WO2001007460A1 - FucR - Google Patents
FucR Download PDFInfo
- Publication number
- WO2001007460A1 WO2001007460A1 PCT/US2000/019776 US0019776W WO0107460A1 WO 2001007460 A1 WO2001007460 A1 WO 2001007460A1 US 0019776 W US0019776 W US 0019776W WO 0107460 A1 WO0107460 A1 WO 0107460A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- seq
- polynucleotide
- sequence
- isolated
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
- C07K14/3156—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci from Streptococcus pneumoniae (Pneumococcus)
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pulmonology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention provides fucR polypeptides and polynucleotides encoding fucR polypeptides and methods for producing such polypeptides by recombinant techniques. Also provided are methods for utilizing fucR polypeptides to screen for antibacterial compounds.
Description
FucR RELATED APPLICATIONS
This application claims benefit to US Provisional Patent Application Number 60/144.988, filed July 22. 1999
FIELD OF THE INVENTION
This invention relates to newly identified polynucleotides and polypeptides. and their production and uses, as well as their vanants. agonists and antagonists, and their uses In particular, the mvention relates to polynucleotides and polypeptides of the fucR (repressor protems) family, as well as their vanants. herein referred to as "fucR." "fucR polynucleotιde(s)," and "fucR polypeptιde(s)" as the case may be
BACKGROUND OF THE INVENTION
The Streptococci make up a medically important genera of microbes known to cause several types of disease in humans, including, for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid Since its isolation more than 100 years ago. Streptococcus pneumoniae has been one of the more intensively studied microbes For example, much of our early understanding that DNA is, in fact, the genetic matenal was predicated on the work of Gnffith and of Avery, Macleod and McCarty using this microbe Despite the vast amount of research with S pneumoniae, many questions concerning the virulence of this microbe remain It is particularly preferred to employ Streptococcal genes and gene products as targets for the development of antibiotics
The frequency of Streptococcus pneumoniae infections has nsen dramatically in the past fev, decades This has been attributed to the emergence of multiply antibiotic resistant strains and an increasing population of people with weakened immune systems It is no longer uncommon to isolate Streptococcus pneumoniae strains that are resistant to some or all of the standard antibiotics This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism
Moreover, the drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics," that is. high throughput genome- or gene-based biology This approach is rapidly superseding earlier approaches based on "positional cloning" and other methods Functional genomics relies heavily on the vanous tools of biomformatics to identify gene sequences of potential interest from the many molecular biology databases now available as well as from other sources There is a continuing and significant need to identify and characterize further genes and other polynucleotides sequences and their related polypeptides. as targets for drug discovery
Clearly, there exists a need for polynucleotides and polypeptides, such as the fucR embodiments of the invention, that have a present benefit of, among other things, being useful to screen compounds for antimicrobial activity Such factors are also useful to determine their role in pathogenesis of infection. dysfunction and disease There is also a need for identification and characterization of such factors and their antagonists and agonists to find ways to prevent, amehorate or correct such infection, dysfunction and disease
SUMMARY OF THE INVENTION
The present invention relates to fucR, in particular fucR polypeptides and fucR polynucleotides recombinant matenals and methods for their production In another aspect, the invention relates to methods for using such pohpeptides and polynucleotides, including treatment of microbial diseases, amongst others In a further aspect, the invention relates to methods for identifying agonists and antagomsts using the matenals provided by the invention, and for treatmg microbial infections and conditions associated with such infections with the identified agonist or antagonist compounds In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting fucR expression or activity
Vanous changes and modifications within the spmt and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descnptions and from reading the other parts of the present disclosure
DESCRIPTION OF THE INVENTION
The invention relates to fucR polypeptides and polynucleotides as descnbed in greater detail below In particular, the invention relates to polypeptides and polynucleotides of a fucR of Streptococcus pneumoniae. that is related by ammo acid sequence homology to Streptococcus mutants lacR polypeptide The invention relates especially to fucR having a nucleotde and ammo acid sequences set out in Table 1 as SEQ ID NO 1 and SEQ ED NO 2 respectively Note that sequences recited in the Sequence Listing below as "DNA" represent an exemplification of the invention, smce those of ordinary skill will recognize that such sequences can be usefully employed m polynucleotides in general, including πbopolynucleotides
TABLE 1 FucR Polynucleotide and Polypeptide Sequences
(A) Streptococcus pneumoniae fucR polynucleotide sequence [SEQ ID NO 1] 5 ' -
ATGATAAAAGATGAACGTGTACTTGAATTGATTGAAATCATCAAAAAGAAAAAAAGAATTGCCGTAAAAGAGCTG GCAGAAATCACTTTCTCCAGCACAAGTACCTTACGTCGTGATTTAATTTTCTTAGAAAATCAAGGTCTTATCAAA
AGAAAGCACGGATACGTGACCCTGTCCTCTATGAACACAATTGAACTTTCTCATCAAATACGGGAAGGAGAAAGT ACTAGGCAAAAAAGA
CTAATCGCTAGTCTCGCTAAAGACTTTATTCGGTCTGGTATGTGTATCTATCTAGATTCCAGTACGACTGTCTAC GAACTTTGTCCCTATCTTTCTGAACTTGATAATTTGATTATTTTTACAAATGGTTTACATACTGCACAAACCCTA TCTGAAACTGTTAAAGATAGCTCCAAAATCTTTATCACATCTGGCGAGGTCAAACATCAATCCTGTTCCGTGGTC AACTATGATAAGGAA
AATTCTTTATTAGATCATTTTAATATCGATTTAGCATTTTGTTCAGCAAGAGGTATTGATGACCAATATGTTTAT GAAGCTTCTCTCAGCCAAGCTATTTCAAAAAAGAATATTATTGACAAAGCCCATGAAACCATCTTACTGATTGAT AGTTCTAAATTTTACAAGACTGGATTTTTTAAAATTAATCCCCTCTCCAAATACACAACCTTTATTTCTGACACC GTGCCAGACCAAAAA
TTATTAGACGCAGTCGAATTATTTGATGGAGAATGA-3'
(B) Streptococcus pneumoniae fucR polypeptide sequence deduced from a polynucleotide sequence in this table [SEQ ID NO 2] NH;-
MI KDERVLELIEI I KKKK IAVKELAEITFS STSTLRRDLI FLENQGLIKRKHGYVTLS SMNTIELSHQI REGES TRQKRLIASLAKDFIRSGMCIYLDSSTTλ YELCPYLSELDNLI I FTNGLHTAQTLSETVKDS SKI FITSGEVKHQ SCSWNYDKENSLLDHFNIDLAFCSARGI DDQYλ/YEASLSQAI SKKNI IDP AHETILLIDS SKFYKTGFFKINPL SKYTTFI SDTVPDQK LLDAVELFDGE-COOH
Deposited materials
A deposit compπsrng a Streptococcus pneumoniae 0100993 strain has been deposited with the National Collections of Industrial and Marine Bactena Ltd (herem "NCIMB"), 23 St Machar Dnve. Aberdeen AB2 IRY, Scotland on 11 Apnl 1996 and assigned deposit number 40794 The deposit was descnbed as Streptococcus pneumoniae 0100993 on deposit
On 17 Apnl 1996 a Streptococcus pneumoniae 0100993 DNA library in E coll was similarly deposited with the NCIMB and assigned deposit number 40800 The Streptococcus pneumoniae strain deposit is referred to herein as "the deposited strain" or as "the DNA of the deposited strain " The deposited strain compnses a full length fucR gene The sequence of the polynucleotides compπsed in the deposited strain, as well as the ammo acid sequence of any polypeptide encoded thereby, are controlling in the event of any conflict with any descnption of sequences herein
The deposit of the deposited strain has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure The deposited strain will be irrevocably and without restnction or condition released to the pubhc upon the issuance of a patent The deposited strain is provided merely as convenience to those of skill in the art and is not an admission that a deposit is required for enablement. such as that required under 35 U S C §112 A
license may be required to make, use or sell the deposited strain, and compounds denved therefrom and no such license is hereby granted
In one aspect of the mvention there is provided an isolated nucleic acid molecule encoding a mature polypeptide expressible by the Streptococcus pneumoniae 0100993 strain, which polypeptide is compnsed in the deposited strain Further provided by the invention are fucR polynucleotide sequences m the deposited strain, such as DNA and RNA, and ammo acid sequences encoded thereby Also provided by the invention are fucR polypeptide and polynucleotide sequences isolated from the deposited strain
Polypeptides
FucR polypeptide of the invention is substantially phylogenetically related to other proteins of the fucR (repressor proteins) family
In one aspect of the invention there are provided polypeptides of Streptococcus pneumoniae referred to herein as "fucR" and "fucR polypeptides" as well as biologically, diagnostically, prophylactically, clinically or therapeutically useful vanants thereof, and compositions compnsrng the same
Among the particularly preferred embodiments of the mvention are vanants of fucR polypeptide encoded by naturally occurring alleles of a fucR gene
The present invention further provides for an isolated polypeptide that (a) compnses or consists of an ammo acid sequence that has at least 95% identity, most preferably at least 97-99% or exact identity, to that of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (b) a polypeptide encoded by an isolated polynucleotide compnsrng or consistmg of a polynucleotide sequence that has at least 95% identity, even more preferably at least 97-99%> or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1. (c) a polypeptide encoded by an isolated polynucleotide compnsrng or consisting of a polynucleotide sequence encoding a polypeptide that has at least 95% identity, even more preferably at least 97-99% or exact identity, to the ammo acid sequence of SEQ ID NO 2. over the entire length of SEQ ID NO 2 The polypeptides of the mvention include a polypeptide of Table 1 [SEQ ID NO 2] (in particular a mature polypeptide) as well as polypeptides and fragments, particularly those that has a biological activity of fucR and also those that have at least 95 % identity to a polypeptide of Table 1 [SEQ ID NO 2] and also include portions of such polypeptides with such portion of the polypeptide generally compnsrng at least 30 ammo acids and more preferably at least 50 ammo acids The mvention also mcludes a polypeptide consistmg of or compnsrng a polypeptide of the formula
X-(Rι )m-(R2)-(R3)n-Y wherein, at the ammo terminus, X is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides. and at the carboxyl terminus, Y is hydrogen, a metal or any other moiety descnbed herem for modified polypeptides. Rj and R3 are any ammo acid residue or modified ammo acid residue, m is an teger
between 1 and 1000 or zero, n is an integer between 1 and 1000 or zero, and R2 is an ammo acid sequence of the mvention, particularly an ammo acid sequence selected from Table 1 or modified forms thereof In the formula above, R2 is onented so that its ammo terminal ammo acid residue is at the left, covalently bound to R and its carboxy terminal ammo acid residue is at the nght, covalently bound to R3 Any stretch of ammo acid residues denoted by either Ri or R3, where m and/or n is greater than 1, may be either a heteropolymer or a homopolymer. preferably a heteropolymer Other prefened embodiments of the mvention are provided where m is an integer between 1 and 50, 100 or 500, and n is an mteger between 1 and 50, 100, or 500
It is most prefened that a polypeptide of the mvention is denved from Streptococcus pneumoniae. however, it may preferably be obtained from other organisms of the same taxonomic genus A polypeptide of the mvention may also be obtained, for example, from organisms of the same taxonomic family or order
A fragment is a vanant polypeptide havmg an ammo acid sequence that is entirely the same as part but not all of any ammo acid sequence of any polypeptide of the mvention As with fucR polypeptides. fragments may be "free-standing," or compnsed within a larger polypeptide of which they form a part or region, most preferably as a smgle continuous region m a smgle larger polypeptide Prefened fragments include, for example, truncation polypeptides havmg a portion of an ammo acid sequence of Table 1 [SEQ ID NO 2], or of vanants thereof, such as a continuous senes of residues that includes an ammo- and/or carboxyl-terminal ammo acid sequence Degradation forms of the polypeptides of the mvention produced by or in a host cell, particularly a Streptococcus pneumoniae, are also prefened Further prefened are fragments charactenzed by structural or functional attributes such as fragments that compnse alpha-hehx and alpha-hehx forming regions, beta-sheet and beta-sheet-forming regions, turn and turn-formmg regions, coil and coil-forming regions, hydrophihc regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions, substrate binding region, and high antigenic mdex regions
Further prefened fragments mclude an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids from the ammo acid sequence of
SEQ ID NO:2, or an isolated polypeptide comprising an amino acid sequence havmg at least 15,
20, 30, 40, 50 or 100 contiguous amino acids truncated or deleted from the amino acid sequence of
SEQ ID NO:2.
Fragments of the polypeptides of the mvention may be employed for producmg the conesponding full-length polypeptide by peptide synthesis, therefore, these vanants may be employed as mtermediates for producmg the full-length polypeptides of the mvention Polynucleotides It is an object of the mvention to provide polynucleotides that encode fucR polypeptides, particularly polynucleotides that encode a polypeptide herem designated fucR
In a particularly prefened embodiment of the mvention the polynucleotide compnses a region encoding fucR polypeptides compnsrng a sequence set out m Table 1 [SEQ ID NO 1] that mcludes a full length gene, or a vanant thereof This mvention provides that this full length gene is essential to the growth and/or survival of an organism that possesses it, such as Streptococcus pneumoniae As a further aspect of the mvention there are provided isolated nucleic acid molecules encoding and/or expressing fucR polypeptides and polynucleotides, particularly Streptococcus pneumoniae fucR polypeptides and polynucleotides, including, for example, unprocessed RNAs, nbozyme RNAs, mRNAs, cDNAs, genomic DNAs. B- and Z-DNAs Further embodiments of the mvention mclude biologically, diagnostically. prophylactically. clinically or therapeutically useful polynucleotides and polypeptides. and vanants thereof, and compositions compnsrng the same
Another aspect of the mvention relates to isolated polynucleotides. mcludmg at least one full length gene, that encodes a fiicR polypeptide having a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] and polynucleotides closely related thereto and vanants thereof
In another particularly prefened embodiment of the mvention there is a fucR polypeptide from Streptococcus pneumoniae compnsrng or consistmg of an amino acid sequence of Table 1 [SEQ ID NO 2], or a vanant thereof
Usmg the information provided herein, such as a polynucleotide sequence set out m Table 1 [SEQ ID NO 1]. a polynucleotide of the mvention encoding fucR polypeptide may be obtained usmg standard cloning and screening methods, such as those for cloning and sequencmg chromosomal DNA fragments from bactena usmg Streptococcus pneumoniae 0100993 cells as startmg matenal, followed by obtainmg a full length clone For example, to obtain a polynucleotide sequence of the mvention. such as a polynucleotide sequence given m Table 1 [SEQ ID NO 1], typically a library of clones of chromosomal DNA of Streptococcus pneumoniae 0100993 m E coh or some other suitable host is probed with a radiolabeled ohgonucleotide. preferably a 17-mer or longer, derived from a partial sequence Clones carrying DNA identical to that of the probe can then be distmgmshed usmg strmgent hybndization conditions By sequencmg the individual clones thus identified by hybndization with sequencmg primers designed from the oπgmal polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence m both directions to determine a full length gene sequence Conveniently, such sequencing is performed, for example, usmg denatured double stranded DNA prepared from a plasmid clone Suitable techmques are descnbed b\ Maniatis, T , Fntsch, E F and Sambrook et al . MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed , Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York (1989) (see m particular Screening By Hybridization 1 90 and Sequencmg Denatured Double-Stranded DNA Templates 13 70) Direct genomic DNA sequencing may also be performed to obtain a full length
gene sequence Illustrative of the mvention. each polynucleotide set out m Table 1 [SEQ ID NO 1] was discovered in a DNA library denved from Streptococcus pneumoniae 0100993
Moreover, each DNA sequence set out m Table 1 [SEQ ID NO 1] contains an open readmg frame encoding a protein having about the number of ammo acid residues set forth m Table 1 [SEQ ID NO 2] with a deduced molecular weight that can be calculated usmg ammo acid residue molecular weight values well known to those skilled m the art The polynucleotide of SEQ ID NO 1, between nucleotide number 1 and the stop codonthat begins at nucleotide number 754 of SEQ ID NO 1, encodes the polypeptide of SEQ ID NO 2 In a further aspect, the present mvention provides for an isolated polynucleotide compnsrng or consisting of (a) a polynucleotide sequence that has at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1, or the entire length of that portion of SEQ ID NO 1 which encodes SEQ ID NO 2, (b) a polynucleotide sequence encoding a polypeptide that has at least 95% identity, even more preferably at least 97-99% or 100%> exact, to the ammo acid sequence of SEQ ID NO 2, over the entire length of SEQ ID NO 2
A polynucleotide encoding a polypeptide of the present mvention, mcludmg homologs and orthologs from species other than Streptococcus pneumoniae, may be obtamed by a process that compnses the steps of screening an appropπate library under strmgent hybndization conditions with a labeled or detectable probe consisting of or compnsrng the sequence of SEQ ID NO 1 or a fragment thereof, and isolating a full-length gene and/or genomic clones compnsrng said polynucleotide sequence
The mvention provides a polynucleotide sequence identical over its entire length to a coding sequence (open reading frame) m Table 1 [SEQ ID NO 1] Also provided by the mvention is a codmg sequence for a mature polypeptide or a fragment thereof, by itself as well as a codmg sequence for a mature polypeptide or a fragment readmg frame with another codmg sequence, such as a sequence encoding a leader or secretory sequence, a pre-, or pro- or prepro-protem sequence The polynucleotide of the mvention may also compπse at least one non-coding sequence, mcludmg for example, but not limited to at least one non-coding 5' and 3' sequence, such as the transcnbed but non-translated sequences, termination signals (such as rho-dependent and rho-rndependent termination signals), πbosome binding sites, Kozak sequences, sequences that stabilize mRNA. mtrons. and polyadenylation signals The polynucleotide sequence may also compnse additional codmg sequence encoding additional ammo acids For example, a marker sequence that facilitates purification of a fused polypeptide can be encoded In certain embodiments of the mvention. the marker sequence is a hexa-histidine peptide. as provided m the pQE vector (Qiagen, Inc ) and descnbed m Gentz et al . Proc Natl Acad Set , USA 86 821-824 (1989), or an HA peptide tag (Wilson et al , Cell 37 767 (1984). both of that may be useful m purifying polypeptide sequence fused to them Polynucleotides of the mvention also mclude. but are not limited to. polynucleotides compnsrng a structural gene and its naturally associated sequences that control gene expression
A prefened embodiment of the mvention is a polynucleotide of consisting of or compnsrng nucleotide 1 to the nucleotide immediately upstream of or mcludmg nucleotide 754 set forth in SEQ ID NO 1 of Table 1. both of that encode a fucR polypeptide
The mvention also mcludes a polynucleotide consistmg of or compnsrng a polynucleotide of the formula
X-(Rι )m-(R2)-(R3)n-Y wherem. at the 51 end of the molecule. X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule. Y is hydrogen, a metal, or a modified nucleotide residue, or together with X defines the covalent bond, each occunence of R\ and R3 is mdependently any nucleic acid residue or modified nucleic acid residue, m is an integer between 1 and 3000 or zero , n is an integer between 1 and 3000 or zero, and R2 is a nucleic acid sequence or modified nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof In the polynucleotide formula above, R2 is onented so that its 5' end nucleic acid residue is at the left, bound to Ri and its 3' end nucleic acid residue is at the nght. bound to R3 Any stretch of nucleic acid residues denoted by either R\ and/or R2, where m and/or n is greater than 1 , may be either a heteropolymer or a homopolymer, preferably a heteropolymer Where, in a prefened embodiment. X and Y together define a covalent bond, the polynucleotide of the above formula is a closed, circular polynucleotide, that can be a double-stranded polynucleotide wherem the formula shows a first strand to which the second strand is complementary In another preferred embodiment m and/or n is an integer between 1 and 1000. Other prefened embodiments of the mvention are provided where m is an mteger between 1 and 50. 100 or 500. and n is an integer between 1 and 50. 100. or 500
It is most prefened that a polynucleoti.de of the mvention is denved from Streptococcus pneumoniae. however, it may preferably be obtamed from other orgamsms of the same taxonomic genus A polynucleotide of the mvention may also be obtamed. for example, from orgamsms of the same taxonomic family or order
The term "polynucleotide encodmg a polypeptide" as used herem encompasses polynucleotides that mclude a sequence encodmg a polypeptide of the mvention, particularly a bactenal polypeptide and more particularly a polypeptide of the Streptococcus pneumoniae fucR having an ammo acid sequence set out m Table 1 [SEQ ID NO 2] The term also encompasses polynucleotides that mclude a smgle contmuous region or discontmuous regions encodmg the polypeptide (for example, polynucleotides mterrupted by mtegrated phage. an mtegrated insertion sequence, an mtegrated vector sequence, an mtegrated transposon sequence, or due to RNA editing or genomic DNA reorganization) together with additional regions, that also may compnse codmg and/or non-coding sequences
The mvention further relates to vanants of the polynucleotides descnbed herem that encode vanants of a polypeptide having a deduced ammo acid sequence of Table 1 [SEQ ID NO 2] Fragments of polynucleotides of the mvention may be used, for example, to synthesize full-length polynucleotides of the mvention Further particularly prefened embodiments are polynucleotides encoding fucR vanants, that have the ammo acid sequence of fucR polypeptide of Table 1 [SEQ ID NO 2] which several, a few, 5 to 10, 1 to 5, 1 to 3. 2. 1 or no ammo acid residues are substituted, modified, deleted and/or added, m any combination Especially prefened among these are silent substitutions, additions and deletions, that do not alter the properties and activities of fucR polypeptide Prefened isolated polynucleotide embodiments also mclude polynucleotide fragments, such as a polynucleotide comprising a nuclic acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids from the polynucleotide sequence of SEQ ID NO 1 , or an polynucleotide comprising a nucleic acid sequence havmg at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids truncated or deleted from the 5' and/or 3' end ot the polynucleotide sequence of SEQ ID NO 1
Further prefened embodiments of the mvention are polynucleotides that are at least 95% or 97% identical over their entire length to a polynucleotide encodmg fucR polypeptide havmg an ammo acid sequence set out in Table 1 [SEQ ID NO 2], and polynucleotides that are complementary to such polynucleotides Most highly prefened are polynucleotides that compnse a region that is at least 95% are especially prefened Furthermore, those with at least 97% are highly prefened among those with at least 95%, and among these those with at least 98% and at least 99% are particularly highly prefened, with at least 99% bemg the more prefened
Prefened embodiments are polynucleotides encodmg polypeptides that retain substantially the same biological function or activity as a mature polypeptide encoded by a DNA of Table 1 [SEQ ID NO 1] In accordance with certain prefened embodiments of this mvention there are provided polynucleotides that hybndize. particularly under strmgent conditions, to fucR polynucleotide sequences, such as those polynucleotides m Table 1
The mvention further relates to polynucleotides that hybndize to the polynucleotide sequences provided herem In this regard, the mvention especially relates to polynucleotides that hybndize under strmgent conditions to the polynucleotides descnbed herem A specific example of strmgent hybndization conditions is overnight incubation at 42°C in a solution compnsrng 50% formamide. 5x SSC (150mM NaCl. 15mM tnsodium citrate), 50 mM sodium phosphate (pH7 6). 5x Denhardt's solution 10% dextran sulfate. and 20 micrograms/ml of denatured, sheared salmon sperm DNA. followed by washing the hybndization support in 0 lx SSC at about 65°C Hybridization and wash conditions are well
known and exemplified m Sambrook, et al , Molecular Cloning A Laboratory Manual, Second Edition. Cold Spring Harbor, N Y . (1989), particularly Chapter 11 therein Solution hybridization may also be used with the polynucleotide sequences provided by the mvention
The mvention also provides a polynucleotide consistmg of or compnsrng a polynucleotide sequence obtamed by screenmg an appropπate library compnsrng a complete gene for a polynucleotide sequence set forth m SEQ ID NO 1 under strmgent hybndization conditions with a probe havmg the sequence of said polynucleotide sequence set forth in SEQ ID NO 1 or a fragment thereof, and isolating said polynucleotide sequence Fragments useful for obtainmg such a polynucleotide include, for example, probes and primers fully descnbed elsewhere herem As discussed elsewhere herem regarding polynucleotide assays of the mvention, for instance, the polynucleotides of the mvention. may be used as a hybndization probe for RNA. cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encodmg fucR and to isolate cDNA and genomic clones of other genes that have a high identity, particularly high sequence identity, to a fucR gene Such probes generally will compπse at least 15 nucleotide residues or base pairs Preferably, such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base parrs Particularly prefened probes will have at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs
A codmg region of a fucR gene may be isolated by screenmg usmg a DNA sequence provided in Table 1 [SEQ ID NO 1] to synthesize an oligonucleotide probe A labeled ohgonucleotide havmg a sequence complementary- to that of a gene of the mvention is then used to screen a hbrary of cDNA, genomic DNA or mRNA to determine which members of the hbrary the probe hybndizes to
There are several methods available and well known to those skilled m the art to obtam full- length DNAs. or extend short DNAs. for example those based on the method of Rapid Amplification of cDNA ends (RACE) (see. for example. Frohman, et al . PNAS USA 85 8998-9002, 1988) Recent modifications of the technique, exemplified by the Marathon™ technology (Clontech Laboratoπes Inc ) for example, have significantly simplified the search for longer cDNAs In the Marathon™ technology. cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence hgated onto each end Nucleic acid amplification (PCR) is then earned out to amplify the "missing" 5' end of the DNA using a combination of gene specific and adaptor specific ohgonucleotide primers The PCR reaction is then repeated usmg "nested" pnmers, that is, primers designed to anneal withm the amplified product (typically an adaptor specific pπmer that anneals further 3' m the adaptor sequence and a gene specific primer that anneals further 5' in the selected gene sequence) The products of this reaction can then be analyzed by DNA sequencing and a full-length DNA constructed either by joining
the product directly to the existing DNA to give a complete sequence, or carrying out a separate full- length PCR usmg the new sequence information for the design of the 5' primer
The polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularly human diseases, as further discussed herem relatmg to polynucleotide assays
The polynucleotides of the invention that are oligonucleotides deπved from a sequence of Table
1 [SEQ ID NOS 1 or 2] may be used m the processes herein as descnbed, but preferably for PCR to determine whether or not the polynucleotides identified herem in whole or m part are transcπbed m bactena m mfected tissue It is recognized that such sequences will also have utility m diagnosis of the stage of infection and type of infection the pathogen has attained
The mvention also provides polynucleotides that encode a polypeptide that is a mature protem plus additional ammo or carboxyl-termrnal ammo acids, or ammo acids ntenor to a mature polypeptide (when a mature form has more than one polypeptide chain, for instance) Such sequences may play a role m processing of a protem from precursor to a mature form, may allow protem transport, may lengthen or shorten protem half-hfe or may facilitate mampulation of a protem for assay or production, among other things As generally is the case in vivo, the additional ammo acids may be processed away from a mature protem by cellular enzymes
For each and every polynucleotide of the mvention there is provided a polynucleotide complementary to it It is prefened that these complementary polynucleotides are fully complementary to each polynucleotide with which they are complementary
A precursor protem. havmg a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such inactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proprote ns As will be recognized, the entire polypeptide encoded by an open readmg frame is often not required for activity Accordingly, it has become routme m molecular biology to map the boundanes of the primary structure required for activity with N-terminal and C-terminal deletion experiments These experiments utilize exonuclease digestion or convenient restnction sites to cleave codmg nucleic acid sequence For example, Promega (Madison. WI) sell an Erase-a-base™ system that uses Exonuclease HI designed to facilitate analysis of the deletion products (protocol available at wwwpromega com) The digested endpomts can be repaired (e g . by hgation to synthetic linkers) to the extent necessary to preserve an open readmg frame In this way. the nucleic acid of SEQ ID NO 1 readily provides contiguous fragments of SEQ ID NO 2 sufficient to provide an activity, such as an enzymatic, binding or antibody-inducing activity Nucleic acid sequences
encoding such fragments of SEQ ID NO 2 and vanants thereof as descnbed herem are within the mvention. as are polypeptides so encoded
As is known m the art, portions of the N-terminal and/or C-terminal sequence of a protein can generally be removed without senous consequence to the function of the protem The amount of sequence that can be removed is often quite substantial The nucleic acid cutting and deletion methods used for creatmg such deletion vanants are now quite routine Accordmgly, any contiguous fragment of SEQ ID NO 2 which retains at least 20%, preferably at least 50%. of an activity of the polypeptide encoded by the gene for SEQ ID NO 2 is within the invention, as are correspondmg fragment which are 70%. 80%, 90%. 95%,97%. 98% or 99% identical to such contiguous fragments In one embodiment, the contiguous fragment comprises at least 70% of the ammo acid residues of SEQ ID NO 2. preferably at least 80%, 90% or 95% of the residues
In sum. a polynucleotide of the mvention may encode a mature protem. a mature protem plus a leader sequence (that may be refened to as a preprotern), a precursor of a mature protem havmg one or more prosequences that are not the leader sequences of a preprotern. or a preproprotein. that is a precursor to a proprotein. havmg a leader sequence and one or more prosequences. that generally are removed dunng processing steps that produce active and mature forms of the polypeptide Vectors, Host Cells, Expression Systems
The mvention also relates to vectors that compnse a polynucleotide or polynucleotides of the mvention, host cells that are genetically engineered w th vectors of the mvention and the production of polypeptides of the mvention by recombinant techmques Cell-free translation systems can also be employed to produce such proteins usmg RNAs denved from the DNA constructs of the mvention
Recombinant polypeptides of the present mvention may be prepared by processes well known m those skilled m the art from genetically engineered host cells compnsrng expression systems Accordmgly, m a further aspect the present mvention relates to expression systems that compnse a polynucleotide or polynucleotides of the present mvention. to host cells that are genetically engineered with such expression systems, and to the production of polypeptides of the mvention by recombinant techmques
For recombinant production of the polypeptides of the mvention, host cells can be genetically engineered to incorporate expression systems or portions thereof or polynucleotides of the mvention Introduction of a polynucleotide mto the host cell can be effected by methods descnbed m many standard laboratory manuals, such as Davis, et al , BASIC METHODS IN MOLECULAR BIOLOGY. (1986) and Sambrook, et al . MOLECULAR CLONING A LABORATORY MANUAL, 2nd Ed , Cold Spring Harbor Laboratory Press. Cold Spring Harbor. N Y (1989). such as, calcium phosphate transfection. DEAE-dextran mediated transfection. transvection. nucromjection, catiomc hpid-mediated transfection, electroporation. transduction. scrape loading, ballistic mtroduction and infection
Representative examples of appropπate hosts mclude bactenal cells, such as cells of streptococci, staphylococci, enterococci E col , streptomyces, cyanobacteπa, Bacillus subtihs, and Streptococcus pneumoniae. fungal cells, such as cells of a yeast, Kluveromyces, Saccharomyces. a basidiomycete, Candida albicans aad Aspergillus. insect cells such as cells of Drosophύa S2 and Spodoptera Sf9, animal cells such as CHO, COS. HeLa. C127. 3T3, BHK. 293, CV-1 and Bowes melanoma cells, and plant cells, such as cells of a gymnosperm or angiosperm
A great vanety of expression systems can be used to produce the polypeptides of the mvention Such vectors mclude, among others, chromosomal-, episomal- and virus-denved vectors, for example, vectors denved from bactenal plasmids, from bacteπophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40. vaccinia viruses, adenoviruses. fowl pox viruses, pseudorabies viruses, picornaviruses and retrovrruses. and vectors denved from combinations thereof, such as those denved from plasmid and bacteπophage genetic elements, such as cosmids and phagemids The expression system constructs may compnse control regions that regulate as well as engender expression Generally, any system or vector suitable to mamtam, propagate or express polynucleotides and or to express a polypeptide m a host may be used for expression m this regard The appropnate DNA sequence may be inserted mto the expression system by any of a vanety of well-known and routme techmques, such as, for example, those set forth m Sambrook et al . MOLECULAR CLONING, A LABORATORY MANUAL, (supra)
In recombinant expression systems m eukaryotes, for secretion of a translated protem mto the lumen of the endoplasmic reticulum. mto the penplasmic space or mto the extracellular environment, appropπate secretion signals may be incorporated mto the expressed polypeptide These signals may be endogenous to the polypeptide or they may be heterologous signals
Polypeptides of the mvention can be recovered and purified from recombinant cell cultures by well- known methods mcludmg ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography . phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography Most preferably, high performance liquid chromatography is employed for purification Well known techmques for refolding protem may be employed to regenerate active conformation when the polypeptide is denatured dunng isolation and or punfication Diagnostic, Prognostic, Serotyping and Mutation Assays
This mvention is also related to the use of fucR polynucleotides and polypeptides of the mvention for use as diagnostic reagents Detection of fucR polynucleotides and/or polypeptides m a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of disease, staging of disease or response of an infectious organism to drugs Eukaryotes, particularly mammals, and especially
humans, particularly those infected or suspected to be infected w th an organism compnsrng the fucR gene or protein, may be detected at the nucleic acid or ammo acid level by a vanety of well known techmques as well as by methods provided herem
Polypeptides and polynucleotides for prognosis, diagnosis or other analysis may be obtamed from a putatively infected and/or infected mdividual's bodily matenals Polynucleotides from any of these sources, particularly DNA or RNA. may be used directly for detection or may be amplified enzymatically by usmg PCR or any other amplification technique pπor to analysis RNA. particularly mRNA. cDNA and genomic DNA may also be used m the same ways Usmg amplification, characterization of the species and strain of infectious or resident organism present in an individual, may be made by an analysis of the genotype of a selected polynucleotide of the orgamsm Deletions and insertions can be detected by a change m size of the amplified product m companson to a genotype of a reference sequence selected from a related organism, preferably a different species of the same genus or a different strain of the same species Point mutations can be identified by hybndizmg amplified DNA to labeled fiicR polynucleotide sequences Perfectly or significantly matched sequences can be distinguished from imperfectly or more significantly mismatched duplexes by DNase or RNase digestion, for DNA or RNA respectively, or by detectmg differences m meltmg temperatures or renaturation kinetics Polynucleotide sequence differences may also be detected by alterations m the electrophoretic mobility of polynucleotide fragments m gels as compared to a reference sequence This may be earned out with or without denaturing agents Polynucleotide differences may also be detected by direct DNA or RNA sequencmg See, for example, Myers et al . Science, 230 1242 (1985) Sequence changes at specific locations also may be revealed by nuclease protection assays, such as RNase. VI and SI protection assay or a chemical cleavage method See, for example. Cotton et al , Proc Natl Acad Set USA 85 4397-4401 (1985)
In another embodiment, an anay of oligonucleotides probes compnsrng fucR nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of. for example, genetic mutations serotype. taxonomic classification or identification Array technology methods are well known and have general applicability and can be used to address a vanety of questions m molecular genetics mcludmg gene expression, genetic linkage, and genetic vanabi ty (see. for example. Chee et al . Science, 274 610 (1996))
Thus m another aspect, the present mvention relates to a diagnostic kit that compnses (a) a polynucleotide of the present invention, preferably the nucleotide sequence of SEQ ID NO 1. or a fragment thereof , (b) a nucleotide sequence complementary to that of (a), (c) a polypeptide of the present mvention. preferably the polypeptide of SEQ ID NO 2 or a fragment thereof, or (d) an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO 2 It will be appreciated that m any such kit, (a), (b), (c) or (d) may compnse a substantial component Such a kit w ll be of use m diagnosing a disease or susceptibility to a Disease, among others
This mvention also relates to the use of polynucleotides of the present mvention as diagnostic reagents Detection of a mutated form of a polynucleotide of the mvention, preferable, SEQ ID NO 1, that is associated with a disease or pathogenicity will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, a prognosis of a course of disease, a determination of a stage of disease, or a susceptibility to a disease, that results from under-expression, over-expression or altered expression of the polynucleotide
Organisms, particularly infectious orgamsms. carrying mutations in such polynucleotide may be detected at the polynucleotide level by a vanety of techmques, such as those descnbed elsewhere herem
The differences in a polynucleotide and/or polypeptide sequence between orgamsms possessing a first phenotype and orgamsms possessing a different, second different phenotype can also be determined If a mutation is observed m some or all organisms possessing the first phenotype but not m any orgamsms possessmg the second phenotype, then the mutation is likely to be the causative agent of the first phenotype
Cells from an orgamsm carrying mutations or polymorphisms (allelic vaπations) m a polynucleotide and or polypeptide of the mvention may also be detected at the polynucleotide or polypeptide level by a vanety of techmques. to allow for serotypmg, for example For example. RT-PCR can be used to detect mutations m the RNA It is particularly prefened to use RT-PCR m conjunction with automated detection systems, such as. for example. GeneScan RNA, cDNA or genomic DNA may also be used for the same purpose. PCR As an example. PCR pnmers complementary to a polynucleotide encoding fiicR polypeptide can be used to identify and analyze mutations The mvention further provides these pnmers with 1, 2, 3 or 4 nucleotides removed from the 5' and/or the 3' end These pnmers may be used for, among other thmgs, amplifying fucR DNA and or RNA isolated from a sample denved from an individual, such as a bodily matenal The pnmers may be used to amplify a polynucleotide isolated from an infected individual, such that the polynucleotide may then be subject to vanous techmques for elucidation of the polynucleotide sequence In this way. mutations m the polynucleotide sequence may be detected and used to diagnose and/or prognose the infection or its stage or course, or to serotype and/or classify the infectious agent
The mvention further provides a process for diagnosing, disease, preferably bactenal infections, more preferably infections caused by Streptococcus pneumoniae, compnsrng determining from a sample denved from an individual, such as a bodily matenal. an increased level of expression of polynucleotide havmg a sequence of Table 1 [SEQ ID NO 1] Increased or decreased expression of a fucR polynucleotide can be measured using any on of the methods well known m the art for the quantitation of polynucleotides. such as. for example, amplification. PCR. RT-PCR, RNase protection. Northern blotting, spectrometry and other hybndization methods
In addition, a diagnostic assay m accordance with the mvention for detectmg over-expression of fucR polypeptide compared to normal control tissue samples may be used to detect the presence of an
infection, for example Assay techmques that can be used to determine levels of a fucR polypeptide, m a sample denved from a host, such as a bodily matenal, are well-known to those of skill m the art Such assay methods mclude radioimmunoassays, competitive-binding assays, Western Blot analysis, antibody sandwich assays, antibody detection and ELISA assays
Antagonists and Agonists - Assays and Molecules
Polypeptides and polynucleotides of the mvention may also be used to assess the binding of small molecule substrates and hgands in, for example, cells, cell-free preparations, chemical branes. and natural product mixtures These substrates and hgands may be natural substrates and hgands or may be structural or functional mimetics See, e g , Cohgan et al . Current Protocols in Immunology 1 (2) Chapter 5 (1991) Polypeptides and polynucleotides of the present mvention are responsible for many biological functions, mcludmg many disease states, m particular the Diseases herem mentioned It is therefore desirable to devise screenmg methods to identify compounds that agonize (e g . stimulate) or that antagonize (e g .inhibit) the function of the polypeptide or polynucleotide Accordingly, m a further aspect, the present mvention provides for a method of screenmg compounds to identify those that agonize or that antagonize the function of a polypeptide or polynucleotide of the mvention, as well as related polypeptides and polynucleotides In general, agomsts or antagomsts (e g , inhibitors) may be employed for therapeutic and prophylactic purposes for such Diseases as herem mentioned Compounds may be identified from a vanety of sources, for example, cells, cell-free preparations, chemical hbranes, and natural product mixtures Such agonists and antagomsts so-identified may be natural or modified substrates, hgands. receptors, enzymes, etc . as the case may be, of fucR polypeptides and polynucleotides. or may be structural or functional mimetics thereof (see Cohgan et al , Current Protocols in Immunology 1 (2) Chapter 5 (1991))
The screenmg methods may simply measure the binding of a candidate compound to the polypeptide or polynucleotide, or to cells or membranes bearing the polypeptide or polynucleotide. or a fusion protem of the polypeptide by means of a label directly or mdirectly associated with the candidate compound Alternatively, the screenmg method may involve competition with a labeled competitor Further, these screenmg methods may test whether the candidate compound results m a signal generated by activation or inhibition of the polypeptide or polynucleotide, usmg detection systems appropnate to the cells compnsrng the polypeptide or polynucleotide Inhibitors of activation are generally assayed m the presence of a known agomst and the effect on activation by the agomst by the presence of the candidate compound is observed Constitutively active polypeptide and/or constitutively expressed polypeptides and polynucleotides may be employed in screenmg methods for mverse agomsts. m the absence of an agonist or antagomst. by testing whether the candidate compound results m inhibition of activation of the polypeptide or polynucleotide, as the case may be Further, the screenmg methods may
simply compnse the steps of mixing a candidate compound with a solution compnsrng a polypeptide or polynucleotide of the present mvention, to form a mixture, measunng fucR polypeptide and/or polynucleotide activity m the mixture, and compaπng the fucR polypeptide and/or polynucleotide activity of the mixture to a standard Fusion protems, such as those made from Fc portion and fucR polypeptide. as herem descnbed, can also be used for high-throughput screenmg assays to identify antagomsts of the polypeptide of the present invention, as well as of phylogenetically and and/or functionally related polypeptides (see D Bennett et al , J Mol Recognition, 8 52-58 (1995). and K Johanson et al . J Biol Chem. 270(16) 9459-9471 (1995))
The polynucleotides. polypeptides and antibodies that bind to and/or interact with a polypeptide of the present invention may also be used to configure screening methods for detectmg the effect of added compounds on the production of mRNA and/or polypeptide in cells For example, an ELISA assay may be constructed for measunng secreted or cell associated levels of polypeptide usmg monoclonal and polyclonal antibodies by standard methods known in the art This can be used to discover agents that may inhibit or enhance the production of polypeptide (also called antagonist or agomst. respectively) from suitably mampulated cells or tissues
The mvention also provides a method of screenmg compounds to identify those that enhance (agomst) or block (antagonist) the action of fucR polypeptides or polynucleotides. particularly those compounds that are bacteπstatic and/or bactencidal The method of screenmg may mvolve high-throughput techmques For example, to screen for agomsts or antagomsts, a synthetic reaction mix, a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compnsrng fucR polypeptide and a labeled substrate or gand of such polypeptide is mcubated m the absence or the presence of a candidate molecule that may be a fucR agomst or antagonist The ability of the candidate molecule to agonize or antagonize the fucR polypeptide is reflected m decreased binding of the labeled hgand or decreased production of product from such substrate Molecules that bmd gratuitously, i e , without inducmg the effects of fucR polypeptide are most hkely to be good antagomsts Molecules that bmd well and. as the case may be, mcrease the rate of product production from substrate, mcrease signal transduction. or mcrease chemical channel activity are agomsts Detection of the rate or level of. as the case may be, production of product from substrate, signal transduction. or chemical channel activity may be enhanced by usmg a reporter system Reporter systems that may be useful m this regard mclude but are not limited to colonmetnc. labeled substrate converted mto product, a reporter gene that is responsive to changes m fucR polynucleotide or polypeptide activity, and binding assays known m the art
Polypeptides of the mvention may be used to identify membrane bound or soluble receptors, if any. for such polypeptide. through standard receptor bmding techmques known in the art These techmques include, but are not limited to, hgand binding and crosslmking assays m which the
polypeptide is labeled with a radioactive isotope (for mstance, *^I), chemically modified (for instance, biotinylated). or fused to a peptide sequence suitable for detection or purification, and mcubated with a source of the putative receptor (e g , cells, cell membranes, cell supernatants, tissue extracts, bodily matenals) Other methods mclude biophysical techmques such as surface plasmon resonance and spectroscopy These screenmg methods may also be used to identify agonists and antagomsts of the polypeptide that compete with the binding of the polypeptide to its receptor(s). if any Standard methods for conducting such assays are well understood in the art
The fluorescence polanzation value for a fluorescently-tagged molecule depends on the rotational conelation time or tumbling rate Protein complexes, such as formed by fucR polypeptide associatmg with another fucR polypeptide or other polypeptide, labeled to comprise a fluorescently- labeled molecule will ha\e higher polanzation values than a fluorescently labeled monomeπc protem It is prefened that this method be used to characterize small molecules that disrupt polypeptide complexes
Fluorescence energy transfer may also be used characterize small molecules that interfere with the formation of fucR polypeptide dimers. tnmers, tetramers or higher order structures, or structures formed by fucR polypeptide bound to another polypeptide FucR polypeptide can be labeled with both a donor and acceptor fluorophore Upon mixing of the two labeled species and excitation of the donor fluorophore, fluorescence energy transfer can be detected by observing fluorescence of the acceptor Compounds that block drmenzation will inhibit fluorescence energy transfer
Surface plasmon resonance can be used to momtor the effect of small molecules on fucR polypeptide self-association as well as an association of fucR polypeptide and another polypeptide or small molecule FucR polypeptide can be coupled to a sensor chip at low site density such that covalently bound molecules will be monomenc Solution protem can then passed over the fucR polypeptide -coated surface and specific bmding can be detected in real-time by momtormg the change in resonance angle caused by a change m local refractive mdex This technique can be used to characteπze the effect of small molecules on kinetic rates and equihbnum binding constants for fucR polypeptide self-association as well as an association of fucR polypeptide and another polypeptide or small molecule A scintillation proximity assay may be used to characteπze the interaction between an association of fucR polypeptide with another fucR polypeptide or a different polypeptide FucR polypeptide can be coupled to a scmtillation-filled bead Addition of radio-labeled fucR polypeptide results m binding where the radioactive source molecule is in close proximity to the scintillation fluid Thus, signal is emitted upon fucR polypeptide binding and compounds that prevent fucR polypeptide
self-association or an association of fucR polypeptide and another polypeptide or small molecule will diminish signal
In other embodiments of the mvention there are provided methods for identifying compounds that bmd to or otherwise mteract with and inhibit or activate an activity or expression of a polypeptide and/or polynucleotide of the mvention compnsrng contacting a polypeptide and/or polynucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polypeptide and/or polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction preferably being associated with a second component capable of providmg a detectable signal m response to the bmdmg or mteraction of the polypeptide and/or polynucleotide with the compound, and determining whether the compound bmds to or otherwise interacts with and activates or inhibits an activity or expression of the polypeptide and or polynucleotide by detectmg the presence or absence of a signal generated from the bmdmg or mteraction of the compound with the polypeptide and or polynucleotide Another example of an assay for fucR agomsts is a competitive assay that combines fucR and a potential agomst with fiicR-binding molecules, recombinant fucR bmdmg molecules, natural substrates or hgands. or substrate or hgand mimetics, under appropnate conditions for a competitive inhibition assay FucR can be labeled, such as by radioactivity or a colonmetnc compound, such that the number of fucR molecules bound to a bmdmg molecule or converted to product can be determined accurately to assess the effectiveness of the potential antagonist
It will be readily appreciated by the skilled artisan that a polypeptide and/or polynucleotide of the present mvention may also be used m a method for the structure-based design of an agomst or antagonist of the polypeptide and/or polynucleotide, by (a) determining m the first instance the three- dimensional structure of the polypeptide and/or polynucleotide, or complexes thereof, (b) deducmg the three-dimensional structure for the likely reactive sιte(s). bmdmg sιte(s) or motιf(s) of an agomst or antagonist, (c) synthesizing candidate compounds that are predicted to bmd to or react with the deduced bmdmg sιte(s). reactive sιte(s), and/or motιf(s), and (d) testing whether the candidate compounds are indeed agonists or antagomsts It w ll be further appreciated that this will normally be an iterative process, and this iterative process mav be performed usmg automated and computer-controlled steps
In a further aspect, the present mvention provides methods of treating abnormal conditions such as. for instance, a Disease, related to either an excess of, an under-expression of. an elevated activity of. or a decreased activity of fucR polypeptide and/or polynucleotide
If the expression and or activity of the polypeptide and/or polynucleotide is in excess, several approaches are available One approach compπses aαmrmsteπng to an individual m need thereof an inhibitor compound (antagonist) as herem descnbed, optionally m combmation with a pharmaceutically acceptable earner, m an amount effective to inhibit the function and or expression of the polypeptide and/or polynucleotide. such as. for example, by blocking the bmdmg of hgands, substrates, receptors, enzymes, etc . or by inhibiting a second signal, and thereby alleviating the abnormal condition In another approach, soluble forms of the polypeptides still capable of bmdmg the hgand, substrate, enzymes, receptors, etc m competition with endogenous polypeptide and/or polynucleotide may be admimstered Typical examples of such competitors mclude fragments of the fucR polypeptide and/or polypeptide
In still another approach, expression of the gene encoding endogenous fucR polypeptide can be inhibited using expression blocking techniques This blocking may be targeted against any step m gene expression, but is preferably targeted aga st transcription and/or translation An examples of a known technique of this sort mvolve the use of antisense sequences, either internally generated or separately admimstered (see. for example. O'Connor, J Neurochem (1991) 56 560 in Oligodeoxvnucleotides as Antisense Inhibitors of Gene Expression. CRC Press, Boca Raton, FL (1988)) Alternatively, ohgonucleotides that form triple helices with the gene can be supplied (see, for example, Lee et al , Nucleic Acids Res (1979) 6 3073. Cooney et al , Science (1988) 241 456, Dervan et al , Science (1991) 251 1360) These ohgomers can be administered per se or the relevant ohgomers can be expressed in vivo
Each of the polynucleotide sequences provided herein may be used m the discovery7 and development of antibactenal compounds The encoded protem, upon expression, can be used as a target for the screenmg of antibactenal drugs Additionally, the polynucleotide sequences encoding the ammo terminal regions of the encoded protem or Shme-Delgarno or other translation facilitating sequences of the respective mRNA can be used to construct antisense sequences to control the expression of the codmg sequence of interest
The mvention also provides the use of the polypeptide, polynucleotide. agomst or antagonist of the mvention to interfere with the initial physical mteraction between a pathogen or pathogens and a eukaryotic. preferably mammalian, host responsible for sequelae of infection In particular, the molecules of the mvention may be used m the prevention of adhesion of bacteria, m particular gram positive and/or gram negative bactena. to eukaryotic, preferably mammalian, extracellular matπx proteins on in-dwelling devices or to extracellular matnx protems in wounds, to block bactenal adhesion between eukaryotic. preferably mammalian, extracellular matrix proteins and bactenal fucR
protems that mediate tissue damage and/or, to block the normal progression of pathogenesis m infections initiated other than by the implantation of in-dwelling devices or by other surgical techmques
In accordance with yet another aspect of the mvention, there are provided agomsts and antagomsts. preferably bacteπstatic or bactencidal agomsts and antagomsts The antagomsts and agomsts of the mvention may be employed, for instance, to prevent, inhibit and/or treat diseases
Antagomsts of the mvention mclude, among others, small organic molecules, peptides, polypeptides and antibodies that bmd to a polynucleotide and/or polypeptide of the mvention and thereby inhibit or extinguish its activity or expression Antagomsts also may be small organic molecules, a peptide, a polypeptide such as a closely related protem or antibody that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule without mducmg fucR-induced activities, thereby preventmg the action or expression of fucR polypeptides and/or polynucleotides by excluding fucR polypeptides and/or polynucleotides from bmdmg
Antagomsts of the mvention also mclude a small molecule that bmds to and occupies the bmdmg site of the polypeptide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented Examples of small molecules mclude but are not limited to small organic molecules, peptides or peptide-like molecules Other antagomsts mclude antisense molecules (see Okano, J Neurochem 56 560 (1991). OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press, Boca Raton, FL (1988), for a descπption of these molecules) Prefened antagomsts mclude compounds related to and vanants of fucR
Other examples of polypeptide antagomsts mclude antibodies or. m some cases, ohgonucleotides or proteins that are closely related to the hgands. substrates, receptors, enzymes, etc . as the case may be. of the polypeptide. e g . a fragment of the hgands. substrates, receptors, enzymes, etc . or small molecules that bmd to the polypeptide of the present mvention but do not elicit a response, so that the activity of the polypeptide is prevented
Small molecules of the invention preferably have a molecular weight below 2,000 daltons, more preferably between 300 and 1,000 daltons, and most preferably between 400 and 700 daltons It is prefened that these small molecules are organic molecules
Hehcobacter pylori (herein "H pylori") bactena infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastπtis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Hehcobacter Pylori (International Agency for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm) Moreover, the International Agency for Research on Cancer recently recognized a cause-and-effect relationship between H pylori and gastnc adenocarcinoma, classifying the bacteπum as a Group I (definite) carcinogen Prefened
antimicrobial compounds of the mvention (agomsts and antagomsts of fucR polypeptides and/or polynucleotides) found usmg screens provided by the invention, or known m the art, particularly narrow-spectrum antibiotics, should be useful m the treatment of H pylori infection Such treatment should decrease the advent of H pylori -induced cancers, such as gastromtestmal carcinoma Such treatment should also prevent, inhibit and or cure gastric ulcers and gastritis
All publications and references, including but not limited to patents and patent applications, cited m this specification are herein incorporated by reference in their entirety as if each individual publication or reference were specifically and individually indicated to be incorporated by reference herein as bemg fully set forth Any patent application to which this application claims pnonty is also incorporated by reference herein in its entirety m the manner described above for publications and references
GLOSSARY The following definitions are provided to facilitate understanding of certain terms used frequently herem
"Bodily mateπal(s) means any matenal denved from an m vidual or from an orgamsm infecting. infesting or inhabiting an mdividual, mcludmg but not limited to, cells, tissues and waste, such as, bone. blood, serum, cerebrospinal fluid, semen, saliva, muscle, cartilage, organ tissue, skin, urine, stool or autopsy matenals
"Dιsease(s)" means any disease caused by or related to infection by a bacteπa, mcludmg , for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid
"Host cell(s)" is a cell that has been introduced (e g , transformed or transfected) or is capable of introduction (e g , transformation or transfection) by an exogenous polynucleotide sequence
"Identity ." as known m the art, is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, as determined by comparing the sequences In the art.
"identity" also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between stπngs of such sequences "Identit " can be readily calculated by known methods, mcludmg but not limited to those descnbed m
(Computational Molecular Biology. Lesk. A M , ed . Oxford University Press. New York. 1988.
Biocomputtng Informatics and Genome Projects, Smith. D W . ed . Academic Press, New York.
1993, Computer Analysis of Sequence Data, Part I. Gnfifin. A M , and Gπffin. H G , eds , Humana
Press. New Jerse . 1994. Sequence Analysis in Molecular Biology, von Hemje. G , Academic Press.
1987. and Sequence Analysis Primer, Gπbskov, M and Devereux, J , eds . M Stockton Press, New York. 1991. and Canllo. H , and Lipman, D , SIAM J Applied Math , 48 1073 (1988) Methods to determme identity are designed to give the largest match between the sequences tested Moreover, methods to determme identity are codified m publicly available computer programs Computer program methods to determme identity between two sequences mclude, but are not limited to, the GCG program package (Devereux, J . et al . Nucleic Acids Research 12(1) 387 (1984)), BLASTP, BLASTN. and FASTA (Altschul, S F et al , J Molec Biol 215 403-410 (1990) The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul. S , et al , NCBI NLM NIH Bethesda. MD 20894. Altschul, S . et al , J Mol Biol 215 403-410 (1990) The well known Smith Waterman algoπthm may also be used to determine identity
Parameters for polypeptide sequence comparison mclude the following Algorithm Needleman and Wunsch. J Mol Biol 48 443-453 (1970)
Companson matrix BLOSSUM62 from Hentikoff and Hentikoff, Proc Natl Acad Sci USA 89 10915-10919 (1992) Gap Penalty 12
Gap Length Penalty 4
A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group. Madison WI The aforementioned parameters are the default parameters for peptide compansons (along with no penalty for end gaps) Parameters for polynucleotide comparison mclude the following Algonthm Needleman and
Wunsch. J Mol Biol 48 443-453 (1970) Companson matnx matches = +10, mismatch = 0 Gap Penalty 50 Gap Length Penalty 3 Available as The "gap" program from Genetics Computer Group, Madison WI These are the default parameters for nucleic acid compansons
A prefened meaning for "identity" for polynucleotides and polypeptides, as the case may be, are provided m (1) and (2) below
(1) Polynucleotide embodiments further mclude an isolated polynucleotide compnsrng a polynucleotide sequence havmg at least a 95, 97 or 100% identity to the reference sequence of SEQ ID NO 1. wherem said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO 1 or may mclude up to a certain integer number of nucleotide alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one nucleotide deletion, substitution, mcludmg transition and transversion. or insertion, and wherem said
alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, mterspersed either individually among the nucleotides m the reference sequence or m one or more contiguous groups within the reference sequence, and wherem said number of nucleotide alterations is determined by multiplymg the total number of nucleotides in SEQ ID NO 1 by the mteger defimng the percent identity divided by 100 and then subtractmg that product from said total number of nucleotides m SEQ ID NO 1, or
nn < xn - (xn • y),
wherem nn is the number of nucleotide alterations. xn is the total number of nucleotides m SEQ ID NO 1. y is 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherem any non-mteger product of xn and y is rounded down to the nearest mteger pnor to subtractmg it from xn Alterations of a polynucleotide sequence encodmg the polypeptide of SEQ ID NO 2 may create nonsense, nussense or frameshift mutations m this codmg sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations
(2) Polypeptide embodiments further mclude an isolated polypeptide compnsrng a polypeptide havmg at least a 95. 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO 2. wherem said polypeptide sequence may be identical to the reference sequence of SEQ ID NO 2 or may mclude up to a certain mteger number of ammo acid alterations as compared to the reference sequence, wherem said alterations are selected from the group consistmg of at least one ammo acid deletion, substitution, mcludmg conservative and non-conservative substitution, or insertion, and wherem said alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the ammo acids m the reference sequence or m one or more contiguous groups within the reference sequence, and wherein said number of ammo acid alterations is determmed by multiplying the total number of ammo acids m SEQ ID NO 2 by the mteger defimng the percent identity divided by 100 and then subtractmg that product from said total number of ammo acids m SEQ ID NO 2. or
na < xa - (xa • y),
wherem na is the number of amino acid alterations, xa is the total number of ammo acids m SEQ ID NO 2. y is 0 95 for 95%, 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication
operator, and wherein any non-integer product of xa and y is rounded down to the nearest integer prior to subtractmg it from xa.
"Indιvidual(s)" means a multicellular eukaryote, including, but not limited to a metazoan, a mammal, an ovid, a bovid, a simian, a primate, and a human. "Isolated" means altered "by the hand of man" from its natural state, /. e. , if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herem Moreover, a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated" even if it is still present in said organism, which organism may be living or non-living
"Organism(s)" means a (i) prokaryote, mcludmg but not limited to. a member of the genus Streptococcus, Staphylococcus, Bordetella, Corynebactenum, Mycobactenum, Neisseria, Haemophilus, Actinomycetes, Streptomycetes, Nocardia, Enterobacter, Yersinia, Fancisella, Pasturella, Moraxella, Acinetobacter, Erysipelothnx, Branhamella, Actinobacillus, Streptobacillus, Listena, Calymmatobactenum, Brucella, Bacillus, Clostndium, Treponema, Escherichia, Salmonella, Kleibsiella, Vibno, Proteus, Erwinia, Borrel a, Leptospira, Spirillum, Campylobacter, Shigella, Legionella, Pseudomonas, Aeromonas, Rickettsia, Chlamydia, Borrelia and Mycoplasma, and further including, but not limited to, a member of the species or group, Group A Streptococcus, Group B Streptococcus, Group C Streptococcus, Group D Streptococcus, Group G Streptococcus, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus faecal s, Streptococcus faec um, Streptococcus durans, Neisseria gonorrheae, Neissena menmgitidis, Staphylococcus aureus, Staphylococcus epidermidis, Corynebactenum dipthenae, Gardnerella vaginahs, Mycobactenum tuberculosis, Mycobactenum bovis, Mycobactenum ulcerans, Mycobactenum leprae, Actinomyctes israelii, Listena monocytogenes, Bordetella pertusis, Bordatella parapertusis, Bordetella bronchiseptica, Eschenchia coh, Shigella dysentenae, Haemophilus influenzae, Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus ducreyi, Bordetella, Salmonella typhi, Citrobacter freundii, Proteus mirabihs, Proteus vulgans, Yersinia pestis, Kleibsiella pneumoniae, Serratia marcessens, Serratia hquefaciens, Vibno cholera, Shigella dysenterii, Shigella flexnen, Pseudomonas aerugmosa, Franscisella tularensis, Brucella abortis, Bacillus anthracis, Bacillus cereus, Clostndium perfringens, Clostndium tetani, Clostndium botulinum, Treponema pallidum, Rickettsia nckettsn and Chlamydia trachomitis, (ii) an archaeon, including but not limited to Archaebacter. and (hi) a unicellular or filamentous eukaryote. including but not limited to, a protozoan, a fungus, a member of the genus Saccharomyces, Kluveromyces, or Candida, and a member of the species Saccharomyces cenviseae, Kluveromyces lactis, or Candida albicans.
"Polynucleotide(s)" generally refers to any polynbonucleotide or polydeoxyπbonucleotide, that may be unmodified RNA or DNA or modified RNA or DNA "Polynucleotide(s)" mclude, without limitation, single- and double-stranded DNA, DNA that is a mixture of smgle- and double-stranded regions or smgle-, double- and tπple-stranded regions, smgle- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybnd molecules compnsrng DNA and RNA that may be single-stranded or. more typically, double-stranded, or tnple-stranded regions, or a mixture of smgle- and double-stranded regions In addition, "polynucleotide" as used herem refers to tπple-stranded regions compnsrng RNA or DNA or both RNA and DNA The strands m such regions may be from the same molecule or from different molecules The regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules One of the molecules of a tnple-helical region often is an ohgonucleotide As used herem the term "polynucleotide(s)" also mcludes DNAs or RNAs as descnbed above that compnse one or more modified bases Thus. DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is mtended herem Moreover. DNAs or RNAs compnsrng unusual bases such as mosme. or modified bases, such as tntylated bases, to name just two examples, are polynucleotides as the term is used herem It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill m the art The term "polynucleotide(s)" as it is employed herem embraces such chemically, enzymatically or metabohcally modified forms of polynucleotides. as well as the chemical forms of DNA and RNA charactenstic of viruses and cells, mcludmg, for example, simple and complex cells "Polynucleotide(s)" also embraces short polynucleotides often refened to as ohgonucleotide(s)
"Polypeptide(s)" refers to any peptide or protem compnsrng two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds "Polypeptide(s)" refers to both short chains, commonly refened to as peptides. ohgopeptides and ohgomers and to longer chains generally refened to as proteins Polypeptides may compnse ammo acids other than the 20 gene encoded ammo acids "Polypeptide(s)" mclude those modified either by natural processes, such as processmg and other post-translational modifications, but also by chemical modification techmques Such modifications are well descnbed m basic texts and m more detailed monographs, as well as m a voluminous research literature, and they are well known to those of skill m the art It will be appreciated that the same type of modification may be present m the same or varying degree at several sites m a given polypeptide Also, a given polypeptide may compnse many types of modifications Modifications can occur anywhere m a polypeptide, mcludmg the peptide backbone, the ammo acid side-chains, and the ammo or carboxyl termini Modifications mclude, for example, acetylation. acylation. ADP-πbosylation, amidation. covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide denvative, covalent attachment of a hpid or hpid denvative. covalent attachment of phosphotidyhnositol. cioss-linkmg. cychzation, disulfide bond
formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, GPI anchor formation, hydroxylation, lodination. methylation. mynstoylation, oxidation, proteolybc processmg, phosphorylation, prenylation, racemization, glycosy ation, hpid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-nbosylation. selenoylation, sulfation, transfer-RNA mediated addition of ammo acids to proteins, such as argmylatioa and ubiquitination See. for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES. 2nd Ed , T E Creighton, W H Freeman and Company, New York (1993) and Wold, F , Posttranslational Protem Modifications Perspectives and Prospects, pgs 1-12 m POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B C Johnson, Ed , Academic Press, New York (1983), Seifter et al . Meth Enzymol 182 626-646 (1990) and Rattan et al , Protein Synthesis Posttranslational Modifications and Aging. Aim N Y Acad Sci 663 48-62 (1992) Polypeptides may be branched or cychc with or without branching Cychc, branched and branched circular polypeptides may result from posttranslational natural processes and may be made by entirely synthetic methods, as well
"Recombinant expression system(s)" refers to expression systems or portions thereof or polynucleotides of the mvention mtroduced or transformed mto a host cell or host cell lysate for the production of the polynucleotides and polypeptides of the mvention
"Vanant(s)" as the term is used herein, is a polynucleotide or polypeptide that differs from a reference polynucleotide or polypeptide respectively, but retams essential properties A typical vanant of a polynucleotide differs m nucleotide sequence from another, reference polynucleotide Changes m the nucleotide sequence of the vanant may or may not alter the ammo acid sequence of a polypeptide encoded by the reference polynucleotide Nucleotide changes may result m ammo acid substitutions, additions, deletions, fusion protems and truncations m the polypeptide encoded by the reference sequence, as discussed below A typical vanant of a polypeptide differs m ammo acid sequence from another, reference polypeptide Generally, differences are limited so that the sequences of the reference polypeptide and the vanant are closely similar overall and, in many regions, identical A vanant and reference polypeptide may differ m ammo acid sequence by one or more substitutions, additions, deletions m any combination A substituted or inserted ammo acid residue may or may not be one encoded by the genetic code The present mvention also mcludes mclude vanants of each of the polypeptides of the mvention, that is polypeptides that vary from the referents by conservative ammo acid substitutions, whereby a residue is substituted by another with like charactenstics Typical such substitutions are among Ala. Val. Leu and He, among Ser and Thr. among the acidic residues Asp and Glu. among Asn and Gin. and among the basic residues Lys and Arg. or aromatic residues Phe and Tyr Particularly prefened are vanants m which several, 5-10, 1-5, 1-3, 1-2 or 1 ammo acids are substituted, deleted, or added m any combination A vanant of a polynucleotide or polypeptide may be a naturally occurring such as an
allelic vanant, or it may be a vanant that is not known to occur naturally Non-naturally occurring vanants of polynucleotides and polypeptides may be made by mutagenesis techmques, by direct synthesis, and by other recombinant methods known to skilled artisans EXAMPLES The examples below are earned out usmg standard techmques, that are well known and routme to those of skill m the art except where otherwise descnbed m detail The examples are illustrative, but do not limit the mvention Example 1 Strain selection, Library Production and Sequencing
The polynucleotide havmg a DNA sequence given in Table 1 [SEQ ID NO 1] was obtamed from a library of clones of chromosomal DNA of Streptococcus pneumoniae in E coh The sequencmg data from two or more clones compnsrng overlappmg Streptococcus pneumoniae DNAs was used to construct the contiguous DNA sequence m SEQ ID NO 1 Libranes may be prepared by routine methods, for example Methods 1 and 2 below Total cellular DNA is isolated from Streptococcus pneumoniae 0100993 according to standard procedures and size-fractionated by either of two methods Method 1
Total cellular DNA is mechanically sheared by passage through a needle m order to size- fractionate according to standard procedures DNA fragments of up to 1 lkbp m size are rendered blunt by treatment with exonuclease and DNA polymerase, and EcoRI linkers added Fragments are ligated mto the vector Lambda ZapII that has been cut with EcoRI, the library packaged by standard procedures and E coh infected with the packaged library The library is amplified by standard procedures
Method 2 Total cellular DNA is partially hydrolyzed with a one or a combmation of restnction enzymes appropnate to generate a senes of fragments for cloning into library vectors (e g , Rsal, Pall. Alul, Bshl235I). and such fragments are size-fractionated according to standard procedures EcoRI linkers are ligated to the DNA and the fragments then ligated mto the vector Lambda ZapII that have been cut with EcoRI. the library packaged by standard procedures, and E coh infected with the packaged library The library is amplified by standard procedures
Claims
What is claimed is:
1 An isolated polypeptide selected from the group consistmg of
(1) an isolated polypeptide compnsrng an ammo acid havmg at least 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (u) an isolated polypeptide compnsrng the ammo acid sequence of SEQ ID NO 2, (m) an isolated polypeptide that is the ammo acid sequence of SEQ ID NO 2, and (IV) a polypeptide that is encoded by a recombinant polynucleotide compnsrng the polyncleotide sequence of SEQ ID NO 1
2 An isolated polynucleotide selected from the group consistmg of
(I) an isolated polynucleotide compnsrng a polynucleotide sequence encodmg a polypeptide that has at least 95% identity to the ammo acid sequence of SEQ ID NO 2, over the entire length of SEQ ID NO 2,
(n) an isolated polynucleotide compnsrng a polynucleotide sequence that has at least 95% identity over its entire length to a polynucleotide sequence encodmg the polypeptide of SEQ ID
NO 2,
(in) an isolated polynucleotide compnsrng a nucleotide sequence that has at least 95% identity to that of SEQ ID NO 1 over the entire length of SEQ ID NO 1,
(iv) an isolated polynucleotide compnsrng a nucleotide sequence encodmg the polypeptide of SEQ ID
NO 2,
(v) an isolated polynucleotide that is the polynucleotide of SEQ ID NO 1 ,
(vi) an isolated polynucleotide of at least 30 nucleotides m length obtainable by screening an appropnate hbrary under strmgent hybndization conditions with a probe havmg the sequence of SEQ
ID NO 1 or a fragment thereof of of at least 30 nucleotides m length,
(vu) an isolated polynucleotide encodmg a mature polypeptide expressed by the fucR gene compnsed m the Streptococcus pneumoniae, and
(vni) a polynucleotide sequence complementary to said isolated polynucleotide of (l), (n), (m), (iv), (v), (w) or (vn)
3 A method for the treatment of an individual
(I) in need of enhanced activity or expression of or lmmunological response to the polypeptide of claim 1 compnsrng the step of administenng to the mdividual a therapeutically effective amount of an antagomst to said polypeptide, or
(n) havmg need to inhibit activity or expression of the polypeptide of claim 1 compπsmg
(a) administering to the individual a therapeutically effective amount of an antagonist to said polypeptide, or
(b) administering to the individual a nucleic acid molecule that inhibits the expression of a polynucleotide sequence encodmg said polypeptide,
(c) admimstenng to the individual a therapeutically effective amount of a polypeptide that competes with said polypeptide for its hgand, substrate, or receptor, or
(d) admmisteπng to the mdividual an amount of a polypeptide that mduces an lmmunological response to said polypeptide m said mdividual
4 A process for diagnosing or prognosmg a disease or a susceptibility to a disease m an mdividual related to expression or activity of the polypeptide of claim 1 m an mdividual compπsmg the step of
(a) deteπmmng the presence or absence of a mutation m the nucleotide sequence encoding said polypeptide m an orgamsm in said mdividual, or
(b) analyzing for the presence or amount of said polypeptide expression m a sample denved from said mdividual
5 A process for producmg a polypeptide selected from the group consistmg of
(l) an isolated polypeptide compnsrng an ammo acid sequence selected from the group havmg at least 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID NO 2. (n) an isolated polypeptide compnsrng the ammo acid sequence of SEQ ID NO 2, (m) an isolated polypeptide that is the ammo acid sequence of SEQ ID NO 2, and (iv) a polypeptide that is encoded by a recombinant polynucleotide compnsrng the polynucleotide sequence of SEQ ID NO 1, compnsrng the step of cultuπng a host cell under conditions sufficient for the production of the polypeptide
6 A process for producmg a host cell compnsrng an expression system or a membrane thereof expressmg a polypeptide selected from the group consistmg of
(1) an isolated polypeptide compπsmg an ammo acid sequence selected from the group havmg at least 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID NO 2, (u) an isolated polypeptide compπsmg the ammo acid sequence of SEQ ID NO 2, (in) an isolated polypeptide that is the ammo acid sequence of SEQ ID NO 2, and (iv) a polypeptide that is encoded by a recombinant polynucleotide compπsmg the polynucleotide sequence of SEQ ID NO 1. said process compπsmg the step of transforming or transfectrng a cell with an expression system compnsmg a polynucleotide capable of producmg said polypeptide of (l), (n), (m) or (iv) when said expression system is present m a compatible host cell such the host cell, under appropriate culture conditions, produces said polypeptide of (I), (11), (in) or (iv)
7 A host cell or a membrane expressmg a polypeptide selected from the group consistmg of (l) an isolated polypeptide compπsmg an ammo acid sequence selected from the group havmg at least 95% identity to the ammo acid sequence of SEQ ID NO 2 over the entire length of SEQ ID
NO 2,
(u) an isolated polypeptide compnsmg the ammo acid sequence of SEQ ID NO 2, (in) an isolated polypeptide that is the ammo acid sequence of SEQ ID NO 2, and (iv) a polypeptide that is encoded by a recombinant polynucleotide compnsmg the polynucleotide sequence of SEQ ID NO 1
8 An antibody immunospecific for the polypeptide of claim 1
9 A method for screenmg to identify compounds that agonize or that inhibit the function of the polypeptide of claim 1 that compnses a method selected from the group consisting of
(a) measunng the bmdmg of a candidate compound to the polypeptide (or to the cells or membranes bearmg the polypeptide) or a fusion protem thereof by means of a label directly or mdirectly associated w th the candidate compound,
(b) measunng the bmdmg of a candidate compound to the polypeptide (or to the cells or membranes bearmg the polypeptide) or a fusion protem thereof m the presence of a labeled competitor.
(c) testmg whether the candidate compound results m a signal generated by activation or inhibition of the polypeptide, usmg detection systems appropπate to the cells or cell membranes bearmg the polypeptide.
(d) mixing a candidate compound with a solution compπsmg a polypeptide of claim 1. to form a mixture, measunng activity of the polypeptide m the mixture, and comparmg the activity of the mixture to a standard, or
(e) detectmg the effect of a candidate compound on the production of mRNA encoding said polypeptide and said polypeptide in cells, usmg for instance, an ELISA assay
10 An agomst or antagonist to the polypeptide of claim 1
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US14498899P | 1999-07-22 | 1999-07-22 | |
US60/144,988 | 1999-07-22 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2001007460A1 true WO2001007460A1 (en) | 2001-02-01 |
Family
ID=22511090
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/019776 WO2001007460A1 (en) | 1999-07-22 | 2000-07-20 | FucR |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2001007460A1 (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998018931A2 (en) * | 1996-10-31 | 1998-05-07 | Human Genome Sciences, Inc. | Streptococcus pneumoniae polynucleotides and sequences |
-
2000
- 2000-07-20 WO PCT/US2000/019776 patent/WO2001007460A1/en active Application Filing
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1998018931A2 (en) * | 1996-10-31 | 1998-05-07 | Human Genome Sciences, Inc. | Streptococcus pneumoniae polynucleotides and sequences |
Non-Patent Citations (1)
Title |
---|
DATABASE MEDLINE ON DIALOG, US NATIONAL LIBRARY OF MEDICINE (BETHESDA, MD, USA)GENCORE DATABASE VERSION 4.5, COMPUGEN LTD.,; BARASH ET AL.: "Computer-readable medium with recorded streptococcus pneumoniae polynucleotide sequences- useful in diagnostic kits and assyas and pharmaceutical compositions and vaccines for streptococcus pneumoniae" * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2000017644A1 (en) | Ndp | |
WO2000037495A1 (en) | EF-Tu | |
WO2000049042A1 (en) | nadE | |
WO2000026377A1 (en) | POLYNUCLEOTIDES AND POLYPEPTIDES ENCODING metK ISOLATED FROM $i(STREPTOCCOCCUS PNEUMONIAE) | |
WO2001007463A1 (en) | Trer | |
WO2000050602A1 (en) | Tdk polypeptides and polynucleotides and methods thereof | |
WO2001007460A1 (en) | FucR | |
WO2001007458A1 (en) | lacR | |
WO2000068426A1 (en) | Ups | |
WO2000065026A2 (en) | YycG | |
WO2000065089A1 (en) | tktA | |
WO2001032021A1 (en) | ytgp | |
WO2000050433A2 (en) | Staphylococcus aureus q13 polynucleotides, polypeptides and methods of use | |
WO2001016351A1 (en) | DnaE | |
WO2000068140A1 (en) | Signal transduction response regulator family of staphylococcus | |
WO2001007465A1 (en) | Ga1R | |
WO2000071555A2 (en) | 509rr | |
WO2000058497A1 (en) | STAPHYLOCOCCUS AUREUS ispA | |
WO2001024819A1 (en) | YsxC | |
WO2000056873A1 (en) | mvaA | |
WO1999061452A2 (en) | acpS | |
WO2001021764A1 (en) | A pcra helicase of staphylococcus aureus | |
WO2000056154A1 (en) | Histidine kinase | |
WO2001024635A1 (en) | AsuE | |
WO2001008486A1 (en) | CoaA POLYPEPTIDES AND POLYNUCLEOTIDES AND METHODS THEREOF |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |