods of use thereof - Google Patents

Abstract

The present invention features human HX2004-6 polypeptide and nucleotide sequences encoding HX2004-6 polypeptides. In a particular aspect, the polynucleotide is the nucleotide sequence of SEQ ID NO:1. In related aspects the invention features expression vectors and host cells comprising polynucleotides that encodes a human HX2004-6 polypeptide. The present invention also relates to antibodies that bind specifically to a human HX2004-6 polypeptide. Further provided are diagnostic and screening methods using HX2004-6 polynucleotides and antibodies specific for HX2004-6 polypeptides.

Description

POLYNUCLEOTIDES DIFFERENTIALLY EXPRESSED IN ADENOCARCINOMAS, POLYPEPTIDES ENCODED THEREBY, AND METHODS OF USE THEREOF

FIELD OF THE INVENTION The invention relates generally to novel polynucleotides, particularly those that are differentially expressed in cancer, in particular, pancreas, colon, and breast cancer

BACKGROUND OF THE INVENTION Pancreatic cancer Cancer of the pancreas is the fifth leading cause of cancer death in the United States

According to the American Cancer Society, approximately 28,000 people will die of pancreatic cancer in the United States in 1998 The pancreas is a tongue-shaped glandular organ composed of both endocrine and exocrme gland portions, as well as ducts that connect the pancreas to the bile duct and small intestine The endocrine portion of the pancreas secretes hormones, such as insulin and glucagon, which are involved in blood sugar regulation, into the bloodstrea The exocrme portion of the pancreas produces pancreatic enzymes involved in the digestion of fats and proteins, these enzymes are delivered to the bile duct and into the small intestine

Tumors of the endocrine pancreas have unique biological characteristics, and therapy is relatively effective Neoplasms of the exocrme pancreas develop insidiously, and therapy is relatively ineffective When considered by histological type, ductal cell adenocarcmomas are the most frequent type of exocrme pancreas tumors, accounting for approximately 82% of all tumors of the exocπne pancreas

Although early and accurate diagnosis can thus be extremely important in treatment success, conventional screening tests for detecting pancreatic cancer in asymptomatic persons are madequate Imaging procedures such as magnetic resonance imaging and computed tomography are too costly to use as routme screening tests, while more accurate tests such as endoscopic retrograde cholangiopancreatography (ERCP) and endoscopic ultrasound are inappropriate for screening asymptomatic patients due to their rnvasiveness Abdominal ultrasonography is a nomnvasive screening test, but there is little information on the efficacy of abdominal ultrasound as a screening test for pancreatic cancer in asvmptomatic persons In symptomatic patients with suspected disease it has a reported sensitivity of 40-98% and a specificity as high as 90-94% Conventional ultrasonography is limited b\ -visualization difficulties m the presence of bowel gas or obesity and by its range of resolution (2-3 cm) Even tumors less than 2 cm m diameter are frequently associated with metastatic disease thus limiting the ability of ultrasound to detect earlv disease Most persons with pancreatic malignancy have elevated levels of certain serologic markers such as CA19-9, peanut agglutinin, pancreatic oncofetal antigen. DU-PAN-2, carcrnoembrvonic antigen, alpha-fetoprotein. CA-50. SPan-1, and tissue polypeptide antigen (Rhodes et al (1990) Bailleres Clin Gastroenterol 4 833, Steinberg (\990) Am J Gastroenterol 85 350, Satake etα/ (1990) /πt J Pancreatol 7 25, Satake (1991) /nt J Pancreatol 9 93) None of these markers is. however, tumor specific or organ specific (Satake (1991), supra) Elevations of vaπous serologic markers also occur m significant proportions of persons with benign gastrointestinal diseases or malignancies other than pancreatic cancer (Carter (1990) Gut 31 494, Rhodes et al (1990), supra, Satake et al (1990), supra. Satake (1991), supra) Most of these markers have been studied exclusively in high-risk populations, such as symptomatic patients with suspected pancreatic cancer CA19-9 has probably achieved the widest acceptance as a serodiagnostic test for pancreatic carcinoma in symptomatic patients, with an overall sensitivity of approximately 80% (68-93%) and specificity of 90% (73-100%), sensitivity was highest m patients with more advanced disease (Steinberg (1990), supra. Satake et al (1990), supra) Among healthy subjects. CA19-9 has good specificity (94-99%) (DelVillano et al (1983) Chn Chem 29549, Ritts et al (\9 ) Int J Cancer 33 339, Fabπs et al (1988) Am J Gastroentrol 83 549) but nevertheless generates a large proportion of false-positive results due to the very low prevalence of pancreatic cancer in the general population (Frebourg et al (1988) Cancer 62 2287, Homma et α/ (1991) Int J Pancreatol 9 119) The predictive value of a positive test could be improved if a population at substantially higher πsk could be identified Breast cancer

Breast cancer is the most common malignant neoplasm in women worldwide This is also true m the United States, where the annual incidence was 1046 new cases per 100,000 m 1989 The lifetime risk of breast cancer in the Umted States is estimated ato be about one case for every eight women Most breast cancers are invasive adenocarαnomas ansmg from the ductal lobular epithelial unit (Fisher (1975) Cancer 36 1), and the vast majority of patients have infiltrating ductal carcinomas Overall, breast cancer makes up 32 percent of all cancer m U S women The annual mortality rate from breast cancer has remained at about 27 deaths per 100,000 for many years despite improvements in medical management (Cancer Treatment. 4^th Ed C Haskell, ed (1995) W B Saunders Co) Current treatments mclude surgical resection, ionizing radiation therapy, systemic chemotherapy, endocrine therapy, or a combination of the foregoing

Early diagnosis is of paramount importance m reducing mortality Currently, screening and diagnostic methods mclude mammographv and self-examination Certain serum markers mav be indicative of metastasis Seπal measurements of serum calcium and alkaline phosphatase are of established value for monitoring patients with known metastatic disease Carcmoembrvomc antigen (CEA) has been used to assess the response of patients to chemotherapy The role of other potential tumor markers, such as CA549 and CA15-3, is currently under investigation

Colorectal cancer

Colorectal cancer is a maj or health problem m most affluent countries In the United States. it is the fourth most frequent site for a primary malignant neoplasm, with approximately 149,000 new cases and 56,000 deaths expected m 1994 The vast ma onty of primary colorectal malignant neoplasms are epithelial adenocarαnomas Current treatments include surgical resection, and single-agent and combination chemotherapy

Current screening and diagnostic methods include, for asymptomatic people, tests for occult blood in the stool and screening flexible sigmoidoscopy For symptomatic patients, diagnostic tests mclude barium enema, colonoscopy. and ultrasound

Inadequacies of conventional diagnostic methods for the above-mentioned cancers highlight the need for diagnostic and therapeutic methods and compositions, as well as for a better understanding of the disease to provide the basis for more rationale and more quickly responsive therapy The present mvention addresses this need by providing nucleotide sequence that are differentially expressed in these diseases

Related Literature

A human mRNA, designated "KIAA0858", was identified in human brain tissue, and is described m Nagase et al (1998) DNA Res 5 355-364 The nucleotide sequence of KIAA0858 is provided under GenBank Accession No AB020665 A human mRNA was identified in pancreas tissue, its predicted translation product encodes a zinc-finger domain-containing protein, and its sequence is provided under GenBank Accession No U90654

SUMMARY OF THE INVENTION The present invention is based on the discovery of polynucleotides that represent a gene that is differentially expressed m restricted types of cancer cells, speαfically, colon, breast, and pancreatic cancer cells, particularly cancerous colon, breast, and pancreatic ductal epithelial cells The present mvention features a human HX2004-6 polypeptide and nucleotide sequences encoding HX2004-6 polypeptides In a particular aspect, the polynucleotide is the nucleotide sequence of SEQ ID NO 1 and SEQ ID NO 3 In addition, the mvention features polynucleotide sequences that hybridize under stringent conditions to SEQ ID NO 1 or SEQ ID NO 3 In related aspects the invention features expression vectors and host cells comprising polynucleotides that encode a human HX2004-6 polypeptide The present mvention also provides antibodies that bmd specifically to a human HX2004-6 polypeptide The mvention further provides methods usmg the polynucleotides and antibodies of the mvention The methods mclude methods for producing human HX2004-6 polypeptides, methods for detecting the presence of an HX2004-6 polypeptide or an HX2004-6 polynucleotide m a biological sample, methods for detecting cells expressing HX2004-6, methods for identification of individuals at πsk for pancreatic, colon, or breast cancer by detecting alteration m HX2004-6 coding and regulatory sequences and HX2004-6 expression levels

Another object of the mvention is to provide an isolated human HX2004-6 polypeptide- encoding polynucleotide for use m generation of non-human transgenic animal models for HX2004-6 gene function, particularly "knock-in" HX2004-6 non-human transgenic animals characterized by excess or ectopic expression of the HX2004-6 gene

The mvention further provides screening methods to identify agents that modulate expression of human HX2004-, for example, transcription and/or translation of a human HX2004-6 polynucleotide Of particular mterest are those compounds that reduce human HX2004-expressιon. which compounds can be further evaluated for use in treating adenocarcmomas of breast, colon and panαeatic ductal epithelial cell origin

These and other objects, advantages and features of the present invention will become apparent to those persons skilled m the art upon reading the details of the mvention more fully set forth below

The mvention will now be descπbed m further detail

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 depicts a sequencing gel autoradiograph of samples from a differential display assay The arrow indicates the message differentially expressed m pπmary cultures of ductal epithelial cells from normal pancreas, and pancreas from individuals diagnosed with dysplasia of pancreatic cells, pancreatitis, and pancreatic cancer

Figures 2A-B depict the nucleotide sequence of HX2004-6 cDNA clone 1 (SEQ ID NO 1) For convenience, Figures 2 A-B are refeπed to herem as "Figure 2" The initiation codon and stop codons, ATG and TGA respectively, are shown, in bold and underlined

Figures 3 A-B depict the nucleotide sequence of HX2004-6 cDNA clone 2 (SEQ ID NO 3 For convenience. Figures 3 A-B are refeπed to herem as "Figure 3" The sequence which is the 2004-6 probe (SEQ ID NO 5) is shown as a bold sequence Within the 2004-6 sequence is the 30-nucleotιde insertion (underlined and in lower case letters) relative to SEQ ID NO 1 The initiation codon and stop codons. ATG and TGA. respectively, are shown, m bold and underlined Figure 4 depicts an autoradiograph of a human multiple tissue Northern blot probed with PCR-2004. RNA was from the following tissues- Lane 1, heart; Lane 2, brain; Lane 3, placenta. Lane 4, lung; Lane 5, liver; Lane 6, skeletal muscle; Lane 7, kidney; Lane 8, pancreas.

Figure 5 depicts an autoradiograph of a human multiple cancer cell lme Northern blot probed with PCR-2004 Cell lines were as follows Lane 1, HL-60 (promyelocytic leukemia), Lane 2, HeLa cell S3, Lane 3, K-562 (chronic myelogenous leukemia), Lane 4, MOLT-4 (acute lymphoblastic leukemia), Lane 5. Raji (Burkitt's lymphoma), Lane 6, SW480 (colorectal adenocarαnoma); Lane 7, A549 (lung carcinoma), Lane 8, G361 (melanoma).

Figure 6 depicts an autoradiograph of a tumor mRNA Northern blot probed with the 2004-6 probe (upper panels) and, as a control, β-actm (lower panels) mRNA samples were from breast tumor (Left-hand panels, Lanes marked "T") and normal breast (Left-hand panels, Lane "N") tissues, and colon tumor (Right-hand panels, Lanes marked "T") and normal colon tissue (Right-hand panels, Lane "N"), as descπbed m Example 4

Figure 7 depicts and autoradiograph of a colon cancer cell lme RNA blot probed with the 2004-6 probe.

Figure 8 is a graph showing the percentages of tumor and normal tissue samples expressing PCD1 by in situ hybridization analysis.

Figures 9A-9H (collectively referred to herein as Figure 9) are a series of graphs showing

HX2004-6 expression levels in tissues from eight colon cancer patients. N: normal colon tissue; P : primary tumor colon tissue; MET: metastatic liver tissue. The expression data (on the Y axis) are adjusted by β-actin expression level and are thus relative values. All PCR reactions were performed in duplicate.

DETAILED DESCRIPTION OF THE MVENTION Before the present nucleotide and polypeptide sequences are descπbed, it is to be understood that this mvention is not limited to the particular methodology, protocols, cell lines, vectors and reagents descπbed as such may, of course, vary It is also to be understood that the terminology used herein is for the purpose of descπbmg particular embodiments only, and is not intended to limit the scope of the present mvention which will be limited only by the appended claims

It must be noted that as used herem and m the appended claims, the singular forms "a". "and", and "the" include plural referents unless the context clearly dictates otherwise Thus, for example, reference to "a host cell" includes a plurality of such host cells and reference to "the antibody" mcludes reference to one or more antibodies and equivalents thereof known to those skilled in the art, and so forth

Unless defined otherwise, all technical and sαentific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this mvention belongs Although any methods, devices and mateπals similar or equivalent to those descπbed herem can be used m the practice or testing of the invention, the prefeπed methods, devices and mateπals are now descπbed

All publications mentioned herem are incorporated herein by reference for the purpose of descπbmg and disclosing, for example, the cell lines, vectors, and methodologies which are descnbed m the publications which might be used m connection with the presently descπbed mvention The publications discussed herem are provided solely for their disclosure pnor to the filing date of the present application Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of pπor mvention

Definitions

"Polynucleotide" as used herein refers to an oligonucleotide. nucleotide, and fragments or portions thereof, as well as to peptide nucleic acids (PNA), fragments, portions or antisense molecules thereof, and to DNA or RNA of genomic or synthetic ongin which can be single- or double-stranded, and represent the sense or antisense strand Where "polynucleotide" is used to refer to a specific polynucleotide sequence (e g a HX2004-6 polypeptide-encoding polynucleotide), "polynucleotide" is meant to encompass polynucleotides that encode a polypeptide that is functionally equivalent to the recited polypeptide, e g , polynucleotides that are degenerate vaπants, or polynucleotides that encode biologically active vaπants or fragments of the reαted polypeptide Similarly, "polypeptide" as used herem refers to an o gopeptide, peptide, or protein Where "polypeptide" is recited herem to refer to an ammo acid sequence of a naturally-occurπng protein molecule, "polypeptide" and like terms are not meant to limit the ammo aαd sequence to the complete, native ammo acid sequence assoαated with the reαted protein molecule

By "antisense polynucleotide" is mean a polynucleotide having a nucleotide sequence complementary to a given polynucleotide sequence (e g, a polynucleotide sequence encoding an HX2004-6 polypeptide) mcluding polynucleotide sequences associated with the transcπption or translation of the given polynucleotide sequence (e g . a promoter of a polynucleotide encoding an HX2004-6 polypeptide), where the antisense polynucleotide is capable of hvbndmng to an HX2004-6 polypeptide-encoding polynucleotide sequence Of particular interest are antisense polynucleotides capable of inhibiting transcπption and or translation of an HX2004-6-encodιng polynucleotide either m vitro or in vivo "Peptide nucleic aαd" as used herem refers to a molecule which compπses an o gomer to which an ammo acid residue, such as lysine, and an ammo group have been added These small molecules, also designated anti-gene agents, stop transcπpt elongation by binding to their complementary (template) strand of nucleic acid (Nielsen et al (1993) Anticancer Drug Des 8 53-63)

As used herem. "HX2004-6 polypeptide" refers to an ammo acid sequence of a recombmant or nonrecombinant polypeptide having an ammo acid sequence of l) a native HX2004-6 polypeptide, n) a fragment of an HX2004-6 polypeptide, in) polypeptide analogs of an HX2004-6 polypeptide. iv) vaπants of an HX2004-6 polypeptide. and v) an lmmunologically active fragment of an HX2004-6 polypeptide HX2004-6 polypeptides of the mvention can be obtamed from any species, e g , mammalian or non-mammalian (e g , reptiles, amphibians, avian (e g , chicken)), particularly mammalian, mcluding human, rodent (e g , muπne or rat), bovine, ovine, porcme. muπne, or equine, preferably rat or human, from any source whether natural, synthetic, semi-synthetic or recombmant "Human HX2004-6 polypeptide" refers to the ammo acid sequences of isolated human HX2004-6 polypeptide obtained from a human, and is meant to mclude all naturally -occurring allehc vaπants, and is not meant to limit the ammo aαd sequence to the complete, native amino aαd sequence associated with the recited protem molecule

The term "lmmunologically active" defines the capability of the natural, recombmant or synthetic human HX2004-6 polypeptide, or any ohgopeptide thereof, to induce a speαfic immune response in appropπate animals or cells and to bmd with speαfic antibodies

As used herem. a "HX2004-6 assoαated disorder" is one that is associated with a neoplasm of pancreatic, colon, or breast cell, particularly an adenocarcinoma of one of these tissues, particularly a neoplasm of a ductal epithelial cell from one of these tissues A "HX2004-6 associated disorder" is also one that is caused by, directly or mdirectly, a neoplasm of one of the aforementioned cells A "HX2004-6 assoαated disorder" is also a physiological condition or disease associated with altered HX2004-6 function (e g , due to abeπant HX2004-6 expression, particularly overexpression of HX2004-6)

"Overexpression" intends that an HX2004-6 mRNA is found at levels at least about 1 5- fold, usually at least about 2-fold, normally at least about 5-fold, generally at least about 10-fold. and up to at least about 50-fold or higher when compared with a non-cancerous cell of the same cell type In particular, the companson is made between a ductal epithelial cell to be tested and a non- cancerous ductal epithelial cell, for example, a non-cancerous normal cell, or a dysplastic non- cancerous cell The companson can be made between two tissues, for example, if one is usmg m situ hybπdization or another assay method which allows some degree of disα mmation among cell types m the tissue, as descπbed m Example 5. however, it may be preferable to make the companson between cells removed from their tissue source, as descπbed m Example 1 Whether an HX2004-6 polynucleotide is over-expressed in a given cell can be readily determined by those skilled in the art usmg known methods, including, but not limited to, detection of HX2004-6 transcπpts by hybπdization with a polynucleotide that hybπdizes to a HX2004-6 polynucleotide, a polymerase cham reaction usmg specific oligonucleotide pπmers. m situ hybπdization. by detection of encoded HX2004-6 polypeptide usmg an lmmunoassay, and the like

As used herem. "neoplastic cells" and "neoplasm" (used interchangeably herem with "tumor", "cancer", "cancerous cells", and "carcinoma") refers to cells which exhibit relatively autonomous growth, so that they exhibit an abeπant growth phenotype characteπzed by a significant loss of control of cell proliferation Neoplastic cells can be benign or malignant. metastatic or non-metastatic The term "adenocarαnoma" is one well understood in the art. and denotes a tumor onginating m glandular epithelium

A "host cell", as used herein, denotes microorganisms or eukaryotic cells or cell lmes cultured as unicellular entities which can be. or have been, used as reαpients for recombmant vectors or other transfer polynucleotides, and mclude the progeny of the onginal cell which has been transfected It is understood that the progeny of a single cell may not necessanly be completely identical m morphology or m genomic or total DNA complement as the oπgmal parent, due to natural, acαdental, or deliberate mutation A host cell which compπses a recombmant vector of the mvention is a "recombmant host cell" As used herem, "antigenic ammo aαd sequence" means an ammo acid sequence that, either alone or in association with a earner molecule, can elicit an antibody response m a mammal

A "vanant" of a human HX2004-6 polypeptide is defined as an ammo acid sequence that is altered by one or more ammo aαds The vaπant can have "conservative" changes, wherem a substituted ammo acid has similar structural or chemical properties, e g , replacement of leuαne with isoleucme More rarely, a vaπant can have "nonconservative" changes, e g , replacement of a glycine with a tryptophan. Similar minor vanations can also mclude ammo aαd deletions or insertions, or both Guidance m determinmg which and how many ammo acid residues may be substituted, inserted or deleted without abolishing biological or lmmunological activity can be found usmg computer programs well known m the art. for example. DNAStar software A "deletion" is defined as a change in either ammo acid or nucleotide sequence m which one or more ammo acid or nucleotide residues, respectively, are absent as compared to an ammo aαd sequence or nucleotide sequence of a naturally occurring HX2004-6 polypeptide

An "insertion^" or "addition" is that change m an ammo acid or nucleotide sequence which has resulted m the addition of one or more ammo acid or nucleotide residues, respectively, as compared to an ammo acid sequence or nucleotide sequence of a naturally occurring HX2004-6 polypeptide

A "substitution" results from the replacement of one or more ammo acids or nucleotides by different ammo aαds or nucleotides, respectively as compared to an ammo aαd sequence or nucleotide sequence of a naturally occurring HX2004-6 polypeptide

The term "denvative" as used herem refers to the chemical modification of a nucleic acid encoding a human HX2004-6 polypeptide or the encoded human HX2004-6 polypeptide Illustrative of such modifications would be replacement of hydrogen by an alkyl, acyl, or ammo group A nucleic aαd denvative would encode a polypeptide which retains essential biological characteπstics of a natural HX2004-6 polypeptide

As used herem the term "isolated" is meant to descπbe a compound of mterest (e g . either a polynucleotide, a polypeptide, an antibody, or a cell) that is m an environment different from that in which the compound naturally occurs "Isolated" is meant to mclude compounds that are withm samples that are substantially enπched for the compound of mterest and/or in which the compound of interest is partially or substantially punfϊed

As used herem, the term "substantially puπfied" refers to a compound (e g , either a polynucleotide or a polypeptide) that is removed from its natural environment and is at least 60% free, preferably 75% free, and most preferably 90% free from other components with which it is naturally assoαated. "Stnngency" typically occurs m a range from about Tm-5°C (5°C below the Tm of the probe) to about 20°C to 25°C below Tm As will be understood by those of skill in the art, stnngency hybπdization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences

The term "hybndization" as used herem shall mclude "any process by which a strand of nucleic aαd joms with a complementary strand through base pairing" (Coombs 1994 Dictionary of Biotechnology, Stockton Press, New York NY) Amplification as earned out m polymerase cham reaction technologies is descnbed m Dieffenbach et al 1995, PCR Pπmer, a Laboratory Manual, Cold Spnng Harbor Press. Plainview NY

By "transformation" is meant a permanent or transient genetic change, preferably a permanent genetic change, induced m a cell followmg mcorporation of new DNA (I e . DNA exogenous to the cell) Genetic change can be accomplished either by mcorporation of the new DNA mto the genome of the host cell, or by transient or stable maintenance of the new DNA as an episomal element Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA mto the genome of the cell By "construct" is meant a recombmant nucleic aαd. generally recombmant DNA that has been generated for the purpose of the expression of a specific nucleotide sequence(s), or is to be used m the construction of other recombinant nucleotide sequences

A "transcπptional control region" (sometimes refeπed to as a "transcnptional regulatory region") encompasses all the elements necessary for transcnption, and may mclude elements necessary for transcnption Thus, a transcnptional control region includes at least the promoter sequence, and may also mclude other regulatory sequences such as enhancers, and transcπption factor binding sites

A "transcπptional control region heterologous to a coding region" is one that is not normally assoαated with the codmg region m nature

"Operably linked" refers to a juxtaposition wherem the components so descnbed are m a relationship permitting them to function in their intended manner For instance, a promoter is operably linked to a codmg sequence if the promoter effects its transcπption or expression

"Regulatory sequences" refer to those sequences normally associated with (for example withm 50 kb) of the codmg region of a locus which affect the expression of the gene (including transcπption of the gene, and translation, sphcmg, stability, or the like of the messenger RNA) Regulatory sequences mclude, mter alia, promoters, enhancers, splice sites and polyadenylation sites

By "operatively inserted" is meant that a nucleotide sequence of mterest is positioned adjacent a nucleotide sequence that directs transcnption or transcπption and translation of the introduced nucleotide sequence of mterest (/ e , facilitates the production of. e g , a polypeptide or a polynucleotide encoded by an HX2004-6 sequence)

The term "biological sample" encompasses a vaπety of sample types obtamed from an organism and can be used m a diagnostic or monitoring assay The term encompasses blood and other liquid samples of biological ongin, solid tissue samples, such as a biopsy specimen or tissue cultures or cells deπved therefrom and the progeny thereof For particular methods descπbed herem, such as diagnostic or screening methods, a biological sample of particular mterest compπses ductal epithelial cells from pancreas, breast, and colon tissues The term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents. solubihzation, or ennchment for certam components The term encompasses a clinical sample, and also includes cells m cell culture, cell supernatants. cell lysates. serum plasma, biological fluids. and tissue samples

Bv "individual" or"subject" or "patient" is meant any mammalian subject for whom diagnosis or therapy is desired, particularly humans Other subjects may include cattle, dogs. cats. gumea pigs, rabbits, rats, mice, horses, and so on Of particular mterest are subjects having an HX2004-6-assocιated disorder that is amenable to treatment (e g , to mitigate symptoms assoαated with the disorder) by modulating expression of either HX2004-6-encodιng nucleic acid m a cell of the subject

The term "transgene^" is used herem to descnbe genetic matenal which has been or is about to be artificially mserted mto the genome of a mammalian, particularly a mammalian cell of a living animal

By "transgenic organism" is meant a non-human organism (e g , single-cell organisms (e g , yeast), mammal, non-mammal (e g , nematode or Drosophύa)) having a non-endogenous (1 e , heterologous) nucleic aαd sequence present as an extrachromosomal element m a portion of its cells or stably integrated mto its germ line DNA

By "transgenic animal" is meant a non-human animal, usually a mammal, having a non- endogenous (l e , heterologous) nucleic acid sequence present as an extrachromosomal element m a portion of its cells or stably integrated mto its germ lme DNA (I e . in the genomic sequence of most or all of its cells) Heterologous nucleic acid is introduced into the germ lme of such transgenic animals by genetic manipulation of, for example, embryos or embryonic stem cells of the host animal

A "knock-out" of a target gene means an alteration m the sequence of the gene that results m a decrease of function of the target gene, preferably such that target gene expression is undetectable or insignificant A knock-out of an HX2004-6 gene means that function of the HX2004-6 gene has been substantially decreased so that HX2004-6 expression is not detectable or only present at insignificant levels "Knock-out" transgenics of the mvention can be transgenic animals having a heterozygous knock-out of the HX2004-6 gene or a homozygous knock-out of the HX2004-6 gene "Knock-outs" also mclude conditional knock-outs, where alteration of the target gene can occur upon, for example, exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e g , Cre m the Cre-lox system), or other method for directing the target gene alteration postnatally

A "knock-in" of a target gene means an alteration m a host cell genome that results in altered expression (e g , increased (including ectopic) or decreased expression) of the target gene, e g , by introduction of an additional copy of the target gene, or by operatively inserting a regulatory sequence that provides for enhanced expression of an endogenous copy of the target gene "Knock-in" transgenics of the invention can be transgenic animals having a heterozygous knock-in of the HX2004-6 gene or a homozygous knock-in of the HX2004-6 gene "Knock-ins" also encompass conditional knock-ins

As used herem. the term "treatment" encompasses any treatment of any disease or condition m a mammal, particularly a human, and mcludes a) preventing a disease, condition, or symptom of a disease or condition from occurring m a subject which may be predisposed to the disease but has not yet been diagnosed as having it, b) inhibiting a disease, condition, or symptom of a disease or condition, e g , causing regression of the disease and/or its symptoms

Overview of the Invention

The present mvention is based upon the identification and isolation of a polynucleotide sequence encoding a human HX2004-6 polypeptide Accordingly, the present invention encompasses such human HX2004-6 polypeptide-encoding polynucleotides, as well as human HX2004-6 polypeptides encoded by such polynucleotides Overexpression of HX2004-6 is linked to adenocarcmomas of panαeas, colon, and breast, particularly neoplasms of ductal epithelial cells of pancreas, colon, and breast

The present mvention provides methods of detecting an HX2004-6 polynucleotide or polypeptide in a biological sample for diagnostic purposes The mvention also encompasses the use of the polynucleotides disclosed herem to faαhtate identification and isolation of polynucleotide and polypeptide sequences having homology to a human HX2004-6 polynucleotide and polypeptide of the mvention The human HX2004-6 polypeptides and polynucleotides of the mvention are also useful in the identification of human HX2004-6 polypeptide-bmdmg compounds, particularly compounds which specifically bmd human HX2004-6 polypeptide Compounds which speαfically bmd HX2004-6 are useful in diagnostic assays to detect the presence of and/or measure a level of HX2004-6 polypeptide In addition, the human HX2004-6 polypeptides, polynucleotides, and antibodies of the mvention are useful m the diagnosis, prevention and treatment of disease associated with human HX2004-6 overexpression

The human HX2004-6 polypeptide-encoding polynucleotides of the invention can also be used as a molecular probe with which to determme the structure, location, and expression of the human HX2004-6 polypeptide and related polypeptides in mammals (including humans), and to investigate potential assoαations between disease states or clinical disorders and defects or alterations m human HX2004-6 polypeptide structure, expression, or function

The human HX2004-6 polynucleotides and antibodies specific for HX2004-6 polypeptides are also useful m screening assays to identify substances which modulate HX2004-6 expression in a cell

HX2004-6 NUCLEIC ACΓ

The present mvention provides isolated HX2004-6 nucleic aαds These nucleic acids are useful m methods to produce HX2004-6 polypeptides. as well as in diagnostic methods, including methods to detect an HX2004-6 mRNA in a biological sample, methods to identify polynucleotides havmg sequence similantv to HX2004-6 polynucleotides of the mvention, methods to detect an alteration m HX2004-6 polynucleotide sequence in a cell, and methods to identify substances which modulate HX2004-6 mRNA and/or polypeptide levels m a cell

In some embodiments, an HX2004-6 polynucleotide of the mvention has the sequence shown in SEQ ID NO 1 (Figure 2) In other embodiments, an HX2004-6 polynucleotide has the sequence shown m nucleotides 1-1724 of SEQ ID NO 1 In other embodiments, an HX2004-6 polynucleotide has the sequence shown m nucleotides 698-1724 of SEQ ID NO 1 In other embodiments, an HX2004-6 polynucleotide has the sequence shown m SEQ ID NO 3 (Figure 3) In other embodiments, an HX2004-6 polynucleotide has the sequence shown in nucleotides 1-1754 of SEQ ID NO 3 In still other embodiments, an HX2004-6 polynucleotide has the sequence shown m nucleotides 728-1754 of SEQ ID NO 3 Also encompassed are the complement of anv of the aforementioned sequences Also encompassed by "HX2004-6 polynucleotide" are fragments of the aforementioned sequences In one embodiment, a fragment of an HX2004-6 polynucleotide has the sequence of nucleotides 559 to 1107 of the sequence shown in SEQ ID NO 3, and shown m bold m Figure 3 This sequence, which is given as SEQ ID NO 5 is also the sequence of the polynucleotide probe refeπed to herein as "the 2004-6 probe" Further encompassed are polynucleotides that hybndize under stringent hybπdization conditions with any one of the aforementioned sequences, as descnbed m detail herem The invention also encompasses polypeptides encoded by any of the polynucleotide sequences descnbed herein The term "HX2004-6 gene" is encompassed in the term "HX2004-6 polynucleotide" and is used genencally to designate HX2004-6 genes and their alternate forms "HX2004-6 gene" is also mtended to mean the open reading frame encodmg specific HX2004-6 polypeptides, mtrons. and adjacent 5' and 3' non-codmg nucleotide sequences mvolved m the regulation of expression, up to about 1 kb beyond the coding region, but possibly further m either direction The DNA sequences encodmg HX2004-6 may be cDNA or genomic DNA or a fragment thereof The gene may be introduced mto an appropnate vector for extrachromosomal maintenance or for integration mto the host

The term "cDNA" as used herem is mtended to mclude all nucleic acids that share the aπangement of sequence elements found in native mature mRNA species, where sequence elements are exons (e g . sequences encodmg open readmg frames of the encoded polypeptide) and 3' and 5' non-codmg regions Normally mRNA species have contiguous exons. with the intervening mtrons removed by nuclear RNA splicing, to create a continuous open readmg frame encodmg the HX2004-6 polypeptide

While other genomic HX2004-6 sequences of other sources may have non-contiguous open readmg frames (e g , where mtrons interrupt the protem coding regions), the human genomic HX2004-6 sequence has no mtrons interrupting the codmg sequence A genomic sequence of mterest compnses the nucleic acid present between the initiation codon and the stop codon, as defined in the listed sequences, including all of the mtrons that are normally present in a native chromosome It may further mclude the 3' and 5' untranslated regions found m the mature mRNA It may further include specific transcπptional and translational regulatory sequences, such as promoters, enhancers, etc , including about 1 kb. but possibly more, of flanking genomic DNA at either the 5' or 3' end of the transcπbed region The genomic DNA may be isolated as a fragment of 100 kbp or smaller, and substantially free of flanking chromosomal sequence

The sequence of this 5' region, and further 5' upstream sequences and 3' downstream sequences, may be utilized for promoter elements, mcludmg enhancer binding sites, that provide for expression m tissues where HX2004-6 is expressed The sequences of the HX2004-6 promoter elements of the mvention can be based on the nucleotide sequences of any species (e g , mammalian or non-mammalian (e g , reptiles, amphibians, avian (e g , chicken)), particularly mammalian, mcluding human, rodenti (e g , munne or rat), bovme, ovine, porcine, muπne, or equme, preferably rat or human) and can be isolated or produced from any source whether natural, synthetic, semi-synthetic or recombmant

As shown in Example 5, overexpression of HX2004-6 is restncted to neoplasms of pancreas, breast, and colon, particularly neoplasms of ductal epithelial cells of these tissues The tissue-restncted overexpression of HX2004-6 is useful for determining the pattern of expression, and for providing promoters that mimic the native pattern of expression Naturally occurring polymorphisms in the promoter region are useful for determmmg natural vanations m expression, particularly those that may be associated with disease Alternatively, mutations may be introduced mto the promoter region to determine the effect of altenng expression m experimentally defined systems Methods for the identification of specific DNA motifs involved in the bmdmg of transcnptional factors are known m the art, e g sequence similanty to known bmdmg motifs, gel retardation studies, etc For examples, see Blackwell et al 1995 Mol Med 1 194-205, Mortlock et al 1996 Genome Res 6 327-33, and Joulin and Richard-Foy (1995) Eur J Biochem 232 620-626

As shown m Example 5, HX2004-6 is overexpressed in certam cancer cells, namely pancreas, colon, and breast cancers, particularly adenocarcmomas. particularly cancerous ductal epithelial cells of these tissues Accordmgly, m some embodiments, HX2004-6 polynucleotides are over-expressed m exocrme pancreatic, colorectal, and/or breast cancer cells, particularly adenocarcmomas, particularly cancerous ductal epithelial cells of these cancers "Overexpression intends that an HX2004-6 mRNA is found at levels at least about 1 5-fold, normally at least about 2-fold, usually at least about 5-fold, generally at least about 10-fold, up to at least about 50-fold or higher when compared with a non-cancerous cell of the same cell type Those skilled in the art can readily determine whether an HX2004-6 nucleic acid is overexpressed, usmg any known method, including Northern blot analysis, m situ hybndization. and the like, using an HX2004-6 nucleic aαd of the mvention or fragment thereof

HX2004-6 regulatory sequences may be used to identify cis acting sequences required for transcnptional or translational regulation of HX2004-6 expression, especially m different tissues or stages of development, and to identify cis acting sequences and trans acting factors that regulate or mediate HX2004-6 expression Such transcnptional or translational control regions may be operably linked to an HX2004-6 gene or other genes m order to promote expression of wild type or altered HX2004-6 or other protems of interest in cultured cells, or m embryonic, fetal or adult tissues, and for gene therapy HX2004-6 transcnptional or translational control regions can also be used to identify extracellular signal molecules that regulate HX2004-6 promoter activity, and thus regulate HX2004-6 expression

The nucleic acid compositions used m the subject invention may encode all or a part of the HX2004-6 polypeptides as appropπate SEQ ID NO 2 gives the ammo acid translation of the nucleotide sequence given as SEQ ID NO 1 SEQ ID NO 4 gives the ammo acid translation of the nucleotide sequence given as SEQ ID NO 3 In some embodiments, an HX2004-6 polynucleotide encodes a polypeptide having the ammo acid sequence shown m SEQ ID NO 2 In other embodiments, an HX2004-6 polynucleotide encodes a polypeptide having the ammo acid sequence shown as ammo acids 1-342 of SEQ ID NO 2 In other embodiments, an HX2004-6 polynucleotide encodes a polypeptide having the amino acid sequence shown m SEQ ID NO 4 In other embodiments, an HX2004-6 polynucleotide encodes a polypeptide having the ammo acid sequence given as ammo acids 1-352 of SEQ ID NO 4 Also encompassed are HX2004-6 polynucleotides encodmg vanants, fragments and fusion proteins of the aforementioned polypeptides Accordmgly, the mvention encompasses an HX2004-6 polynucleotide which encodes a polypeptide having an ammo acid sequence of at least 5, usually at least about 15, usually at least about 30 or more contiguous ammo acids of ammo aαds 1-342 of SEQ ID NO 2 or ammo aαds 1 -352 of SEQ ID NO 4, vaπants of an HX200-46 polypeptide, particularly vaπants having conservative ammo acid substitutions of the aforementioned fragments, and fusion protems compnsmg any one of the aforementioned fragments and a heterologous polypeptide (I e , a non- HX2004-6 polypeptide)

HX2004-6 nucleic acids can be obtained by chemical or biochemical synthesis, bv recombmant DNA techniques, or by isolating the nucleic acids from a biological source Fragments may be obtamed of the DNA sequence bv chemicalK synthesizing oligonucleotides in accordance with conventional methods, by restnction enzyme digestion, by amplification (e g bv a polymerase cham reaction), etc For the most part. DNA fragments will be of at least about ten contiguous nucleotides, usually at least about 15 nucleotides (nt), more usually at least about 18 nt to about 20 nt, more usually at least about 25 nt to about 50 nt Such small DNA fragments are useful as primers for PCR, hybπdization screening, etc Larger DNA fragments, / e greater than 100 nt are useful for production of the encoded polypeptide For use in amplification reactions, such as PCR, a pair of pnmers will be used The exact composition of the pπmer sequences is not cntical to the mvention, but for most applications the pπmers will hybπdize to the subject sequence under stringent conditions, as known m the art It is preferable to choose a pair of pnmers that will generate an amplification product of at least about 50 nt, preferably at least about 100 nt Algonthms for the selection of pπmer sequences are generally known, and are available m commerαal software packages Amplification pπmers hybndize to complementary strands of DNA, and will prime towards each other

The HX2004-6 gene is isolated and obtamed in substantial punty, generally as other than an mtact mammahan chromosome Usually, the DNA will be obtamed substantially free of other nucleic aαd sequences that do not mclude an HX2004-6 sequence or fragment thereof, generally bemg at least about 50%, usually at least about 90% pure and are typically "recombmant", i e flanked by one or more nucleotides with which it is not normally assoαated on a naturally occurπng chromosome

The DNA sequences are used m a vanety of ways They can be used in methods to detect HX2004-6 mRNA in a biological sample, as descnbed m more detail below They may also be used as probes for identifying homologs of HX2004-6 Mammahan homologs have substantial sequence similanty to one another, i e at least 75%, usually at least 90%, more usually at least 95% sequence identity Sequence similanty is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, codmg region, flanking region, etc A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is bemg compared Algonthms for sequence analysis are known m the art, such as BLAST, descnbed in Altschul et al (1990) JMol Biol 215 403-10 For the purposes of this mvention, sequence identity is determined by the Smith-Waterman homology search algonthm as implemented m MPSRCH program (Oxford Molecular) For the purposes of this mvention, a prefeπed method of calculating percent identity is the Smith-Waterman algonthm. usmg the followmg Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algonthm as implemented m MPSRCH program (Oxford Molecular) using an affine gap search with the followmg search parameters gap open penalty, 12. and gap extension penalty. 1

Nucleic acids having sequence similanty are detected by hvbndization under low stnngency conditions, for example, at 50°C and 6XSSC (0 9 M salme 0 09 M sodium citrate) and remam bound when subjected to washing at 55°C in 1XSSC (0 15 M sodium chlonde/0 015 M sodium citrate) Sequences shanng a high degree of nucleotide sequence identity may be determined by hybπdization under high stnngency conditions, for example, at 50°C or higher and 0 1XSSC (15 mM salme/0 15 mM sodium citrate) By usmg probes, particularly labeled probes of DNA sequences, one can isolate homologous or related genes The source of homologous genes may be any species, e g pπmate speαes. particularly human, rodents, such as rats and mice, canines, felmes. bovmes, ovmes, equines, yeast, Drosophύa, Caenhorabditis, etc

The HX2004-6-encodιng DNA may also be used to identify expression of the gene m a biological speαmen The manner m which one probes cells for the presence of particular nucleotide sequences, as genomic DNA or RNA is well established m the literature and does not require elaboration here mRNA may be isolated from a cell sample, or may be detected without being first isolated mRNA may be amplified by RT-PCR. usmg reverse transcnptase to form a complementary DNA strand, followed by polymerase cham reaction amplification usmg pπmers speαfic for the subject DNA sequences Alternatively, mRNA sample is separated by gel electrophoresis, transfeπed to a suitable support, e g mtrocellulose, nylon, etc , and then probed with a fragment of the subject DNA as a probe Other techniques, such as oligonucleotide hgation assays, in situ hybndizations, and hybndization to DNA probes aπayed on a solid chip may also find use Detection of mRNAhybπdizmg to an HX2004-6 sequence is indicative of HX2004-6 gene expression m the sample The HX2004-6 nucleic acid sequence may be modified for a number of purposes, particularly where they will be used lntracellularly. for example, by bemg joined to a nucleic acid cleaving agent, e g a chelated metal ion. such as iron or chromium for cleavage of the gene, or the

The sequence of the HX2004-6 locus, including flanking promoter regions and codmg regions, may be mutated m vaπous ways known m the art to generate targeted changes m promoter strength, sequence of the encoded protein, etc The DNA sequence or product of such a mutation will be substantially similar to the sequences provided herein, i e will differ by at least one nucleotide or ammo acid, respectively, and may differ by at least two but generally not more than about ten nucleotides or ammo acids The sequence changes may be substitutions, insertions or deletions Deletions may further include larger changes, such as deletions of a domain or exon Other modifications of mterest mclude epitope tagging, e g with the FLAG system. HA etc For studies of subceUular localization, fusion proteins with green fluorescent proteins (GFP) mav be used Such mutated genes mav be used to study structure-function relationships of HX2004-6 polypeptides with other polypeptides. or to alter properties of the proteins that affect their function or regulation Such modified HX2004-6 sequences can be used, for example, to generate transgenic animals

Techniques for m vitro mutagenesis of cloned genes are known Examples of protocols for scanning mutations may be found m Gustin et al , 1993 Biotechmques 14 22 , Barany, 1985 Gene 37 111-23, Co celh et al , 1985 Mol Gen Genet 199 537-9. and Prentki et al , 1984 Gene 29 303- 13 Methods for site-specific mutagenesis can be found in Sambrook et al , 1989 Molecular Cloning A Laboratory Manual, CSH Press, pp 15 3-15 108, Werner et al , 1993 Gene 126 35-41. Sayers et al . 1992 Biotechmques 13 592-6. Jones and Winistorfer, 1992 Biotechmques 12 528-30. Barton et al , 1990 Nuclαc Acids Res 18 7349-55, Marotti and Tomich, 1989 Gene Anal Tech 6 67-70, and Zhu 1989 Anal Biochem 177 120-4

Recombmant Vectors

The present mvention further provides recombmant vectors compnsmg an HX2004-6 polynucleotide of the mvention Recombmant vectors are useful for propagation of the subj ect HX2004-6 polynucleotides (clonmg vectors) They are also useful for effecting expression of an HX2004-6 polynucleotide m a cell The choice of appropπate vector is well within the skill of the art A wide vaπety of vectors, both cloning vectors and expression vectors, are known to those skilled m the art, have been descnbed in, inter alia. Current Protocols m Molecular Biology. (F M Ausubel, et al , Eds 1987, and updates), and can be used in the present mvention Many such vectors are available commerαally

The subject polynucleotides are generally propagated by placmg an HX2004-6 polynucleotide m a vector Viral and non-viral vectors can be used, mcludmg plasmids The choice of plasmid will depend on the type of cell m which propagation is desired and the purpose of propagation Certam vectors are useful for amplifying and making large amounts of the desired DNA sequence

Other vectors are suitable for expression m cells m culture ("expression vectors") These vectors will generally mclude regulatory sequences ("control sequences" or "control regions") which are necessary to effect the expression of an HX2004-6 polynucleotide to which they are operably linked Still other vectors are suitable for transfer and expression m cells m a whole organism or person

Host Cells

The present mvention further provides isolated host cells compnsmg HX2004-6 polynucleotides of the mvention Suitable host cells mclude prokaryotes such as E coli. B subtihs S cerevisiae. and eukaryotic cells, mcludmg mseα cells m combmation with baculovirus vectors, yeast cells, such as Saccharomyces cerevisiae, or cells of a higher organism such as vertebrates, particularly marnmals, e g COS 7 cells, may be used as the expression host cells Host cells can be used for the purposes of propagating an HX2004-6 polynucleotide. for production of an HX2004-6 polypeptide, or m a screening method as descnbed below

HX2004-6 Transgenic Animals

The HX2004-6-encodιng nucleic acids can be used to generate genetically modified non-human animals or site speαfic gene modifications in cell lmes The term "transgenic" is mtended to encompass genetically modified animals having a deletion or other knock-out of HX2004-6 gene activity, havmg an exogenous HX2004-6 gene that is stably transmitted m the host cells, "knock-in" having altered HX2004-6 gene expression, or havmg an exogenous HX2004-6 promoter operably linked to a reporter gene Of particular mterest are homozygous and heterozygous knock-outs of HX2004-6

Transgenic animals may be made through homologous recombination, where the HX2004-6 locus is altered Alternatively, a nucleic aαd construct is randomly integrated mto the genome

Vectors for stable integration mclude plasmids, retroviruses and other animal viruses, YACs (yeast artificial chromosomes), and the like Of mterest are transgenic mammals, preferably a mammal from a genus selected from the group consisting of Mus (e g , mice), Rattus (e g , rats), Oryctologus (e g , rabbits) and Mesocncetus (e g , hamsters) More preferably the animal is a mouse which is defective or contains some other alteration in HX2004-6 gene expression or function

A "knock-out" animal is genetically manipulated to substantially reduce, or eliminate endogenous HX2004-6 function, preferably such that target gene expression is undetectable or insignificant Different approaches may be used to achieve the "knock-out" A chromosomal deletion of all or part of the native HX2004-6 homolog may be mduced Deletions of the non- codmg regions, particularly the promoter region, 3' regulatory sequences, enhancers, or deletions of gene that activate expression of the HX2004-6 genes A functional knock-out may also be achieved by the introduction of an anti-sense construct that blocks expression of the native HX2004-6 gene (for example, see Li and Cohen (1996) Cell 85 319-329)

Conditional knock-outs of HX2004-6 gene function can also be generated Conditional knock-outs are transgenic animals that exhibit a defect in HX2004-6 gene function upon exposure of the animal to a substance that promotes target gene alteration, introduction of an enzyme that promotes recombination at the target gene site (e g , Cre m the Cre-loxP system), or other method for directing the target gene alteration

For example, a transgenic animal havmg a conditional knock-out of HX2004-6 gene function can be produced usmg the Cre-loxP recombination system (see. e , Kilby et al 1993 Trends Genet 9413-421) Creis an enzyme that exαses the DNA between two recognition sequences, termed loxP This system can be used m a vanety of ways to αeate conditional knockouts of HX2004-6 For example, two independent transgenic mice can be produced one transgenic for an HX2004-6 sequence flanked by loxP sites and a second transgenic for Cre The Cre transgene can be under the control of an inducible or devdopmentally regulated promoter (Gu et al 1993 Cell 73 1155-1164, Gu et al 1994 Science 265 103-106), or under control of a tissue-specific or cell type-specific promoter (e g , a pancreas-speαfic promoter or brain tissue-specific promoter) The HX2004-6 transgenic is then crossed with the Cre transgenic to produce progeny defiαent for the HX2004-6 gene only in those cdls that expressed Cre dunng development Transgenic animals may be made havmg an exogenous HX2004-6 gene For example, the transgenic animal may compnse a "knock-in" of an HX2004-6 gene, such that the host cell genome contains an alteration that results in altered expression (e g , mcreased (mcludmg ectopic) or decreased expression) of an HX2004-6 gene, e g , by introduction of an additional copy of the target gene, or by operatively inserting a regulatory sequence that provides for enhanced expression of an endogenous copy of the target gene "Knock-in" transgenics can be transgenic animals havmg a heterozygous knock-in of the HX2004-6 gene or a homozygous knock-in of the HX2004-6 "Knock-ins" also encompass conditional knock-ins

The exogenous gene mtroduced into the host cell genome to produce a transgenic animal is usually either from a different species than the animal host, or is otherwise altered m its codmg or non-codmg sequence The introduced gene may be a wild-type gene, naturally occurring polymorphism, or a genetically manipulated sequence, for example those previously descπbed with ddetions, substitutions or insertions m the coding or non-codmg regions The introduced sequence may encode an HX2004-6 polypeptide, or may utilize the HX2004-6 promoter operably linked to a reporter gene Where the mtroduced gene is a codmg sequence, it is usually operably linked to a promoter, which may be constitutive or mducible, and other regulatory sequences required for expression m the host animal

Speαfic constructs of mterest mclude, but are not limited to, anti-sense HX2004-6, or a πbozyme based on an HX2004-6 sequence, which will block HX2004-6 expression, as well as expression of dominant negative HX2004-6 mutations, and over-expression of an HX2004-6 gene A detectable marker, such as lac Z may be introduced mto the HX2004-6 locus, where upregulation of expression of the HX2004-6 gene will result m an easily detected change m phenotype Constructs utilizing a promoter region of the HX2004-6 genes m combmation with a reporter gene or with the codmg region of HX2004-6 are also of mterest Constructs havmg a sequence encodmg a truncated or altered (e g, mutated) HX2004-6 are also of mterest The modified cells or animals are useful in the study of function and regulation of HX2004-6 Such modified cells or animals are also useful m, for example, the study of the function and regulation of genes whose expression is affected by HX2004 Thus, the transgenic animals of the mvention are useful m identifying downstream targets of HX2004-6. as such targets may have a role m the phenotypes assoαated with overexpression of HX2004-6

Animals may also be used m functional studies, drug screening, etc . e g to determine the effect of a candidate drug on HX2004-6 expression A seπes of small deletions and/or substitutions may be made m the HX2004-6 genes to determine the role of different polypeptide-encoding regions in DNA bmdmg, transcπptional regulation, etc By providing expression of HX2004-6 protem in cells m which it is otherwise not normally produced (e g , ectopic expression), one can mduce changes m cell behavior

DNA constructs for homologous recombination will compnse at least a portion of the HX2004-6 gene with the desired genetic modification, and will mclude regions of homology to the target locus DNA constructs for random integration need not mclude regions of homology to mediate recombination Conveniently, markers for positive and negative selection are mcluded Methods for generating cdls havmg targeted gene modifications through homologous recombination are known m the art For vaπous techniques for transfecting naarnrnalian cells, see Keown et al 1990 Methods m Enzymology 185 527-537

For embryonic stem (ES) cells, an ES cell lme may be employed, or embryonic cdls may be obtamed freshly from a host, e g mouse, rat, guinea pig, etc Such cells are grown on an appropnate fibroblast-feeder layer or grown m the presence of appropnate growth factors, such as leukemia inhibiting factor (LIF) When ES cells have been transformed, they may be used to produce transgenic animals After transformation, the cdls are plated onto a feeder layer m an appropπate medium. Cells contammg the construct may be detected by employing a selective medium After suffiαent time for colomes to grow, they are picked and analyzed for the occuπence of homologous recombination or integration of the construct Those colonies that are positive may then be used for embryo manipulation and blastocyst injection Blastocysts are obtamed from 4 to 6 week old superovulated females The ES cells are trypsinized, and the modified cdls are injected mto the blastocod of the blastocyst After injection, the blastocysts are returned to each uterine horn of pseudopregnant females Females are then allowed to go to term and the resulting litters screened for mutant cells having the construct Bv providing for a different phenotype of the blastocyst and the ES cells, chimenc progeny can be readily detected

The chimenc animals are screened for the presence of the modified gene Chimenc animals havmg the modification (normally chimenc males) are mated with wild-type animals to produce heterozygotes. and the heterozygotes mated to produce homozygotes If the gene alterations cause lethality at some pomt m development, tissues or organs can be maintained as allogeneic or congemc grafts or transplants, or m in vitro culture

Investigation of genetic function may utilize non-mammalian modds, particularly usmg those organisms that are biologically and genetically well charactenzed. such as C elegans. D melanogaster and S cerevisiae For example, transposon (Tel) insertions m the nematode homolog of an HX2004-6 gene or a promoter region of an HX2004-6 gene may be made The HX2004-6 gene sequences may be used to knock-out or to complement defined genetic lesions m order to determine the physiological and biochemical pathways mvolved m development of a neoplasm It is well known that human genes can complement mutations m lower eukaryotic models

HX2004-6 Polypeptides

The mvention provides isolated HX2004-6 polypeptides and methods for making the polypeptides HX2004-6 polypeptides mclude polypeptides havmg the sequences shown m SEQ ID NO 2 and SEQ ID NO 4, ammo acids 1-342 of SEQ ID NO 2, ammo acids 1-352 of SEQ ID NO 4, vaπants thereof, particularly vaπants compnsmg conservative amino acid substitutions, fragments thereof, particularly fragments havmg at least about 5. usually at least about 15, usually at least about 30 or more contiguous ammo acids of the aforementioned sequences; and fusion protems thereof HX2004-6 polypeptides can be chemically synthesized, produced by recombmant methods, isolated from a biological source, or a combmation of the foregomg

HX2004-6-encodιng nucleic acid may be emploved to synthesize full-length HX2004-6 polypeptides or fragments thereof, for example, fragments at least about 8 ammo acids m length. more usually at least about 15 ammo acids m length, to about 25 ammo acids, and up to the complete open reading frame of the HX2004-6 cDNA and mcludmg fusions of the subject polypeptides to other proteins or parts thereof For expression, an expression cassette may be employed, providing for a transcnptional and translational initiation region, which may be mduαble or constitutive, where the codmg region is operably linked under the transcnptional control of the transcnptional initiation region, and a transcnptional and translational termination region Vanous transcπptional initiation regions may be employed that are functional m the expression host

The polypeptides may be expressed m prokaryotes or eukarvotes m accordance with conventional ways, depending upon the purpose for expression For large scale production of the protem. a unicellular organism such as E coli B subtύis S cerevisiae, or cells of a higher organism such as vertebrates, particularly mammals, e g COS 7 cells, mav be used as the expression host cells In many situations, it may be desirable to express the HX2004-6 genes m mammalian cells, particularly isolated mammahan cells, especially where the encoded polypeptides will benefit from native folding and post-translational modifications Small peptides can also be synthesized m the laboratory

With the availability of the polypeptides in large amounts, by employing an expression host, the polypeptides may be isolated and punned in accordance with conventional ways A lysate may be prepared of the expression host and the lysate punfied usmg HPLC, exclusion chromatography, gd electrophoresis, affinity chromatography, or other puπfication technique The punfied polypeptide will generally be at least about 80% pure, preferably at least about 90% pure, and may be up to and including 100% pure Pure is mtended to mean free of other protems, as wdl as cellular debns

Antibodies Specific for HX2004-6 Polypeptides

The mvention further provides isolated antibodies specific for HX2004-6 polypeptides of the mvention The HX2004-6 polypeptides can be used for the production of antibodies, where short fragments provide for antibodies speαfic for the particular polypeptide, and larger fragments or the entire protem allow for the production of antibodies over the surface of the polypeptide Antibodies may be raised to the wild-type or vaπant forms of HX2004-6 Antibodies may be raised to isolated peptides coπesponding to these domains, or to the native protem, e g by immunization with cells expressing HX2004-6, immunization with liposomes havmg HX2004-6 polypeptides inserted m the membrane, etc

Antibodies are prepared m accordance with conventional ways, where the expressed polypeptide or protein is used as an lmmunogen, by itself or conjugated to known lmmunogemc earners, e g KLH, pre-S HBsAg, other viral or eukaryotic proteins, or the like Vanous adjuvants may be employed, with a senes of mjections, as appropnate For monoclonal antibodies, after one or more booster mjections, the spleen is isolated, the lymphocytes immortalized by cell fusion, and then screened for high affinity antibody bmdmg The immortalized cells, / e hybndomas, producing the desired antibodies may then be expanded For further descnption, see Monoclonal Antibodies A Laboratory Manual, Harlow and Lane eds , Cold Spring Harbor Laboratoπes. Cold Spring Harbor. New York, 1988 If desired, the mRNA encodmg the heavy and light chains may be isolated and mutagemzed bv clonmg m E coli, and the heavy and light chains mixed to further enhance the affinity of the antibody Alternatives to m vivo immunization as a method of raising antibodies include bmdmg to phage "display" hbranes. usually in conjunction with in vitro affinity maturation Isolation of HX2004-6 Allehc Vanants and Homologs m Other Speαes

Other rnammahan HX2004-6 genes can be identified and isolated and their function characteπzed usmg the HX2004-6 genes used in the present mvention Other HX2004-6 genes of mterest mclude, but are not limited to, mammalian (e g , human, rodent (e g, muπne. or rat), bovine, fdme, canine, and the like) and non-mammalian (e g , chicken, reptile, and the like)

Methods for identifying, isolating, sequencing, and characteπzmg an unknown gene based upon its homology to a known gene sequence are wdl known m the art (see. e g , Sambrook et al . Molecular Clonmg A Laboratory Manual, CSH Press 1989

DETECTION METHODS USING HX2004-6 POLYNUCLEOTIDES AND ANTIBODIES OF THE INVENTION The present mvention provides detection methods usmg HX2004-6 polynucleotides, and antibodies specific for HX2004-6 polypeptides of the mvention Detection methods usmg HX2004-6 polynucleotides mclude methods of detecting a level of HX2004-6 messenger RNA (mRNA) m a biological sample These methods can be used to monitor HX2004-6 mRNA levels m response to a treatment, such as chemotherapy or radiation therapy, for treating pancreatic, breast, or colon cancer, to assess the efficacy of a drug m lowering HX2004-6 polynucleotide levds m a cdl, to detect the presence of cells m an mdividual or m a culture which overexpress HX2004- 6 mRNA wherem the presence of a cell or cells which overexpress HX2004-6 mRNA is indicative of the presence of cancerous cells, in screening methods to detect agents which modulate levels of HX2004-6 mRNA and to momtor progression of a cell from a normal to a neoplastic state

Detection methods to detect the presence of a HX2004-6 polynucleotide can also be used to detect a polymorphism m the HX2004-6 polynucleotide, which polymorphism may be indicative or predictive of a predisposition to develop pancreatic, breast, or colon cancer

Similarly, the mvention provides methods of detecting HX2004-6 polypeptides m a biological sample These methods can be used to assess the efficacy of a drug in loweπng

HX2004-6 polypeptide levels m a cdl, to detect the presence of cells m an mdividual or m a culture which overexpress HX2004-6 protem. wherem the presence of a cell or cells which overexpress HX2004-6 protem may be indicative of the presence of cancerous cells, m sαeening methods to ddect agents which modulate levds of HX2004-6 polypeptides, and to monitor progression of a cell from a normal to a neoplastic state Detection methods to detect the presence of a HX2004-6 polypeptide can also be used to detect the presence an abnormal HX2004-6 polypeptide. such as a truncated polypeptide. or other mutant HX2004-6 protem Methods of Detecting HX2004-6 mRNA m a Biological Sample

The present invention provides methods of detecting an HX2004-6 messenger RNA (mRNA) m a biological sample Such methods are useful diagnostic methods to assess the potential of a cell to become neoplastic (where overexpression of HX2004-6 is an indication that a cell is. or is pre-disposed to become, neoplastic). to assess the efficacy of a chemotherapeutic regimen, as part of a screening method to identify agents that reduce the expression of HX2004-6 mRNA and or to detect the presence of a cdl(s) which overexpress HX2004-6 mRNA The methods generally mvolve contacting a biological sample with an HX2004-6 polynucleotide capable of hybπdizing to an HX2004-6 mRNA or the complement thereof as appropπate, and detecting hybπdization mRNA can be detected directly, or can first be reverse transcnbed mto cDNA for analysis In addition, multiple copies of the mRNA can be made by amplification reactions, if desired. mRNA may be isolated from a biological sample, or may be detected without being first isolated Alternatively, the mRNA sample is separated by gel electrophoresis, transfeπed to a suitable support, e g mtrocellulose, nylon, etc , and then probed with all or a fragment of HX2004- 6 cDNA as a probe, and detecting hybπdization by Northern blotting, liquid hybndization techniques, and the like Where mRNA is being directly hybndized to an HX2004-6 polynucleotide, the HX2004-6 polynucleotide compπses a sequence complementary to the HX2004-6 mRNA bemg detected Alternatively, mRNA may be amplified by RT-PCR, usmg reverse transcnptase to form a complementary DNA strand, followed by a polymerase cham reaction amplification usmg pnmers specific for the subject DNA sequences

For example, pancreatic cells may be used as a source of mRNA which may be assayed directly or reverse transcnbed mto cDNA for analysis The nucleic aαd may be amplified by conventional techniques, such as the polymerase cham reaction (PCR), to provide sufficient amounts for analysis The use of the polymerase cham reaction is descnbed in Saiki, et al 1985 Science 239 487, a review of cuπent techniques may be found in Sambrook, et al Molecular Cloning A Laboratory Manual. CSH Press 1989, pp 14 2-14 33

In some instances, it mav be desirable to analyze many samples at the same time for HX2004-6 mRNA expression levels A vanetv of aπavs have been descπbed. and can be used m these methods Quantitative monitoring of gene expression patterns with a complementary DNA microaπay is descπbed m Schena et al (1995) Science 270 467 DeRisi et al (1997) Science 270 680-686 explore gene expression on a genomic scale Analysis of gene expression patterns m human cancer using a cDNA microarrav is descnbed in DeRisi et al (1996) Nat Genet 14 457 Expression analysis using nucleic acid arrays is reviewed by Ramsav (1998) Nat Biotech 16 40- 44 Methods for creating microaπays of biological samples, such as arrays of DNA samples to be used m DNA hybπdization assays, are descnbed m PCT publication no WO 95/35505, published December 28, 1995, U S 5,445,934. Drmanac et al , Science 260 1649, and Yershov et al (1996) Genetics 93 4913 Use of differential display to identify differential gene expression is descnbed m, for example, U S 5,776,683, and U S 5,807.680

Methods for preparation of substrate matnces (e g , arrays), design of oligonucleotides for use with such matnces. labeling of probes, hybndization conditions, scanning of hybπdized matnces, and analysis of patterns generated, mcludmg companson analysis, are descnbed m, for example, U S 5.800.992 Other techniques, such as oligonucleotide gation assays, and in situ hybπdizations, can also be used In situ hybndization is descnbed m a vanetv of textbooks, mcludmg, for example. Current Protocols in Molecular Biology, Ausubel et al . eds For example, a fragment of HX2004-6 cDNA, particularly and oligonucleotide of about 18-30 nucleotides in length, can be labeled, for example, with biotin, and used to probe a tissue section The tissue section can then be developed usmg an avidin-coupled enzyme and a substrate for the enzyme which yields a colored product Counterstaining with, for example, hematoxylm and eosm, accordmg to standard protocols, can be earned out

In other embodiments, mRNA is detected by amplifying reverse-transcπbed cDNA copies of the mRNA, usmg oligonucleotide pπmers that are detectably labeled. In these embodiments, a detectable label is mcluded m an amplification reaction Suitable labels mclude fluorochromes, e g fluorescein lsothiocyanate (FITC), rhodamme, Texas Red, phvcoerythπn. allophycocyanm. 6- carboxyfluorescein (6-FAM), 2^,,7'-dιmethoxy-4'.5'-dιchloro-6-carboxyfluorescem (JOE). 6- carboxy-X-rhodamine (ROX), 6-carboxy-2',4',7'.4,7-hexachlorofluorescein (HEX), 5-carboxyfluorescem (5-FAM) or N,N.N'.N'-tetramethyl-6-carboxyrhodamme (TAMRA), radioactive labels, e g ³²P. ³⁵S, ³H, etc The label may be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc havmg a high affinity bmdmg partner, e g avidin, specific antibodies, etc , where the bmdmg partner is conjugated to a detectable label The label may be conjugated to one or both of the pnmers Alternatively, the pool of nucleotides used m the amplification is labeled, so as to incorporate the label mto the amplification product Detection of the reverse-transcπbed and amplified HX2004-6 mRNA is achieved by standard methods to detect, as appropπate. fluorescence, radioactivity, the product(s) of an enzvmatic reaction, etc

Overexpression of HX2004-6 mRNA is assessed relative to an appropπate control, e g . a counterpart cell that is known to be normal, and/or a cell lme of the same cell type which is known to have normal expression of HX2004-6 mRNA Methods of detecting HX2004-6 polypeptides in a biological sample

The present mvention further provides methods of detecting HX2004-6 polypeptides m a biological sample Antibodies speαfic for HX2004-6 polypeptides can be used m these detection methods The methods generally compnse contacting a biological sample with an antibody speαfic for an HX2004-6 polypeptide, and detecting speαfic bmdmg

A sample is taken from a patient suspected of havmg an HX2004-6-assocιated disorder Samples, as used herein, mclude tissue biopsies, biological fluids, organ or tissue culture deπved fluids, and fluids extracted from physiological tissues, as well as deπvatives and fractions of such fluids If the polypeptide to be detected is associated with a cell, the number of cells m a sample will generally be at least about 10³, usually at least 10⁴ more usually at least about 10⁵ The cells may be dissociated, in the case of solid tissues, or tissue sections may be analyzed Alternatively a lysate of the cells may be prepared

Diagnosis may be performed by a number of methods The different methods all determine the absence or presence of HX2004-6 polypeptide m the biological sample bemg tested For example, detection may utilize staining of cells or histological sections, performed m accordance with conventional methods Antibodies speαfic for HX2004-6 polypeptides are added to the cell sample, and mcubated for a peπod of time sufficient to allow bmdmg to the epιtope(s), usually at least about 10 minutes The antibody may be labded with radioisotopes, enzymes, fluorescers, chemiluminescers, or other labels for direct ddection Alternatively, a second stage antibody or reagent is used to amplify the signal Such reagents are well known m the art For example, the pnmary antibody may be conjugated to biotin, with horseradish peroxidase-conjugated avidin added as a second stage reagent Final detection uses a substrate that undergoes a color change m the presence of the peroxidase The absence or presence of antibody bmdmg may be determined by vanous methods, mcludmg flow cytometry of dissociated cells, microscopy, radiography, scintillation counting, etc

An alternative method for diagnosis depends on the in vitro detection of binding between antibodies and HX2004-6 polypeptides m a cell lysate or other biological fluid Measuring the concentration of HX2004-6 bmdmg m a sample or fraction thereof may be accomplished by a vanety of specific assays A conventional sandwich type assay may be used For example, a sandwich assay may first attach HX2004-6-speαfic antibodies to an msoluble surface or support The particular manner of bmdmg is not crucial so long as it is compatible with the reagents and overall methods of the mvention They may be bound to the plates covalentlv or non-covalentlv

The insoluble supports may be any compositions to which polypeptides can be bound, which is readily separated from soluble matenal. and which is otherwise compatible with the overall method The surface of such supports may be solid or porous and of any convenient shape Examples of suitable insoluble supports to which the receptor is bound mclude beads, e g magnetic beads, membranes and miσotiter plates These are typically made of glass, plastic (e g polystyrene), polysacchaπdes, nylon or nitrocdlulose Microtiter plates are espeαally convenient because a large number of assays can be earned out simultaneously, usmg small amounts of reagents and samples

Cell lysates (or other biological fluid) are then added to separately assayable supports (for example, separate wells of a microtiter plate) contammg antibodies Preferably, a senes of standards, contammg known concentrations of normal and/or abnormal HX2004-6 is assayed m parallel with the samples or aliquots thereof to serve as controls Preferably, each sample and standard will be added to multiple wells so that mean values can be obtained for each The incubation time should be sufficient for bmdmg, generally, from about 0 1 to 3 hours is suffiαent After incubation, the msoluble support is generally washed of non-bound components Generally, a dilute non-ionic detergent medium at an appropπate pH, generally 7-8, is used as a wash medium From one to six washes may be employed, with suffiαent volume to thoroughly wash non- specifically bound proteins present m the sample

After washing, a solution containing a second antibody is applied The antibody will bmd HX2004-6 with suffiαent speαfiαty such that it can be distinguished from other components present The second antibodies may be labeled to facilitate direct, or indirect quantification of bmdmg Examples of labels that permit direct measurement of second receptor binding mclude radiolabels, such as ³H or ¹²⁵I, fluorescers. dyes, beads, chemilummescers, colloidal particles, and the like Examples of labels which permit indirect measurement of bmdmg mclude enzymes where the substrate may provide for a colored or fluorescent product In a prefeπed embodiment, the antibodies are labeled with a coval entry bound enzyme capable of providing a detectable product signal after addition of suitable substrate Examples of suitable enzymes for use m conjugates mclude horseradish peroxidase, alkalme phosphatase, malate dehydrogenase and the like Where not commerαally available, such antibody -enzyme conjugates are readily produced by techniques known to those skilled m the art The incubation time should be suffiαent for the labeled ligand to bmd available molecules Generally, from about 0 1 to 3 hr is sufficient, usually 1 hr sufficing

After the second bmdmg step, the msoluble support is again washed free of non-specifically bound mateπal The signal produced by the bound conjugate is detected by conventional means Where an enzyme conjugate is used, an appropnate enzyme substrate is provided so a detectable product is formed

Other lmmunoassavs are known in the art and mav find use as diagnostics Ouchterlony plates provide a simple determination of antibody bmdmg Western blots may be performed on protem gds or protem spots on filters, usmg a detection system specific for HX2004-6 as desired. conveniently usmg a labeling method as descnbed for the sandwich assay Antibody aπavs may be formed wherem antibody specific for HX2004-6 polypeptide is attached to a solid support and, after allowing bmdmg of a test sample, HX2004-6 polypeptide is detected usmg a detectablv labeled antibody speαfic for HX2004-6 polypeptide

SCREENING ASSAYS

The transgenic animals, recombmant host cells, polynucleotides, and antibodies of the mvention can be used to identify candidate agents that affect HX2004-6 expression (e g , bv affecting HX2004-6 promoter function) or that interact with HX2004-6 polypeptides Agents of mterest can mclude those that enhance, inhibit, regulate, or otherwise affect HX2004-6 expression Of particular mterest are agents that reduce expression of HX2004-6 Agents that reduce HX2004-6 expression can be used to, for example, treat or study disorders associated with overexpression of HX2004-6 (e g , pancreatic, breast and/or colon cancer "Candidate agents" is meant to mclude synthetic molecules (e g , small molecule drugs, peptides, or other synthetically produced molecules or compounds, as well as recombinantly produced gene products) as well as naturally occurring compounds (e g , polypeptides, hormones, plant extracts, and the like) In the screening assays of the invention, results obtamed with test substances are compared to results obtamed with appropnate controls An appropnate control is provided by conducting the assay m the absence of the test substance Drug Screening Assays

Of particular mterest m the present invention is the identification of agents that have activity m affecting HX2004-6 expression and/or function Such agents are candidates for devdopment of treatments for, for example, cancer or other condition that may be assoαated with overexpression of HX2004-6 Drug screening identifies agents that provide for down-regulation of HX2004-6 expression or function m affected cells Of particular interest are sαeemng assays for agents that have a low toxicity for human cells

The term "agent" as used herem descπbes any molecule, e g protem or pharmaceutical, with the capability of reducmg expression of HX2004-6 and/or of reducing HX2004-6 polypeptide function Generally a plurality of assay mixtures are run m paralld with different agent concentrations to obtain a differential response to the vanous concentrations Typically, one of these concentrations serves as a negative control, i e at zero concentration or below the level of detection

Candidate agents encompass numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2.500 daltons Candidate agents compnse functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically mclude at least an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the functional chemical groups The candidate agents often compnse cyclical carbon or heterocychc structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups Candidate agents are also found among biomolecules mcludmg, but not limited to peptides, sacchaπdes. fatty acids, steroids, puπnes, pyπmidmes, deπvatives. structural analogs or combinations thereof

Candidate agents are obtamed from a wide vaπety of sources mcludmg libranes of synthetic or natural compounds For example, numerous means are available for random and directed synthesis of a wide vaπety of organic compounds and biomolecules, mcludmg expression of randomized oligonucleotides and oligopeptides Alternatively, libranes of natural compounds m the form of bactenal, fungal, plant and animal extracts are available or readily produced Additionally, natural or synthetically produced libranes and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatonal libranes Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esteπfication, amidification, etc to produce structural analogs

Screenmg of Candidate Agents In Vivo

Agents can be screened for their ability to affect HX2004-6 expression or function or to mitigate an undesirable phenotype (e g , a symptom) associated with an alteration m HX2004-6 expression or function In some embodiments, screenmg of candidate agents is performed m vivo m a transgenic animal descπbed herem Transgenic animals suitable for use m screenmg assays mclude any transgenic animal havmg an alteration in HX2004-6 expression, and can mclude transgenic animals havmg, for example, an exogenous and stably transmitted human HX2004-6 gene sequence, a reporter gene composed of an isolated human HX2004-6 promoter sequence operably linked to a reporter gene (e g, β-galactosidase, CAT, luciferase, or other gene that can be easily assayed for expression), or a homozygous or heterozygous knockout of an HX2004-6 gene The transgenic animals can be either homozygous or heterozygous for the genetic alteration and, where a sequence is mtroduced mto the animal's genome for expression, may contain multiple copies of the mtroduced sequence Where the in vivo screemng assay is to identify agents that affect the activity of the HX2004-6 promoter, the HX2004-6 promoter can be operably linked to a reporter gene (e g , luciferase) and integrated mto the non-human host animal's genome

The candidate agent is administered to a non-human, transgenic animal havmg altered HX2004-6 expression, and the effects of the candidate agent determined The candidate agent can be administered m any manner desired and or appropπate for delivery of the agent m order to effect a desired result For example, the candidate agent can be administered by injection (e g , by injection intravenously, mtramuscularly, subcutaneously, or directly mto the tissue m which the desired affect is to be achieved), orally, or by any other desirable means Normally, the in vivo screen will mvolve a number of animals receiving varying amounts and concentrations of the candidate agent (from no agent to an amount of agent that approaches an upper limit of the amount that can be ddivered successfully to the animal), and may mclude delivery of the agent m different formulation The agents can be administered smgly or can be combmed m combinations of two or more, especially where administration of a combination of agents may result m a synergistic effect

The effect of agent administration upon the transgenic animal can be momtored by assessmg HX2004-6 function as appropπate (e g , by examining expression of a reporter or fusion gene), or by assessmg a phenotype assoαated with the HX2004-6 expression For example, where the transgenic animal used m the screen exhibits overexpression of HX2004-6, the effect of the candidate agent can be assessed by deteπrunmg levels of HX2004-6 mRNA produced m normal non-transgenic httermates and/or m wildtype mice Levds of HX2004-6 mRNA can be measured using techniques that are well known m the art Where the in vivo screenmg assay is to identify agents that affect the activity of the HX2004-6 promoter and the non-human transgenic animal (or cultured mammahan cell lme) compπses an HX2004-6 promoter operably linked to a reporter gene, the effects of candidate agents upon HX2004-6 promoter activity can be screened by, for example, momtoπng the expression from the HX2004-6 promoter (through detection of the reporter gene) and coπdation of altered HX2004-6 promoter activity an abeπant cellular phenotype, such as abeπant mitotic activity, or other indications of neoplastic transformation Alternativdy or m addition, HX2004-6 promoter activity can be assessed by detection (qualitative or quantitative) of HX2004-6 mRNA or protem levels Where the candidate agent affects HX2004-6 expression, and/or affects an HX2004-6-assoαated phenotype, m a desired manner, the candidate agent is identified as an agent which may be suitable for use m therapy of an HX2004-6-associated disorder

Screenmg of Candidate Agents Using Cell-Based Assays

In addition to screenmg of agents in HX2004-6 transgenic animals, a wide vanety of cell- based assays may be used for this purpose, usmg, for example, a mammahan cdl transformed with a construct compnsmg HX2004-6 cDNA such that the cDNA is overexpressed, or. alternativdy, a construct compnsmg an HX2004-6 promoter operably linked to a reporter gene

Accordmgly, the present mvention provides a method for identifying an agent, particularly a biologically active agent, that modulates a level of human HX2004-6 expression m a cell, the method compnsmg combining a candidate agent to be tested with a cell compnsmg a nucleic acid which encodes a human HX2004-6 polypeptide. and determining the effect of said agent on HX2004-6 expression "Modulation" of HX2004-6 expression levds mcludes mαeasmg the levd and decreasing the level of HX2004-6 mRNA and/or HX2004-6 polypeptide encoded by the HX2004-6 polynudeotide when compared to a control lacking the agent bemg tested An increase or decrease of about 1 25-fold, usually at least about 1 5-fold, usually at least about 2-fold, usually at least about 5 -fold, usually at least about 10-fold or more, m the level (l e , an amount) of HX2004-6 mRNA and or polypeptide followmg contacting the cell with a candidate agent bemg tested, compared to a control to which no agent is added, is an indication that the agent modulates HX2004-6 expression

An agent bemg tested for its effect on HX2004-6 expression is assessed for any cytotoxic activity it may exhibit toward the cell used m the assay, usmg well-known assays, such as trypan blue dye exclusion, an MTT ([3-(4,5-dιmethylthιazol-2-yl)-2,5-dιphenyl-2 H-tetrazohum bromide]) assay, and the like Agents that do not exhibit cytotoxic activity are considered candidate agents

The cells used m the assay are usually inammahan cells, mcludmg, but not limited to, rodent cells and human cdls The cells may be pnmary cultures of ductal epithelial cells, or may be immortalized cell lines

HX2004-6 mRNA and/or polypeptide whose levels are being measured can be encoded by an endogenous HX2004-6 polynudeotide, or the HX2004-6 polynucleotide can be one that is compnsed withm a recombinant vector and mtroduced mto the cell, I e , the HX2004-6 mRNA and/or polypeptide can be encoded by an exogenous HX2004-6 polynudeotide For example, a recombinant vector may compnse an isolated human HX2004-6 transcπptional regulatory sequence, such as a promoter sequence, operably linked to a reporter gene (e g, β-galactosidase. CAT, luαferase, or other gene that can be easily assayed for expression) In these embodiments, the method for identifying an agent that modulates a level of human HX2004-6 expression m a cell, comprises combimng a candidate agent to be tested with a cell compnsmg a nucleic acid which comprises a human HX2004-6 gene transcπptional regulatory element operably linked to a reporter gene, and determining the effect of said agent on reporter gene expression A recombinant vector may comprise compnse an isolated human HX2004-6 transcnptional regulatory sequence, such as a promoter sequence, operably linked to sequences codmg for an HX2004-6 polypeptide, or the transcπptional control sequences can be operably linked to coding sequences for an HX2004-6 fusion protem compnsmg HX2004-6 polypeptide fused to a polypeptide which facilitates detection In these embodiments, the method compnses combimng a candidate agent to be tested with a cell compnsmg a nucleic aαd which compnses a human HX2004-6 gene transcnptional regulatory element operably linked to an HX2004-6 polypeptide-coding sequence, and determining the effect of said agent on HX2004 expression, which determination can be earned out by measuring an amount of HX2004-6 mRNA, HX2004-6 polypeptide, or HX2004-6 fusion polypeptide produced by the cdl.

Cell-based assays generally comprise the steps of contacting the cdl with an agent to be tested, forming a test sample, and, after a suitable time, assessing the effect of the agent on HX2004-6 expression. A control sample comprises the same cdl without the candidate agent added. HX2004-6 expression levels are measured in both the test sample and the control sample. A comparison is made between HX2004-6 expression level in the test sample and the control sample. HX2004-6 expression can be assessed using conventional assays. For example, when a mammalian cell line is transformed with a construct that results in expression of HX2004-6, HX2004-6 mRNA levds can be detected and measured, as described above, or HX2004-6 polypeptide levels can be detected and measured, as described above. A suitable period of time for contacting the agent with the cdl can be determined empirically, and is generally a time sufficient to allow entry of the agent into the cdl and to allow the agent to have a measurable effect on HX2004-6 mRNA and/or polypeptide levds. Generally, a suitable time is between 10 minutes and 24 hours, more typically about 1-8 hours. Methods of measuring HX2004-6 mRNA levels are known in the art, several of which have been described above, and any of these methods can be used in the methods of the present invention to identify an agent which modulates HX2004-6 mRNA levd in a cell, including, but not hmited to, a PCR, such as a PCR employing detectably labded oligonucleotide primers, and any of a variety of hybridization assays. Similarly, HX2004-6 polypeptide levds can be measured using any standard method, several of which have been described heran, including, but not limited to, an immunoassay such as ELISA or example an ELIS A employing a detectably labded antibody specific for an HX2004-6 polypeptide.

The method described above is useful for identifying agents which may be useful in treating certain cancers. An agent which reduces HX2004-6 expression and is not cytotoxic is considered a possible agent for treatment of adenocarcmomas of pancreatic, breast, and colon ductal epithelial cdl origin, e.g., to facilitate tumor regression, reduction in tumor mass, etc. Such agents are then further evaluated for safety and efficacy.

Screening of Candidate Agents Using Cell-Free Assays

Cell-free assays, i.e., assays which measure HX2004-6 polypeptide levds or function directly, include, but are not limited to, labeled in vitro protein-protein binding assays, protein-

DNA binding assays, electrophoretic mobility shift assays, irnmunoassays for protein binding, and the like. Using these methods, one can identify substances that bind specifically to HX2004-6 polypeptides. Such substances are useful as diagnostic agents to detect the presence of and/or to measure a level of HX2004-6 polypeptide in a biological. The screening assay can be a bmdmg assay, wherem one or more of the molecules may be jomed to a label, and the label directly or indirectly provide a detectable signal Vanous labels mclude radioisotopes, fluorescers, chemilummescers, enzymes, specific bmdmg molecules, particles, e g magnetic particles, and the like Specific bmdmg molecules mclude pairs, such as biotin and streptavidin. digoxm and antidigoxin etc For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, m accordance with known procedures

A vanety of other reagents may be mcluded in the screenmg assays descnbed herein Where the assay is a bmdmg assay, these mclude reagents like salts, neutral proteins, e g albumin, detergents, etc that are used to facilitate optimal protem-protem bmdmg, protem-DNA bmdmg, and/or reduce non-specific or background interactions Reagents that improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc may be used The components are added m any order that provides for the requisite bmdmg Incubations are performed at any suitable temperature, typically between 4 and 40°C Incubation penods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screenmg Typically between 0 1 and 1 hours will be sufficient

Many mammahan genes have homologs m yeast and lower animals The study of such homologs' physiological role and interactions with other protems m vivo or m vitro can facihtate understanding of biological function In addition to model systems based on genetic complementation, yeast has been shown to be a powerful tool for studying protem-protem interactions through the two hybnd system descπbed m Cmen et al 1991 Proc Natl Acad Sci USA 88 9578-9582 Two-hybnd system analysis is of particular mterest for exploring transcπptional activation by HX2004-6 protems and to identify cDNAs encodmg polypeptides that interact with HX2004-6 Identified Candidate Agents

The compounds havmg the desired activity (I e , modulation of HX2004-6 expression) may be administered m a physiologically acceptable earner to a host for treatment of a condition attributable to overexpression of HX2004-6 (e g , a neoplasm of a pancreatic, breast, or colon cell, particular an adenocarcmoma of one of these tissues) The therapeutic agents may be administered m a vanety of ways, orally, topically, parenterally e g subcutaneously, mtrapentoneally. by viral infection, lntravascularly, etc Dependmg upon the manner of introduction, the compounds may be formulated m a vaπety of ways The concentration of therapeutically active compound m the formulation may vary from about 0 1-100 wt %

The pharmaceutical compositions can be prepared m vaπous forms, such as granules, tablets, pills, suppositones, capsules, suspensions, salves, lotions and the like Pharmaceutical grade organic or inorganic carriers and or diluents suitable for oral and topical use can be used to make up compositions containing the therapeutically-active compounds. Diluents known to the art include aqueous media, vegetable and animal oils and fats. Stabilizing Agents, wetting and emulsifying Agents, salts for varying the osmotic pressure or buffers for securing an adequate pH value, and skin penetration enhancers can be used as auxiliary agents.

EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to carry out the invention and is not intended to hmit the scope of what the inventors regard as thdr invention. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental eπor and deviation should be accounted for. Unless indicated otherwise, parts are parts by waght, molecular waght is average molecular wdght, temperature is in degrees Celcius, and pressure is at or near atmospheric.

Example 1 ^■ Identification of a Message Differentiallv Expressed in Pancreatic Cancer Cdls

A family was identified that had several members who had been diagnosed with pancreatic cancer. The family members also have a form of diabetes. The pathological features of disease in the family included progression from normal to metaplasia to dysplasia to cancer. Tissues were obtained from a member of the family diagnosed with pancreatic cancer and from a member of the family diagnosed with dysplasia of panαeatic cells, and primary cultures of ductal cells prepared according to methods well known in the art. Tissue was also obtained from an unrelated person who was diagnosed with pancreatitis, and from an unrdated person who had a normal pancreas, and primary cultures of ductal cdls prepared according to methods well known in the art. The Genomyx HIEROGLYPH™ mRNA profile kit for differential display analysis was used according to the manufacturer's instructions to identify genes that are differentially expressed in the various samples rdative to one another. Briefly, RNA was extracted from primary cultures of ductal epithehal cells obtained from patients with normal pancreas, nonspecific pancreatitis, panαeatic dysplasia and pancreatic carcinoma. Two μg of total RNA prepared by the guamdinium method was reverse-transcribed with anchored oligo-dT primer in a 10 μl reaction volume. Two μl of each reaction was subjected to PCR using 200 primer pairs to profile gene expression, [α- 32P]dCTP (Amersham Pharmaάa Biotech Inc., Piscataway, NJ) was included in the PCR reaction. The PCR products were then separated on 6% sequencing gels using a GenomvxLR sequencer. The dried gds were subjected to autoradiography on Kodak BioMax films (33x61 cm). The cDNA fragment pattern in each sample was manually compared to the cDNA fragment pattern in every other sample on the gd. The results, depicted in Figure 1 , show that cDNA 2004-6 (HX2004-6) is expressed in ductal epithelial cdls of pancreatic tissue from individuals with panαeatic dysplasia and individuals with pancreatic cancer. In contrast, the transcript was not detectable in normal and pancreatitis samples. Thus, an alternative name assigned to the gene is PCD1 (pancreatic cancer-derived).

Example 2: Isolation and Sequencing of a Human HX2004-6 Polypeptide-Encoding Polynucleotide A band representing a differentially expressed gene product (i.e., a band assoriated with relativdy more or less cDNA in one sample relative to another) was cut from the gel, amplified, cloned, and sequenced. The polynucleotide sequence of cDNA fragments isolated from one such differentially displayed cDNA fragment was identified as being differentially regulated in panαeatic disease and potentially other cancers. A cDNA library prepared from the human colon cell line HT29 was screened to isolate a full-length cDNA This 4,612-nucleotide sequence ("clone 1") is given as SEQ ID NO: 1 in the sequence listing, and depicted in Figure 2. The predicted translation product of this polynucleotide is a 1054-amino add polypeptide (provided as SEQ ED NO:2). Another clone ("clone 2") was sequenced, and was found to differ from the sequence shown in SEQ ID NO:l by an insertion of 30 nucleotides (bold, underlined, lower-case lettering in Figure 3). Its sequence is provided as SEQ ID NO:3 in the sequence listing. Translation of this polynucleotide predicts a translation product of 1064 amino adds (provided as SEQ ID NO:4). The deduced amino add sequence contains a PDZ domain in the middle (amino acid residues 427-504) and a highly conserved LIM domain at the C-terminus (amino add residues 995-1053) (Fig. 3). PDZ domains (also called DHR or GLGF domains) are found in diverse membrane- proteins induding members of the MAGUK family of guanylate kinase homologues, several protein phosphatases and kinases, neuronal nitric oxide synthase, and several dystrophin-assodated proteins, collectively known as syntrophins. Many PDZ domain-containing proteins appear to be localized to highly spetialized submembranous sites. LIM domains are cysteine-rich domains that bind zinc ions, and which act as the interface for interface for protan-protein interaction. The LIM domain of HX2004-6 matched well with the LIM consensus motif CX₂CXι_6-23HX₂CX₂CX₂Cι_{6- 2}ιCX_2-3(C/H/D).

Example 3: Comparison of SEQ ID NOT with sequences in database

The sequence given as SEQ ID NO:l was used as a query sequence to search for similar sequences in GenBank, using the BLASTN (2.0.8) program with default parameters. Altschul et al. (1997) Nucl Acids Res 25 3389-3402 A 2224-nucleotide sequence havmg 100% nucleotide identity with nudeotides 1725-3863 of SEQ ID NO 1 was identified This sequence (GenBank Accession No AB020665) is a human cDNA clone, from brain tissue, which encodes a polypeptide termed KIAA0858 Nagase et al (1998) DNA Res 5 355-364 Companson of the predicted translation product of SEQ ID NO 1 with the translation product of the sequence found m

GenBank revealed 100% ammo aαd sequence identity between ammo aαds 343-1054 of HX 2004- 6 clone 1 polypeptide sequence and the KIAA0858 protein sequence

Another sequence was found which shares 100% nucleotide sequence identity with nucleotides 2837-3863 of SEQ ID NO 1 This sequence (GenBank Accession No U90654) is a partial cDNA sequence, from mRNA isolated from human panαeas, encoding a putative human zinc-finger domain Comparison of the amino aαd sequence revealed 100% amino aαd sequence identity between ammo aαds 714-1054 of the predicted translation product of SEQ ID NO 1 and ammo aαds of the predicted translation product of U90654

Example 4 Analysis of tissue and cell type distnbution of 2004 expression

To determine the tissue and cdl type distnbution of HX2004 expression, the HX2004 cDNA clone was used as a template for PCR to generate a radiolabded probe coπespondmg to a portion of the cDNA clone This radiolabeled fragment ("the PCR-2004 probe" or "the 2004-6 probe") was used to probe vanous RNA blots This probe corresponds to nudeotides 559 to 1107 of SEQ ID NO 3, is denoted by bold lettering m Figure 3, and is given here as SEQ ID NO 5

When the 2004-6 probe was used as a hybπdization probe with multiple tissue RNA blots (Clontech), a 4 6-kb band was observed m heart, placenta, lung, liver, kidney, and pancreas, as shown m Figure 4 A band coπespondmg to an approximatdy 6-kb mRNA speαes was seen m heart, brain, lung, hver, and skeletal muscle Thus, mRNA hybndizmg with the 2004-6 probe is found in a vaπety of normal tissues In addition, tissue-specific splicing event(s) may lead to messages of different lengths

A multiple tissue RNA blot contammg RNA from vaπous cancer cell hues was hybndized with the 2004-6 probe (upper pands) and, to control for amount of RNA loaded pa lane, a β-actin probe (lower panels) The results, depicted m Figure 5, show that the 4 6-kb band was observed m HeLa. MOLT-4 (lymphoblastic leukemia), SW480 (colorectal adenocarcinoma), and famtlv m A549 (lung carαnoma) cells

To assess whether expression of HX2004 mRNA is associated with a particular cancerous state, a human tumor mRNA Northern blot (Invrtrogen) was probed with the PCR-2004 probe The data, presented m Figure 6, show that the HX2004-6 message is detected in breast and colon tumors Lanes marked "T" in the left-hand panels are breast tumor tissue samples The first and third lanes marked "T" are invasive ductal carcinomas, while second lane marked "T" is a poorly differentiated invasive ductal carcinoma. Lane N in the left-hand pands is normal breast tissue. Lanes marked "T" in the right-hand panels are colon adenocarcinomas, and Lane N in the right- hand panels is normal colon tissue. HX2004-6 transcripts wae also detected in normal tissues. This likely reflects the fact that the tissues used to prepare the human tumor material comprise many different cell types, including ductal epithdial cells.

A variety of colon cancer cell lines were analyzed by Northern blot using the 2004-6 probe. The results, shown in Figure 7, show that dght cell lines strongly express mRNA hybridizing with the 2004-6 probe; three cdl lines show moderate levels of mRNA hybridizing with the 2004-6 probe; and three cell lines show low or undetectable expression of mRNA hybridizing with the 2004-6 probe.

Example 5: In situ hybridization analysis of HX2004-6 expression in breast, panαeas. and colon cancer tissue sections In view of the fact that the tissue samples analyzed in the Northern analysis described in

Example 4 comprise many different cell types, and thus would not assess differential expression in any one cell type, in situ hybridization analyses were conducted. Since these analyses use tissue sections, HX2004-6 expression levels in individual cell types can be evaluated.

Normal and cancerous tissue sections were obtained from colon, breast, liver, lung, pancreas, stomach and prostate tissues using standard methods. The sections were fixed with 4% paraformaldehyde fixative, then overlaid with a mixture of oligonucleotide probes coπesponding to HX2004-6, as follows:

Oligo #2 5'- GTAACTTTTTCGACGATCTTTCCAC -3' (SEQ ID NO:6) Oligo #4 5'- TATTTTCTGCATCTCCTCGTAACGC -3' (SEQ ID NO:7)

Oligo #6 5'- TGACATCACTCATGGACTTACTCCC -3' (SEQ ID NO: 8)

Oligo #8 5'- GTTCCATCTGCTTCTGTATAAACCG -3' (SEQ ID NO:9)

Oligo #13 5'- TCTGTTATCCTCATGTTTGTCTGGC -3' (SEQ ID NO: 10)

Oligo #14 5'- TCTGGCTTTTTCTTTCTCAAAGTGC -3' (SEQ ID NOT 1) Oligo #16 5'- AAGTGCTGGTACATAGATGGCTGTC -3' (SEQ ID NO: 12) Oligo #18 5'- TCTACTTTTGTTGGGGTTGAAAACG -3' (SEQ ID NO: 13) Oligo #19 5'- TGTGTCACTTTCAAAAACTTCACGC -3' (SEQ ID NO:14) Oligo #21 5'- AGAGCAGCTTGTCTATGAACTCCAG -3' (SEQ ID NO:15)

The oligonucleotides were labeled with fluorescein isothiocyanate (FITC) according to standard procedures. Normal and cancerous tissue was stained with hematoxylin-eosin. Hybridization was detected using the Super Sensitive ISH Detection System kit from Biogenex Laboratories, Inc., San Ramon, CA All procedures were carried out as instructed in the protocol provided by the manufacturer.

Table 1 summarizes the mRNA expression of HX2004-6 in 7 different tissues which we examined and Fig. 8 shows percentages of tissues which are positive for HX2004-6.

Table 1. Svimmary of HX2004-6 expression in tumor and normal tissues detected by in situ hybridization. =: srong expression; -: weak or no detectable expression

For all seven tumor tissues, HX2004-6 expression is highly expressed in a significant portion of the samples tested; in contrast, few or none showed positive HX2004-6 expression in normal samples for each tissue. Therefore, HX2004-6 expression is elevated in a significant portion of tumor tissue samples from colon, breast, liver, lung, pancreas, stomach and prostate cancer patients.

Example 6: Expression analysis bv real-time quantitative RT-PCR

Real-time quantitative PCR was performed using a Lightcycler instrument to investigate expression levels of HX2004-6 message in tumor tissues from dght colon cancer patients.

One μg human placenta total RNA (Clontech, Palo Alto, CA) was reverse-transcribed with oligo-dTι₈ primer at 42°C for 1 hour then heated at 94°C for 5 minutes in a total reaction volume of 20 μl (lst-Strand™ cDNA Systhesis Kit, Clontech). The reaction mix was used as the lx template standard for PCR in the Lightcycler. Serial dilutions from the lx template standard were then prepared: 10^_1x, 10^_2x, 10^"3x, lO^x, 10^"5x template standards.

Patient colon tissue was obtained at surgery and stored frozen in liquid nitrogen. The patient tissue samples were homogenized in TRIZOL reagent. Chloroform was then added to isolate RNA, followed by RNA predpitation with isopropanol. The RNA predpitates were washed with 75% ethanol, dried in air, then dissolved in RNase-free distilled water. The total RNA samples were treated with DNase I (RNase-free) (2 U/μl, Ambion, Austin, TX) and deaned up using RNeasy Mini Kit (Qiagen, Santa Clarita, CA) then reverse-transcribed with oligo-dTig primer (1 st-StrandTM cDNA Systhesis Kit, Clontech). PCR was performed in the Lightcycler using the following gene-spetific primers: β-actin: forward primer 5'-CGGGAAATCGTGCGTGACATTAAG-3' (SEQ ID NO: 16) reverse primer 5'-TGATCTCCTTCTGCATCCTGTCGG-3' (SEQ ID NO:17) PCD1 : forward primer 5'- TTCGTAGCATCAGTTGAAGCAGG -3' (SEQ ID NO: 18) reverse primer 5'- GGTGAACCAGCCTTTCCATAGC -3' (SEQ ID NO:19)

The 20-μl PCR reaction mix in each Lightcycler capillary contained 2 μl of lOx PCR buffer π, 3 mM MgCl₂ (Perkin-Eliner, Foster City, CA), 140 μM dNTP, 1:50000 of SYBR Green I, 0.25 mg/ml BSA, 1 unit of Taq polymerase (Boehringer Mannheim, Indianapolis, IN), 0.175 μM each primer, 2 μl of RT reaction mix. The PCR amplification began with 20-second denaturation at 95°C, followed by 45 cycles of denaturation at 95°C for 5 seconds, armealing at 60°C for 1 second and extension at 72°C for 30 seconds. At the end of final cycle, PCR products were annealed at 60°C for 5 seconds, then slowly heated to 95°C at 0.2°C/second, to measure mdting curves of specific PCR products. All experiments were performed in duplicate. Data analysis was performed using Lightcycler Software (Roche Diagnosis) with quantification and mdting curve options. The quantification assay was based on ddermination of the cycle crossing point, which represents the cycle when the PCR product begins to double with each cyde, i.e., when the log- linear phase begins. A template dilution test was performed and demonstrated that the gene- specific primers for β-actin and HX2004-6 are capable of accurate, sensitive and spedfic detection of expression levels for β-actin and HX2004-6, respectivdy (Data not shown). For each colon cancer patient, RNA was extracted from a trio of surgical spedmens: normal colon tissue, primary colon tumor tissue and metastatic liver tissue from patients with colon cancer. The sample trio from each patient was always tested simultaneously in the same run of the Lightcycler. Each run of the Lightcycla included a standard curve established on β-actin expression in the template standards, β-artin expression in patient tissue samples was used as the internal adjustment control.

The results are quantified and shown in Figures 9A-9H. HX2004-6 is overexpressed (> 2 fold) in primary tumor colon tissue and/or metastatic liver tissue relative to normal colon tissue in 5/8 patients. Spedfically, HX2004-6 was overexpressed in metastatic liver tissue relative to normal tissue in 5/8 patients; HX2004-6 was overexpressed in primary tumor tissue relative to normal tissue in 3/8 patients, and HX2004-6 was overexpressed m either primary tumor and/or metastatic liver tissue relative to normal tissue (1 e , m cancerous tissue relative to normal tissue) m 6/8 patients These results are consistent with the previous results from in situ hybπdization and Northern hybπdization descπbed above It is noteworthy that in one patient, HX2004-6 expression levels m primary tumor colon and metastatic liver tissue are dramatically decreased, not mcreased. relative to normal colon tissue

Example 7 Chromosomal localization of HX2004-6

To determine the chromosomal localization of HX2004-6. the 2004-6 probe was labeled and used as a probe on human metaphase chromosomes usmg fluorescence in situ hybndization accordmg to standard procedures The results mdicated that HX2004-6 localizes to 13q21 33

Example 8 Fabncating a DNA anay using polynucleotides differentially expressed m ductal epithelial cells A DNA array is made by spotting DNA fragments onto glass microscope slides that are pretreated with poly-L-lysme Spotting onto the array is accomplished by a robotic aπayer The DNA is cross-linked to the glass by ultraviolet madiation, and the free poly-L-lysme groups are blocked by treatment with 0 05% succmic anhydπde, 50% l-methyl-2-pyπohdmone and 50% borate buffer The spots on the anay are oligonucleotides synthesized on an ABI automated synthesizer

Each spot is one of the polynucleotides of SEQ ID NO 1 or 3. a fragment thereof, a complement thereof, or a complement of a fragment thereof, which coπespond to a gene that is differentially expressed m pancreatic, breast, or colon epithelial cells accordmg to varying disease states (e g , overexpressed m cancerous, pancreatic cancer, breast cancer, colorectal cancer cells) The polynucleotides may be present on the anay m any of a vaπety of combmations or subsets Some internal standards and negative control spots mcludmg non-differentially expressed sequences and/or bactenal controls are mcluded mRNA from patient samples is isolated, the mRNA used to produce cDNA. amplified and subsequently labeled with fluorescent nucleotides as follows isolated mRNA is added to a standard PCR reaction containing pπmers (100 pmoles each), 250μM nucleotides. and 5 Units of Taq polymerase (Perkm Elmer) In addition, fluorescent nucleotides (Cv3-dUTP (green fluorescence) or Cy5-dUTP (red fluorescence), sold by Amersham) are added to a final concentration of 60 μM The reaction is earned out in a Perkm Elmer thermocvcler (PE9600) for 30 cycles usmg the followmg cycle profile 92°C for 30 seconds, 58°C for 30 seconds and 72°C for 2 minutes Umncorporated fluorescent nucleotides are removed by size exclusion chromatography (Microcon- 30 concentration devices, sold by Amicon)

Buffer replacement, removal of small nucleotides and pnmers and sample concentration is accomphshed by ultrafiltration over an Amicon mιcroconcentrator-30 (mw cutoff = 30,000 Da) with three changes of 0 45 ml TE The sample is reduced to 5 μl and supplemented with 1 4 μl 20X SSC and 5 μg yeast tRNA Particles are removed from this mixture by filtration through a pre-wetted 0 45 μ microspin filter (Ultrafree-MC, Milhpore, Bedford, MA ) SDS is added to a 0 28% final concentration The fluorescently-labeled cDNA mixture is then heated to 98°C for 2 mm , quickly cooled and applied to the DNA anay on a microscope slide Hybndization proceeds under a covershp, and the slide assembly is kept m a humidified chamber at 65°C for 15 hours The slide is washed bnefly m IX SSC and 0 03% SDS, followed by a wash m 0 06% SSC

The shde is kept m a humidified chamber until fluorescence scanning was done Fluorescencescanmng and data acquisition are then accomplished usmg any of a vaπety of suitable methods well known m the art For example, fluorescence scanning is set for 20 microns/pixel and two readings are taken per pixel Data for channel 1 is set to collect fluorescence from Cy3 with excitation at 520 nm and emission at 550-600 nm Channel 2 collects signals excited at 647 nm and emitted at 660-705 nm, appropπate for Cy5 No neutral density filters are apphed to the signal from either channel, and the photomultiplier tube gam is set to 5 Fme adjustments are then made to the photomultiplier gam so that signals collected from the two spots are equivalent

The data acquired from the scan of the anay is then converted to any suitable form for analysis For example, the data may be analyzed usmg a computer system, and the data may be displayed m a pictoral format on a computer screen, where the display shows the array as a collection of spots, each spot coπespondmg to a location of a different polynucleotide on the array The spots vary m bπghtness accordmg to the amount of fluorescent probe associated with the spot, which m turn is coπelated with an amount of hybndized cDNA m the sample The relative bnghtness of the spots on the anay can be compared with one another to determme their relative intensities, either qualitatively or quantitatively

The display of spots on the anay, along with their relative bnghtness, provides a test sample pattern The test sample pattern can be then compared with reference anay patterns associated with positive and negative control samples on the same array, e g , an array having polynucleotides m substantially the same locations as the anay used with the test sample The reference anay patterns used m the companson can be anay patterns generated using samples from normal pancreas cells, cancerous pancreatic cells, pancreatitis-associated pancreas cells, normal breast and breast cancer cells, normal colon and colorectal cancer cells, and the like A substantial or significant match between the test array pattern and a reference anay pattern is indicative of a disease state of the patient from whom the test sample was obtamed The invention now being fully described, it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims.

Claims

What is claimed is

1 An isolated human HX2004-6 polypeptide

2 The human HX2004-6 polypeptide of claim 1 , compnsmg an ammo aαd sequence of SEQ ID NO 2

3 The human HX2004-6 polypeptide of claim 1 , which has an amino aαd sequence of amino aαds 1-342 of SEQ ID NO 2

4 An isolated polynucleotide, or complement thereof, compnsmg a polynucleotide sequence encodmg a human HX2004-6 polypeptide of claim 1

5 The isolated polynucleotide sequence of claim 4 compnsmg a polynucleotide sequence of SEQ ID NO 1

6 The isolated polynucleotide sequence of claim 4 havmg a polynudeotide sequence of nucleotides 1 - 1724 of SEQ ID NO 1

7 An isolated polynucleotide sequence which hybndizes under stringent conditions to a polynucleotide havmg the sequence depicted m SEQ ID NO 1

8 An isolated polynucleotide sequence which hybndizes under stringent conditions to a polynucleotide havmg the sequence of nucleotides 1 -1724 of SEQ ID NO 1

9 An isolated polynucleotide of claim 4, wherem said polynucleotide is overexpressed m an adenocarcinoma of a tissue selected from the group consisting of exocrme pancreas, breast, and colon

10 A recombmant expression vector compnsmg the polynucleotide sequence of claim 4

11 An isolated host cell compnsmg the polynucleotide sequence of claim 4

12 A method for producing the human HX2004-6 polypeptide of claim 1 , the method compnsmg the steps of a) cultuπng a recombmant host cell containing a human HX2004-6 polypeptide- encodmg polynudeotide sequence under conditions suitable for the expression of the polypeptide; and b) recoveπng the polypeptide from the host cell culture

13 An isolated antibody that speαfically bmds a human HX2004-6 polypeptide of claim 1

14 A method for identifying a polynucleotide homologous to the polynucleotide of claim

4, the method compnsmg the steps of contacting a polynucleotide probe with a test polynucleotide, the probe compnsmg at least 15 contiguous nucleotides of a polynucleotide sequence encodmg a human HX2004-6 polypeptide, and ddecting hybndization of the probe with the test polynucleotide, wherem ddection of hybndization of the probe to the test polynucleotide indicates that the polynucleotide shares sequence homology with the human HX2004-6 polypeptide-encodmg polynucleotide.

15. A method of detecting the presence of an HX2004-6 mRNA m a biological sample, compnsmg a) contacting the sample with an HX2004-6 polynucleotide, and b) detecting hybndization

16 The method of claim 15 , wheran the sample is ductal epithelial cells from a tissue selected from the group consisting of pancreas, colon, and breast

17 The method of claim 15, further compnsmg, before step (a) the step of making a cDNA copy of the HX2004-6 mRNA

18 A method for detecting the presence of an HX2004-6 polypeptide in a biological sample, compnsmg a) contacting the sample with an antibody specific for an HX2004-6 polypeptide. and b) detecting specific bmdmg of the antibody 19 A method for identifying an agent that modulates HX2004-6 expression m a cell, the method compnsmg combmmg a candidate agent with a cell compnsmg a nuclαc aαd encoding a human HX2004-6 polypeptide, and determining the effect of said agent on HX2004-6 expression

20 The method of claim 19. wherem said determinmg is earned out by measunng an amount of an HX2004-6 mRNA m the cell

21 The method of claim 19. wheran said determining is earned out by measunng an amount of an HX2004-6 polypeptide m the cdl