WO2001004152A1 - Mucin - Google Patents

Mucin Download PDF

Info

Publication number
WO2001004152A1
WO2001004152A1 PCT/AU2000/000846 AU0000846W WO0104152A1 WO 2001004152 A1 WO2001004152 A1 WO 2001004152A1 AU 0000846 W AU0000846 W AU 0000846W WO 0104152 A1 WO0104152 A1 WO 0104152A1
Authority
WO
WIPO (PCT)
Prior art keywords
muc3
transmembrane
sequence
alteration
absence
Prior art date
Application number
PCT/AU2000/000846
Other languages
French (fr)
Inventor
Michael Andrew Mcguckin
Stephanie Jane Williams
Original Assignee
Michael Andrew Mcguckin
Stephanie Jane Williams
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Michael Andrew Mcguckin, Stephanie Jane Williams filed Critical Michael Andrew Mcguckin
Priority to AU57961/00A priority Critical patent/AU5796100A/en
Publication of WO2001004152A1 publication Critical patent/WO2001004152A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4727—Mucins, e.g. human intestinal mucin

Definitions

  • This invention relates to a transmembrane mucm. More particularly, it relates to a transmembrane variant of MUC3.
  • Epithelial mucins are large glycoproteins characterized by a central polymorphic tandem repeat structure with a large number of O-hnked carbohydrate side chains. Ten human epithelial mucm genes have been identified, though due to their large size and tandem repeat nature, full-length cDNA clones are available for only 5 of these genes (Seregni et al (1997)).
  • MUC1 mucin is expressed by almost all human glandular epithelial cells and has a distinct role in adhesion modulation and intracellular signaling (Gendler et al. (1991)).
  • MUC4 transmembrane mucin to be reported
  • MUC4 and its rat orthologue, ASGPl/2 contain two extracellular cysteine-rich EGF- ke domains after a large mucin-like tandem repeat domain (Sheng et al (1992), Moniaux et al. (1999))
  • the cysteine-nch region is followed by a transmembrane domain and a cytoplasmic tail containing a potential tyrosine phosporylation site.
  • the functional significance of EGF-like domains is unclear, however, they may allow exposure of Iigand-binding sites on the exterior regions of a t ⁇ -lobed structure formed by disulfide bridging ot the core 6 cysteine residues.
  • MUC3 located on human chromosome 7q22, encodes an intestinal mucm expressed by goblet and absorptive cells. It has previously been reported to contain a single cysteine-rich EGF-like domain at its carboxyl-terminus and to lack a transmembrane domain, suggesting it could be a secreted mucin (Gum et al (1997)). Two rodent genes, encoding rMuc3 and mMuc3, have been designated Muc3 due to their location on the syntenic regions to human chromosome 7, their expression in intestine and their weak homology with MUC3.
  • hMUC3 Although the EGF-like domain of hMUC3 is similar to one of the EGF-like domains of the rodent proteins, overall the hMUC3 carboxy terminus shows limited homology to the rodent proteins (34%), suggesting that hMUC3 may not be the orthologue of rat and mouse Muc3.
  • the invention can broadly be said to consist in a glycoprotein which contains a cytoplasmic tail, transmembrane domain, an N-glycosylated region containing a coiled coil domain and two distinct EGF-like extracellular domains, which glycoprotein includes at least one of the following amino acid sequences;
  • the present invention provides a glycoprotein which comprises the following amino acid sequence:
  • the invention provides a glycoprotein which comprises the following amino acid sequence:
  • the invention provides a polynucleotide which encodes a glycoprotein as defined above.
  • said polynucleotide has the following sequence:
  • the invention also provides a polynucleotide which has the following sequence:
  • the present invention provides antibodies which bind to a glycoprotein as defined above but which do not bind to the secreted mucin described by Gum et al, (1997).
  • antibodies which bind to a peptide selected from the following, or to any overlapping sequences of these contiguous peptides:
  • the invention provides a probe comprising a nucleic acid molecule sufficiently complementary with a polynucleotide as defined above, or its complement, to bind under stringent conditions,
  • the invention provides a method of detecting a predisposition to colorectal cancer and/ or inflammatory bowel disease, and/ or for prediction of the outcome, and/or severity, and/ or responsiveness to treatment of these diseases, which employs an antibody or a probe as defined above.
  • the invention provides a method of detecting transmembrane MUC3 in respiratory mucus and/or tissues from individuals with respiratory conditions such as chronic bronchitis, asthma and cystic fibrosis, employing an antibody or a probe as defined above, for the purpose of predicting disease severity, and/ or prognosis, and/or responsiveness to treatment.
  • the invention provides a method of detecting transmembrane MUC3 in the serum of patients with cancers of epithelial origin (for example cancers of the gastrointestinal tract, respiratory tract, reproductive tracts and breast) as a method of detecting the presence of cancer, and/ or diagnosing a specific cancer, and/or responsiveness to treatment, and/or predicting prognosis using an antibody or a probe as defined above.
  • cancers of epithelial origin for example cancers of the gastrointestinal tract, respiratory tract, reproductive tracts and breast
  • the invention provides a method of detecting transmembrane MUC3 in gastrointestinal mucus and/or tissues of patients with cystic fibrosis for the purpose of predicting disease severity and/ or prognosis and/ or responsiveness to treatment which employs an antibody or a probe as defined above.
  • the invention provides a method of testing to detect whether a human subject is predisposed to colorectal cancer which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane UC3, wherein the presence of an alteration is indicative of a predisposition to colorectal cancer.
  • the invention provides a method of testing to detect whether a human subject is predisposed to inflammatory bowel disease (IBD) which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane MUC3, wherein the presence of an alteration is indicative of a predisposition to IBD.
  • IBD inflammatory bowel disease
  • the presence or absence of an alteration is determined by analysis of DNA coding for transmembrane UC3, such as by comparing the sequence of DNA from a sample from said subject with the DNA sequence coding for wild-type transmembrane MUC3.
  • the presence or absence of an alteration is determined by analysis of mRNA transcribed from DNA encoding transmembrane MUC3, such as by comparing the sequence of RNA from a sample from said subject with the mRNA sequence transcribed from DNA coding for wild- type transmembrane MUC3.
  • the presence or absence of an alteration is determined by analysis of the amino acid sequence of the expressed transmembrane MUC3 protein.
  • FIG. 1 RT-PCR showing amplification of HMUC3 mRNA transcripts from normal colonic mucosa (NC), small intestine (SI) and 10 colorectal cancer cell lines.
  • M denotes molecular size markers
  • the 1247 bp product encoding the transmembrane form ot MUC3 is the major product in normal intestinal tissues and in 8/9 cell lines showing MUC3 expression.
  • the 1073 bp product was seen in all nine MUC3 expressing lines, it was the dominant form expressed by only one cell line, LoVo.
  • the 1 131 bp product representing the previously described MUC3 carboxyl terminus was not readily visible in any of the PCR reactions using normal intestinal RNA and RNA from colorectal cancer cell lines.
  • FIG. 1 Expression of transmembrane MVC3 in 13 breast cancer cell lines determined by semi-quantitative RT-PCR.
  • the loading control is Bs-microglobulin denoted by B2MG and the molecular weight marker is denoted by ⁇ '
  • B2MG Bs-microglobulin
  • ⁇ ' molecular weight marker
  • nucleotides Numbering of nucleotides is given on the left and amino acids on the right Five potential N-glycosylation sites are shown m italic, the transmembrane region is smgly underlined and two cysteine-rich EGF-like domains are double underlined. A potential coiled-coil region is in bold. The alternatively spliced regions are marked by arrows. The stop codon is denoted by an asterisk.
  • FIG. 4 Amino acid sequence alignment of the carboxyl termini of hMUC3 (amino acids 1-366) (Fig. 5), rMuc3 (Gum et a (1991), Khatri et at. (1997)) (amino acids 356-447 and 1-379 respectively), rnMuc3 (Shekels et al. (1988)) (amino acids 637-1015) grouped according to functional domains. Shading demonstrates identity of hMUC3 with the rodent proteins. Hyphens indicate gaps inserted to optimize the alignment. DESCRIPTION OF THE INVENTION
  • transmembrane MUC3 a human transmembrane mucin.
  • This mucin is a variant of the secreted human mucin previously referred to as MUC3 and is referred to herein as "transmembrane MUC3".
  • Transmembrane MUC3 has been established as including a cytoplasmic tail, transmembrane domain, an N-giycosylated region containing a coiled coil domain and two distinct EGF-like extracellular domains.
  • the DNA sequence and predicted amino acid sequence of transmembrane MUC3 is shown in Figure 2.
  • amino acid sequences include:
  • the invention also includes functional equivalents of transmembrane MUC3.
  • Such functional equivalents can be a variant protein.
  • a protein is considered a functional equivalent of another protein for a specific function if the equivalent protein is immunologically cross-reactive with, and has the same function as, the original protein.
  • the equivalent may, for example, be a fragment of the protein, or a substitution, addition or deletion mutant of the protein.
  • transmembrane MUC3 may be made as long as the resulting equivalent protein is immunologically cross-reactive with, and has the same function as, the native transmembrane MUC3.
  • the equivalent transmembrane MUC3 will normally have substantially the same amino acid sequence as the native transmembrane MUC3.
  • An amino acid sequence that is substantially the same as another sequence, but that differs from the other sequence by means of one or more substitutions, additions and/ or deletions is considered to be an equivalent sequence.
  • Preferably, less than 25%, more preferably less than 10%, and most preferably less than 5% of the number of amino acid residues in the amino acid sequence of the native transmembrane MUC3 are substituted for, added to, or deleted from.
  • polynucleotides which encode a protein having transmembrane MUC3 functionality are also contemplated.
  • polynucleotides include nucleic acid sequences that encode proteins equivalent to transmembrane MUC3 as defined above.
  • Equivalent nucleic acid molecules also include nucleic acid sequences that, due to the degeneracy of the nucleic acid code, differ from native nucleic acid sequences in ways that do not affect the corresponding amino acid sequences.
  • Transmembrane MUC3 and its functional equivalents may be prepared by methods known in the art Such methods include protein synthesis from individual amino acids as described by Stuart and Young in "Solid Phase Peptide Synthesis", 2 nd Edition, Pearce Chemical Company (1984). It is however preferred that transmembrane UC3 and/ or its functional equivalents be prepared by recombinant methods. Such methods involve insertion of polynucleotides encoding the desired protein into appropriate expression vectors using art standard techniques such as are desc ⁇ bed m Sambrook et al , "Molecular Cloning", 2" d Edition, Cold Spring Harbour Laboratory, Cold Spring Harbour, New York (1987).
  • Antibodies to transmembrane MUC3 are also provided by this invention. Such antibodies can be polyclonal but will preferably be monoclonal antibodies. These can be raised to separate regions of transmembrane MUC3 to enable differential binding to various forms of MUC3. Specifically, antibodies can be raised against the cytoplasmic tail region, transmembrane domain, coiled coil domain and the two EGF-like extracellular domains.
  • Monoclonal antibodies with affinities of 10 " ' 1 or preferably 10-'' to 10- ⁇ o IvH or stronger will typically be made by standard procedures as described, eg. in Harlow ⁇ c Lane ( 1988) or Goding (1986) Briefly, appropriate animals will be selected and the desired immunizauon protocol followed. After the appropriate period of time, the spleens of such animals are excised and individual spleen cells fused, typicaUy, to immortalised myeloma cells under appropriate selection conditions. Thereafter, the cells are clo ⁇ ally separated and the supernatants of each clone tested for then- production of an appropriate antibody specific for the desired region of the antigen.
  • Suitable techniques for preparing antibodies well known in the art involve in vitro exposure of lymphocytes to the antigenic polypeptides, or alternatively, to selection of libraries of antibodies in phage or similar vectors.
  • recombinant lmmunoglobulins may be produced using procedures known in the art (see, for example, US Patent 4,816,567 and Hodgson J. (1991)).
  • the antibodies may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal.
  • labels and conjugation techniques are known and are reported extensively in the literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include US Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275, 149; and 4,366,241.
  • the immunological assay in which the antibodies are employed can involve any convenient format known in the art. Such formats include western blots, immunohistochemical assays and ELISA assays.
  • discrimination between, or quantification of, the isoforms of MUC3 can also be at the nucleic acid level.
  • the nucleic acid targeted can be mRNA or DNA.
  • nucleotide probes will be sufficiently complementary to part or all of the sequence of Figure 2, to bind under stringent conditions, with the precise sequence of the probe being dependent upon which of the MUC3 isoforms is to be detected.
  • nucleotide probes which target transmembrane MUC3 but not its other isoforms can include a sequence complementary to that coding for the transmembrane region or the cytoplasmic tail of transmembrane MUC3
  • probes which target both secreted UC3 and transmembrane MUC3 can include a sequence complementary to that coding for the extracellular domain.
  • Such probes can then carry differentiating labels, and the individual MUC3 isoforms identified with reference to the binding of one or both of the labelled probes (ie. one label only will indicate nucleic acid coding for secreted UC3 whereas both labels will indicate nucleic acid coding for transmembrane MUC3).
  • Discrimination can also be through the use of a set of primers for amplifying nucleic acid.
  • primers can be selected to amplify nucleic acid encoding the transmembrane domain and/or cytoplasmic tail of transmembrane MUC3.
  • RT-PCR was performed on total RNA isolated from two normal colonic mucosa samples, one small intestine sample and 10 colorectal cancer cell lines, Caco-2, LIM1215, LI 1899, HCT116, SW1 16, LoVo, LS 174T, M12SM, LISP- 1 and SW620.
  • First strand cDNA synthesis was accomplished using 1 ⁇ g of total RNA.
  • Tissue and cell line RNA was initially screened for MUC3 expression by performing PCR amplification of DNA in a total volume of 25 ⁇ l containing 0.5 ⁇ l of the first strand cDNA synthesis reaction products, 2.5 ⁇ l lOx PCR buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 20 pmol each of the forward and reverse primers, 5% DMSO and 1.25 U AmpliTaq gold (Perkin Elmer, Norwalk, CT). Based upon the published sequence of the partial hMUC3 cDNA (Genbank accession no.
  • gene-spec ⁇ c forward and reverse primers ( UC3F1; 5'-TGTGACAATGGTGGCACCTGG-3' and MUC3R1 ; 5'-GGGATTTGGGGGAACAGTCTC-3') were designed to produce a predicted PCR product of 1 126 bp.
  • PCR amplification conditions began with an initial denaturation step of 94°C for 10 min followed by a "touchdown" procedure (Don et al. (1991)). This involved 2 cycles each at annealing temperatures decreasing at 1° intervals from 68°C to 64°C (30 s), with denaturation at 94°C (45 s) and extension at 72°C (1 min). Then followed by 30 cycles of 94°C (45 s), annealing at 63°C (30 s) and extension at 72"C ( 1 min) were performed. PCR products were electrophoresed on 1% agarose, lx TBE gels and photographed. For sequencing purposes, PCR amplification was also performed using high fidelity Expand polymerase (Boehringer Mannheim, Roche Diagnostics, Mannheim, Germany).
  • Amplified products from normal colonic and small intestinal mucosa, and from Caco-2 and LoVo cell lines were purified, cloned into pGEM-T (Promega Corporation, Madison, WI) and sequenced.
  • cDNAs Were sequenced in a cycle sequencing reaction with 2.5 p ol of primer and 4 ⁇ l of BigDye reaction mix (DNA Cycle Sequencing Kits, Perkin-Elmer) in a total volume of 10 ⁇ l. Cycling reactions were as follows: 25 cycles of denaturation at 96°C (30 s), primer annealing at 50°C (15 s) and extension at 60°C (4 min). Unincorporated nucleotides were removed by isopropanol precipitation.
  • Fig. 2 The DNA sequence and conceptual protein translation of this product (Genbank accession no. AF 143371) is shown in Fig. 2 and differs from that reported by Gum et al. in several respects. Firstly, an additional previously unrecognized exon is found in the present hMUC3 sequence (from nucleotides 182-297 inclusive, Fig. 2). This sequence is almost identical to nucleotides 1950-2063 of Genbank accession no. AF007196, described by Gum et al. as intronic sequence, except for two additional nucleotide insertions at positions 183 and 184 (Fig. 2).
  • a smaller, less abundant PCR product of 1073 bp (Genbank accession no. API 43372) was also readily identifiable in 9 of 10 colorectal cancer cell lines (band identified by lower arrow in Fig. 1).
  • the LoVo cell line was unusual in that it expressed this product almost exclusively. In repeated PCR reactions of the same cDNAs, this product was not always detected in PCR reactions from normal colonic cDNA and faint bands were only rarely seen in reactions with small intestinal cDNA. Sequence analysis of this PCR product generated from LoVo and normal colonic RNA confirmed it was as a result of specific priming of the forward and reverse hMUC3 cDNA primers.
  • hMUC3 has been described as containing a single EGF-like domain and lacking a transmembrane domain.
  • carboxy terminus of hMUC3 contains two EGF domains, a hydrophobic region consistent with a transmembrane domain, and a long cytoplasmic tail. This mucin is what we have termed "transmembrane MUC3".
  • MUC3 thus appears to be a transmembrane mucin and as such is only the third human membrane-anchored epithelial mucin to be described to date, along with MUC l and MUC4.
  • MUC l has been shown to be involved in cell signaling via multiple tyrosine phosphorylation sites on its highly conserved cytoplasmic tail (Zrihan-Licht et al. (1994)).
  • MUC3 possesses a cytoplasmic tail containing a YVAL sequence which is similar to motifs recognized by SH-2 domain- containing proteins (Songyang et al (1994)), suggesting that MUC3, like MUC l , could be involved in signal transduction.
  • an extracellular potential coiled-coil domain and two EGF-hke domains suggest roles in protein- protein interactions and ligand binding.
  • MUC3 Two alternative splice forms of MUC3 have been identified, their conceptual protein translations suggesting that they both could be secreted as they both lack a transmembrane domain.
  • the secreted isoforms of MUC3 may function as protective mucins, perhaps as a co-constituent with gel-forming mucins in mucus, or may act at the apical cell surface as a ligand for other cell surface molecules such as EGF- like growth factor receptors.
  • hMUC3 The carboxyl terminus of hMUC3 shows areas of high homology to the equivalent regions of both rat and mouse Muc3 proteins (Gum et al. (19 1), Khatri et al ( 1997), Shekels et al. (1998)). Extensive conservation of the two EGF-like domains (61% and 42% respectively) suggest they have been functionally important throughout evolution. Given the very high degree of conservation between the rodent proteins (81% amino acid identity), it is clear that rMuc3 and mMuc3 are orthologues. In contrast, the present hMUC3 conceptual protein has only 38% identity overall with the rodent proteins. Despite conservation of parts of the carboxyl terminus of hMUC3 with rMuc3 and mMuc3, it is likely that hMUC3 represents a closely related protein family member rather than the human orthologue of the rodent proteins.
  • the EGF-like domain in ASGP2 shows homology with the c-erbB-2 ligands (heregulins), and the first EGF-like domain in transmembrane hMUC3 shows conservation of cysteine residues and limited homology to a number of EGF receptor- binding growth factors such as TGFu, amphiregulin and betacellulin.
  • transmembrane MUC3 has a large cytoplasmic tail containing multiple potential serine and tyrosine phosphorylation sites consistent with a role in signal transduction,
  • Mucins have been implicated in the pathology of carcinomas as well as several non- malignant diseases such as cystic fibrosis and inflammatory bowel disease.
  • MUC3 has been reported to be downregulated in colorectal cancers (Ogata et al (1992), Chang et al (1994)); although the above results show that transmembrane MUC3 is expressed in 9/ 10 colorectal cancer cell lines.
  • a recent report has also described evidence for linkage between inflammatory bowel disease and markers on chromosome 7q22 (Satsangi et al (1996)).
  • MUC3 has therefore been proposed as a candidate susceptibility gene for this disease and preliminary evidence suggests a possible relationship between rare MUC3 alleles anil inflammatory bowel disease (Kyo et al. (1999)). Furthermore, alterations in mucins have been proposed as a primary event in the development of inflammatory bowel diseases (Rhodes (1997)).
  • Murine Muc3 (a closely related family member, but not the orthologue of human MUC3) has been shown to be a major constituent of the mucus that causes gastrointestinal obstruction in murine models of cystic fibrosis (Parmley et al (1998)). Detection of human transmembrane MUC3 in gastrointestinal or respiratory mucus samples and/or tissues may therefore be an important predictor of disease status and response to treatment in cystic fibrosis.
  • transmembrane mucin transmembrane MUC3. Isoforms of this mucin are also identified.
  • transmembrane MUC3 The applications of transmembrane MUC3 are numerous. One application is in the identification of ligands which bind transmembrane MUC3. Such ligands can either be stimulatory ligands in that they bind to and activate transmembrane MUC3 or inhibitory, in that they bind to but do not activate transmembrane MUC3.
  • Ligands which can be screened for may bind to the extracellular domain of transmembrane MUC3 or the cytoplasmic domain of transmembrane MUC3.
  • a polynucleotide encoding transmembrane MUC3 can be incorporated into cell lines (such as Chinese hamster ovary (CHO) cells) where the expressed protein is capable of producing a biological response or capable of binding potential ligands that are added.
  • cell lines such as Chinese hamster ovary (CHO) cells
  • antibodies particularly monoclonal antibodies, which are capable of functioning as stimulatory or inhibitory ligands.
  • Such antibodies can be produced as described above.
  • Such ligands have application in the modulation of transmembrane MUC3 function. Such modulation may involve either stimulation or inhibition of transmembrane MUC3 function.
  • transmembr-me MUC3 function may also be achieved with a soluble form of the extracellular domain of transmembrane MUC3, or a fragment of that domain to which a circulating stimulatory ligand binds.
  • a soluble protein can be prepared using the same techniques as for transmembrane MUC3 itself.
  • the soluble extracellular domain of transmembrane MUC3 also has application in the modulation of the function of non-MUC3 proteins which include equivalent ligand binding domains.
  • Such proteins include members of the c-erb family, with inhibitory modulation being achieved through the use of the extracellular domain of transmembrane MUC3 or a molecule which mimics the conformation of the region of the extracellular domain which binds the ligand (such as an anti-idiotypic antibody).
  • the antibodies of the invention have application in prognostic or diagnostic protocols.
  • the antibodies can be employed to detect transmembrane MUC3 in respiratory mucus and/or tissues from individuals with respiratory conditions such as chronic bronchitis, asthma and cystic fibrosis for the purpose of predicting disease severity and/or prognosis and/or responsiveness to treatment.
  • optionally labelled antibodies can be employed in methods of detecting transmembrane MUC3 in gastrointestinal mucus and/ or tissues of patients with cystic fibrosis.
  • the antibodies, optionally labelled can be employed to detect transmembrane MUC3 in the serum of patients with cancers of epithelial origin, or in patients with other conditions in which this form of MUC3 is found in the serum.
  • nucleotide probes or primers as described above in such applications.
  • mutations or allelic variations in DNA encoding transmembrane MUC3 will be representative of a predisposition to colorectal cancer and/or inflammatory bowel disease as well as for providing prognostic or predictive information relating to the outcome, severity or responsiveness to treatment of a patient suffering from such a disease.
  • Such mutations or allelic variations can be identified using antibodies as defined above or, more usually, by screening protocols performed at the nucleic acid level.
  • “Mutation of a transmembrane MUC3 gene” encompasses all forms of mutations including deletions, insertions and point mutations in the coding and noncoding regions. Point mutations may result in stop codons, frameshift mutations or amino acid substitutions.
  • Detection of point mutations may be accomplished by molecular cloning of the transmembrane MUC3 allele(s) and sequencing that allele(s) using techniques well known in the art.
  • the gene sequences can be amplified, using polynucleotide amplification techniques, directly from a genomic DNA preparation from the sample tissue.
  • the amplification techniques which can be used include methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-bela replicase. These methods are well known and widely practised in the art.
  • Transmembrane MUC3 sequences generated by amplification may be sequenced directly.
  • the amplified sequence(s) may be cloned prior to sequence analysis.
  • a method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf, 1986.
  • SSCA single stranded confirmation analysis
  • DGGE denaturing gradient gel electrophoresis
  • RNase protection assays Finkelstein et al, 1990; Kinsler et al, 1991
  • ASO's allele-specific oligonucleotides
  • DNA probes can be used to detect mismatches, through enzymatic or chemical cleavage. See, eg., Shenk et al, 1975; Novack et al clove 1986.
  • mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes. See eg. Cariello, 1988.
  • riboprobes or DNA probes the cellular mRNA or DNA which might contain a mutation can be amplified using PCR before hybridization. Changes in DNA of the transmembrane MUC3 gene can also be detected using Southern hybridization, especially if the changes are gross rearrangements, such as deletions and insertions.
  • Mutations from potentially susceptible patients falling outside the coding region of transmembrane MUC3 can be detected by examining the non-coding regions, such as introns and regulatory sequences near or within the transmembrane MUC3 gene.
  • non-coding regions such as introns and regulatory sequences near or within the transmembrane MUC3 gene.
  • An early indication that mutations in noncoding regions are important may come from Northern blot experiments that reveal messenger RNA molecules of abnormal size or abundance in patients as compared to control individuals.
  • Antibodies specific for products of transmembrane MUC3 mutant alleles could also be used to detect mutant transmembrane MUC3 gene product. Such antibodies can be produced in equivalent fashion to the antibodies for transmembrane MUC3 as described above.

Abstract

The invention relates to a transmembrane mucin, which is transmembrane MUC3. Methods of diagnosis involving detection of transmembrane MUC3 are also provided.

Description

MUCIN
This invention relates to a transmembrane mucm. More particularly, it relates to a transmembrane variant of MUC3.
BACKGROUND
Epithelial mucins are large glycoproteins characterized by a central polymorphic tandem repeat structure with a large number of O-hnked carbohydrate side chains. Ten human epithelial mucm genes have been identified, though due to their large size and tandem repeat nature, full-length cDNA clones are available for only 5 of these genes (Seregni et al (1997)).
Many human mucin genes appear to encode secreted proteins which protect and lubricate epithelial tissues by forming a layer of viscoelastic gel. However, two human membrane-anchored epithelial mucins have been identified to date The MUC1 mucin is expressed by almost all human glandular epithelial cells and has a distinct role in adhesion modulation and intracellular signaling (Gendler et al. (1991)). The second transmembrane mucin to be reported, MUC4, is also widely distributed in human epithelial tissues. MUC4 and its rat orthologue, ASGPl/2, contain two extracellular cysteine-rich EGF- ke domains after a large mucin-like tandem repeat domain (Sheng et al (1992), Moniaux et al. (1999)) The cysteine-nch region is followed by a transmembrane domain and a cytoplasmic tail containing a potential tyrosine phosporylation site. The functional significance of EGF-like domains is unclear, however, they may allow exposure of Iigand-binding sites on the exterior regions of a tπ-lobed structure formed by disulfide bridging ot the core 6 cysteine residues. Such motifs are found in several growth iactors and in numerous extracellular proteins involved in formation of the extracellular matrix, cell adhesion, chemotaxis and wound healing (Campbell et al. (1993)). Association of rat ASGPl/2 with the c-erbB-2 growth factor receptor and consequent modulation of receptor function has been demonstrated (Mcneer et al ( 1998)), implicating the EGF-hke domain-containing transmembrane mucins in growth modulation
MUC3, located on human chromosome 7q22, encodes an intestinal mucm expressed by goblet and absorptive cells. It has previously been reported to contain a single cysteine-rich EGF-like domain at its carboxyl-terminus and to lack a transmembrane domain, suggesting it could be a secreted mucin (Gum et al (1997)). Two rodent genes, encoding rMuc3 and mMuc3, have been designated Muc3 due to their location on the syntenic regions to human chromosome 7, their expression in intestine and their weak homology with MUC3. Although the EGF-like domain of hMUC3 is similar to one of the EGF-like domains of the rodent proteins, overall the hMUC3 carboxy terminus shows limited homology to the rodent proteins (34%), suggesting that hMUC3 may not be the orthologue of rat and mouse Muc3.
What the applicants have now surprisingly found is that there exists a transmembrane variant of the secreted mucin previously called MUC3. It is broadly towards this transmembrane mucin that the present invention is directed.
SUMMARY OF INVENTION
In a first aspect, the invention can broadly be said to consist in a glycoprotein which contains a cytoplasmic tail, transmembrane domain, an N-glycosylated region containing a coiled coil domain and two distinct EGF-like extracellular domains, which glycoprotein includes at least one of the following amino acid sequences;
(a) V V E T E V G M Ξ V S V D Q Q F S P D L N D . T S Q A Y R D
F N K T ' W N Q M Q K I F Λ D M Q G F T F K S V E I L S L R N G S I V V D Y L V L L E M F F S P Q L E S E Y I-. Q V K T T K E G Q N A S Q D V N 5 C Q D S Q T L C F K P D S I K V N N N S K T E L T P A A I;
(b)
(c) C R R A A P T G Y E E F Y F P L V E A T R L R C V T K C T S G V D N A I D C H Q G Q C V E T S G P T C R C Y S T D T H W F S G P R C; or
( ) A V R S G W W G G Q R R G R S W D Q D R K W F E Γ W D E E V
V G T F S N W G F S D D G T D K D T N F Y V A E N V D T T M V H I K R P E M T S S S V. In a further aspect, the present invention provides a glycoprotein which comprises the following amino acid sequence:
C D N G G T W E Q G Q C A C L P G F S G 20
D R C Q L Q T R C Q N G G Q D G L K C 40 Q C P S T F Y G S S C E F A V E Q V D 60
D V V E T E V G M E V S V D Q Q F 5 P D 80
L N D N T S Q A Y R D F N K T F W N Q M 100
Q K I F A D M Q G F T F K G V E I L S L 120
R N G S I V V D Y L V L L E M P F S P Q 140 L E S E Y E Q V K T T L K E G L Q A S 160
Q D V N S C D S Q T L C F K P D S I K 180
V N N N S K T E L T P A A I C R R A P 200
T G Y E E F Y F P L V E A T R L R C V T 220
K C T S G V D N A I D C H Q G Q C V L E 240 T S G P T C R C Y S T D T H W F S S P R 260
C E V A V H W R A L V G G L T A G A A L 280
L V L L L L A L G V R A V R S G W G G 300
Q R R G R S W D Q D R K W F E T W D E E 320
V V G T F S N W G F D D G T D K D T N 340 F Y V A L E N V D T T M K V H I K R P E 360
M T S S S V 366
or a functionally equivalent variant thereof.
In still a further embodiment, the invention provides a glycoprotein which comprises the following amino acid sequence:
C D N S G T W E Q G Q C A C L P G F S G 20
D R C Q L Q T R C Q N G G Q W D G L K C 40 Q C P S T F Y G S S C E F A V E Q V D L 60
D V V E T E V G M E V S V D Q Q F S P D SO
L N D N T S Q A Y R D F N K T F W N Q M TOO
Q K I F A D M Q G F T F K G V E Ϊ L S I. '120
R N G S I V V D Y L V L L E M P F S P Q 140 L E 3 E Y E Q V K T T L K E G L Q N A S 160
Q D V N S C Q D S Q T L C F K P D 5 I K 160
V N N N S K T E L T P A A I C R R A A P 200
T G Y E E F Y F P V E A T R L R C V T 220
K C T S G V D N A i: D C H Q G Q C V L E 240 T S G P T C R S W D Q D R K W F E T W D 260
E E V V G T F S N W G F E D D G T D K 280
T N F Y V A L E N V D T T M K V H I K R 3G0
P E M Γ S S S V 3ca
or a functionally equivalent variant thereof.
In still a further embodiment, the invention provides a polynucleotide which encodes a glycoprotein as defined above.
In one embodiment, said polynucleotide has the following sequence:
1 TGTGACAA GGTGGCACCTGGGAACAGGGCCAGTGTGCTTGCCTTCCG GGGTTTTCTGGG
61 GACCGCTGTCAGCTCCAGACCAGATGCC:AGAARGCGGGTCAGTGCGATGGCCTCAAA.TGC
121 CAGTGCCCCAGCACCTTCTATGGTTCCAGTTGΓGAGTTTGCTGTGGAACAGG GGATCTA l ei GATGTAGTGGAGACCGAGGTGGGCATGGAAGTGTCTGTGGATCAGCAGTTCTCGCCGGAC
2 1 CTCAATGACAACACTTCCCAGGCCTACAGGGATTTCAACAAGACCTTCTGGAATCAGATG
301 CAGAAGATTTTTGCAGACATGCAGGGCTTCACCTTCAAGGGTGTGGAGATCCTGTCCCTG
361 AGGAATGGCAGCATCGTGGTGGACTACCTGGTCCTGCTGGAGATGCCCTTCAGCCCCCAG
42 CTGGAGAGCGAGTATGAGCAGGTGAAGACCACGCTGAAGGAGGGGCTGCAGAACGCCAGC 4 Bi CAGGATGTGAACAGCTGCCAGGACTCCCAGACCCTGTGTTTTAAGCCTGACTCCATCAAG
5 GTGAACAACAACAGCAAGACAGAGCTGACCCCGGCAGCCATCTGCCGCCGCGCCGCTCCC
601 ACGGGCTATGAAGAGTTCTACTTCCCCTTGGTGGAGGCCACCCGGCTCCGCTGTGTCACC
661 AAATGCACGTCGGGGGTGGA ACGCCATCGACTGTCACCAGGGCCAGTGCGTTCTGGAG
721 ACGAGCGGTCCCACGTGTCGCTGCTACTCCACCGACACGCACTGGTTCTCTGGCCCGCGC 781 TGCGAGGTGGCCGTCCACTGGAGGGCGGTGGTCGGGGGCCTGACGGCCGGCGCCGCGCTG
841 CTGGTGCTGCTGCTGCTGGCGCTGGGCGTCCGGGCGGTGCGCTCCGGATGGTGGGGCGGC
90.. CAGCGCCGAGGCCGGTCCTGGGACCAGC-ACAGGAAATGGTTCGAGACCTGGGATGAGGAA
961 GTCGTGGGCACTTTTTCAAACTGGGGTTTCGAGGACGACGGAACAGACAAGGATACAAAT
1021 TTCTATGTGGCCTTGGAGAACGTGGACACCACTATGAAGGTGCACATCAAGAGACr.GGAG 1081 ATGACCTCGTCCTCAGTG or a functionally equivalent variant thereof.
In a further embodiment, the invention also provides a polynucleotide which has the following sequence:
1 TGTGACAATGGTGGCACCTGGGAACAGGGCCΛGTGTGCTTGCCTTCCGGGGTTTTCTGGG
6i GACCGCTCTCAGCTCCAGACCAGATGCCAGAATGGGGGTCAGTGGGATGGCCTCAAATGC
121 CAGTGCCCCAGCACCTTCTATGGTTCCAGTTGTGAGTTTGCTGTGGAACAGGTGGATCTA
181 GATGTAGTGGAGACCGAGGTGGGCATGGAAGTGTCTGTGGATCAGCAGTTCTCGCCGGAC 241 CTCAATGACAACACTTCCCAGGCCTACAGGGATTTCAACAAGACCTTCTGGAATCAGATG
301 CAGAAGATTTTTGCAGACATGCAGGGCTTCACCTTCAAGGGTGTGGAGATCCTGTCCCTG
361 AGGAATGGCAGCATCGTGGTGGACTACCTGGTCCTGCTGGAGATGCCCTTCAGCCCCCAG 21 CTGGAGAGCGAGTATGAGCAGGTGAAGACCACGCTGAAGGAGGGGCTGCAGAACGCCAGC
481 CAGGATGTGAACAGCTGCCAGGACTCCCAGACCCTGTGTTTTAAGCCTGACTCCATCAAG 5 1 GTGAACAACAACAGCA7GACAGAGCTGACCCCGGCAGCCATCTGCCGCCGCGCCGCTCCC
601 ACGGGCTATGAAGAGTTCTACTTCCCCTTGGTGGAGGCCACCCGGCTCCGCTGTGTCACC
661. .^AATGCACGTCGGGGGTGGACAACGCCATCGACTGTCACCAGGGCCAGTGCGTTCTGGAG
721 ACGAGCGGTCCCACGTGTCGGTCCTGGGACCAGGACAGGAAATGGTTCGAGACCTGGGAT
781 GAGGAAGTCGTGGGCACTTTTTCAAACTGGGGTTTCGAGGACGAGGGAACAGACAAGGAT 841 ACAAATTTCTATGTGGCCTTGGAGAACGTGGACACCACTΛTGAAGGTGCACATGAAGAGA
901 CCCGAGATGACCTCGTCCTCAGTG
or a functionally equivalent variant thereof.
In yet a further embodiment, the present invention provides antibodies which bind to a glycoprotein as defined above but which do not bind to the secreted mucin described by Gum et al, (1997).
In specific embodiments, antibodies are provided which bind to a peptide selected from the following, or to any overlapping sequences of these contiguous peptides:
(a) V V E E V G M E V S V D Q Q F S P D L N D N T S Q A Y R D
F N K T F W N Q M Q K I F A D M Q G F T F K G V E I L S L R N G S I V V D Y L V L L E M P F S P Q L E S E Y E Q V K T
T L K E G L Q N A 5 Q V N S C Q D S Q T L C F K P D S I K V N N N S K T E L T P A A I;
(b) A L V G G L T A G A A L L V L L L L A L G V R; (c) A V R S G W W G G Q R R C- R S W D Q D R K W F E T W D E E V V G T S N G F E D D G T D K D T N F Y V A L E V D T M K V H I R P E M T S S S V;
(d) C R R A A P T G Y Ξ E F Y F P L V E A T R L C V T K C T S
G V D N A I D C H Q G Q V L E T S G P T C R C Y Ξ T D T H W F S G P R C; or
(e) C R R A A P T G Y E E f Y F P L V E A R L R C V T K C T S G V D N A I D C H Q G Q C V L E T S G P T C R S D Q D R K
W F E T W D E E VV G F S N W G F E D D G T D K D T N F Y VA L E V D T T M K V H I K R P E M T S S S V.
In another aspect, the invention provides a probe comprising a nucleic acid molecule sufficiently complementary with a polynucleotide as defined above, or its complement, to bind under stringent conditions,
In still a further aspect, the invention provides a method of detecting a predisposition to colorectal cancer and/ or inflammatory bowel disease, and/ or for prediction of the outcome, and/or severity, and/ or responsiveness to treatment of these diseases, which employs an antibody or a probe as defined above.
In still a further aspect, the invention provides a method of detecting transmembrane MUC3 in respiratory mucus and/or tissues from individuals with respiratory conditions such as chronic bronchitis, asthma and cystic fibrosis, employing an antibody or a probe as defined above, for the purpose of predicting disease severity, and/ or prognosis, and/or responsiveness to treatment.
In still a further aspect, the invention provides a method of detecting transmembrane MUC3 in the serum of patients with cancers of epithelial origin (for example cancers of the gastrointestinal tract, respiratory tract, reproductive tracts and breast) as a method of detecting the presence of cancer, and/ or diagnosing a specific cancer, and/or responsiveness to treatment, and/or predicting prognosis using an antibody or a probe as defined above.
tn still a further aspect, the invention provides a method of detecting transmembrane MUC3 in gastrointestinal mucus and/or tissues of patients with cystic fibrosis for the purpose of predicting disease severity and/ or prognosis and/ or responsiveness to treatment which employs an antibody or a probe as defined above.
In yet a further aspect, the invention provides a method of testing to detect whether a human subject is predisposed to colorectal cancer which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane UC3, wherein the presence of an alteration is indicative of a predisposition to colorectal cancer.
In another aspect, the invention provides a method of testing to detect whether a human subject is predisposed to inflammatory bowel disease (IBD) which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane MUC3, wherein the presence of an alteration is indicative of a predisposition to IBD.
Conveniently, the presence or absence of an alteration is determined by analysis of DNA coding for transmembrane UC3, such as by comparing the sequence of DNA from a sample from said subject with the DNA sequence coding for wild-type transmembrane MUC3.
Alternatively, the presence or absence of an alteration is determined by analysis of mRNA transcribed from DNA encoding transmembrane MUC3, such as by comparing the sequence of RNA from a sample from said subject with the mRNA sequence transcribed from DNA coding for wild- type transmembrane MUC3.
Yet a further possibility is that the presence or absence of an alteration is determined by analysis of the amino acid sequence of the expressed transmembrane MUC3 protein.
BRIEF DESCRIPTION OF THE DRAWINGS
While the invention will be understood to be broadly as defined above, it will also be appreciated that it is not limited thereto but that it also includes embodiments of which the description which follows provides examples. In addition, a better understanding of the invention will be gained by reference to the accompanying drawings in which:
Figure 1. RT-PCR showing amplification of HMUC3 mRNA transcripts from normal colonic mucosa (NC), small intestine (SI) and 10 colorectal cancer cell lines. M denotes molecular size markers Note that the 1247 bp product encoding the transmembrane form ot MUC3 is the major product in normal intestinal tissues and in 8/9 cell lines showing MUC3 expression. Although the 1073 bp product was seen in all nine MUC3 expressing lines, it was the dominant form expressed by only one cell line, LoVo. The 1 131 bp product representing the previously described MUC3 carboxyl terminus was not readily visible in any of the PCR reactions using normal intestinal RNA and RNA from colorectal cancer cell lines.
Figure 2. Expression of transmembrane MVC3 in 13 breast cancer cell lines determined by semi-quantitative RT-PCR. The loading control is Bs-microglobulin denoted by B2MG and the molecular weight marker is denoted by Η' After 38 rounds of amplification, MUC3 expression was identified in 5/ 13 breast cancer cell lines under investigation; at low levels m MDA- B-4S3, SKBR3, UACC893 and ZR- 75- 1 cell lines and at higher levels in MCF7 which has previously been reported to express MUC3.
Figure 3. DNA sequence and predicted amino acid sequence of h UC3.
Numbering of nucleotides is given on the left and amino acids on the right Five potential N-glycosylation sites are shown m italic, the transmembrane region is smgly underlined and two cysteine-rich EGF-like domains are double underlined. A potential coiled-coil region is in bold. The alternatively spliced regions are marked by arrows. The stop codon is denoted by an asterisk.
Figure 4. Amino acid sequence alignment of the carboxyl termini of hMUC3 (amino acids 1-366) (Fig. 5), rMuc3 (Gum et a (1991), Khatri et at. (1997)) (amino acids 356-447 and 1-379 respectively), rnMuc3 (Shekels et al. (1988)) (amino acids 637-1015) grouped according to functional domains. Shading demonstrates identity of hMUC3 with the rodent proteins. Hyphens indicate gaps inserted to optimize the alignment. DESCRIPTION OF THE INVENTION
As described above, the primary focus of the present invention is on a human transmembrane mucin. This mucin is a variant of the secreted human mucin previously referred to as MUC3 and is referred to herein as "transmembrane MUC3".
Transmembrane MUC3 has been established as including a cytoplasmic tail, transmembrane domain, an N-giycosylated region containing a coiled coil domain and two distinct EGF-like extracellular domains. The DNA sequence and predicted amino acid sequence of transmembrane MUC3 is shown in Figure 2.
Specific amino acid sequences include:
(a) V V E T E V G M E V S V 3 Q Q F S P D L N D N T S Q A Y R D F N K T F N Q M Q K I F A M Q G F T F K G V E I L S L R
N G S I V V D Y L V L L E M P F S P Q L E S S Y E Q V K T T L E G L Q N A S Q D V N S C Q D S Q T L C F K P D S I K V N N N 3 K T E L T P A A I (representing an N-glycosylated region containing a coiled coil domain) ;
(b) A L V G G L T A G A A L L V L L L L A G V transmembrane domain) ;
(c) C R R A A P T G Y E E F Y F P L V E A T R L C V T K G T S G V D N A I D C H Q G Q C V L E T S G P T C R C Y S T D T H
W F 3 G P R C (an EGF-like extracellular dom in); or
(D) AV R S GW W G G Q RR G R S W D Q D R K W F E T W D E^E V V G T F S N W G F E D D G D K D T N F Y VA L E N V D'T T M K V H I K R P E M T S S S ta cytoplasmic tail) .
The invention also includes functional equivalents of transmembrane MUC3. Such functional equivalents can be a variant protein. A protein is considered a functional equivalent of another protein for a specific function if the equivalent protein is immunologically cross-reactive with, and has the same function as, the original protein. The equivalent may, for example, be a fragment of the protein, or a substitution, addition or deletion mutant of the protein. For example, it is possible to substitute amino acids in a sequence with equivalent amino acids using conventional techniques. Groups of amino acids known normally to be equivalent are:
(a) Ala(A) Ser(S) Thr(T) Pro(P) Gly(G);
(b) Asn(N) Asp(D) Glu(E) Gln(Q);
(c) His(H) Arg{R) Lys(K);
(d) Met(M) Leu(L) Ile(l) ValfV); and
(e) Phe(F) TyrfY) TrpfW).
Substitutions, additions and/ or deletions in transmembrane MUC3 may be made as long as the resulting equivalent protein is immunologically cross-reactive with, and has the same function as, the native transmembrane MUC3.
The equivalent transmembrane MUC3 will normally have substantially the same amino acid sequence as the native transmembrane MUC3. An amino acid sequence that is substantially the same as another sequence, but that differs from the other sequence by means of one or more substitutions, additions and/ or deletions is considered to be an equivalent sequence. Preferably, less than 25%, more preferably less than 10%, and most preferably less than 5% of the number of amino acid residues in the amino acid sequence of the native transmembrane MUC3 are substituted for, added to, or deleted from.
Functionally equivalent, polynucleotides which encode a protein having transmembrane MUC3 functionality are also contemplated.
Such equivalent, polynucleotides include nucleic acid sequences that encode proteins equivalent to transmembrane MUC3 as defined above. Equivalent nucleic acid molecules also include nucleic acid sequences that, due to the degeneracy of the nucleic acid code, differ from native nucleic acid sequences in ways that do not affect the corresponding amino acid sequences.
Functionally equivalent proteins and polynucleotides can also be identified with the assistance of computer algorithms that are publicly available. These include 3LASTN and BLASTP, which are accessible on the NCBI anonymous FTP server
(ftp://ncbi.nlm.nih.gov) under / blast /executables/. The use of the BLAST family of algorithms, including BLASTN and BLASTP, is described at NCBI's website at URL h p-// www.ncbi.nlm mh.goυ/ BLAST/ neivblas html and the publication of Altschul, Stephen F , et al. (1997).
Transmembrane MUC3 and its functional equivalents may be prepared by methods known in the art Such methods include protein synthesis from individual amino acids as described by Stuart and Young in "Solid Phase Peptide Synthesis", 2nd Edition, Pearce Chemical Company (1984). It is however preferred that transmembrane UC3 and/ or its functional equivalents be prepared by recombinant methods. Such methods involve insertion of polynucleotides encoding the desired protein into appropriate expression vectors using art standard techniques such as are descπbed m Sambrook et al , "Molecular Cloning", 2"d Edition, Cold Spring Harbour Laboratory, Cold Spring Harbour, New York (1987).
Antibodies to transmembrane MUC3 are also provided by this invention. Such antibodies can be polyclonal but will preferably be monoclonal antibodies. These can be raised to separate regions of transmembrane MUC3 to enable differential binding to various forms of MUC3. Specifically, antibodies can be raised against the cytoplasmic tail region, transmembrane domain, coiled coil domain and the two EGF-like extracellular domains.
Monoclonal antibodies with affinities of 10 " '1 or preferably 10-'' to 10-ιo IvH or stronger will typically be made by standard procedures as described, eg. in Harlow θc Lane ( 1988) or Goding (1986) Briefly, appropriate animals will be selected and the desired immunizauon protocol followed. After the appropriate period of time, the spleens of such animals are excised and individual spleen cells fused, typicaUy, to immortalised myeloma cells under appropriate selection conditions. Thereafter, the cells are cloπally separated and the supernatants of each clone tested for then- production of an appropriate antibody specific for the desired region of the antigen.
Other suitable techniques for preparing antibodies well known in the art involve in vitro exposure of lymphocytes to the antigenic polypeptides, or alternatively, to selection of libraries of antibodies in phage or similar vectors. Also, recombinant lmmunoglobulins may be produced using procedures known in the art (see, for example, US Patent 4,816,567 and Hodgson J. (1991)).
The antibodies may be used with or without modification. Frequently, antibodies will be labeled by joining, either covalently or non-covalently, a substance which provides for a detectable signal. A wide variety of labels and conjugation techniques are known and are reported extensively in the literature. Suitable labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like. Patents teaching the use of such labels include US Patents 3,817,837; 3,850,752; 3,939,350; 3,996,345; 4,277,437; 4,275, 149; and 4,366,241.
The immunological assay in which the antibodies are employed can involve any convenient format known in the art. Such formats include western blots, immunohistochemical assays and ELISA assays.
It will of course be appreciated that discrimination between, or quantification of, the isoforms of MUC3 can also be at the nucleic acid level. Further, the nucleic acid targeted can be mRNA or DNA.
Discrimination or quantification can be effected through the use of nucleotide probes. Such probes will be sufficiently complementary to part or all of the sequence of Figure 2, to bind under stringent conditions, with the precise sequence of the probe being dependent upon which of the MUC3 isoforms is to be detected, For example, nucleotide probes which target transmembrane MUC3 but not its other isoforms can include a sequence complementary to that coding for the transmembrane region or the cytoplasmic tail of transmembrane MUC3, whereas probes which target both secreted UC3 and transmembrane MUC3 can include a sequence complementary to that coding for the extracellular domain. Such probes can then carry differentiating labels, and the individual MUC3 isoforms identified with reference to the binding of one or both of the labelled probes (ie. one label only will indicate nucleic acid coding for secreted UC3 whereas both labels will indicate nucleic acid coding for transmembrane MUC3). Discrimination can also be through the use of a set of primers for amplifying nucleic acid. For example, primers can be selected to amplify nucleic acid encoding the transmembrane domain and/or cytoplasmic tail of transmembrane MUC3.
Aspects of the invention will now be described with reference to the following non- limiting experimental section.
EXPERIMENTAL
Materials and Methods
RNA Extraction
Total RNA was isolated from cell lines and tissues listed below by the method of Chomczynski and Sacchi (1987). Concentration and purity was determined by spectrophotometry at 260 and 280nm. The integrity of the RNA was assessed by denaturing agarose gel electrophoresis.
To didoxυn RT-PCR
RT-PCR was performed on total RNA isolated from two normal colonic mucosa samples, one small intestine sample and 10 colorectal cancer cell lines, Caco-2, LIM1215, LI 1899, HCT116, SW1 16, LoVo, LS 174T, M12SM, LISP- 1 and SW620. First strand cDNA synthesis was accomplished using 1 μg of total RNA. Tissue and cell line RNA was initially screened for MUC3 expression by performing PCR amplification of DNA in a total volume of 25 μl containing 0.5 μl of the first strand cDNA synthesis reaction products, 2.5 μl lOx PCR buffer, 0.2 mM dNTPs, 1.5 mM MgCl2, 20 pmol each of the forward and reverse primers, 5% DMSO and 1.25 U AmpliTaq gold (Perkin Elmer, Norwalk, CT). Based upon the published sequence of the partial hMUC3 cDNA (Genbank accession no. AF007194), gene-specϋϊc forward and reverse primers ( UC3F1; 5'-TGTGACAATGGTGGCACCTGG-3' and MUC3R1 ; 5'-GGGATTTGGGGGAACAGTCTC-3') were designed to produce a predicted PCR product of 1 126 bp.
PCR amplification conditions began with an initial denaturation step of 94°C for 10 min followed by a "touchdown" procedure (Don et al. (1991)). This involved 2 cycles each at annealing temperatures decreasing at 1° intervals from 68°C to 64°C (30 s), with denaturation at 94°C (45 s) and extension at 72°C (1 min). Then followed by 30 cycles of 94°C (45 s), annealing at 63°C (30 s) and extension at 72"C ( 1 min) were performed. PCR products were electrophoresed on 1% agarose, lx TBE gels and photographed. For sequencing purposes, PCR amplification was also performed using high fidelity Expand polymerase (Boehringer Mannheim, Roche Diagnostics, Mannheim, Germany).
Cloning and Sequencing
Amplified products from normal colonic and small intestinal mucosa, and from Caco-2 and LoVo cell lines were purified, cloned into pGEM-T (Promega Corporation, Madison, WI) and sequenced. cDNAs Were sequenced in a cycle sequencing reaction with 2.5 p ol of primer and 4 μl of BigDye reaction mix (DNA Cycle Sequencing Kits, Perkin-Elmer) in a total volume of 10 μl. Cycling reactions were as follows: 25 cycles of denaturation at 96°C (30 s), primer annealing at 50°C (15 s) and extension at 60°C (4 min). Unincorporated nucleotides were removed by isopropanol precipitation. Products were analysed on a Model 377A automated DNA sequencer (PE Applied Biosystems). Sequences were analysed by multiple sequence similarity searches using BLAST algorithms (Altschul et al. (1990)) accessed through the National Centre of Biotechnology Information (NCQl;http;//www.ncbi.nlm.nih.goιή.
Computer Analysis of Protein Sequences
Examination of protein sequences for potential structural domains was performed using ExPASy sequence analysis programs accessed through http:/ www. expasy. chj tools/.
Results
Identification by RT-PCR of 1247 bp, 1131 bp and 1073 bp PCR products
In PCR reactions with RNA from normal colon, small intestine and 8 of 10 colorectal cancer cell lines (Caco-2, LIM1899, LIM1215, LS174T, HCT1 16, SW1 16, KM12SM, and LΪSP-1), an abundant PCR product of 1247 bp was observed (band identified by upper arrow in Fig. 1), in contrast to the predicted 1126 bp PCR product expected from the previously published hMUC3 sequence. The SW620 cell line did not express MUC3. Sequence analysis of this PCR product generated from normal small intestinal, and colonic and Caco-2 RNA, confirmed its sequence was amplified as a result of specific priming of the forward and reverse hMUC3 cDNA primers. The DNA sequence and conceptual protein translation of this product (Genbank accession no. AF 143371) is shown in Fig. 2 and differs from that reported by Gum et al. in several respects. Firstly, an additional previously unrecognized exon is found in the present hMUC3 sequence (from nucleotides 182-297 inclusive, Fig. 2). This sequence is almost identical to nucleotides 1950-2063 of Genbank accession no. AF007196, described by Gum et al. as intronic sequence, except for two additional nucleotide insertions at positions 183 and 184 (Fig. 2). Secondly, there are 5 single nucleotide deletions in the original sequence (at positions 3026, 3254, 3269, 3479 and 3538 of Genbank accession no. AF007194) corresponding to nucleotides 589, 818, 834, 1045 and 1 105 respectively of the new hMUC3 cDNA sequence shown in Fig. 2. Thirdly, the hMUC3 cDNA presented here contains 2 nucleotide substitutions (GC rather than CG) at positions 855 and 856 (Fig. 2).
Computer analysis revealed conceptual protein translation of this cDNA to contain two cysteine-rich EGF-like domains (amino acid positions 1-51 and 195-261 in Fig. 2) separated by an N-glycosylated domain and a coiled-coil region (amino acids 138- 169 in Fig. 2), followed by a transmembrane domain (amino acids 269-291 in Fig. 2), containing 23 hydrophobic or uncharged amino acids, and a cytoplasmic tail of 75 amino acids at the carboxyl terminus (amino acids 292-366 in Fig. 2). A YVAL motif in the cytoplasmic tail (at amino acid positions 342-345 in Fig, 2) is similar to specific motifs recognised by SH-2 domain-containing proteins (Songyang et al. (1994)).
Sequencing of one of eight clones derived from an extracted band containing the 1247 bp PCR product from small intestinal RNA, revealed an 1 131 bp product (Genbank accession no. AF 143373) almost identical to the previously described MUC3 sequence except for the 5 single nucleotide insertions reported above. The conceptual translation of this splice form (generated by deleting the sequence between the first two arrow heads in Fig. 2) is as previously described by Gum et al. and due to a shift in the open reading frame, results in a product with a different carboxyl terminus to the predominant isoform described above.
A smaller, less abundant PCR product of 1073 bp (Genbank accession no. API 43372) was also readily identifiable in 9 of 10 colorectal cancer cell lines (band identified by lower arrow in Fig. 1). The LoVo cell line was unusual in that it expressed this product almost exclusively. In repeated PCR reactions of the same cDNAs, this product was not always detected in PCR reactions from normal colonic cDNA and faint bands were only rarely seen in reactions with small intestinal cDNA. Sequence analysis of this PCR product generated from LoVo and normal colonic RNA confirmed it was as a result of specific priming of the forward and reverse hMUC3 cDNA primers. A section of sequence, from nucleotides 740-914, was found to be spliced out of this transcript resulting in removal (between the third and fourth arrow heads in Fig. 2) of the latter part of the second EGF-like domain and the entire transmembrane region from the conceptual translation product.
Amino acid sequence alignment of the C-terminal human hMUC3, r uc3 and mMuc3 is shown in Fig. 3. Conservation of the cysteine spacing between the hMUC3 and rodent Muc3 proteins is observed in both EGF-like domains. The hMUC3 C- terminal amino acid sequence was found to have 38% overall identity with rat and mouse Muc3.
Discussion
Previously, hMUC3 has been described as containing a single EGF-like domain and lacking a transmembrane domain. Using RT-PCR, we have established that the carboxy terminus of hMUC3 contains two EGF domains, a hydrophobic region consistent with a transmembrane domain, and a long cytoplasmic tail. This mucin is what we have termed "transmembrane MUC3".
The discrepancies between the C-terminal amino acid sequence we have described and that described by Gum et al. previously are due to an additional exon and five single base pair insertions. The previously described sequence was assembled from several clones with little overlapping sequence (a genomic clone named GM3- 1; a cDNA clone named clone20 and a 3' RACE PCR product; both of the latter being generated from small intestine). Much of the previously reported 3' sequence of hMUC3 relies on the accuracy of a single clone. Sequence analysis has revealed we have derived an identical 1247 bp PCR product from three different sources of RNA using high stringency RT-PCR. The amplification of the alternative splice form of MUC3 lacking a transmembrane domain ( 1073 bp), was not consistently expressed in the colonic tissue-derived RNA sample, and not seen in PCR reactions generated from small intestinal RNA, suggesting the newly described MUC3 transcript encoding a transmembrane mucin represents the major form of hMUC3 produced in the intestine. An 113 1 bp PCR product representing the previously described MUC3 carboxyl terminus was isolated from small intestinal RNA. This product was not readily visible under the present stringent PCR conditions and suggests this transcript is relatively rare.
MUC3 thus appears to be a transmembrane mucin and as such is only the third human membrane-anchored epithelial mucin to be described to date, along with MUC l and MUC4. MUC l has been shown to be involved in cell signaling via multiple tyrosine phosphorylation sites on its highly conserved cytoplasmic tail (Zrihan-Licht et al. (1994)). At its carboxyl terminus, MUC3 possesses a cytoplasmic tail containing a YVAL sequence which is similar to motifs recognized by SH-2 domain- containing proteins (Songyang et al (1994)), suggesting that MUC3, like MUC l , could be involved in signal transduction. Furthermore an extracellular potential coiled-coil domain and two EGF-hke domains suggest roles in protein- protein interactions and ligand binding.
Two alternative splice forms of MUC3 have been identified, their conceptual protein translations suggesting that they both could be secreted as they both lack a transmembrane domain. The secreted isoforms of MUC3 may function as protective mucins, perhaps as a co-constituent with gel-forming mucins in mucus, or may act at the apical cell surface as a ligand for other cell surface molecules such as EGF- like growth factor receptors.
The carboxyl terminus of hMUC3 shows areas of high homology to the equivalent regions of both rat and mouse Muc3 proteins (Gum et al. (19 1), Khatri et al ( 1997), Shekels et al. (1998)). Extensive conservation of the two EGF-like domains (61% and 42% respectively) suggest they have been functionally important throughout evolution. Given the very high degree of conservation between the rodent proteins (81% amino acid identity), it is clear that rMuc3 and mMuc3 are orthologues. In contrast, the present hMUC3 conceptual protein has only 38% identity overall with the rodent proteins. Despite conservation of parts of the carboxyl terminus of hMUC3 with rMuc3 and mMuc3, it is likely that hMUC3 represents a closely related protein family member rather than the human orthologue of the rodent proteins.
Following the identification of the transmembrane hMUC3 gene, and the recent clonmg of MUC4, it appears that there is a distinct subfamily of epithelial mucins with a conserved C-terminal domain structure. Data concerning functions of this mucin subfamily are restricted to studies of the rat MUC4 orthologue (ASGPl/2), or the rat sialomucin complex. The ASGP2 isoforra which contains EGF-like domains but lacks a mucin domain, has been shown in transfection studies to bind and activate the c-erbB-2 growth factor receptor, both in the presence and absence of the c-erbB-2 ligand, resulting m increased mitogenesis (Mcneer et al (1998)). In fact, the EGF-like domain in ASGP2 shows homology with the c-erbB-2 ligands (heregulins), and the first EGF-like domain in transmembrane hMUC3 shows conservation of cysteine residues and limited homology to a number of EGF receptor- binding growth factors such as TGFu, amphiregulin and betacellulin. In contrast to ASGP2 which has only a short cytoplasmic tail, transmembrane MUC3 has a large cytoplasmic tail containing multiple potential serine and tyrosine phosphorylation sites consistent with a role in signal transduction,
Mucins have been implicated in the pathology of carcinomas as well as several non- malignant diseases such as cystic fibrosis and inflammatory bowel disease. Specifically, MUC3 has been reported to be downregulated in colorectal cancers (Ogata et al (1992), Chang et al (1994)); although the above results show that transmembrane MUC3 is expressed in 9/ 10 colorectal cancer cell lines. A recent report has also described evidence for linkage between inflammatory bowel disease and markers on chromosome 7q22 (Satsangi et al (1996)). MUC3 has therefore been proposed as a candidate susceptibility gene for this disease and preliminary evidence suggests a possible relationship between rare MUC3 alleles anil inflammatory bowel disease (Kyo et al. (1999)). Furthermore, alterations in mucins have been proposed as a primary event in the development of inflammatory bowel diseases (Rhodes (1997)). Murine Muc3 (a closely related family member, but not the orthologue of human MUC3) has been shown to be a major constituent of the mucus that causes gastrointestinal obstruction in murine models of cystic fibrosis (Parmley et al (1998)). Detection of human transmembrane MUC3 in gastrointestinal or respiratory mucus samples and/or tissues may therefore be an important predictor of disease status and response to treatment in cystic fibrosis.
INDUSTRIAL APPLICATION
Thus, in accordance with the invention there is provided a transmembrane mucin, transmembrane MUC3. Isoforms of this mucin are also identified.
The applications of transmembrane MUC3 are numerous. One application is in the identification of ligands which bind transmembrane MUC3. Such ligands can either be stimulatory ligands in that they bind to and activate transmembrane MUC3 or inhibitory, in that they bind to but do not activate transmembrane MUC3.
Ligands which can be screened for may bind to the extracellular domain of transmembrane MUC3 or the cytoplasmic domain of transmembrane MUC3.
The design and implementation of a screening assay by which such ligands can be identified and characterised will be routine to those persons skilled in the art. By way of example, a polynucleotide encoding transmembrane MUC3 can be incorporated into cell lines (such as Chinese hamster ovary (CHO) cells) where the expressed protein is capable of producing a biological response or capable of binding potential ligands that are added.
The art skilled worker will also recognise that it will be possible to produce antibodies, particularly monoclonal antibodies, which are capable of functioning as stimulatory or inhibitory ligands. Such antibodies can be produced as described above.
Such ligands have application in the modulation of transmembrane MUC3 function. Such modulation may involve either stimulation or inhibition of transmembrane MUC3 function.
Inhibition of transmembr-me MUC3 function may also be achieved with a soluble form of the extracellular domain of transmembrane MUC3, or a fragment of that domain to which a circulating stimulatory ligand binds. Such a soluble protein can be prepared using the same techniques as for transmembrane MUC3 itself.
The soluble extracellular domain of transmembrane MUC3 also has application in the modulation of the function of non-MUC3 proteins which include equivalent ligand binding domains. Such proteins include members of the c-erb family, with inhibitory modulation being achieved through the use of the extracellular domain of transmembrane MUC3 or a molecule which mimics the conformation of the region of the extracellular domain which binds the ligand (such as an anti-idiotypic antibody).
The antibodies of the invention have application in prognostic or diagnostic protocols. By way of example, the antibodies, optionally labelled, can be employed to detect transmembrane MUC3 in respiratory mucus and/or tissues from individuals with respiratory conditions such as chronic bronchitis, asthma and cystic fibrosis for the purpose of predicting disease severity and/or prognosis and/or responsiveness to treatment. Similarly, optionally labelled antibodies can be employed in methods of detecting transmembrane MUC3 in gastrointestinal mucus and/ or tissues of patients with cystic fibrosis. Similarly, the antibodies, optionally labelled, can be employed to detect transmembrane MUC3 in the serum of patients with cancers of epithelial origin, or in patients with other conditions in which this form of MUC3 is found in the serum.
It is equally practical to employ nucleotide probes or primers as described above in such applications.
The applicants also believe that mutations or allelic variations in DNA encoding transmembrane MUC3 will be representative of a predisposition to colorectal cancer and/or inflammatory bowel disease as well as for providing prognostic or predictive information relating to the outcome, severity or responsiveness to treatment of a patient suffering from such a disease. Such mutations or allelic variations can be identified using antibodies as defined above or, more usually, by screening protocols performed at the nucleic acid level.
"Mutation of a transmembrane MUC3 gene" encompasses all forms of mutations including deletions, insertions and point mutations in the coding and noncoding regions. Point mutations may result in stop codons, frameshift mutations or amino acid substitutions.
Detection of point mutations may be accomplished by molecular cloning of the transmembrane MUC3 allele(s) and sequencing that allele(s) using techniques well known in the art. Alternatively, the gene sequences can be amplified, using polynucleotide amplification techniques, directly from a genomic DNA preparation from the sample tissue. The amplification techniques which can be used include methods such as the polymerase chain reaction (PCR), ligation amplification (or ligase chain reaction, LCR) and amplification methods based on the use of Q-bela replicase. These methods are well known and widely practised in the art. See, eg., US Patents 4,683, 195 and 4,683,202 and Innis et al, 1990 (for PCR); and Wu et al, 1989 (for LCR). Reagents and hardware for conducting amplϋϊcaτion are commercially available.
Transmembrane MUC3 sequences generated by amplification may be sequenced directly. Alternatively, but less desirably, the amplified sequence(s) may be cloned prior to sequence analysis. A method for the direct cloning and sequence analysis of enzymatically amplified genomic segments has been described by Scharf, 1986.
There are numerous well known methods for confirming the presence of a susceptibility allele. These include: 1) single stranded confirmation analysis ("SSCA") (Orita et al, 1989); 2) denaturing gradient gel electrophoresis ("DGGE") (Wariell et al, 1990; Sheffield et al, 1989); 3) RNase protection assays (Finkelstein et al, 1990; Kinsler et al, 1991); 4) allele-specific oligonucleotides (ASO's) (Conner et al., 1983); 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein (Modrich, 1991); and 6) allele-specific PCR (Rano & Kidd, 1989). For allele-specific PCR, primers are used which hybridize at their 3' ends to a particular mutation. If the particular mutation is not present, an amplification product is not observed.
Other approaches which can also be used include the Amplification Refractory Mutation System (ARMS), as disclosed in European Patent Application Publication No. 0332435 and in Newton et al, 1989. In similar fashion, DNA probes can be used to detect mismatches, through enzymatic or chemical cleavage. See, eg., Shenk et al, 1975; Novack et al„ 1986. Alternatively, mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes. See eg. Cariello, 1988. With either riboprobes or DNA probes, the cellular mRNA or DNA which might contain a mutation can be amplified using PCR before hybridization. Changes in DNA of the transmembrane MUC3 gene can also be detected using Southern hybridization, especially if the changes are gross rearrangements, such as deletions and insertions.
Mutations from potentially susceptible patients falling outside the coding region of transmembrane MUC3 can be detected by examining the non-coding regions, such as introns and regulatory sequences near or within the transmembrane MUC3 gene. An early indication that mutations in noncoding regions are important may come from Northern blot experiments that reveal messenger RNA molecules of abnormal size or abundance in patients as compared to control individuals.
Antibodies specific for products of transmembrane MUC3 mutant alleles could also be used to detect mutant transmembrane MUC3 gene product. Such antibodies can be produced in equivalent fashion to the antibodies for transmembrane MUC3 as described above.
Early at-risk determination provides the opportunity for early intervention. Carriers of the mutation could choose to have prophylactic treatment. Testing also enables carriers to make important life decisions (eg. child bearing) and will provide the opportunity for pre-natal diagnosis. For non-carriers, testing will bring peace of mind and will remove the need for surveillance.
There is also the possibility of a curative or corrective approach using gene therapy. This will involve supplying wild-type transmembrane MUC3 function to an individual who carries mutant alleles. Supplying such a function, in the case of colorectal cancer, should suppress neoplastic growth of the recipient cells. The wild-type gene or a part of the gene may be introduced into cells within such an individual in a vector such that the gene remains extrachromosomal. In such a situation, the gene will be expressed by the cell from the extrachromosomal location. If a gene portion is introduced and expressed in a cell carrying a mutant allele, the gene portion should encode a part of the protein which is required for non-neoplastic growth of the cell. More usual is the situation where the wild-type gene or a part thereof is introduced into the mutant cell in such a way that it recombines with the endogenous mutant gene present in the cell. Such recombination requires a double recombination event which results in the correction of the gene mutation. Vectors for introduction of genes both for recombination and for extrachromosomal maintenance are known in the art, and any suitable vector may be used. Methods for introducing DNA into cells such as electroporation, calcium phosphate co-precipitation and viral transductjon are known in the art. Cells transformed with the wild-type gene can be used as model systems to study colorectal cancer remission and drug treatments which promote such remission.
It will also be appreciated by the art skilled worker that the above description is provided by way of example only and that the invention is in no way limited thereby.
REFERENCES
Seregni, E., Botti, C, Massaron, S., Lombardo, C, Capobianco, A , Bog , A , Bombardieri E. (1997) Tumori, 83, 625-632.
Gendler, S. J., Spicer, A. P., Lalani, E. N., Duhig, T , Peat N., Burchell, J , Pe berton, L., Boshell, M., Taylor-Papadimitriou, J (1991) Am Rev. Respir. Dis., 144, S42-S47.
Sheπg, S., Wu, K., Carraway, K L & Fregien, N. ( 1992) J. Bid Chem., 267, 16341- 16346
Moniaux, N., Noliet, S., Porchet, N , Degand, P , Laine, A., Aubert, J. P ( 1999) Biochem. J, 338, 325-333.
Campbell, I. D., Bork, P. (1993) Epidermal growth factor-like modules. Curr. Optn Struct. Biol, 3, 385-392.
Mcneer, R. R., Price-Schiavi, S. A., Komatsu, M., Fregien, N-, Carraway, C. A. C. & Carraway, K. L. (1998) Front. Bioscience, 2, 449-459.
Gum, J.R , Ho, J. J. L., Pratt, W. S., Hicks, J W., Hill, A S., Vinall, L. E., Roberton, A. M , Swallow, D M., Kim, Y. S. (1997) J. Biol Cliem., 272, 26678-26686
WiUiams, S J , McGuckiπ, M. A., Gotley, D. J. , Eyre, H., Sutherland, G , Antalis, T. M. (1998). Cancer Res. (in press).
Chomczynski, P., Sacchi, N (1987) Anal Biochem., 162, 156- 159.
Don, R. H., Cox, P. T , Wainwπght, B. J., Baker, K., Mattick, J. S. (1991) N.A.R., 19, 4008
Altschul, S. F , Gish, W., Miller, W., Myers, E. W., Lipman, D. J (1990) J. Mol Biol, 215, 403-410. Songyang, Z., Shoelson, S. E., McGlade, J., Olivier, P., Pawson, T., Bustello, X. R., Barbacid, M„ Sabe, H., Hanafusa, H-, Yi, T., Ren, R., Baltimore, D., Ratnofsky, S., Feldman, R. A. & Cantley, L. C. ( 1994) Mol Cell Biol, 14, 2777-2785.
Zrihan-Licht, S., Barυch, A., Elroy-Stem, O., Keydar, I., Wreschner, D. H. (1994) FEES Lett., 356, 130-136.
Wreschner, D. H., Hareuvini, M., Tsarfaty, I., Smorodinsky, N., Horev, J., Zaretsky, J., Kotkes, P., Weiss, M., Lathe, R., Dion, A. S., Keydar, I. (1990) Eur J. Biochem., 189, 463-473.
Zrihan-Licht, S., Vos, H. L., Baruch, A. , Elroy-Stein, O., Sagiv, D., Keydar, I., Hilkens, J., Wreschner, D. H. (1994) Eur. J. Cancer, 224, 787-795.
Gum, J. R. , Hicks, J. W., Lagace, R. , Byrd, J. C, Toribara, N. W., Siddiki, B., Feamey, F. J., Lamport, D. T., Kim, Y. S. (1991) J. Biol Chem., 266, 22733-22738.
Khatri, I. A. , Forstner, G. G., Forstner, J. F. (1997) Biochim. Biophys. Acta., 1326, 7-
1 1.
Shekels, L. L., Hunninghake, D. A., Tisdale, A. S., Gipson, I.K., Kieliszewski, M., Kαzak, C. A, Ho, S. B. (1998) Biochem. J., 330, 1301-1308.
Ogata, S., Uehara, H. , Chen, A., Itzkowitz, S. H. (1992) Cancer Res, 52, 5971-5978.
Chang, S., Dohrman, A. F., Basbaum, C. B. , Ho, S. B., Tsuda, T., Toribara, N» W., Gum, J. R. , Kim, Y. S. (1994) Gastroenterology, 107, 28-26.
Satsangi, J., Parkes, M., Louis, E., Hashimoto, L., Kato, N., Welsh, K., Terwilliger, J. D., Lathrop, G. M., Bell, J. I. , Jewell, D. P. (1996) Nature Genet, 14, 199-202.
Kyo, K., Parkes, M., Takei, Y., Nishimori, H., Vyas, P., Satsangi, J., Simmons, J., Nagawa, II., Baba, S. , Jewell, D., Muto, T., Lathrop, M., Nakamura Y. (1999) Hum. Mol. Gen, 8, 307-31 1. Rhodes, J.M. (1997) Q. J. Med. 90, 79-82.
Parmley, R.R. and Gendler, S.J. (1998) J. Clin. Invest 102, 1798- 1806.
Altschul, S. F., et al. (1997) Nucleic Adds Res. 25: 3389-3402
Harlow & Lane (1988) Antibodies: A Laboratory Manual, Cold Sprmg Harbour Press, 144.
Hodgson J (1991) Making Monoclonals in Microbes, Biotechnology 9:423-425.
Canello ( 1988). Human Genetics 42:726.
Conner, B J., et al ( 1983). Proc Nat Acad. Sci USA. 80:278-282.
Finkelstein, J., et al. (1990). Genomics 7: 167- 172.
Innis et al, (1990). PCR Protocols: A Guide to Methods and Applications, (Academic Press, San Diego).
Kinszler, K.W., et al, ( 1991). Science 251: 1366- 1370.
Modrich, P. (1991). Ann. Rev. Genet. 25.229-253.
Newton, C.R., Graham, A , Heptinstall, L.E., Powell, S.J., Summers, C, Kalsheker, N., Smith, J.C., and Markham, A.F (1989). Nucl. Adds Res. 17:2503- 2516.
Novack, et al, (1986). Proc. N t. Acad. Sά. USA 83:586.
Oπta, et al, ( 1989). Proc. Nat. Acad. Set. USA 86:276-2770.
Oπta, et l, (1989). Genomics 5:874-879.
Rano & Kidd (1989). Nucl Acids Res. 17.8392. Scharf (l86). Sdence 233: 1076.
Sheffield, V.C, et al, (1989). Proc. Nat. Acad. Sd. USA 86:232-236.
Shenk, et al., (1975). Proc. Nat. Acad. Sci. USA 72:989.
Wartell, R.M., et al., (1990). Nud. Acids. Res. 18:2699-2705.
Wu, et al., (1989a). Genomics 4:560-569.

Claims

1. A glycoprotein which contains a cytoplasmic tail, transmembrane domain, an N-glycosylated region containing a coiled coil domain and two distinct EGF-like extracellular domains, which glycoprotein includes at least one of the following amino acid sequences:
) V V E T E V G M E V S V D Q Q F S P D L N D N T S Q A Y R D
F N K T F W N Q M Q K I F A D M Q G F T F K G V E I L S L R N G S I V V D Y L V L L E M P F S P Q L E S E Y E Q V K T T
L K E G L Q N A S Q D V N S C Q D S Q T L C F K P D S I K V N N N S K T E L T P A A I;
(b) A L V G G L T A G A A L L V L L L L A G ;
(c) C R R A A P T G Y E E F Y F P L V E A T R L R C V T K C T S G V D N A I D C H Q G Q C V L E T S G P T C R C Y S T D T H W F S G P R C; or
(d) Λ V R S G W W G G Q R R G R S W D Q D R K W F E T W D E E V
V G F S N W G F E D D G T D K D T N F Y V A L Ξ N V D T T M K V H I K R P E M T S S S .
2. A glycoprotein which comprises the following amino acid sequence:
C D N G G T W E Q G Q C A C L P G F S G 20
D R C L Q. T R C Q N G G Q W D G L K C 40
Q C P S T F Y G S S C E F A V E Q V D L 6"0
D V V E T E V G M E V S V D Q Q F S P D 80 L N D N T S Q A Y R D F N K T F W N Q M 100
Q K I F A D M Q G F T F K G V E I L S L 120
R N G S I V V D Y L V L L E M P F S P Q 140
L E S E Y E Q V K T T L K E G L Q N A S 160
Q D 3 C Q D S Q T C K P D S I K 180 V N N N S K T E L T P A A I C R R A A P 200
T G Y E E F Y F P L V E A T R L R C V T 220 K C T S G V D N A I D C H Q G Q C V L E 240
T S G P T C R C Y S T D T H W F S G P R 2δ0
C E V A V H R A L V G G L T A G A A L 230
L V L L L L A L G V R A V R S G W G G 300 Q R R G R S W D Q D R K W F S T W U E Ξ 320
V V G T F S N W G F E D D G T D K D T 340
F Y V A L E N V D T T M K V H I K R P E 360
M T S S S V 366
or a functionally equivalent variant thereof.
3. A glycoprotein which compπses the following amino acid sequence:
C D N G G T W E Q G Q A C L P G F S G 20
D R C Q L Q T R C Q G G Q W D G L K C 40
Q C P S ' F Y G S S C E F A V E Q V D L 60
D V V E T E V G M E V S V D Q Q F S P D 80
L N D N T S Q A Y R D F N K T F W N Q M 100
Q K I F A D M Q G F T F K G E I L S L 120
R N G 5 l' V V D Y L V L L E M P F 5 P Q 140
L E S E Y E Q V K T T L K E G L Q N A S 160
Q D V N S C Q D S Q T L C F K P D S X K 180
V N N N S K T E L T P A A I C R R A A P 200
T G Y E E F Y F P L V E A T R L R C V T 22,0
K C T S G V D N A I D C H Q G Q C V E 240
T S G P C R S W D Q D R K W F T W D 260
E Ξ V V G T F S N W G F E D D G T D K D 280
T N F Ϊ V A L E N V D T T M K V H I K R 300
P E M T S S S V 308
or a functionally equivalent variant thereof.
4. A polynucleotide which encodes a glycoprotein as defined in claim 1.
5. A polynucleotide which has the following sequence:
1 TGTGACAATGGTGGCACCTGGGAACAGGGCCAGTGfGCTTGCCTTCCGGGGTTTTCTGGG
61 GACCGCTGTCAGCTCCAGACCAGATGCCAGAATGGGGGTCAGTGGGATGGCCTCAAATGC
] 1 AGTGCC CAGCACCTTCTATGGTTCCAGTTGTGAGTTTGCTGTGGAACAG3TGGATCTA 181 GATGTAGTGGAGACCGAGGTGGGCATGGAAGTGTCTGTGGATCAGCACTTCTCGCCGGAC
241 CTCAATGACAACACTTCCCAGGCCTACAGGGATTTCAACAA ACCT CTGGAATCAGATG
301 CAGAAGATTTTTGCAGACATGCAGGGCTTCACCTTCAAGGGTGTGGAGATCCTGTCCCTG
361 AGGAATGGCAGCATCGTGGTGGACTACCTGGTCCTGCTGGAGATGCCCTTCAGCCCCCAG 21 CTGGAGAGCGAGTATGAGCAGGTGAAGACCACGCTGAAGGAGGCGCTGCAGAACGCCAGC 481 CAGGATGTGAACAGCTGCCAGGACTCCCAGA'C TGTG TTTAAGCCTGACTCCATCAAG
5 1 GTGAACAACAACAGCAAGACAGAGCTGACCCCGGCAGCCATCTGCCGCCGCGCCGCTCCC
601 ACGGGCTATGAAGAGTTCTACTTCCCCTTGGTGGAGGCCACCCGGCTCCGCTCTGTCACC
661 ΛAATGCACGΓCGGGGGTGGACAACGCCATCGACTGTCACCAGGGCCAGTGCGTTCTGGAG
721 ACGAGCGGTCCCACGTGTCGCTGCTACTCCACCGACACGCACTGGTTCTCTGGCCCGCGC 781 TGCGAGGTGGCCGTCCACTGGAGGGCGCTGGTCGGGGGCCTGACCGCCCGCGCCGCGCTG
8 1 CTGGTGCTGCTGCTGCTGGCGCTGGGCCTCCGGGCGGTGCGCTCCGGATGGTGGGGCGGC
901 AGCGCCGAGGCCGGTCCTGGGACCAGGACAGGAAATGGTTCGAGACCTGGGATGAGGAA
961 GTCGTGGGCACTTTTTCAAACTGGGGTTTCGAGGACGACGGAACAGACAAGGATACAAAT
1021 TTCTATGTGGCCTTGGAGAACGTGGACACCACrATGAAGGTGCACATCAAGAGACCCGAG 1081 ATGACCTCGTCCTCΛGTG or a functionally equivalent variant thereof.
6. A polynucleotide which has the following sequence:
1 TGTGACAATGGTGGCACCTGGGAACAGGGCCAGTGTGCTTGCCTTCCGGGGTTTTCTGGG
61 GACCGCTGTCAGCTCCAGACCAGATGCCAGAA'i'GGGGGTCAGTGGGATGGCCTCAAATGC 121 CAGTGCCCCAGCACCTTCTATGGTTCCAGTTGTGAGTTTGCTGTGGAACAGGTGGATCTA
181 GATGTAGTCGACACCGAGGTGGGCATGGAAGTGTCTGTGGATCAGCAGrTCTCGCCGGAC
2 1 CTCAATGACAACACTTCCCAGGCCTACAGGGATTTCAACAAGAC-.CTTCTGGAATCAGATG
301 CAGAAGATTTTTGCAGACATGCAGGGCTTCACCTT AAGGGTGTGGAGATCCTGTCCCTG 361 AGGAATGGCAGCATCGTGGTGGACTACCTGGTCCTGCTGGAGATGCCCTTCAGCCCCCAG
421 CTGGAGAGCGAGTATGAGCAGGTGAAGACCACGCTGAAGGAGGGGCTGCAGAACGCCAGC
481 CAGGATGTGAACAGCTGCCAGGACTCCCAGACCCΓGTGTTTTAΛGCCΓGACTCCATCAAG
5 1 GTGAACAACAACAGCAAGACAGAGCTGACCCCGGCAGCCATC GCCGCCGCGCCGCTCCC
601 ACGGGCTATGAAGAGTTCTACTTCCCCTTGGTGGAGGCCACCCGGCTCCGCTGTGTCACC
661 AAATGCACGTCGGGGGTGGACAACGCCATCGACTGTCACCAGGGCCAGTGCGTTCTGGAG
721 ACGAGCGGTCCCACGTGTCGGTCCTGGGACCAGGACAGGAAATGGTTCGAGACCTGGGAT 781 GAGGAAGTCGTGGGCACTTTTTCAAACTGGGGTTTCGAGGACGACGGAACAGACAAGGAT
841 ACAAATTTCTATGTGGCCTTGGAGAACGTGGACACCACTATGAAGGTGCACATCAAGAGA
901 CCCGAGATGACCTCGTCCTCAGTG
or a functionally equivalent variant thereof.
7. Antibodies which bind to a glycoprotein as defined in claim 1 but which do not bind to the secreted mucin MUC3 described by Gum et al, (1997).
8. Antibodies as defined in claim 7 which bind to a peptide selected from the following, or to any overlapping sequences of these contiguous peptides:
(a) V V E T E V G M E V S V D Q Q F S D L N U N T S Q A Y R D F N K T F N Q M Q K 1 FA D Q G F T F K 3 V E I L S L R
N S 1 V V D Y L V L L E P F S P Q L E S E Y E Q V K T L K E G L Q N A S Q D V N S C D S Q T L C F P D S I K V N N N S K T E L T P A A I
(b) A L V G G L TA GA A L L V L L L L A L G V R
(c) A V R S G W W G G Q R R C R S W D Q D R K W F E 'i' W D E E V V G T F S N G F S D D G T D K D T N F Y V A L E N V D T T M V H I K R P E M T S S S V;
( ) C R R A A P T G Y E E F Y F P L V E A T R L R C V T K C T S
G V D N A I D C H Q G Q C V E 'I S G P T C R C Y S T D T H W F S G P R C or (e) C R RAA P T G Y E E F P L V EAT R L R CV T K C T S GV DN A I D C H Q G Q C V L E T S G P T C R S W D Q D R K W F F, T D E EVVG T F S N G F Ξ D D G T D K D T N F Y VAL E NV D T TM KV H I K R P EM S .S S V.
9. A probe comprising a nucleic acid molecule sufficiently complementary with a polynucleotide having a sequence as claimed in claim 5 or claim 6, or to its complement, so as to bind thereto under stringent conditions.
10. A method of detecting a predisposition to colorectal cancer and/ or inflammatory bowel disease, and/or for prediction of the outcome, and/or severity, and/or responsiveness to treatment of these diseases, which employs an antibody as defined in claim 7 or claim 8, or a probe as defined in claim 9.
11. A method of detecting transmembrane MUC3 in respiratory mucus and/or tissues from individuals with respiratory conditions employing an antibody as defined in claim 7 or claim 8, or a probe as defined in claim 9, for the purpose of predicting disease severity, and/or prognosis, and/or responsiveness to treatment.
12. A method as claimed in claim 11 in which the respiratory condition is chronic bronchitis, asthma or cystic fibrosis.
13. A method of detecting transmembrane MUC3 in the serum of patients with cancers of epithelial origin as a method of detecting the presence of cancer, and/or diagnosing a specific cancer, and/ or responsiveness to treatment, and/ or predicting prognosis using an antibody as defined in claim 7 or claim 8, or a probe as defined in claim 9.
14. A method as claimed in claim 13 in which the cancer is of the gastrointestinal tract, respiratory tract, reproductive tract or breast.
15. A method of detecting transmembrane MUC3 in gastrointestinal mucus and/or tissues of patients with cystic fibrosis for the purpose of predicting disease severity and/ or prognosis and/ or responsiveness to treatment which employs an antibody as defined in claim 7 or claim 8, or a probe as defined in claim 9.
16. A method of testing to detect whether a human subject is predisposed to colorectal cancer which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane MUC3, wherein the presence of an alteration is indicative of a predisposition to colorectal cancer.
17. A method of testing to detect, whether a human subject is predisposed to inflammatory bowel disease (IBD) which comprises the step of detecting the presence or absence of an alteration in the gene encoding transmembrane MUC3, wherein the presence of an alteration is indicative of a predisposition to IBD.
18. A method according to claim 16 or claim 17 wherein presence or absence of an alteration is determined by analysis of DNA coding for transmembrane MUC3.
19. A method according to claim 18 wherein the presence or absence of an alteration is determined by comparing the sequence of DNA from a sample from said subject with the DNA sequence coding for wild-type transmembrane MUC3.
20. A method according to claim 16 or claim 17 wherein the presence or absence of an alteration is determined by analysis of mRNA transcribed from DNA encoding transmembrane MUC3.
21. A method according to claim 20 wherein the presence or absence of an alteration is determined by comparing the sequence of mRNA from a sample from said subject with the mRNA sequence transcribed from DNA coding for wild- type transmembrane MUC3.
2. A method according to claim 16 or claim 17 in which the presence or absence of an alteration is determined by analysis of the amino acid sequence of the expressed transmembrane MUC3 protein.
PCT/AU2000/000846 1999-07-13 2000-07-13 Mucin WO2001004152A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU57961/00A AU5796100A (en) 1999-07-13 2000-07-13 Mucin

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NZ336726 1999-07-13
NZ33672699 1999-07-13

Publications (1)

Publication Number Publication Date
WO2001004152A1 true WO2001004152A1 (en) 2001-01-18

Family

ID=19927378

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2000/000846 WO2001004152A1 (en) 1999-07-13 2000-07-13 Mucin

Country Status (2)

Country Link
AU (1) AU5796100A (en)
WO (1) WO2001004152A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005111070A3 (en) * 2004-05-13 2006-07-20 Univ Minnesota Mucin3 egf-like domains
US9119869B2 (en) 2010-04-29 2015-09-01 Ronald J. Shebuski Mucin derived polypeptides

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
CRAWLEY S.C. ET AL.: "Genomic organization and structure of the 3' region of human MUC3: Alternative splicing predicts membrane-bound and soluble forms of the mucin", BIOCHEMICAL AND BIOPHYSIUCAL RESEARCH COMMUNICATINS, vol. 263, 5 October 1999 (1999-10-05), pages 728 - 736 *
DATABASE GENPEPT [online] 24 February 2000 (2000-02-24), KYO K. ET AL.: "Human intestinal mucin gene 'MUC3' consists of two genes, MUC3A and MUC3B: Associations of distinct variants of MUC3B with ulcerative colitis and Crohn's disease", Database accession no. BAB12116, BAB12118, BAB12115 *
GUM J.R. ET AL.: "MUC3 human intestinal mucin", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, 1997, pages 26678 - 26686 *
NGUYEN P.L. ET AL.: "Membrane-bound (MUC1) and secretary (MUC2, MUC3 and MUC4) mucin gene expression in human lung cancer", TUMOR BIOLOGY, vol. 17, 1996, pages 176 - 192 *
WEISS A.A. ET AL.: "Expression of MUC2 and MUC3 mRNA in human normal, malignant and inflammatory intestinal tissues", THE JOURNAL OF HISTOCHEMISTRY AND CYTOCHEMISTRY, vol. 44, 1996, pages 1161 - 1166 *
WILLIAMS S.J. ET AL.: "The MUC3 gene encodes a transmembrane mucin and is alternatively spliced", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 261, 22 July 1999 (1999-07-22), pages 83 - 89 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005111070A3 (en) * 2004-05-13 2006-07-20 Univ Minnesota Mucin3 egf-like domains
JP2008506365A (en) * 2004-05-13 2008-03-06 リージェンツ オブ ザ ユニバーシティ オブ ミネソタ Mucin 3 EGF-like domain
US9119869B2 (en) 2010-04-29 2015-09-01 Ronald J. Shebuski Mucin derived polypeptides

Also Published As

Publication number Publication date
AU5796100A (en) 2001-01-30

Similar Documents

Publication Publication Date Title
Williams et al. The MUC3 gene encodes a transmembrane mucin and is alternatively spliced
US20070082345A1 (en) Secretory protein or membrane protein
US20110288034A1 (en) Methods of identifying adipocyte specific genes, the genes identified, and their uses
US20020098530A1 (en) Tumor suppressor gene
AU2014373927B2 (en) Prostate cancer gene profiles and methods of using the same
KR20150129847A (en) Fusion proteins and methods thereof
KR20080042162A (en) Composition and method for diagnosing kidney cancer and estimating kidney cancer patient's prognosis
KR100566839B1 (en) Compositions and Methods for The Treatment of Tumor
US8008437B2 (en) Cancer-associated genes
WO2004044164A2 (en) Method for identifying risk of melanoma and treatments thereof
US20030186333A1 (en) Down syndrome critical region 1-like protein
WO2001004152A1 (en) Mucin
US20030211515A1 (en) Novel compounds
US20030167485A1 (en) Novel G protein-coupled receptor encoding gene and diagnostic uses therefor
US7314713B1 (en) Obesity gene and use thereof
US20040214990A1 (en) Transmembrane protein differentially expressed in cancer
WO2001009320A1 (en) Gene encoding novel adp-ribosylation factor (arf)-like protein
JP2002541850A (en) Genes and expression products from hematopoietic cells
Onuchic et al. Genomic organization of the KIAA0057 gene that encodes a TRAM-like protein and its exclusion as a polycystic kidney and hepatic disease 1 (PKHD1) candidate gene
WO2002080842A2 (en) Medicament and method for diagnosing an autoimmune condition_in particular psoriasis
WO2000004142A1 (en) Mucins
US20040092724A1 (en) Mucin
WO2002072822A2 (en) Als2 gene and amyotrophic lateral sclerosis type 2
AU784629B2 (en) Tumour suppressor factor
EP1279733A1 (en) Nucleic acids and polypeptides involved in the predisposition to infection to human papilloma virus, to epidermodysplasia verruciformis and/or to psoriasis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP