WO2001007606A1 - Axor21, recepteur couple g-proteine - Google Patents

Axor21, recepteur couple g-proteine Download PDF

Info

Publication number
WO2001007606A1
WO2001007606A1 PCT/GB2000/002899 GB0002899W WO0107606A1 WO 2001007606 A1 WO2001007606 A1 WO 2001007606A1 GB 0002899 W GB0002899 W GB 0002899W WO 0107606 A1 WO0107606 A1 WO 0107606A1
Authority
WO
WIPO (PCT)
Prior art keywords
receptor
polypeptide
mmch
polynucleotide
sequence
Prior art date
Application number
PCT/GB2000/002899
Other languages
English (en)
Inventor
David Malcolm Duckworth
Jeffrey Hill
Alison Isobel Muir
Philip Graham Szekeres
Original Assignee
Smithkline Beecham Plc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GBGB9917627.3A external-priority patent/GB9917627D0/en
Priority claimed from GBGB9920046.1A external-priority patent/GB9920046D0/en
Application filed by Smithkline Beecham Plc filed Critical Smithkline Beecham Plc
Priority to EP00948173A priority Critical patent/EP1196572A1/fr
Publication of WO2001007606A1 publication Critical patent/WO2001007606A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/723—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH receptor

Definitions

  • This invention relates to newly identified polypeptides and polynucleotides encoding such polypeptides, to their use in diagnosis and in identifying compounds that may be agonists, antagonists that are potentially useful in therapy, and to production of such polypeptides and polynucleotides.
  • the drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics", that is, high throughput genome- or gene-based biology. This approach as a means to identify genes and gene products as therapeutic targets is rapidly superceding earlier approaches based on “positional cloning”. A phenotype, that is a biological function or genetic disease, would be identified and this would then be tracked back to the responsible gene, based on its genetic map position.
  • proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 1991 , 351 :353-354).
  • these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins.
  • Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B. ., et al., Proc. Natl Acad.
  • the effect of hormone binding is activation of the enzyme, adenylate cyclase, inside the cell.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP.
  • GTP also influences hormone binding.
  • a G-protein connects the hormone receptor to adenylate cyclase.
  • G-protein was shown to exchange GTP for bound GDP when activated by a hormone receptor.
  • the GTP-carrying form then binds to activated adenylate cyclase.
  • Hydrolysis of GTP to GDP catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form.
  • G-piotein coupled leceptors (othei ⁇ vise known as 7TM l eceptoi s) hav e been characterized as including these seven conserved hydi ophobic stretches of about 20 to 30 amino acids connecting at least eight divergent hvdrophilic loops
  • the G-piotein family of coupled l eceptors includes dopamine receptors which bind to neuroleptic daigs used toi ti eating psychotic and neurological disordei s
  • Other examples of members of this fami lv include, but ai e not limited to. calcitonm. adrenei gic. endothe n.
  • G-protein coupled receptois contains potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus
  • G-protein coupled receptors such as the b-adrenoreceptor
  • phosphorylation by protein kinase A and or specific receptor kinases mediates receptor desensitization
  • G-protein coupled receptors can be lntracellularly coupled by heterotnme ⁇ c G-proteins to various intracellular enzymes, ion channels and transporters (see. Johnson et al , Endoc Rev , 1989, 10 317-331)
  • Different G-protein a-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell Phosphorylation of cytoplasmic residues of G-protein coupled l eceptors hav e been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors
  • G-protein coupled receptors are found in numerous sites within a mammalian host
  • the present invention relates to ⁇ XOR2 1 , in particular ⁇ XOR21 polypeptides and AXOR21 polynucleotides, recombinant mate ⁇ als and methods for their production
  • Such polypeptides and polynucleotides are of interest m relation to methods of treatment of certain diseases, including, but not limited to, obesity, diabetes, eating disorders, such as anorexia and bulimia
  • the invention relates to methods for identifying agonists and antagonists (e g , inhibitors) using the mate ⁇ als provided by the invention, and treating conditions associated with A ⁇ OR21 imbalance with the identified compounds
  • the invention relates to diagnostic assays for detecting diseases associated with inapprop ⁇ ate ⁇ O 21 activity or levels
  • Polypeptides of the present invention are believed to be members of the G protein-coupled receptor family of polypeptides
  • Preferred fragments of polypeptides of the present invention include an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids from the ammo acid sequence of SEQ ID NO 2, or an isolated polypeptide compnsmg an ammo acid sequence having at least 30, 50 or 100 contiguous ammo acids truncated or deleted from the ammo acid sequence of SEQ ID NO: 2.
  • Preferred fragments are biologically active fragments that mediate the biological activity of AXOR21 , including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also preferred are those fragments that are antigenic or immunogenic in an animal, especially in a human.
  • polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.
  • the polypeptides of the present invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence that contains secretory or leader sequences, pro-sequences, sequences that aid in purification, for instance multiple histidine residues, or an additional sequence for stability during recombinant production.
  • Polypeptides of the present invention can be prepared in any suitable manner, for instance by isolation form naturally occuring sources, from genetically engineered host cells comprising expression systems (vide infra) or by chemical synthesis, using for instance automated peptide synthesisers, or a combination of such methods.
  • Means for preparing such polypeptides are well understood in the art.
  • the present invention relates to AXOR21 polynucleotides.
  • Such polynucleotides include:
  • polynucleotides of the present invention include splice variants, allelic variants, and polymorphisms, including polynucleotides having one or more single nucleotide polymorphisms (SNPs).
  • Polynucleotides of the present invention also include polynucleotides encoding polypeptide variants that comprise the amino acid sequence of SEQ ID NO:2 and in which several, for instance from 50 to 30, from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acid residues are substituted, deleted or added, in any combination.
  • the present invention provides polynucleotides that are RNA transcripts of the DNA sequences of the present invention. Accordingly, there is provided an RNA polynucleotide that:
  • (a) comprises an RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
  • (b) is the RNA transcript of the DNA sequence encoding the polypeptide of SEQ ID NO:2;
  • RNA transcript of the DNA sequence of SEQ ID NO: 1 comprises an RNA transcript of the DNA sequence of SEQ ID NO: 1; or (d) is the RNA transcript of the DNA sequence of SEQ ID NO: 1 ; and RNA polynucleotides that are complementary thereto.
  • the polynucleotide sequence of SEQ ID NO:l shows homology with rat somatostatin receptor-like (SLC1) (B Lakaye et al., Biochim. Biophys. Acta 1401:216-220, 1998).
  • SLC1 rat somatostatin receptor-like
  • the polynucleotide sequence of SEQ ID NO: 1 is a cDNA sequence that encodes the polypeptide of SEQ ID NO:2.
  • the polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may be identical to the polypeptide encoding sequence of SEQ ID NO: 1 or it may be a sequence other than SEQ ID NO: 1, which, as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO:2.
  • the polypeptide of the SEQ ID NO:2 is related to other proteins of the G protein-coupled receptor family, having homology and/or structural similarity with rat somatostatin receptor-like (SLC 1 ) (B Lakaye et al., Biochim. Biophys. Acta 1401 :216-220, 1998).
  • Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polypeptides and polynucleotides of the present invention have at least one AXOR21 activity.
  • Polynucleotides of the present invention may be obtained using standard cloning and screening techniques from a cDNA library derived from mRNA in cells of human testes, small intestine, retina, (see for instance, Sambrook et al , Molecular Cloning A Laboratory Manual, 2nd Ed , Cold Sp ⁇ ng Harbor Laboratory Press, Cold Sp ⁇ ng Harbor, N Y (1989))
  • Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques
  • the polynucleotide may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions
  • a leader or secretory sequence such as those encoding a leader or secretory sequence, a pre-, or pro
  • Recombinant polypeptides of the present mvention may be prepared by processes well known in the art from genetically engmeered host cells compnsmg expression systems. Accordingly, in a further aspect, the present invention relates to expression systems compnsmg a polynucleotide or polynucleotides of the present invention, to host cells which are genetically engmeered with such expression sytems and to the production of polypeptides of the mvention by recombmant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs denved from the DNA constructs of the present invention
  • Preferred methods of introducing polynucleotides into host cells include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, catiomc hpid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection
  • Representative examples of approp ⁇ ate hosts include bacte ⁇ al cells, such as Streptococci,
  • Staphylococci E coh, Streptomyces and Bacillus subtihs cells
  • fungal cells such as yeast cells and Asperg ⁇ lus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells, and plant cells
  • Polypeptides of the present invention can be recovered and punfied from recombmant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectm chromatography Most preferably, high performance liquid chromatography is employed for pu ⁇ fication Well known techniques for refoldmg proteins may be employed to regenerate active conformation when the polypeptide is denatured during lntracellular synthesis, isolation and/or pu ⁇ fication
  • the diseases Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques well known in the art. Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or it may be amplified enzymatically by using PCR, preferably RT-PCR, or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype.
  • a polynucleotide of the present invention preferably the nucleotide sequence of SEQ ID NO: 1, or a fragment or an RNA transcript thereof;
  • PCRs result in 93 scores indicating the presence or absence of the PCR product of the gene of interest. These scores are compared with scores created using PCR products from genomic sequences of known location. This comparison is conducted at http://www.genome.wi.mit.edu/
  • the polynucleotide sequences of the present invention are also valuable tools for tissue expression studies. Such studies allow the determination of expression patterns of polynucleotides of the present invention which may give an indication as to the expression patterns of the encoded polypeptides in tissues, by detecting the mRNAs that encode them.
  • polypeptides of the present invention are expressed in, for example, brain, intestine, adipose, prostate and cartilage.
  • single chain antibodies such as those described in U.S. Patent No. 4,946,778, can also be adapted to produce single chain antibodies to polypeptides of this invention.
  • transgenic mice, or other organisms, including other mammals may be used to express humanized antibodies.
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or to purify the polypeptides by affinity chromatography.
  • Antibodies against polypeptides of the present invention may also be employed to treat diseases of the invention, amongst others.
  • polypeptides and polynucleotides of the present invention may also be used as vaccines. Accordingly, in a further aspect, the present invention relates to a method for inducing an immunological response in a mammal that comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response, including, for example, cytokine-producing T cells or cytotoxic T cells, to protect said animal from disease, whether that disease is already established within the individual or not.
  • An immunological response in a mammal may also be induced by a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal from diseases of the invention.
  • One way of administering the vector is by accelerating it into the desired cells as a coating on particles or otherwise.
  • Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid.
  • a polypeptide or a nucleic acid vector will be normally provided as a vaccine formulation (composition).
  • the formulation may further comprise a suitable carrier.
  • the identification of mMCH as a ligand for AXOR21 therefore facilitates the development of screening methods for identifying agonists and antagonists of the receptor. Accordingly, the present invention further provides a method of identifying compounds which bind to and activate (agonist) or inhibit activation (antagonist) of the receptor AXOR21 which method comprises using AXOR21, in combination with mMCH or a derivative thereof.
  • a suitable amino acid for adding to the N or C terminus of the peptide is lysine.
  • lysine is an example of an amino acid that can be used to substitute for an amino acid residue in the mMCH peptide. Lysine is a preferred residue for these pu ⁇ oses because of it's flexibility with regard the range of chemical labels which can be attached to it.
  • Further derivatives include truncated forms of mMCH wherein the mMCH peptide has one or more amino acid residues at the N-terminus, C-terminus or internal amino acid residues removed, or the mMCH peptide derivatives are synthesised to lack said residues.
  • mMCH peptides wherein one or more amino acid residues are substituted with other amino acid residues. Such substituted derivatives may or may not be truncated. Derivatives such as those described will include other naturally ocurring MCH peptides, for example salmon MCH (H.Kawauchi et al (1993), Ann. N.Y Acad. Sci., 680, 64). mMCH derivatives may include naturally occuring amino acid residues, naturally occuring amino acid residues that have been chemically modified and non-naturally occuring amino acid residues.
  • modified amino acid residues include radiolabeled residues (for example tyrosine labeled with ⁇ "Iodine) anc j chemically labeled residues with, for example, biotin or a fluorescent label.
  • mMCH is commercially available (Bachem).
  • mMCH and mMCH derivatives may be prepared by peptide synthesis methods well known in the art.
  • mMCH and mMCH derivatives may be made by recombinant DNA means whereby the polypeptide is expressed from an appropriate polynucleotide encoding said polypeptide either directly (the expressed mMCH or mMCH derivative peptide does not require any further processing) or as part of a polypeptide precursor from which the mMCH or mMCH derivative peptide is subsequently cleaved.
  • the mMCH peptide may be isolated directly from a natural source such as mammalian brain using standard isolation and purification methods (Saito et al, 1999, Nature, 400, 265- 269).
  • Another such screening method involves use of mammalian cells which are transfected to express the receptor of interest, and which are also transfected with a reporter gene construct that is coupled to activation of the receptor (for example, luciferase or beta-galactosidase behind an approp ⁇ ate promoter)
  • the cells are contacted with a test substance and a receptor hgand, such as mMCH, and the signal produced by the reporter gene is measured after a defined penod of time
  • the signal can be measured usmg a luminometer, spectrophotometer, fluo ⁇ meter, or other such instrument approp ⁇ ate for the specific reporter construct used
  • Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor
  • Kits may be provided for identifying agonists and antagonists for AXOR21.
  • Such kits comprise: (a) an AXOR21 polypeptide and labeled or unlabeled mMCH;
  • This invention also provides a method of treating an abnormal condition related to an under- expression of AXOR21 activity and/or a ligand thereof which comprises administering to a patient in need thereof a therapeutically effective amount of an agonist compound, including mMCH, which activates the receptor as hereinbefore described and thereby alleviate the abnormal conditions.
  • an agonist compound including mMCH
  • Identification of a ligand for AXOR21 allows for the effective identification of polyclonal or monoclonal antibodies raised against the AXOR21 which are neutralising antibodies.
  • Such neutralising antibodies are of use in therapy, in comparison to non-neutralising antibodies which are ineffective.
  • the present invention provides for the use of neutralising antibodies raised against AXOR21 in therapy.
  • a liquid formulation will generally consist of a suspension or solution of the compound or pharmaceutically acceptable salt in a suitable liquid carrier(s) for example, ethanol, glycerine, non-aqueous solvent, for example polyethylene glycol, oils, or water with a suspending agent, preservative, flavouring or colouring agent.
  • a suitable liquid carrier(s) for example, ethanol, glycerine, non-aqueous solvent, for example polyethylene glycol, oils, or water with a suspending agent, preservative, flavouring or colouring agent.
  • a composition in the form of a tablet can be prepared using any suitable pharmaceutical carrier(s) routinely used for preparing solid formulations. Examples of such carriers include magnesium stearate, starch, lactose, sucrose and cellulose.
  • a composition in the form of a capsule can be prepared using routine encapsulation procedures.
  • pellets containing the active ingredient can be prepared using standard carriers and then filled into a hard gelatin capsule; alternatively, a dispersion or suspension can be prepared using any suitable pharmaceutical carrier(s), for example aqueous gums, celluloses, silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule.
  • suitable pharmaceutical carrier(s) for example aqueous gums, celluloses, silicates or oils and the dispersion or suspension then filled into a soft gelatin capsule.
  • Typical parenteral compositions consist of a solution or suspension of the compound or pharmaceutically acceptable salt in a sterile aqueous carrier or parenterally acceptable oil, for example polyethylene glycol, polyvinyl pyrrolidone, lecithin, arachis oil or sesame oil.
  • Isolated means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is “isolated” even if it is still present in said organism, which organism may be living or non-living.
  • Polynucleotide generally refers to any polyribonucleotide (RNA) or polydeoxribonucleotide
  • Modifications may occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present to the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Polypeptides may be branched as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, biotinylation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma- carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination (see, for instance, Proteins
  • Identity reflects a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences In general, identity refers to an exact nucleotide to nucleotide or amino acid to ammo acid correspondence of the two polynucleotide or two polypeptide sequences, respectively, over the length of the sequences being compared
  • BESTFIT is more suited to comparing two polynucleotide or two polypeptide sequences that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer.
  • GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Neddleman and Wunsch (J Mol Biol, 48, 443-453, 1970).
  • GAP is more suited to comparing sequences that are approximately the same length and an alignment is expected over the entire length.
  • the parameters "Gap Weight” and "Length Weight” used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively.
  • % identities and similarities are determined when the two sequences being compared are optimally aligned.
  • a candidate polypeptide sequence having, for example, an Identity Index of 0.95 compared to a reference polypeptide sequence is identical to the reference sequence except that the polypeptide sequence may include an average of up to five differences per each 100 amino acids of the reference sequence. Such differences are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non-conservative substitution, or insertion. These differences may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between these terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.
  • Homolog is a generic term used in the art to indicate a polynucleotide or polypeptide sequence possessing a high degree of sequence relatedness to a reference sequence Such relatedness may be quantified by determining the degree of identity and/or similarity between the two sequences as hereinbefore defined Falling within this generic term are the terms "ortholog”, and “paralog” "Ortholog” refers to a polynucleotide or polypeptide that is the functional equivalent of the polynucleotide or polypeptide m another species "Paralog” refers to a polynucleotideor polypeptide that within the same species which is functionally similar
  • Fusion protein refers to a protein encoded by two, often unrelated, fused genes or fragments thereof
  • EP-A-0 464 *** discloses fusion proteins compnsmg various portions of constant region of immunoglobulin molecules together with another human protein or part thereof
  • employing an immunoglobulin Fc region as a part of a fusion protein is advantageous for use in therapy and diagnosis resulting m, for example, improved pharmacokinetic properties [see, e g , EP-A 0232 262]
  • the expressed receptor is utilized to screen compound banks, complex biological fluids, combmato ⁇ al organic and peptide libranes, etc. to identify antagonists Similarly, the receptor is screened against tissue extracts of human, and other mammalian, species, such as porcine tissue Specifically such tissue extracts include lung, liver, gut, heart, kidney, adrenals, lschemic brain, plasma, unne and placenta Extraction techniques employed in the formation of these tissue banks are known in the art
  • HEK 293 cells stably transfected with AXOR21 responded with a robust dose-dependent calcium mobilisation response to mMCH
  • Membranes obtained this way are suitable for the set-up of a high throughput mMCH binding competition assay to search for compounds that interfere in the hgand-receptor interaction
  • the total binding of mMCHto these membranes is first tested to be linear with the amount of membranes used
  • the time pe ⁇ od to reach equihb ⁇ um binding at a suitable temperature is also established and is in our expe ⁇ ence about 1 h at a temperature of 20 °C
  • For the screening assay typically 25 ⁇ g of membrane protein per well is used in a total volume of 100 ⁇ l buffer containing 50 mM HEPES, 1 mM CaCl2, 5 mM MgCl2 and 0 5 % Bovine serum albumin (western blot quality), pH 7 4
  • the concentration of *25 ⁇ _ mMCH is typically 1-2 nM and 75,000 cpm /well Specific binding of labeled mMCH should be displaced completely by unlabeled mMCH at concentrations
  • mMCH could be tagged with either a fluorescent label (page 415-421, Handbook of Fluorescent Probes and Research Chemicals 6th Edition, RP Haugland editor, Molecular Probes), a biotin label or a enzyme tag like the alkaline phosphatase SEAP-tag (H ⁇ sh ⁇ ema,K et al, J Biol Chem 1997, 272, 5846-53)
  • a fluorescent label page 415-421, Handbook of Fluorescent Probes and Research Chemicals 6th Edition, RP Haugland editor, Molecular Probes
  • biotin label or a enzyme tag like the alkaline phosphatase SEAP-tag (H ⁇ sh ⁇ ema,K et al, J Biol Chem 1997, 272, 5846-53)
  • the binding assay itself would typically be very similar to that descnbed for radiolabeled mMCH Detection of bound mMCH would be by measunng fluorescence, binding of streptavadin or
  • AXOR 21 Expression pattern of AXOR 21 was investigated using Taqman fluorescent PCR (Perkin Elmer) and human cDNAs prepared from vanous brain areas and peripheral tissues All Taqman analysis was carried out according to the manufacturers instructions using the following oligonucleotides AXOR 21 labelled probe 5' AATGAGTGTGGACAGGTACTTTGCCCTCGT 3'
  • Fig 1 shows that AXOR21 mRNA was detected at appreciable levels in brain and at lower levels in intestine, adipose, prostate and cartilage
  • Figure 1 shows the results of the Taqman expe ⁇ ments. Key to tissues- (1) Brain*, (2) pituitary, (3) heart, (4) lung, (5) liver, (6) foetal liver, (7) kidney, (8) skeletal muscle, (9) stomach, (10) small/large intestine, (1 1) spleen, (12) lymphocytes (PBMC), (13) macrophages, (14) adipose, (15) pancreas, (16) prostate (4 males), (17) placenta, (18) cartilage, (19) bone (1 male, 3 females), (20) bone marrow.
  • PBMC lymphocytes
  • pancreas (16) prostate (4 males), (17) placenta
  • cartilage (19) bone (1 male, 3 females), (20) bone marrow.
  • Figure 2 shows response (change in fluorescence as measured by FLIPR) in cells transiently expressing either the AXOR 21 receptor or the SLC-1 receptor (Chambers J et al , Nature 1999, 400:261-265, Saito Y et al, Nature 1999, 400:265-269), following challenge with human MCH.
  • the SLC-1 receptor is labelled "11CBY"

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Endocrinology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Immunology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des polypeptides et des polynucléotides AXOR21 ainsi que des procédés de production de ces polypeptides, au moyen de techniques recombinantes. L'invention concerne également l'utilisation des polypeptides AXOR21 et d'un ligand AXOR21, hormone de concentration de mélanine (MCH), en identifiant des composés qui peuvent être des agonistes ou des antagonistes qui peuvent servir en thérapie.
PCT/GB2000/002899 1999-07-27 2000-07-27 Axor21, recepteur couple g-proteine WO2001007606A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP00948173A EP1196572A1 (fr) 1999-07-27 2000-07-27 Axor21, recepteur couple g-proteine

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GBGB9917627.3A GB9917627D0 (en) 1999-07-27 1999-07-27 Novel compounds
GB9917627.3 1999-07-27
GBGB9920046.1A GB9920046D0 (en) 1999-08-24 1999-08-24 Novel receptor/ligand
GB9920046.1 1999-08-24

Publications (1)

Publication Number Publication Date
WO2001007606A1 true WO2001007606A1 (fr) 2001-02-01

Family

ID=26315801

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2000/002899 WO2001007606A1 (fr) 1999-07-27 2000-07-27 Axor21, recepteur couple g-proteine

Country Status (2)

Country Link
EP (1) EP1196572A1 (fr)
WO (1) WO2001007606A1 (fr)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001036471A3 (fr) * 1999-11-17 2002-01-03 Arena Pharm Inc Versions endogenes et non-endogenes de recepteurs couples a la proteine g humaine
WO2002003070A1 (fr) 2000-07-05 2002-01-10 Takeda Chemical Industries, Ltd. Procede de criblage d'antagoniste/agoniste du recepteur de l'hormone de concentration de la melanine (mch)
EP1233981A1 (fr) * 1999-11-16 2002-08-28 Merck & Co., Inc. Recepteur couple a la proteine g
JP2002296277A (ja) * 2000-07-05 2002-10-09 Takeda Chem Ind Ltd Ｍｃｈ受容体アンタゴニスト・アゴニストのスクリーニング方法
US6555339B1 (en) 1997-04-14 2003-04-29 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human protein-coupled receptors
WO2003104480A1 (fr) * 2002-06-08 2003-12-18 Aventis Pharma Deutschland Gmbh Procede pour identifier des agonistes ou des antagonistes du recepteur de type gpr45/gpr63
US6809104B2 (en) 2001-05-04 2004-10-26 Tularik Inc. Fused heterocyclic compounds
US6858619B2 (en) 2001-05-04 2005-02-22 Amgen Inc. Fused heterocyclic compounds
US6902902B2 (en) 2001-11-27 2005-06-07 Arena Pharmaceuticals, Inc. Human G protein-coupled receptors and modulators thereof for the treatment of metabolic-related disorders
US7045527B2 (en) 2002-09-24 2006-05-16 Amgen Inc. Piperidine derivatives
US7078187B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
US7078484B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
EP1686135A1 (fr) * 2000-02-23 2006-08-02 Pharmacia & Upjohn Company LLC Récepteurs couplés à la protéine G
US7119190B2 (en) 1997-04-14 2006-10-10 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human G protein-coupled receptors
US7141391B2 (en) 2001-11-13 2006-11-28 Neurogen Corporation Monkey and canine melanin concentrating hormone receptors
US7208282B2 (en) 2001-05-31 2007-04-24 Merck & Co., Inc. Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
US7253179B2 (en) 2002-11-06 2007-08-07 Amgen Inc. Fused heterocyclic compounds
US7300764B2 (en) 2002-06-08 2007-11-27 Sanofi-Aventis Deutschland Gmbh Method for identifying agonists and antagonists of the GPR45-like/GPR63 receptor

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2296792A1 (fr) * 1999-02-26 2000-08-26 Genset S.A. Sequences marqueurs exprimees et proteines humaines codees

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL 22 September 1998 (1998-09-22), SHAKER R. ET AL.: "Sequence-tagged connectors: A sequence approach to mapping and scanning the human genome.", XP002152582 *
SAITO Y. ET AL.: "Molecular characterization of the melanin-concentrating-hormone receptor.", NATURE, vol. 400, no. 6741, 15 July 1999 (1999-07-15), pages 265 - 269, XP002152581, ISSN: 0028-0836 *
See also references of EP1196572A1 *

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6555339B1 (en) 1997-04-14 2003-04-29 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human protein-coupled receptors
US7410777B2 (en) 1997-04-14 2008-08-12 Arena Pharmaceuticals, Inc. Non-endogenous, constitutively activated human G protein-coupled receptors
US7119190B2 (en) 1997-04-14 2006-10-10 Arena Pharmaceuticals, Inc. Endogenous and non-endogenous versions of human G protein-coupled receptors
EP1233981A1 (fr) * 1999-11-16 2002-08-28 Merck & Co., Inc. Recepteur couple a la proteine g
EP1233981A4 (fr) * 1999-11-16 2003-02-12 Merck & Co Inc Recepteur couple a la proteine g
US6593108B1 (en) 1999-11-16 2003-07-15 Merck & Co., Inc. Nucleic acid molecule encoding a melanin-concentrating hormone receptor 2 polypeptide
WO2001036471A3 (fr) * 1999-11-17 2002-01-03 Arena Pharm Inc Versions endogenes et non-endogenes de recepteurs couples a la proteine g humaine
EP1686135A1 (fr) * 2000-02-23 2006-08-02 Pharmacia & Upjohn Company LLC Récepteurs couplés à la protéine G
WO2002003070A1 (fr) 2000-07-05 2002-01-10 Takeda Chemical Industries, Ltd. Procede de criblage d'antagoniste/agoniste du recepteur de l'hormone de concentration de la melanine (mch)
JP2002296277A (ja) * 2000-07-05 2002-10-09 Takeda Chem Ind Ltd Ｍｃｈ受容体アンタゴニスト・アゴニストのスクリーニング方法
US7273710B2 (en) 2000-07-05 2007-09-25 Takeda Pharmaceutical Company Limited Method for screening MCH receptor antagonist/agonist
US7078187B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
US7078484B2 (en) 2001-04-19 2006-07-18 Neurogen Corporation Melanin concentrating hormone receptors
US6858619B2 (en) 2001-05-04 2005-02-22 Amgen Inc. Fused heterocyclic compounds
US7125885B2 (en) 2001-05-04 2006-10-24 Amgen Inc. Fused heterocyclic compounds
US6809104B2 (en) 2001-05-04 2004-10-26 Tularik Inc. Fused heterocyclic compounds
US7208282B2 (en) 2001-05-31 2007-04-24 Merck & Co., Inc. Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor
US7141391B2 (en) 2001-11-13 2006-11-28 Neurogen Corporation Monkey and canine melanin concentrating hormone receptors
US6902902B2 (en) 2001-11-27 2005-06-07 Arena Pharmaceuticals, Inc. Human G protein-coupled receptors and modulators thereof for the treatment of metabolic-related disorders
US7829298B2 (en) 2001-11-27 2010-11-09 Arena Pharmaceuticals, Inc. Human G protein-coupled receptors for metabolic-related disorders
US7300764B2 (en) 2002-06-08 2007-11-27 Sanofi-Aventis Deutschland Gmbh Method for identifying agonists and antagonists of the GPR45-like/GPR63 receptor
WO2003104480A1 (fr) * 2002-06-08 2003-12-18 Aventis Pharma Deutschland Gmbh Procede pour identifier des agonistes ou des antagonistes du recepteur de type gpr45/gpr63
US7045527B2 (en) 2002-09-24 2006-05-16 Amgen Inc. Piperidine derivatives
US7253179B2 (en) 2002-11-06 2007-08-07 Amgen Inc. Fused heterocyclic compounds

Also Published As

Publication number Publication date
EP1196572A1 (fr) 2002-04-17

Similar Documents

Publication Publication Date Title
WO2001007606A1 (fr) Axor21, recepteur couple g-proteine
EP0897980A2 (fr) CXCR4B: Un variant d'épissage humain du récepteur de chemokine CXCR4
WO2001016159A1 (fr) Gpcr, ant
WO2001004139A2 (fr) Sequences polynucleotidiques et polypeptidiques du recepteur humain axor29 et procedes de detection d'agonistes et d'antagonistes de l'interaction entre ce recepteur humain axor29 et ses ligands
US6344342B1 (en) Human G protein coupled lysophosphatidic acid receptor
WO1999042484A1 (fr) Fishboy, un recepteur couple a la proteine g
US6881827B2 (en) Molecular cloning of a 7TM receptor (AXOR34) and screening methods thereof
US6428982B1 (en) Polynucleotides encoding mouse urotensin-II Receptor (UTB-R)
US20010034331A1 (en) EDG family gene, human H218
EP1194551A1 (fr) Recepteur couple a la proteine g et ses sequences d'adn
EP1171467A1 (fr) Axor-27, recepteur couple a une proteine g
WO2001027153A1 (fr) Récepteur transmembranaire murin à sept régions, mus musculus mhneaa81
WO2001053308A1 (fr) Clonage d'un recepteur 7tm d'un singe (axor8)
WO2001042486A1 (fr) Axor12
US20020052330A1 (en) Molecular cloning of a chemokine receptor (SBELEVTM)
GB2364057A (en) G protein coupled receptor
US20020098538A1 (en) 7TM receptor (AXOR23)
US20050054034A1 (en) Thyrotropin-releasing hormone receptor-like gpcr(gprfwki)
GB2371301A (en) G protein coupled receptors
GB2365012A (en) G protein coupled receptor AXOR89
WO2001064836A2 (fr) Clonage d'un variant de gpr38
US20060154244A1 (en) Novel g-protein coupled receptor
GB2371546A (en) G protein coupled receptor AXOR 109
GB2364058A (en) AXOR79, a G-protein coupled receptor
GB2365009A (en) AXOR polypeptides and polynucleotides

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): JP

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 2000948173

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000948173

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 2000948173

Country of ref document: EP