WO2001000854A2 - Chimeric proteins mediating targeted apoptosis - Google Patents

Abstract

Chimeric cell-surface proteins are described which may be used in the selective induction of apoptosis in particular target cell types such as cancer cells in vivo or in vitro. Nucleic acid sequences encoding such proteins and methods of use relating to cancer and other therapies are provided.

Description

CHIMERIC PROTEINS MEDIATING TARGETED APOPTOSIS

This invention relates to chimeric cell surface proteins, nucleic acids encoding such proteins, and the use of these molecules in therapy such as cancer therapy which involves the selective induction of apoptosis in particular target cell types in vivo or in vi tro .

Fas (APO-1, CD95) is a member of a large family of conserved transmembrane proteins known collectively as the tumor necrosis factor receptor (TNFR) family (Baker and Reddy, 1998). Upon interaction with their respective cell surface and/or soluble ligands, for example, FasL, TNF-a, LT-a, TRAIL, RANKL/TRANCE, TWEAK/Apo-3L, a subset of these proteins including, for example, Fas, TNFRl, TRAIL-R1/DR , TRAIL- R2/DR5, OPG, TRAMP/DR3 and DR6, induce apoptosis, a form of programmed cell death characterised by a series of biochemical events that result ultimately in the degradation of genomic DNA (Baker and Reddy, 1998). Receptor oligomerization induced by ligand binding is critical to this process (Ware et al., 1996) . The cytoplasmic domain of these various pro-apoptotic proteins contains a conserved amino acid sequence known as the "death domain" that upon receptor ligation associates with a homologous domain present within a number of adapter proteins, for example, FADD/M0RT1, TRADD and RIP (Schulze-Osthoff et al . , 1998), triggering the activation of downstream caspases, leading ultimately to the induction of apoptosis (Nunez et al . , 1998) .

Takebayashi et al . , (1996) describe a method in which chimeric proteins that incorporate the transmembrane and cytoplasmic domains of murine Fas fused in-frame to a cytoplasmic ligand- binding domain derived from the rat estrogen receptor or human retinoic acid receptor, induce the apoptotic cell death of transfected L929 and HeLa cells in vi tro following addition of the corresponding ligand (17β-estradiol or retinoic acid) .

Human pancreatic carcinoma cell lines transfected with a DNA construct encoding the Fas-estrogen receptor chimera were similarly killed in vi tro in the presence of 17β-estradiol (Kawaguchi et al . , 1997).

Kodaira et al describe the replacement of the cytoplasmic ligand-binding domain in the chimeric protein described above with an equivalent domain derived from a mutant estrogen receptor, generating a fusion that is unable to bind estrogen, but which retains affinity for the synthetic estrogen agonist 4-hydroxytamoxifen. L929 cells transfected with a DNA construct encoding this chimeric protein were killed in vi tro in the presence of tamoxifen but not in the presence of 17β- estradiol (Kodaira et al . , 1998).

Although the constructs described above may have utility in cancer gene therapy, they lack specificity for tumor cells.

Normal tissues that express the chimeric protein will also be killed in the presence of the appropriate ligand, which in an in vivo setting would preferably be administered systemically . Moreover, the design of these chimeric proteins and, in particular, the cytoplasmic location of the ligand-binding domain, limits the range of potential ligands to those capable of crossing the cell membrane, for example, lipophilic hormones . In studies designed to investigate the nature of the signal transduction events triggered via hemopoietic growth factor receptors, Takahashi et al . , (1996) describe chimeric proteins in which the extracellular ligand-binding domain of the murine G-CSF receptor was fused to the cytoplasmic domain of murine Fas. Importantly, however, when expressed in the mouse T cell line WR19L or the myeloid cell line FDC-P1, such chimeric receptors did not induce cell death when dimerized by interaction with G-CSF. Cell death could be induced by treatment of transduced cells with a polyvalent anti-G-CSF receptor antibody suggesting that oligomerization is necessary to activate the apoptotic process. Such studies indicate that homodimeric cytokines, such as VEGF, do not induce cell death upon interaction with the corresponding receptor-Fas chimera.

Crabtree et al (US 5,834,266 and US 5,994,313) describe a procedure for the regulated (inducible) dimerization or oligomerization of intracellular proteins and disclose the use of this procedure to regulatably initiate cell-specific apoptosis (programmed cell death) in genetically engineered cells. Chimeric proteins are disclosed which contain a portion of the cytoplasmic domain of Fas or the TNF receptor and induce apoptotic cell death upon oligomerization with appropriate ligands. Polypeptide ligands proposed for inducing the cross-linking of the chimeric protein are either membrane permeable or have molecular weights of less than 5 kD.

Cellular specificity may be achieved in the Crabtree et al procedure through the use of promoter elements or other regulatory sequences that restrict expression of the chimeric protein to particular cell types in vitro or in vivo. The investigations described herein relate to the expression and/or functional activity of various cell surface receptors which are altered during the malignant process. The expression of both cell surface and soluble ligands may also be induced within the tumor micro-environment. While such changes may contribute to tumor growth, local invasion and metastasis, they also offer opportunities for therapeutic intervention.

The present invention relates to the unexpected discovery that these cellular changes may allow the specific targeting of particular cells in methods of gene therapy.

One aspect of the present invention therefore provides an isolated nucleic acid encoding a polypeptide comprising;

(i)an extra-cellular domain which binds multivalent ligand preferentially at the surface of a target cell relative to a non target cell,

(ii) a membrane spanning domain, and

(iii) a cytoplasmic domain which induces cell death in a target cell upon binding of the extra-cellular domain with the multivalent ligand.

Binding of the extra-cellular domain and the multivalent ligand may be directed preferentially to the surface of target cells by employing as an extracellular domain in the chimeric polypeptide, a ligand-binding domain from a receptor which is preferentially activated in a target cell i.e. the receptor is more active in binding ligand on a target cell than on a non target cell.

Preferential binding of the extra-cellular domain and the ligand may alternatively or additionally be achieved at the surface of a target cell relative to a non-target cell by employing an extracellular domain from a receptor whose ligand is preferentially expressed in the vicinity of a target cell i.e. is found in high concentration at or near the target cell relative to elsewhere.

Polypeptide encoded by nucleic acid of the present invention herein represents a further aspect of the present invention.

A polypeptide of the present invention may therefore include;

(i)an extra-cellular domain which binds multivalent ligand preferentially at the surface of a target cell relative to a non target cell,

(ii) a membrane spanning domain, and

(iii) a cytoplasmic domain which induces cell death in a target cell upon binding of the extra-cellular domain with the multivalent ligand.

Generally, nucleic acid according to the present invention is provided as an isolate, in isolated and/or purified form, or free or substantially free of material with which it is naturally associated, such as free or substantially free of nucleic acid flanking the gene in the human genome, except possibly one or more regulatory sequence (s) for expression. Nucleic acid may be wholly or partially synthetic and may include genomic DNA, cDNA or RNA. The coding sequence shown herein is a DNA sequence. Where nucleic acid according to the invention includes RNA, reference to the sequence shown should be construed as encompassing reference to the RNA equivalent, with U substituted for T.

Nucleic acid of the present invention may be operably linked to a regulatory element on an expression vector. Suitable expression vectors include plasmids, retroviral vector, adenoviral vector, adeno-associated viral vector.

Nucleic acid may be provided as part of a replicable vector, and also provided by the present invention are a vector including nucleic acid as set out above, particularly any expression vector from which the encoded polypeptide can be expressed under appropriate conditions, and a host cell containing any such vector or nucleic acid. An expression vector in this context is a nucleic acid molecule including nucleic acid encoding a polypeptide of interest and appropriate regulatory sequences for expression of the polypeptide, in an in vi tro expression system, e.g. reticulocyte lysate, or in vivo, e.g. in eukaryotic cells such as COS or CHO cells or in prokaryotic cells such as E. coli . Regulatory sequences may allow also expression in human cell types, particularly human cell types whose selective destruction would have therapeutic benefits.

Suitable vectors can be chosen or constructed, containing appropriate regulatory sequences, including promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al . , 1989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example in preparation of nucleic acid constructs, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and analysis of proteins, are described in detail in Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley & Sons, 1992.

Nucleic acid according to the present invention may be used in methods of gene therapy, for instance in treatment of individuals with the aim of curing (wholly or partially) cancer, autoimmune disease, inflammation, psoriasis and other conditions requiring selective destruction of particular cell types. This may ease one or more symptoms of the disease.

Soluble ligands which may interact with extra-cellular domains of polypeptides of the present invention may include proteins such as growth factors, for example,

VEGF, EGF and PDGF. Suitable ligands may also include one or more glycosaminoglycans such as, for example hyaluronan and chondroitin-4-sulfate . Generally, ligands suitable for use according to the present invention may be endogenous proteins of molecular weight greater than 5kD or glycosaminoglycans and are not membrane permeable

The ligand which interacts with the extra cellular domain may be produced by the target cells themselves or by cells in the vicinity of the target cells such that the target cells are in contact with a concentration of the ligand sufficient to induce dimerisation or oligomerisation of the extracellular domain. Crosslinking of the encoded chimeric cell surface protein by an appropriate multivalent ligand binding to the extracellular domain induces the apoptotic death of cells expressing the chimeric protein product.

Target cells may be of any cell type which is desirably destroyed selectively in a method of therapeutic treatment, for example treatment of cancer, auto-immune disease, inflammation and psoriasis. Suitable target cells may be selected from tumour cells, endothelial cells, smooth muscle cells, fibroblasts and hemopoietic cells.

A variety of extracellular ligand-binding domains, and cytoplasmic "death domains" may be employed in the practice of the present invention. (See Hofmann K. and Tschopp, J. 1995, for review of "death domains") .

The extracellular domain of the chimeric protein should be differentially active on target cells relative to non- target cells (i.e. more active on target cells) or should be capable of binding an endogenous multivalent ligand which is differentially expressed in the vicinity of target cells relative to non-target cells (i.e. higher expression near target cells) . A suitable extracellular domain for use in chimeric polypeptides according to the present invention may include an extracellular domain of CD44 (cluster of differentiation 44, Stamenkovic et al 1989, Accession No: M24915), ICAM-1 (intercellular adhesion molecule - 1,

Staunton et al 1988, Accession No:J03132), VEGFRl/Flt-1 (vascular endothelial growth factor receptor l,Shibuya et al 1990, Accession No: NM_002019) , VEGFR2/KDR/Flk-1 (vascular endothelial growth factor receptor 2, Patterson et al 1995, Accession No: AF035121), VEGFR3/Flt-4 (fms related tyrosine kinase 4, Galland et al 1992, Galland et al 1993, Accession No: NM_002020), PDGFR (platelet derived growth factor receptor alpha, Matsui et al 1989, Accession No: NM_006206) , PDGFRβ (platelet derived growth factor receptor beta, Gronwald et al 1988, Accession No: NM_002609) and EGF receptor (epidermal growth factor receptor (avian erythroblastic leukaemia viral homologue (v-erb-b) oncogene homolog) Ullrich et al 1984 Acession number NM_005228) or other related receptors.

The extracellular domain of the chimeric polypeptide may comprise the complete extracellular domain of a receptor protein or a portion or fragment thereof which retains the ability to induce oligomerisation of the chimeric polypeptide on binding to ligand.

The signal peptide of CD44 (M24915) starts at amino acid -19 (Met) which corresponds to bases 116-118 of the published nucleotide sequence, and ends at amino acid -1 (Leu) , which corresponds to bases 170-172 of the nucleotide sequence. The extracellular domain of CD44 starts at amino acid +1 (Ala) which corresponds to bases 173-175 of the nucleotide sequence, and ends at amino acid +249 (Glu) , which corresponds to bases 917-919 of the nucleotide sequence.

The signal peptide of ICAM-1 (J03132) starts at amino acid -27 (Met) which corresponds to bases 58-60 of the published nucleotide sequence, and ends at amino acid -1 (Ala) , which corresponds to bases 136-138 of the nucleotide sequence. The extracellular domain of ICAM-1 starts at amino acid +1 (Gin) which corresponds to bases 139-141 of the nucleotide sequence, and ends at amino acid +453 (Glu) , which corresponds to bases 1495-1497 of the nucleotide sequence.

The signal peptide of FLT-1 (MN_002019) starts at amino acid -22 (Met) which corresponds to bases 250-252 of the nucleotide sequence, and ends at amino acid -1 (Gly) , which corresponds to bases 313-315 of the nucleotide sequence. The extracellular domain of FLT-1 starts at amino acid +1 (Ser) which corresponds to bases 316-318 of the nucleotide sequence, and ends at amino acid +736 (Glu) , which corresponds to bases 2521-2523 of the nucleotide sequence.

The signal peptide of FLK-1 (AF035121) starts at amino acid -19 (Met) which corresponds to bases 304-306 of the published nucleotide sequence, and ends at amino acid -1 (Ala) , which corresponds to bases 358-360 of the nucleotide sequence. The extracellular domain of FLK-1 starts at amino acid +1 (Ala) which corresponds to bases 361-363 of the nucleotide sequence, and ends at amino acid +745 (Glu) , which corresponds to bases 2593-2595 of the nucleotide sequence.

The signal peptide of EGF (NM_005228) starts at amino acid -24 (Met) which corresponds to bases 187-189 of the published nucleotide sequence, and ends at amino acid -1 (Ala) , which corresponds to bases 256-258 of the nucleotide sequence. The extracellular domain of EGF starts at amino acid +1 (Leu) which corresponds to bases 259-261 of the nucleotide sequence, and ends at amino acid +612 (Ser) , which corresponds to bases 2119-2121 of the nucleotide sequence.

The signal peptide of PDGF Receptor beta (NM_002609) starts at amino acid -32 (Met) which corresponds to bases 357-359 of the published nucleotide sequence, and ends at amino acid -1 (Gly) , which corresponds to bases 450-452 of the published nucleotide sequence. The extracellular domain of PDGF Receptor beta starts at amino acid +1 (Leu) which corresponds to bases 453-455 of the nucleotide sequence, and ends at amino acid +499 (Lys) , which corresponds to bases 1947-1949 of the nucleotide sequence .

The signal peptide of PDGF Receptor alpha (NM_006206) starts at amino acid -24 (Met) which corresponds to bases 140-142 of the published nucleotide sequence, and ends at amino acid -1 (Gin) , which corresponds to bases 209-211 of the published nucleotide sequence. The extracellular domain of PDGF Receptor alpha starts at amino acid +1 (Leu) which corresponds to bases 212-214 of the nucleotide sequence, and ends at amino acid +500 (Glu) , which corresponds to bases 1709-1711 of the nucleotide sequence .

The signal peptide of FLT-4 (NM_002020) starts at amino acid -22 (Met) which corresponds to bases 22-24 of the published nucleotide sequence, and ends at amino acid -1 (Val) , which corresponds to bases 85-87 of the published nucleotide sequence. The extracellular domain of FLT-4 starts at amino acid +1 (Ser) which corresponds to bases 88-90 of the nucleotide sequence, and ends at amino acid +753 (Glu) , which corresponds to bases 2344-2346 of the published nucleotide sequence.

The cytoplasmic domain of the expressed polypeptide may comprise a "death domain" from a member of the Fas/TNFR family, preferably the cytoplasmic domain from a receptor protein which is member of the Fas/TNFR family, more preferably the cytoplasmic domain from Fas .

The death domain of the human Fas/Apo-l/CD95 (Protein Database Accession No: P25445) consists of amino acid residues 230 to 314 and has the following sequence ;

KYITTIAGVM TLSQVKGFVR KNGVNEAKID EIKNDNVQDT AEQKVQLLRN WHQLHGKKEA YDTLIKDLKK ANLCTLAEKI QTII

The death domain of the human TNFR1 (Protein Database Accession No: P19438) consists of amino acid residues 356 to 441 and has the following sequence; PATLY AVVENVPPLR WKEFVRRLGL SDHEIDRLEL QNGRCLREAQ YSMLATWRRR TPRREATLEL LGRVLRDMDL LGCLEDIEEA L.

Introduction of nucleic acid into a cell may take place in vivo by way of gene therapy, as discussed below. A host cell containing nucleic acid according to the present invention, e.g. as a result of introduction of the nucleic acid into the cell or into an ancestor of the cell (which introduction or alteration may take place in vivo or ex vivo) , may be comprised (e.g. in the soma) within an organism which is an animal, particularly a mammal, which may be human or non-human, such as rabbit, guinea pig, rat, mouse or other rodent, cat, dog, pig, sheep, goat, cattle or horse, or which is a bird, such as a chicken.

Supplementary targeting therapies may be used to deliver nucleic acid more specifically to certain types of cell, by the use of targeting systems such as antibody or cell specific ligands. Supplementary targeting may be desirable to reduce still further the chimeric protein induced apoptosis of non-target cells.

A vector containing a nucleic acid of the present invention may undergo supplementary targeting to the specific cells to be treated, or it may contain regulatory elements which are switched on more or less selectively by the target cells. For example, expression of the nucleic acid of the present invention may be placed under the control of an appropriate promoter and/or enhancer element that is functional in the target cell type or tissue but not in other non target cell types or tissues, or under the control of a promoter and/or enhancer element that can be induced or activated locally by an appropriate stimulus (e.g. ionising radiation) .

Viral vectors may be targeted to a selected tissue or cell type using specific binding molecules, such as a sugar, glycolipid or protein such as an antibody or binding fragment thereof . Nucleic acid may be incorporated into a virion expressing a chemically or genetically altered cellular receptor that recognises a differentially expressed counter receptor on a target cell.

Nucleic acid may be targeted by means of linkage to a protein ligand (such as an antibody or binding fragment thereof) via polylysine, with the ligand being specific for a receptor present on the surface of the target cells. Vectors such as viral vectors have been used to introduce genes into a wide variety of different target cells. Typically the vectors are exposed to the target cells so that transfection can take place in a sufficient proportion of the cells to provide a useful therapeutic or prophylactic effect from the expression of the desired polypeptide. The transfected nucleic acid may be permanently incorporated into the genome of each of the targeted cells, providing long lasting effect, or alternatively the treatment may have to be repeated periodically. A variety of vectors, both viral vectors and plasmid vectors, are known in the art, see e.g. US Patent No. 5,252,479 and WO 93/07282. In particular, a number of viruses have been used as gene transfer vectors, including adenovirus, papovaviruses, such as SV40, vaccinia virus, herpesviruses, including HSV and EBV, and retroviruses , including gibbon ape leukaemia virus, Rous Sarcoma Virus, Venezualian equine enchephalitis virus, Moloney murine leukaemia virus and murine mammary tumourvirus . Many gene therapy protocols in the prior art have used disabled murine retroviruses.

Disabled virus vectors are produced in helper cell lines in which genes required for production of infectious viral particles are expressed. Helper cell lines are generally missing a sequence which is recognised by the mechanism which packages the viral genome and produce virions which contain no nucleic acid. A viral vector which contains an intact packaging signal along with the gene or other sequence to be delivered (e.g. encoding the chimeric polypeptide) is packaged in the helper cells into infectious virion particles, which may then be used for the gene delivery.

Other known methods of introducing nucleic acid into cells include electroporation, calcium phosphate co- precipitation, mechanical techniques such as microinjection, transfer mediated by liposomes and direct DNA uptake and receptor-mediated DNA transfer. Liposomes can encapsulate RNA, DNA and virions for delivery to cells. Depending on factors such as pH, ionic strength and divalent cations being present, the composition of liposomes may be tailored for targeting of particular cells or tissues. Liposomes include phospholipids and may include lipids and steroids and the composition of each such component may be altered. Targeting of liposomes may also be achieved using a specific binding pair member such as an antibody or binding fragment thereof, a sugar or a glycolipid.

The aim of gene therapy using nucleic acid encoding the chimeric polypeptide, is to generate the expression product of the nucleic acid in cells. In target cell types, endogenously produced ligand binds the extracellular domain of chimeric protein setting off a series of biochemical events leading to the apoptotic death of the target cell. Such treatment may be therapeutic or prophylactic, for example in the treatment of cancer, auto-immune disease, inflammation or psoriasis.

Administration of a nucleic acid molecule according to the present invention to an individual, is preferably in a "prophylactically effective amount" or a

"therapeutically effective amount" (as the case may be, although prophylaxis may be considered therapy) , this being sufficient to show benefit to the individual. The actual amount administered, and rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g. decisions on dosage etc, is within the responsibility of general practitioners and other medical doctors. Thus, the present invention extends in various aspects to a pharmaceutical composition, medicament, drug or other composition comprising a nucleic acid as described above, a method comprising administration of such a composition to a patient, e.g. for expressing chimeric polypeptide for instance in treatment of treatment of cancer, auto-immune disease, inflammation or psoriasis or other disease, use of such a substance in manufacture of a composition for administration, e.g. for expressing chimeric polypeptide for instance in treatment of treatment of cancer, auto-immune disease, inflammation or psoriasis or other disease, and a method of making a pharmaceutical composition comprising admixing such a substance with a pharmaceutically acceptable excipient, vehicle or carrier, and optionally other ingredients.

Pharmaceutical compositions according to the present invention, and for use in accordance with the present invention, may include, in addition to active ingredient, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient . The precise nature of the carrier or other material will depend on the route of administration, which may be oral, or by injection, e.g. cutaneous, subcutaneous or intravenous .

Pharmaceutical compositions for oral administration may be in tablet, capsule, powder or liquid form. A tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oil. Physiological saline solution, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

For intravenous, cutaneous or subcutaneous injection, or injection at the site of affliction, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride Injection, Ringer's Injection, or Lactated Ringer's Injection. Preservatives, stabilisers, buffers, antioxidants and/or other additives may be included, as required.

An aspect of the present invention therefore provides a nucleic acid or expression vector as described herein for use in methods of treatment of cancer, autoimmune disease, inflammation, psoriasis and other conditions requiring selective destruction of particular cell types.

A nucleic acid or expression vector as described herein may also be used in the manufacture of a medicament for the treatment of cancer, autoimmune disease, inflammation, psoriasis and other normal or abnormal conditions requiring selective destruction of particular cell types. This aspect of the present invention also provides the use of a nucleic acid or expression vector as described herein in a method of treatment of cancer, autoimmune disease, inflammation, psoriasis and other conditions requiring selective destruction of particular cell types.

Nucleic acids as described herein may be administered as a sole therapy or in combination with other therapies, either simultaneously or sequentially dependent upon the condition to be treated. For the treatment of solid tumours, nucleic acid of the present invention may be administered in combination with radiotherapy or photodynamic therapy, or in combination with other nucleic acid constructs or anti-tumour substances including mitotic inhibitors, for example, vinblastine, paclitaxel and docetaxel; alkylating agents, for example, cisplatin, carboplatin and cyclophosphamide; antimetabolites, for example, 5-flurourocil, cytosine arabinoside and hydroxyurea; intercalating agents, for example, adriamycin and bleomycin; enzymes, for example, aspariginase; topoisomerase inhibitors, for example, etoposide, topotecan and irinotecan; thymidine synthase inhibitors, for example, raltitrexed; vascular-targeting agents, for example, combretastatin A4 disodium phosphate; biological response modifiers, for example, interferon; antibodies, for example, edrecolomab; and hormone agonists, for example, tamoxifen. Such combination treatment may involve simultaneous or sequential application of the individual components of the treatment. A convenient way of producing a polypeptide of the present invention is to express nucleic acid encoding it, by use of the nucleic acid in an expression system. Accordingly, the present invention also encompasses a method of making a polypeptide (as disclosed) , the method including expression from nucleic acid encoding the polypeptide (generally nucleic acid according to the invention) . This may conveniently be achieved by growing a host cell in culture, containing such a vector, under appropriate conditions which cause or allow expression of the polypeptide. Polypeptides may also be expressed in in vi tro systems, such as reticulocyte lysate.

A further aspect of the present invention therefore provides a method of producing a polypeptide comprising;

introducing a nucleic acid as described herein into a host cell,

causing or allowing expression of said nucleic acid to produce a polypeptide.

A further aspect of the present invention provides a method for inducing the apoptotic cell death of target cells comprising;

introducing a nucleic acid as described herein into a target cell,

causing or allowing expression of said nucleic acid to produce a polypeptide; and, contacting said polypeptide with a ligand which interacts with said polypeptide,

said interaction causing apoptotic death of said target cell .

Methods according to the present invention may be performed in vitro, for example using a mammalian cell line as a target cell. Suitable cell lines include Chinese hamster ovary cells, HeLa cells, baby hamster kidney cells and COS cells. Many other suitable cell lines are known in the art. Ligand may be endogenously produced by the cell line or may be exogenous ligand added to the culture medium.

One embodiment of the present invention is a nucleic acid construct that encodes a chimeric cell surface protein that incorporates a cytoplasmic domain derived from Fas or another pro-apoptotic member of the Fas/TNFR family, and the extracellular ligand-binding domain of the adhesion protein CD44.

CD44 is a broadly distributed cell surface glycoprotein that can function as a receptor for a variety of extracellular matrix and cell surface ligands including, for example, the glycosaminoglycans hyaluronan and chondroitin-4-sulfate (Lesley et al . , 1993; Cooper and Dougherty, 1995; Chiu et al . , 1999) . In common with many other adhesion proteins, however, the ligand binding function of CD44 is not regulated simply by expression (Lesley et al . , 1993). Thus, while many normal cell types express CD44, only a subset of these can bind either immobilised or soluble hyaluronan (Lesley et al . , 1993). The hyaluronan binding function of CD44 is activated by various stimuli and is frequently induced on malignant cells (Lesley and Hyman, 1992; Lesley et al . , 1993;

Lesley et al . , 1997; Sy et al . , 1997). While the precise mechanism involved has not yet been defined, evidence suggests that changes in the glycosylation of CD44 may be important in regulating the functional activity of the molecule (English et al . , 1998). For certain tumors, a correlation has been noted between CD44 expression, hyaluronan-binding function, or the expression of particular alternatively spliced CD44 isoforms, and metastatic propensity and/or poor prognosis (Cooper and Dougherty, 1995; Lesley et al . , 1997; Rudzki and Jothy, 1997; Sy et al . , 1997; Goldbrunner et al . , 1998; Takahashi et al . , 1999).

Thus, nucleic acid constructs encoding chimeric proteins that incorporate a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family, and the extracellular ligand-binding domain derived from CD44 may be therapeutically useful, for example, in the treatment of cancer or other conditions where the destruction of cells in which CD44 is activated, is desired. It is noteworthy that the CD44 ligand hyaluronan is also differentially expressed in various tissues and that production of the molecule may be upregulated at sites of angiogenesis, inflammation, wound healing, and within certain solid tumors (Laurent and Fraser, 1992; Oksala et al . , 1995; Rooney et al . , 1995; Fraser et al . , 1997; Setala et al. , 1999) .

A second embodiment of the present invention is a nucleic acid construct that encodes a chimeric cell surface protein that incorporates a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family, and an extracellular ligand-binding domain derived from the adhesion protein ICAM-1. The cell surface glycoprotein ICAM-1 functions as a ligand for the β2-integrin LFA-1 (van de Stolpe and van der Saag, 1996) . Expression of ICAM-1 is induced on endothelial cells at sites of inflammation and within tumours as a result of exposure to various pro-inflammatory cytokines (Walsh and Murphy, 1992; van de Stolpe and van der Saag, 1996) . Nucleic acid constructs encoding chimeric proteins that incorporate a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family and the extracellular domain derived from ICAM-1 may be useful in circumstances where the selective destruction of target cells in the presence of hemopoietic cells expressing LFA-1 is desirable. For example, this method could be used to effect the killing of endothelial cells within tumours or at sites of inflammation. It is noteworthy that although LFA-1 is widely expressed on hemopoietic cells, the ligand-binding function of the molecule is only induced following appropriate stimulation (Springer, 1990) .

A third embodiment of the present invention is a nucleic acid construct that encodes a chimeric cell surface protein that incorporates a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family, and an extracellular ligand-binding domain derived from a receptor for the cytokine vascular endothelial growth factor (VEGF), for example VEGFRl/Flt-1, VEGFR2/KDR/Flk-1 or VEGFR3/Flt-4 (Neufeld et al . , 1999). Various soluble ligands are known to be induced within both normal and malignant tissues in response to specific microenvironmental stimuli. Thus, the chaotic nature of the angiogenic process that occurs within solid tumours generates regions of chronic and transient hypoxia not found in normal tissues (Chaplin and Trotter, 1990; Vaupel, 1996; Brown and Giaccia, 1998) .

Exposure to hypoxic conditions can induce tumour cells to produce soluble mediators such as VEGF that function to induce the formation of new blood vessels (Shweiki et al . , 1992; Minchenko et al . , 1994). Nucleic acid encoding chimeric proteins that incorporate a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family and an extracellular ligand-binding domain derived from a VEGF receptor, for example, VEGFRl/Flt-1, VEGFR2/KDR/Flk- 1 or VEGFR3/Flt-4, may be therapeutically useful in circumstances where the destruction of normal or malignant target cells in the presence of VEGF is desirable.

A fourth embodiment of the present invention is a nucleic acid construct that encodes a chimeric cell surface protein that incorporates a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family, and an extracellular ligand-binding domain derived from a receptor for the cytokine platelet-derived growth factor (PDGF). Restenosis is a significant clinical problem associated with the trauma induced by mechanical procedures such as coronary angioplasty and stenting that are commonly used in the treatment of vascular occlusive disease .

Vascular smooth muscle cell proliferation plays a critical role in the development of these conditions and in the evolution of spontaneous atherosclerosis, hypertension-related arteriosclerosis, and venous bypass graft arteriosclerosis (Zou et al . , 1998). PDGF, is a potent chemotactic and mitogenic agent for vascular smooth muscle cells and recent studies have implicated this molecule in the development of these various vascular lesions (Abe et al . , 1998). Thus, nucleic acid encoding chimeric proteins that incorporate a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family and an extracellular domain derived from the alpha or beta PDGF receptors, may be therapeutically useful, for example, in the treatment of atherosclerosis or restenosis, or other conditions where the destruction of target cells in the presence of PDGF is desirable.

A fifth embodiment of the present invention is a nucleic acid construct that encodes a chimeric cell surface protein that incorporates a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family, and an extracellular ligand-binding domain derived from a receptor for the cytokine epidermal growth factor (EGF) . Members of EGF superfamily including, for example, EGF and Cripto-1, play an important role in regulating the proliferation and differentiation of both normal and malignant epithelial cells (Jones et al . , 1999; Salomon et al . , 1999; Thomas et al . , 1999). High levels of EGF and related proteins can be detected within various solid malignancies including, for example, those of the breast, ovary and stomach. EGF induces homodimerization of the EGF receptor (EGFR) and heterodimerization of the EGFR and ErbB2 (Wang et al . , 1999).

Thus, nucleic acid encoding chimeric proteins that incorporate a cytoplasmic domain derived from Fas or another member of the Fas/TNFR family and the extracellular ligand-binding domain of an EGF receptor, may be therapeutically useful, for example, in the treatment of epithelial malignancies, or other conditions where the destruction of target cells in the presence of EGF is desirable.

Nucleic acid sequences encoding the ligand-binding domains and counter-receptors discussed above represent exemplary domains useful in the practice of the present invention. It will be appreciated, however, that following the teachings and guidance of the present specification, one of skill in the art may select other sequences suitable for use with the present invention, and that the use of such sequences is considered to be within the scope of the present invention. Those skilled in the art will also recognise that cytoplasmic domains derived from the various members of the Fas/TNFR family may have different activities in different target cell types. It will also be appreciated that cytoplasmic domains lacking classical "death domains" of the type seen in the various members of the Fas/TNFR family and which kill cells by a different mechanism may nevertheless prove suitable for use with the present invention

The following examples illustrate but are in no way are intended to limit the present invention, and that the use of such sequences is considered to be within the scope of the present invention.

The examples will be described with reference to the following figures;

Figure 1 shows the pCEP4 expression vector with the alternative cDNA inserts used herein.

Figures 2A and 2B show the nucleic acid and predicted amino acid sequence of C44H^ETRA-FAS^TM/CYT0

Figures 3A and 3B show the nucleic acid and predicted amino acid sequence of _C44H^EXTRA/TMFAS^CYTO

Figure 4 shows the results of FACS analysis of the expression of Fas, CD44H and chimeric proteins C44H^EXTRA- _FASTM/CYTO _{and C44H}EXTRA/TM_FASCYTO _{on the surface Q}f transfected K562 cells. Figure 5 shows the apoptosis (expressed as % hypodiploid) of K562 cells transfected with CD44H , C44H^EXTRA-FAS^TM/CYT0 or _C44HEXTRA/TM_FASCYTO _{upon adhe}sion to hyaluronan.

Figure 6 shows the inhibition of the clonogenic potential of ECV304 cells when transfected with C44H^EXTRA-FAS^TM/CYT0 or

Figure 7 shows the inhibition of the clonogenic potential of QBI -293 cell s when trans fected with C44H^EXTRA-FAS^TM/CYT0 or C44H^EXTRA/TMFAS^CYT0.

Figure 8 shows the inhibition of the clonogenic potential of MCF-7 cells when trans fected with C44H^EXTRA- FAS^TM/CYT0 or C44 H^EXTRA/TMFAS^CYT0.

Figure 9 shows the inhibition of the clonogenic potential of PC- 3 cells when trans fected with C44H^EXTRA-FAS^TM/CYT0 or C44H^EXTRA/TMFAS^CYT0.

Figures 10A to 10 D show the nucleic acid and amino acid sequence of _Fι_t- l^EXTRAFas™^/CYT0.

Figures 11A to 11 D show the nucleic acid and amino acid sequence of _Fι_t- l^E™™Fas^cγτ0.

Figure 12 shows the express ion of Flt-l^EXTRAFas^TM/CYT0 and

Flt- l^EXTRA/TMFas^CYT0 on the surface of K562 cells using FACS analys is . Figure 13 shows the inhibition of the clonogenic potential of ECV304 cells when transfected with Flt-

1 EXTRAp_{a s}TM/CYTO _{o r} p 1 4- _ 1 EXTRA/TMp_a „ CYTO

Figure 14 shows the inhibition of the clonogenic potential of QBI-293 cells when transfected with Flt-

1 EXTRAp_{a s}TM/CYTO _{Q r} p 4- _ 1 EXTRA/TMp_a - CYTO

Figure 15 shows the inhibition of the clonogenic potential of MCF-7 cells when transfected with Flt-

-1 EXTRA_{F a s}TM/CYTO _{o r} p "^ - _ EXTFA/TMp_{a g} CYT0

EXAMPLES

Example 1

Cytotoxic activity of CD44-Fas chimeric proteins

Vector Construction

A full length CD44H cDNA was isolated from pCDM8.CD44H clone 2.3 (Dougherty et al , 1991) by digestion with

Hindlll and Notl and the fragment obtained cloned into the Hindlll-Notl sites of the episomal expression vector pCEP4 (Invitrogen) generating a plasmid designated pCEP4.CD44H. The major features of this vector are shown in Figure 1. Digestion of pCEP4.CD44H with Xhol released a fragment containing the full length CD44H cDNA, which was blunted using T4 DNA polymerase and cloned into the EcoRV site of pZEr02 (Invitrogen). Orientation of the insert was determined by digestion with a panel of restriction enzymes and an appropriate clone digested with EcoRI and Notl to release the full length CD44H cDNA in which the 3' end of the gene is located adjacent to the EcoRI site. This fragment was cloned into the EcoRI- Notl sites of pBluescript (KS+) (Stratagene) generating a vector designated pBS.CD44H.

mRNA was isolated from approximately 4 x 10⁷ Jurkat cells using the Stratagene mRNA Isolation Kit (Stratagene) . The mRNA was reverse transcribed and cDNA synthesized using the Pharmacia cDNA Synthesis Kit (Pharmacia) as per the manufacturers instructions using random hexanucleotide primers. A full-length' human Fas cDNA (Fas^FL) or cDNA fragments encoding the transmembrane and cytoplasmic domains of human Fas (Fas^TM/CYT0) or only the cytoplasmic domain of the molecule (Fas^cγτ0) were generated by polymerase chain reaction (PCR) using the following primer pairs designed on the basis of published Fas sequences (Itoh et al . , 1991).

Fas FL

5 ' primer 5 ' GCGGAATTCAGGGGCGGGCACTGGCAC 3 '

EcoRI

3' primer 5' GGCTCGAGAATCTTTTCAAACACTAATTGC 3'

Xhol

Fas¹ 5 ' primer 5 ' AACGTGATCATCCTTTGTCTTCTTCTTTTG 3 '

Bell

3 ' primer 5 ' GGCTCGAGAATCTTTTCAAACACTAATTGC 3 '

Xhol

Fas CYTO

5 ' primer 5 ' GCCCGGGGTGAAGAGAAAGGAAGTACAG 3

Smal

3 ' primer 5 ' GGCTCGAGAATCTTTTCAAACACTAATTGC 3 '

Xhol

The underlined base pairs in the 5' Fas TM/CYTO primer are not found in Fas and were introduced to maintain the correct reading frame. The restriction enzyme sites used in subsequent cloning steps are indicated in bold.

PCR reactions (94°C for 30s, 50°C for 30s and 72°C for 1 min; 40 cycles) were carried out in an OmniGene

Thermacycler (Hybaid) using Ampli-Taq (Perkin-Elmer ) . PCR products were blunted using T4 DNA polymerase and cloned into the EcoRV site of pZEr02 generating vectors designated pZEr02. Fas^FL, pZEr02. Fas^TM/CYT0 and pZEr02. Fas^cγτo.

pZEr02. Fas^FL was digested with EcoRI-XhoI to release the full length Fas cDNA which was then ligated into the EcoRI-XhoI sites of pBluescript (KS+) generating the vector pBS.Fas^FL. Digestion of pBS.Fas^FL with Notl and Xhol released a fragment containing the full length Fas cDNA which was then ligated into the corresponding Notl-Xhol sites of the episomal expression vector pCEP4 (Invitrogen) . The major features of this vector, designated pCEP4. FAS^FL, are illustrated in Figure 1.

To generate a nucleic acid construct encoding a chimeric protein containing the extracellular domain of CD44H and the transmembrane and cytoplasmic domains of human Fas (CD44^EXTRAFas^TM/CYTO) , pBS.CD44H was digested with Bell and Xhol to remove the transmembrane and cytoplasmic domain of CD44H and a Bcll-Xhol fragment derived from pZEr02. Fas^TM/CYT0 containing the transmembrane and cytoplasmic domains of Fas was ligated into the corresponding sites in the plasmid generating a vector designated pBS . CD44^EXTRAFas^TM/CYT0. The complete nucleic acid sequence and predicted animo acid sequence of _CD44E^χτRA_FasτM/c^γτo _{are shown} i_n Figures 2A and 2B.

To generate a nucleic acid construct encoding a chimeric protein containing the extracellular and transmembrane domains of CD44H and the cytoplasmic domain of human Fas (CD44^EXTRA/TMFas^CYTO) pBS.CD44H was digested with Notl and EcoRI to release the full length CD44H cDNA which was then partially digested with Hindi to obtain a Notl- HincII fragment that contained only the extracellular and transmembrane domains of the CD44H molecule. pZEr02. Fas^CYT0 was digested with Notl and Smal and the Notl-HincII fragment containing the extracellular and transmembrane domains of CD44H was ligated into the plasmid generating a vector designated pZEr02. CD44^EXTRA/TMFas^CYT0. The complete nucleic acid sequence and predicted amino acid sequence of cD44^EXTRA/TMFas^CYTO are shown in Figure 3A and 3B.

In order to test the functional activity of the nucleic acid constructs, full length _CD44^EXTRAFas™^/CYTO and _{CD 4} ^Eχτ^RA/τ^M _Fas ^cγτo _chimeric cDNAs were isolated by digestion of pBS.CD44^ETRAFas^TM/CYTO and pZEr02. CD44^EXTRA/TMFas^CYTO with Notl and Xhol. The fragments obtained were then cloned into the Notl-Xhol sites of the episomal expression vector pCEP4 (Invitrogen) generating vectors designated pCEP4.CD44^EXTRAFas^TM/CYTO and pCEP4. CD44^EXTRA/TMFas^CYT0. The major features of both plasmids are illustrated in Figure 1.

Cell lines and culture conditions

The human cell lines K562 (erythroleukemia) , ECV304 (a variant of the T28 bladder carcinoma) , MCF-7 (breast adenocarcinoma) and PC-3 (prostatic adenocarcinoma) , were obtained from the American Type Culture Collection (ATCC) . QBI-293 (adenovirus 5 transformed kidney epithelial cells) was obtained from Quantum Biotechnology Inc. All tumor cell lines except MCF-7 were maintained at 37°C in an atmosphere containing 5% C0₂ in Dulbecco' s

Minimal Essential Medium (DMEM) supplemented with fetal bovine serum (10%) , L-glutamine (2mM) , penicillin (50 units/ml) , and streptomycin sulfate (50 mg/ml) . MCF-7 was maintained in Eagles Minimum Essential Medium (EMEM) supplemented with fetal bovine serum (10%), bovine insulin (0.01 mg/ml), glutamine (2mM) , non-essential amino acids (0.1 mM) sodium pyruvate (1.0 mM) , penicillin (50 units/ml) , and streptomycin sulfate (50 mg/ml) . Cell surface expression of CD44^EXTRAFas^TM/CYTO and

CD44^EXTRA/TMFas^CYTO chimeric proteins in transfected cell lines

K562 cells do not express CD44 and can be used to characterize the expression and functional activity of chimeric CD44-Fas proteins in the absence of a contribution from the endogenous CD44 protein. K562 cells were transfected with plasmid DNA by electroporation using the BTX ECM 600 Electroporator System (BTX) . Briefly, log-phase K562 cultures were harvested and the cells resuspended in phosphate buffered saline (PBS) at a final concentration of 1 x 10⁷ cells/ml. 15 mg of plasmid DNA (pCEP4, pCEP4.Fas^FL, pCEP4.CD44H, pCEP4. CD44^EXTRAFas^TM/CYTO or pCEP4.CD44^EXTRA/TMFas^CYTO) were added to a 400 ml aliquot of each cell suspension, transferred to a 2 mm gap cuvette and electroporated at resistance setting R3-48 ohms, 280 V, and 500 mF. The time constants obtained generally ranged from 3.0-4.0 ms . Immediately after electroporation, the transfected cells were resuspended in 30 ml tissue culture medium, plated in a 15 cm

Integrid dish and incubated at 37°C in an atmosphere containing 5% C0₂. Hygromycin B (Sigma) was added 24-48 hours after electroporation at a final concentration of 250 mg/ml and the transfected cells selected for a minimum of 14 days before being further analysed.

Expression of Fas, CD44H and chimeric cD44^EXTRAFas^TM/CYTO and _{CD 4} ^Exτ^RA/^τM _Fas ^cγτ^o _proteins on the surface of transfected K562 cells was determined by Fluorescent Antibody Cell Sorter (FACS) analysis. Briefly, 5xl0⁵ cells were incubated with anti-CD44 mAb 4A4 tissue culture supernatant (Droll et al . , 1995), or the mouse anti-human Fas mAb DX2 (PharMingen) at a final concentration of 5 mg/ml or media alone, for 30 min at 4°C. After 3 washes with ice-cold Hank's balanced salt solution (HBSS) containing 2% FCS (HBSS+2% FCS) , the cells were stained for a further 30 min at 4°C with an FITC-conjugated goat anti-mouse antibody (PharMingen) at a final concentration of 5 mg/ml in HBSS+2% FCS. Following extensive washing, cells were resuspended in HBSS+2% FCS containing 1 mg/ml propidium iodide (PI) (Sigma) to facilitate the identification and exclusion of dead cells, and analyzed on a FACSCalibur (Becton Dickinson) . As shown in Figure 4, Fas, CD44H and the chimeric proteins CD44^EXTRAFas^TM/CYTO and CD44^EXTRA/TMFas^CYTO are all expressed at moderate to high levels on the surface of the corresponding transfected K562 cells.

Induction of apoptosis by binding to immobilized hyaluronan

Hemopoietic cells such as K562 generally produce very low or undetectable levels of hyaluronan (Laurent and Fraser, 1992; Fraser et al . , 1997) and K562 cells stably transfected with either _CD44^EXTRAFas^TM/CYTO or _CD44^EXTRA/TMFas^CYTO do not appear to exhibit a high rate of spontaneous apoptosis. In order to determine whether cells expressing chimeric _CD44^EXTRAFas^TM/CYTO and CD44^EXTRA/TMFas^CYTO proteins undergo apoptosis upon ligand binding, the wells of 6 well tissue culture plates (Falcon) were coated overnight at 4°C with human placental hyaluronan (Sigma) (5mg/ml in PBS) . Unbound hyaluronan was decanted and the wells washed 5 times with PBS and twice with DMEM+10% FCS. 5xl0⁶ transfected K562 cells in a final volume of 3 ml HBSS were added to each well. After incubation for 10 min at 37°C, non-adherent cells were removed by gently washing with medium. K562 cells transfected with CD44H or the chimeric proteins _CD44^EXTRAFas^TM/CYTO or _CD44^EXTRATMFas^CYTO bound avidly to the hyaluronan-coated dishes. Equivalent cells transfected with the pCEP4 vector alone or with pCEP4.Fas^FL did not adhere reflecting the absence of CD44 or other hyaluronan binding proteins on these cells .

The induction of apoptosis upon adhesion to hyaluronan was determined using the method of Fraker et al . , (1995). Briefly, transfected K562 cells that had been allowed to adhere to plastic surfaces coated with hyaluronan as described above were recovered by gentle pipetting at various time points ranging from 1.5-12 hours. Approximately 2 x 10⁶ cells were then aliquoted into sample tubes (Falcon 2099, Becton Dickinson) , pelleted by centrifugation at 350g for 10 min, washed once in HBSS, and then resuspended in 2 ml ice cold 70% ethanol with rapid but gentle mixing. Cells were fixed by incubation at -20°C for at least 4 h, centrifuged at 400 g for 10 min, washed once in HBSS and resuspended in 1 ml DNA staining solution (PBS, pH 7.4, containing 0.1% Triton X- 100, 0.1 mM EDTA pH7.4, 0.05 mg/ml RNase A, and 50 mg/ml propidium iodide) . Cells were stained for at least 4 h in the dark at room temperature and the apoptotic fraction determined by FACS analysis (FACSCalibur, Becton Dickinson) . Briefly, data were collected for at least 10,000 events and FL2 histograms generated. Using the CellQuest software package (Becton Dickinson) gates were set to calculate the percentage of hypodiploid cells (i.e. those cells with a sub Go G^_. DNA content) . As shown in Figure 5, K562 cells transfected with CD44^EXTRAFas^TM/CYTO or CD44^EXTRA/TMFas^CYTO rapidly undergo apoptosis upon adhesion to hyaluronan. In contrast, although K562 cells expressing CD44H adhered to hyaluronan, they remained largely viable even if recovered 12 hours after initial attachment.

Effect of the expression of CD44^EXTRAFas^TM/CYTO and

CD44^EXTRA/TMFas^CYTO chimeric proteins on the clonogeneic potential of transfected tumor cell lines

Many adherent tumor cells constitutively produce hyaluronan, which is found associated with the cell surface bound to CD44 and perhaps other molecules forming a pericellular coat (Laurent and Fraser, 1992; Knudson et al . , 1996; Fraser et al . , 1997). In order to determine whether the introduction of chimeric cD44^EXTRAFas^TM/CYTO or _CD E^χRA/τM_Fasc^γτo _{into such ce}ιι_s induces cell death in the absence of added hyaluronan via an autocrine or paracrine mechanism, ECV304, QBI-293, MCF-7 and PC-3 cells were transfected with plasmid DNA by electroporation using the BTX ECM 600 Electroporator System (BTX) . Briefly, sub- confluent cultures were harvested by trypsinization and cells resuspended in phosphate buffered saline (PBS) at a final concentration of 1 x 10⁷ cells/ml. 15 mg of plasmid DNA (pCEP4, pCEP4.Fas^FL, pCEP4.CD44H, pCEP4. CD44^{E TRA}Fas^TM/CYTO or pCEP4.CD44^EXTRA/TMFas^CYTO) were added to a 400 ml aliquot of each cell suspension, transferred to a 2 mm gap cuvette and electroporated using the following conditions .

ECV304:- Resistance setting R3-48 ohms, 280 V, 400-500 mF. The time constants obtained ranged from 2.7-4.0 ms .

QBI-293:- Resistance setting R4-72 ohms, 270 V, 400-450 mF. The time constants obtained ranged from 2.8-3.7 ms .

MCF-7:- Resistance setting R4-72 ohms, 270 V,

400 mF. The time constants obtained ranged from 2.9-3.2 ms.

PC-3:- Resistance setting R3-48 ohms, 280 V, 300 mF. The time constants obtained ranged from 2.0-3.1 ms.

Immediately after electroporation, transfected cells were resuspended in 30 ml tissue culture medium, plated in a 15 cm Integrid dish (Falcon) and incubated at 37°C in an atmosphere containing 5% C0₂.

Western blot analysis was used confirm expression of the various transgenes in transfected cells. Briefly, although QBI-293 cells constitutively express CD44, elevated levels of species reactive with the anti-CD44 mAb 4A4 are seen in cells transfected with pCEP4.CD44H, pCEP4 . CD44^EXTRAFas^TM/CYTO or pCEP4 . CD44^EXTRA/TMFas^CYT0. - It is noteworthy that the chimeric CD44 proteins do not differ greatly in molecular weight from endogenous CD44. Fas^FL and the chimeric CD44-Fas proteins can be readily detected in transfected cells by probing blots with mAb 3D5 (Alexis Biochemicals) directed against the Fas Death Domain .

In order to determine the effect of expressing the

_{CD4 4}EXTRA_{Fa s}TM/CYTO _{Q r Q D4}4 EXTRA/TM_Fa gCYTO _{chime r}ic _Pr_θtein_{S O}i_l the clonogenic potential of tumor cells, Hygromycin B (Sigma) was added to cultures of transfected cells 24-48 h after electroporation at a final concentration of 250 mg/ml (ECV304) or 200 mg/ml (QBI-293, MCF-7 and PC-3). Plates were incubated undisturbed for 18-21 days after which time the tissue culture supernatant was removed and the number of colonies derived from single cells that survived the treatment, were determined after staining in a solution containing 1% (w/v) methylene blue in methanol. As shown in Figures 6-9, both CD44^EXTRAFas^T!!/CYTO and cD44^EXTRA/TMFas^CYTO dramatically inhibited clonogenic potential when expressed in each of the four tumor cell lines tested. In contrast, overexpression of CD44H produced a modest and variable decrease in the number of hygromycin resistant colonies relative to cells transfected with the pCEP4 vector alone. Although transfection of ECV304 cells with pCEP4. Fas^FL, had little effect on clonogeneic potential, expression of Fas^FL did inhibit the growth of transfected QBI-293, MCF-7 and PC-3 cells. These findings are in agreement with previous studies that demonstrated constitutive production of FasL by PC-3 and MCF-7 (Liu et al., 1998; Gutierrez et al., 1999) .

EXAMPLE 2

Cytotoxic activity of Flt-1-Fas and Flk-1-Fas chimeric proteins

Vector Construction

mRNA was isolated from approximately 5 x 10⁶ human umbilical cord vascular endothelial (HUVEC) cells using the Pharmacia QuikPrep mRNA Purification Kit (Pharmacia) . mRNA was reverse transcribed and cDNA synthesized using the Pharmacia cDNA Synthesis Kit (Pharmacia) as per the manufacturers instructions using random hexanucleotide primers .

cDNAs encoding the extracellular ligand-binding domain of Flt-1 and Flk-1 were generated by polymerase chain reaction (PCR) using the following primer pairs designed on the basis of published Flt-1 and Flk-1 sequences (Shibuya et al., 1990; Terman et al . , 1991; Patterson et al., 1995) and sequence information submitted to GenBank (Accession numbers NM_002019 and AF035121) .

Flt-1

5' primer 5' GCGGGTACCGCGGCCAGCGGGCCTGGCGCC 3'

Kpnl 3' primer 5' GGCGGATCCGTCCGAGGTTCCTTGAACAGTGAGG 3'

BamHI

Flk-1

5' primer 5' GCGGGTACCGCCGCCGGTCGGCGCCCGGGC 3' Kpnl

3' primer 5' GGCGGATCCCTTTTCCTGGGCACCTTCTATTATG 3'

BamHI

PCR reactions (Flt-1: 95°C for 30s, 58°C for 30s and 72°C for 2.5 min, 35 cycles; Flk-1: 95°C for 30s, 60°C for 30s and 72°C for 2.5 min, 40 cycles) were carried out in an OmniGene Thermacycler (Hybaid) using Taq DNA polymerase (Gibco-BRL) . PCR products were gel purified, blunted using T4 DNA polymerase, digested sequentially with BamHI and Kpnl and the fragments obtained ligated into the BamHI-Kpnl sites of pBluescript (KS+) (Stratagene) generating the vectors pBS . Flt-1^EXTRA and pBS. Flk-1¹ EXTRA

In order to acquire flanking restriction sites for use in subsequent cloning steps, pBS . Flt-1 ^EXTRA and pBS . Flk-1 ^{E TRA} were digested with Kpnl and BamHI and DNA fragments encoding the extracellular ligand-binding domain of Flt-1 and Flk-1 were isolated and ligated into the Kpnl-BamHI sites of the plasmid pZEr02 (Invitrogen) generating vectors designated pZEr02. Flt-1 ^EXTRA and pZEr02. Flk-1 ^EXTRA.

To generate a nucleic acid construct encoding chimeric proteins containing the extracellular domain of Flt-1 and Flk-1 fused in-frame to the transmembrane and cytoplasmic domains of Fas, the vector pCEP4. Fas^FL (see above) was digested with Xhol, blunted with T4 DNA polymerase and then digested with BamHI releasing a fragment of approximately 600 bp containing the transmembrane and cytoplasmic domains of Fas (Fas^TM/CYT0) . This fragment was cloned into the BamHI-EcoRV sites of pZEr02. Flt-1^EXTRA and pZEr02. Flk-1^EXTRA generating vectors designated pZEr02.Flt- 1^EXTRA FAS^TM/CYT0 and pZEr02. Flk-l^EXTRAFas^TM/CYT0.

In order to test the functional activity of the chimeric nucleic acid constructs, full length Flt-l^EXTRAFas^TM/CYT0 and Flk-l^EXTRAFas^TM/CYT0 chimeric cDNAs were isolated by digestion of pZEr02.Flt-l^XTRAFAS^TM/CYT0 and pZEr02. Flk-l^EXTRAFas^TM/CYT0 with Kpnl and Notl and the fragments obtained ligated into the Kpnl-Notl sites of pCEP4 generating the vectors pCEP4.Flt-l^EXTRAFAS^TM/CYT0 and pCEP4. Flk-l^EXTRAFas^TM/CYT0. The complete predicted nucleic acid and amino acid sequences of Flt-1^EXTRAFAS^TM/CYT0 and _Fik-l^EXTRA-Fas^TM/CYT0 are shown in Figures 10A-D and Figures 11A-D respectively.

Cell surface expression of Flt-l^EXTRAFas^TM/CYT0 and Flk- l^Exτ^RA _Fasτ^M/^cγτ^o _c imeric proteins in transfected cell lines

The pCEP4.Flt-l^EXTRAFas^TM/CYT0 and pCEP4. Flk-l^EXTRAFas^TM/CYT0 plasmid vectors were introduced into K562 cells by electroporation and cell surface expression of the corresponding chimeric proteins determined by FACS analysis as described in Example 1 using mAb 49560.11 directed against Flt-1 (R&D Systems) and mAb FLK-12M directed against Flk-1 (Alpha Diagnostic) . As shown in Figure 12, low levels of both chimeric proteins can be detected on the surface of transfected K562 cells.

Production of VEGF by tumor cells

Expression of VEGF by tumor cell lines was determined using a semi-quantitative RT-PCR technique. Briefly, mRNA was isolated from various tumor cell lines using the Pharmacia QuikPrep mRNA Purification Kit (Pharmacia) and cDNA synthesized using the Pharmacia cDNA Synthesis Kit (Pharmacia) as per the manufacturers instructions using the NotI-dT18 primer provided. ECV304 cDNA was serially diluted and PCR reactions carried out as described below in order to identify the lowest dilution that still allowed the detection of VEGF. All cDNAs were then diluted to this level and PCR reactions (95°C for 30s, 62°C for 30s 72°C for 30s; 35 cycles) carried out using the following primer pairs designed on the basis of published sequences (Ponte et al . , 1984; Keck et al., 1989) and sequence information submitted to GenBank (Accession numbers NM_001101 and M27281) .

VEGF

5' primer 5' GAGACCCTGGTGGACATCTTCCAGGAGTACCC 3'

3' primer 5' GGCTCCTTCCTCCTGCCCGGCTCACCGCCTCG 3'

Actin 5' primer 5' GAGCGGGAAATCGTGCGTGACATT 3'

3' primer 5' GATGGAGTTGAAGGTAGTTTCGTG 3'

The results indicated that all four of the tumor cell lines tested (ECV304, K562, PC-3 and 293) express detectable levels of VEGF mRNA although substantially lower quantities (5-10 fold) are present within ECV304 cells. Control PCR using actin primers confirmed that equivalent amounts of cDNA were added to each reaction. Previous studies have demonstrated the production of VEGF by MCF-7 cells (Lewin et al . , 1999).

Effect of the expression of Flt-l^EXTRAFas^TM/CYT0 and Flk- lExτ^RA _Fas ^τM/^cγτ^o _c imeric proteins on the clonoqeneic potential of transfected tumor cell lines

The pCEP4.Flt-l^EXTRAFas^TM/CYT0 and pCEP4. Flk-l^EXTRAFas^TM/CYT0 plasmid vectors were introduced into tumor cells and transfectants selected in Hygromycin B exactly as described in Example 1. As shown in Figure 13, expression of _Fιt-l^E*^TRAFas^w/CYT0 or _Flk-l^EXTRAFas^TM/CYT0 had little if any effect on the clonogenic potential of ECV304 cells, which produce only very low levels of VEGF, as described above. In contrast, Flk-l^ETRAFas^TM/CYT0 but not Flt-l^EXTRAFas^TM/CYT0 substantially inhibited the clonogenic potential of QBI- 293 cells (Figure 14). Finally, both Flt-l^EXTRAFas^TM/CYT0 and _Fl_k_₁ ^Eχτ^RA _Fas ^τM/^cγτo inhibited the clonogenic potential of MCF-7 cells although somewhat better killing was obtained for the Flt-1 construct (Figure 15) . These studies are important as they provide evidence that the naturally occurring form of VEGF constitutively produced by tumor cells can oligomerize the chimeric Flt-l^{E RA}Fas^TM/CYT0 and Flk-l^EXTRAFas^TM/CYT0 molecules to an extent sufficient to trigger the induction of cell death. Differences in the activity of the chimeric proteins in different tumor cells lines reflect the relative concentration of VEGF produced by each of the lines, differences in the affinity of the two chimeric proteins for VEGF and the compounding influence of endogenous Flt-1 and Flk-1 which may interfere with the oligomerization of the chimeric molecules .

REFERENCES

Abe, J. et al . (1998) Heart 19, 400-6.

Baker, S. J. , and Reddy, E. P. (1998). Oncogene 27, 3261-

70.

Brown, J. M. , and Giaccia, A. J. (1998). Cancer Res 58, 1408-16.

Chaplin, D. J. , and Trotter, M. J. (1990). Prog Clin Biol Res, 81-92.

Chiu, R. K. et al. (1999) Exp Cell Res 248, 314-21.

Cooper, D. L., and Dougherty, G. J. (1995). Nat Med 1 , 635-7.

Dougherty, G. J. et al. (1991) J Exp Med 274, 1-5.

Droll, A. et al (1995). J Biol Chem 270, 11567-73.

English, N. M. et al . (1998). Cancer Res 58, 3736-42.

Fraker, P. J. et al (1995) Methods in Cell Biology 46, 57-76.

Fraser, J. R. et al . (1997) . J Intern Med 242, 27-33.

Galland F. et al. (1992). Genomics 13 (2) 475-478 Galland F. et al (1993) . Oncogene 8 (5) 1233-1240

Goldbrunner, R. H. et al (1998) . Microsc Res Tech 43, 250-7.

Gronwald R. et al (1988) . Proc Natl Acad Sci USA 85 (10) 3435-3439.

Gutierrez, L.S. et al (1999). Breast Cancer Research and Treatment 54, 245-53.

Hofmann K. and Tschopp J. (1995) FEBS Lett 371(3) 321-323

Itoh, N. et al (1991). Cell 66, 233-43.

Jones, M. K. et al (1999) Front Biosci 4, D303-9.

Kawaguchi, Y. et al (1997) . Cancer Lett 11 6, 53-9.

Keck, P.J. et al (1989). Science 246, 1309-12.

Knudson, W. et al (1996). Exp Cell Res 228, 216-28.

Kodaira, H. et al . (1998). Jpn J Cancer Res 89, 141-7 .

Laurent, T. C, and Fraser, J. R. (1992). Faseb J 6, 2397-404.

Lesley, J. , and Hyman, R. (1992). Eur J Immunol 22, 2719- 23. Lesley, J. et al (1997). Glycoconj J 14, 611-22.

Lesley, J. et al (1993). Adv Immunol 54, 271-335.

Lewin, M. et al (1999). Int J Cancer 83, 798-802.

Liu, Q. Y. et al (1998). Clin Cancer Res 4, 1803-11.

Matsui T. et al (1989) . Science 243 (4892) 800-804

Minchenko, A. et al (1994). Lab Invest 72, 374-9.

Neufeld, G. et al (1999) . Faseb J 13, 9-22

Nunez, G. et al . (1998). Oncogene 27, 3237-45.

Oksala, 0. et al (1995). J Histochem Cytochem 43, 125-35.

Patterson, C. et al (1995). J Biol Chem 270, 23111-8.

Ponte, P. et al (1984). Nucleic Acids Res 12, 1687-96.

Rooney, P. et al (1995) . Int J Cancer 60, 632-6.

Rudzki, Z., and Jothy, S. (1997). Mol Pathol 50, 57-71.

Salomon, D. S. et al. (1999) Bioessays 21 , 61-70.

Schulze-Osthoff , K. et al (1998). Eur J Biochem 254, 439- 59. Setala, L. P. et al (1999). Br J Cancer 19, 1133-8.

Shibuya, M. et al.(1990) Oncogene 5, 519-24.

Shweiki, D. et al (1992). Nature 359, 843-5.

Springer, T. A. (1990). Nature 346, 425-34.

Stamenkovic I. et al (1989) Cell 56 1057-1062

Staunton D. et al (1988) Cell 52 925-933

Sy, M. S. et al (1997). Curr Opin Oncol 9, 108-12.

Takahashi, K. et al (1999). Int J Cancer 80, 387-95.

Takahashi, T. et al. (1996). J Biol Chem 271, 17555-60.

Takebayashi, H. et al (1996) . Cancer Res 56, 4164-70.

Terman, B.I. et al (1991). Oncogene 6, 1677-83.

Thomas, T. et al (1999). J Cell Physiol 279, 257-66.

Ullrich A. et al (1984) Nature 309 (5967) 418-425

van de Stolpe, A., van der Saag, P. T. (1996). J Mol Med 14 , 13-33.

Vaupel, P. (1996) Adv Exp Med Biol 388, 341-51. Walsh, L. J., and Murphy, G. F. (1992). J Cutan Pathol 19, 161-71.

Wang, Z. et al (1999). Mol Biol Cell 20, 1621-36.

Ware, C. F. et al . (1996) J Cell Biochem 60, 47-55.

Zou, Y. et al (1998). Int J Mol Med 2, 827-34.

Claims

CLAIMS :

1. An isolated nucleic acid encoding a chimeric polypeptide comprising;

(i)an extra-cellular domain which binds multivalent ligand preferentially at the surface of a target cell relative to a non target cell,

(ii) a membrane spanning domain, and

(iii) a cytoplasmic domain which induces cell death in a target cell upon binding of the extra-cellular domain with the multivalent ligand.

2. A nucleic acid according to claim 1 wherein the multivalent ligand is preferentially expressed in the vicinity of the target cell

3. A nucleic acid according to claim 1 wherein the binding of the extra-cellular domain is preferentially activated at the surface of a target cell relative to a non target cell.

4. A nucleic acid according to any one of the preceding claims wherein the target cell is selected from tumour cells, endothelial cells, smooth muscle cells, fibroblasts and hemopoietic cells.

5. A nucleic acid according to any one of the preceding claims wherein the cytoplasmic domain comprises a "death domain" from a member of the Fas/TNFR family.

6. A nucleic acid according to claim 5 wherein the cytoplasmic domain comprises the cytoplasmic domain from a receptor protein which is member of the Fas/TNFR family.

7. A nucleic acid according to claim 6 wherein the receptor protein is Fas.

8. A nucleic acid according to any one of the preceding claims wherein the extracellular domain is a CD44, ICAM- 1, VEGFRl/Flt-1, VEGFR2/KDR/Flk-1, VEGFR3/Flt-4 , PDGFRα, PDGFRβ or EGF receptor extracellular domain.

9. A nucleic acid according to claim 8 encoding an amino acid sequence as shown in any one of Figures 2A, 2B, 3A,

3B, 10A to 10D and 11A to 11D.

10. A nucleic acid according to claim 9 having a nucleic acid sequence as shown in any one of Figures 2A, 2B, 3A, 3B, 10A to 10D and 11A to 11D.

11. An expression vector comprising a nucleic acid according to any one of claims 1 to 10 operably linked to a regulatory element.

12. An expression vector according to claim 11 wherein the regulatory element is functional in a target cell type and not functional in a non-target cell type.

13. An expression vector according to claim 11 wherein the regulatory element is inducible.

14. A host cell comprising an expression vector according to any one of claims 11 to 13.

15 An isolated polypeptide encoded by a nucleic acid according to any one of claims 1 to 10.

16. A pharmaceutical composition comprising a nucleic acid according to any one of claims 1 to 10 or an expression vector according to any one of claims 11 to 13 and a pharmaceutically acceptable excipient.

17. A nucleic acid according to any one of claims 1 to 10, an expression vector according to any one of claims 11 to 13 or a composition according to claim 16 for use in a method of treatment of cancer, autoimmune disease, inflammation, psoriasis or other condition requiring selective destruction of a particular cell type.

18. Use of a nucleic acid according to any one of claims 1 to 10, an expression vector according to any one of claims 11 to 13 or a composition according to claim 16 in the manufacture of a medicament for use in the treatment of cancer, autoimmune disease, inflammation, psoriasis or other condition requiring selective destruction of a particular cell type.

19 A method of producing a polypeptide according to claim 15 comprising;

introducing a nucleic acid according to any one of claims 1 to 10 into a host cell,

causing or allowing expression of said nucleic acid to produce said polypeptide.

20. A method for inducing apoptosis in a target cell comprising;

introducing a nucleic acid according to any one of claims 1 to 10 into a target cell,

causing or allowing expression of said nucleic acid to produce a polypeptide; and,

contacting said polypeptide with a ligand which interacts with said polypeptide,

said interaction causing apoptosis in said target cell.

21. A method according to claim 19 or claim 20 wherein the method is in vitro.