WO2001000678A1 - Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120 - Google Patents

Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120 Download PDF

Info

Publication number
WO2001000678A1
WO2001000678A1 PCT/US2000/017327 US0017327W WO0100678A1 WO 2001000678 A1 WO2001000678 A1 WO 2001000678A1 US 0017327 W US0017327 W US 0017327W WO 0100678 A1 WO0100678 A1 WO 0100678A1
Authority
WO
WIPO (PCT)
Prior art keywords
hiv
antibody
human monoclonal
seq
fabs
Prior art date
Application number
PCT/US2000/017327
Other languages
French (fr)
Inventor
Brynmor A. Watkins
Marvin S. Reitz, Jr.
Original Assignee
The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services filed Critical The Government Of The United States Of America As Represented By The Secretary, Department Of Health And Human Services
Priority to AU57619/00A priority Critical patent/AU5761900A/en
Publication of WO2001000678A1 publication Critical patent/WO2001000678A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses from RNA viruses
    • C07K16/1036—Retroviridae, e.g. leukemia viruses
    • C07K16/1045—Lentiviridae, e.g. HIV, FIV, SIV
    • C07K16/1063—Lentiviridae, e.g. HIV, FIV, SIV env, e.g. gp41, gp110/120, gp160, V3, PND, CD4 binding site
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A61P31/18—Antivirals for RNA viruses for HIV
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55—Fab or Fab'

Definitions

  • the present invention relates to human monoclonal antibodies to type 1 human immunodeficiency virus (HIV-1) envelope glycoprotein gpl20.
  • the present invention also relates to the phage display libraries from which the antibodies were j p. isolated.
  • This invention further relates to diagnostic methods and to pharmaceutical compositions which employ these antibodies therapeutically and prophylactically.
  • HIV Human immunodeficiency virus
  • HIV-1 type 1
  • HIV-2 type 2
  • vpr vif, tat, rev, nef and vpu genes which regulate viral production in various ways.
  • the HIV env gene encodes two envelope glycoproteins, gpl20 and gp41, and the binding of gpl20 to the CD4 molecule on the surface of a primate T cell or mononuclear phagocyte is the first step during an HIV infection.
  • gpl20 can be divided into five conservative domains (Cl through C5) and five variable domains (VI through V5) (17).
  • the third variable domain (V3 loop) and the CD4 binding site on the gpl20 protein have been identified as the principle 0 neutralizing determinants of HIV-1.
  • a phage display vector for the expression of human Fabs (20, 21) was used to construct a series of Fab libraries from RNA isolated from the lymph node of a type 1 human immunodeficiency virus (HIV-1) seropositive 5 individual undergoing surgery for lymph-adenopathy and twenty-one human monoclonal antibodies to the HIV-1 g ⁇ l20 protein were selected from these libraries.
  • HIV-1 human immunodeficiency virus
  • the present invention relates to human monoclonal antibodies to the 0 HIV-1 envelope glycoprotein gpl20 or peptide fragments thereof.
  • the present invention relates to the isolation and characterization of 21 monoclonal antibodies, seven of which recognize the CD4 binding site of gpl20, eight of which recognize the V3 loop and six of which recognize an as yet unidentified epitope of 5 gpl20.
  • the invention also relates to nucleic acid molecules encoding the heavy and light chain immunoglobulin variable region amino acid sequences of the 21 antibodies to the HIV g ⁇ l20 protein. 30 The invention further relates to diagnostic methods which utilize these human monoclonal antibodies to screen for the presence of HIV in biological samples.
  • the invention also relates to the use of these human monoclonal antibodies as diagnostic and therapeutic reagents, and to pharmaceutical compositions _ _ which comprise these human monoclonal antibodies.
  • these antibodies were isolated from three Fab phage display libraries prepared from lymph node RNA isolated from an HIV-1 -seropositive patient, the invention also relates to the three Fab phage display libraries. These libraries provide a tool for identifying additional human antibodies to HIV-1 or to other pathogens that the individual from whose RNA the libraries were prepared may have been exposed to.
  • Figure 1 shows deduced heavy chain variable region amino acid sequences for Fabs 1-7.
  • Figure 2 shows deduced light chain variable region amino acid sequences for Fabs 1-7.
  • Figure 3 shows alignment of VH DNA sequences for Fabs 1 -7 with the nearest described germline sequences.
  • r Figure 4 shows alignment of Vk DNA sequences for Fabs 1-7 with the nearest described germline sequences.
  • Figure 5 shows the relative binding of biotinylated Fab fragments to gpl20 as measured by ELISA in a 2-fold dilution series. Data points represent the mean of 4 determinations and error bars are the standard error of the mean. 20
  • Figure 6 shows competition of the binding of biotinylated Fab fragments to recombinant gpl20 in ELISA by recombinant F105 Fab. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
  • Figure 7 shows competition of the binding of biotinylated Fab fragments to recombinant gpl20 in ELISA by recombinant CD4. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
  • Figure 8 shows competition of binding of biotinylated Fabs 1-7 to recombinant gpl20 in ELISA by each of the other unbiotinylated Fab fragments. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
  • Figure 9 shows binding of biotinylated Fabs 1-7 to HIV-1 lysates of different strains of HIV-1 as measured by ELISA. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
  • the present invention relates to human monoclonal antibodies to HIV-1 gpl20, where the antibodies are isolated as Fab fragments from three Fab phage display libraries prepared from lymph node RNA isolated from an HIV-1 -seropositive patient.
  • antibody as used throughout the specification and claims 0 includes immunoglobulin molecules (i.e. two Fab fragments and one Fc fragment) and antigen binding fragments of intact immunoglobulin molecules such as Fab fragments. Methods for producing an intact immunoglobulin from isolated Fab fragments by combining Fab fragments with an Fc domain are known to those of skilled in the art.
  • the present invention relates to twenty-one human monoclonal antibodies having specified heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences in pairs (H:L) which confer the ability to bind to specific epitopes on the gpl20 of HIV-1.
  • the present invention therefore relates to the heavy chain 0 immunoglobulin variable region amino acid sequences shown in the sequence listing as SEQ ID NO: 43 through SEQ ID NO: 49, SEQ ID NO: 5-7 through SEQ ID NO: 64, and SEQ ID NO: 73 through SEQ ID NO: 78, and the light chain immunoglobulin variable region amino acid sequences shown in the sequence listing as SEQ ID NO: 50 5 through SEQ ID NO: 56, SEQ ID NO: 65 through SEQ ID NO: 22, and SEQ ID NO:
  • the human monoclonal antibody of this invention immunoreacts with the CD4 binding site of gpl20 protein of HIV-1, and has a heavy 0 chain amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 1
  • the human monoclonal antibody of this 5 invention immunoreacts with the V3 loop of gpl20 protein of HIV-1, and has a heavy chain amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 57 through SEQ ID NO: 64, and a light chain immunoglobulin variable region amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 65 through SEQ ID NO: 72.
  • the present invention also relates to nucleic acid molecules encoding the heavy and light chain immunoglobulin variable region amino acid sequences of this invention where these sequences are shown in the sequence listing as SEQ ID NO: 1 through SEQ ID NO: 42 (SEQ ID NO: 1 encodes SEQ ID NO:43; SEQ ID NO: 2 encodes SEQ ID NO. 44, etc.).
  • the present invention also relates to human antibodies comprising an Fab fragment derived from a human monoclonal antibody of this invention and the human Fc domain derived from an IgG subtype.
  • the intact immunoglobulin IgG molecules are preferable to immunoglobulin molecules containing Fab fragments alone.
  • the present invention also relates to the three Fab phage display libraries from which the human monoclonal antibodies of this invention were isolated. These phage display libraries have been deposited with the American Type Culture Collection (ATCC). The ATCC accession numbers for the phage display libraries L938, L939 and L944 are PTA-193, PTA-194 and PTA-195, respectively.
  • the invention further relates to methods of making human monoclonal antibodies from the phage display libraries L938, L939 and L944.
  • the method for isolating a human monoclonal antibody from these phage display libraries involves (1) using immunoaffinity techniques such as panning to select phage particles that immunoreact with a preselected antigen; (2) transforming bacteria with the selected phage particles; (3) preparing and analyzing the phagemid DNA from the colonies recovered; and (4) expressing and purifying soluble Fab fragments from clones of interest for further analysis.
  • immunoaffinity techniques such as panning to select phage particles that immunoreact with a preselected antigen
  • transforming bacteria with the selected phage particles (3) preparing and analyzing the phagemid DNA from the colonies recovered; and (4) expressing and purifying soluble Fab fragments from clones of interest for further analysis.
  • the invention also relates to the use of these human monoclonal antibodies as diagnostic agents.
  • the antibodies can be used as an in vitro diagnostic agent to test for the presence of HIV-1 in biological samples.
  • a sample such as biological fluid or tissue obtained from an individual is contacted with a diagnostically effective amount of one or more of the human monoclonal antibodies of this invention under conditions which will allow the formation of an immunological complex between the antibody and the HIV-1 antigen that may be present in the sample.
  • the formation of an immunological complex which indicates the presence of HIV-1 in the sample is then detected by immunoassays.
  • assays include, but are not limited to, radioimmunoassays, Western blot assay, immunofluorescent assay, enzyme immunoassay, chemiluminescent assay, immunohistochemical assay and the like.
  • a human monoclonal antibody which is cross-reactive with multiple HIV strains is used for diagnosing HIV-1.
  • preferred antibodies are Fabs 1 , 2 and 4 which are immunoreactive with all three isolates of HIV-1 tested (Illb, Ba-L and MN), and Fabs 5, 6, and 7 which are immunoreactive with two of the three isolates of HIV-1 tested.
  • the invention also relates to the use of the antibodies of the invention in passive immunotherapy of HIV infection.
  • neutralization is measured as the ability of the antibody to inhibit HIV-1 infection.
  • target cells are incubated with HIV-1 in the presence of the antibody to be tested, and the degree of infection is assessed after at least about 5 days in culture by immunofluorescence staining for HIV- 1 to assess percent of HIV-1 positive cells.
  • Target cells can be any HIV-1 susceptible cells, although H9 cells are preferred.
  • Well-characterized HIV-1 neutralizing antibodies are run in parallel as controls. Neutralizing antibody titer are defined as the reciprocal of the monoclonal antibody concentration at which infectivity levels are 60% of control following normalization of the data to control values.
  • the patient When used in passive immunotherapy, the patient is administered a therapeutically effective amount of one or more neutralizing human monoclonal antibodies.
  • the passive immunotherapy of this invention may be practiced on individuals exhibiting AIDS or related conditions caused by HIV infection, or individuals at risk of HIV infection.
  • a therapeutically effective amount of a human monoclonal antibody for individual patients may be determined by titrating the amount of antibody given to the individual to arrive at the therapeutic or prophylactic effect while minimizing side effects.
  • the effective amount can be measured by serological decreases in the amount of HIV-1 antigens in the individual.
  • the plasma concentration for individuals receiving the treatment is typically between 0.1 ug/ml to 100 ug/ml.
  • the human monoclonal antibodies of this invention may be administered via one of several routes including, but not limited to intravenous, intraperitoneal, intramuscular, subcutaneous, transdermal and the like.
  • the present invention therefore relates to pharmaceutical compositions comprising at least one antibody of the invention and a pharmaceutically acceptable carrier where such carriers may include physiologically acceptable buffers, for example, saline or phosphate buffered saline.
  • physiologically acceptable buffers for example, saline or phosphate buffered saline.
  • the present invention further relates to anti-idiotypic antibodies to the monoclonal antibodies of this invention.
  • an anti-idiotypic antibody can be prepared by immunizing a host animal with a monoclonal antibody of this invention by methods known to those of skill in the art. To eliminate an immunogenic response to the Fc region, antibodies produced by the same species as the host animal can be used or the Fc region of the administered antibodies can be removed. The anti-idiotypic antibodies produced can be used to prepare pharmaceutical compositions rather than using the monoclonal antibodies of this invention.
  • Vector pL537 was constructed from previously described vector pCOMB3 (1, 2) but differs from pCOMB3 in several aspects. More specifically, the cloning of heavy chains has been simplified by the addition of the human IgGl hinge region, two restriction sites present in human immunoglobulin genes have been removed, and some sequences have included to enhance the expression and ease of Fab purification.
  • Sac-I restriction site used in vector pCOMB3 for the cloning of light chains, was replaced with a Bgl-II restriction site by using mutagenic PCR primers (SEQ ID NO: 85: CCGCTTAACTCTAGAACTGACGAGATCTGCATG and
  • SEQ ID NO:86 GTGAAACTGCTCGAGGTCGAC
  • Sac-I sites occur in the human Ck gene, and in all human VHiv family genes.
  • the cloning of Fd fragments was changed by including part of the human IgGl hinge region, and using Sfi-I in place of Spe-I to clone these genes. This was done because of previous observation that Spe-I sites occur with a frequency of approximately 25% in human V H genes, though they are rarely found in germline genes (13).
  • the heavy chain leader sequence was changed by inserting a linker formed with oligonucleotides SEQ ID NO: 87: CATGGGCGGTGGGGTCAC and
  • SEQ ID NO: 88 TCGAGTGACCCACCGCC. This replaced the first five amino acid residues of a mouse V H (AQVKL) region present in pCOMB3, with the amino acid sequence GGGS.
  • the light chain leader sequence was similarly modified by inserting a linker formed by oligonucleotides SEQ ID NO: 89: CATGGGGGGAGGCTCA and SEQ ID NO: 90: GATCTGAGCCTCCCCC, together with the Nhe-I/Nco-I fragment of pCOMB 3 via Nhe-1 and Bgl-II. This construct was sequenced throughout the modified region, to ensure not only that the modifications were correct, but that the PCR amplified regions had not been subject to Taq polym erase error.
  • a metal co-ordination site composed of six histidines [His] 6 ) was accomplished by inserting a phosphorylated linker formed from oligonucleotides SEQ ID NO: 91 : CTAGTGCCTAGGTTGGTACCGAGAGGTTC- GCACCATCACCACCATCATG and SEQ ID NO: 92: CTAGCATGATGGTGGTG- ATGG-TGCGAACCTCTCGGTACCAACCTAGGCA into the Nhe-I site.
  • the original Nhe-I site is retained, and an Avr-II site has been added 30 nucleotides before the Nhe-1 site.
  • the 30 nucleotides between the Avr-II and Nhe-I sites encode Factor Xa (FXa) recognition site and six histidines that form the metal coordination site.
  • FXa Factor Xa
  • RNA was prepared from the enriched B-lymphocyte population from a lymph node of a HIV-1 seropositive individual using standard techniques (10).
  • the heavy ( ⁇ l , Fd region) and light chain (K) immunoglobulin genes in this RNA were amplified as described previously (13) with the single exception of the reverse primers for the heavy chain, which were changed to accommodate the Sfi-I site in vector pL537.
  • These primers were IgG: GGGCTCGGCCTTCTTGGCCACCTTGGTGTTGCT (SEQ ID NO: 93);
  • IgA GCAGGGGGCCGTCACGGCCTGGGCTGGGATTCGT (SEQ ID NO: 94);
  • IgM IgM:
  • K light chains amplified in this way were cloned in to pL537 via Xba-I and Bgl-II (Boehringer-Mannheim, Indianapolis, IN), using 2 ⁇ g of digested vector and 300ng of digested PCR products, ligated overnight at 12°C with T4 ligase (Stratagene, La Jolla, CA) and electroporated into E.coli strain DH10B using the Cell-Porator (both from Life Technologies Inc, Gaithersburg, MD).
  • the electroporated DHlOBs were grown in SOC for lhr at room temperature, then titered in serial 100-fold dilutions (to estimate the size of the libraries) by plating onto LB plates supplemented with 100 ⁇ g/mL ampicillin. The remaining bacteria were expanded to a final volume of 500 mL in LB broth containing lOO ⁇ g/mL ampicillin and 2% D-glucose, and grown overnight at room temperature. Plasmid was prepared from this cultures using standard techniques (10), the K-chain library was composed of 7 xl0 ? members.
  • Plasmid prepared from this library was digested with Xho-I and Sfi-I and ligated to similarly digested PCR-amplified Fd fragments, as described for the K chains. Electroporation, titration and plasmid preparation were performed exactly as described for the K libraries, and the final library titers were as follows: IgG/ ⁇ : 2 xlO 7 ; IgA/ ⁇ : 2 xlO 6 , IgM/ ⁇ : 1 xl06. The plasmids produced from these constructs were then introduced into E.coli XL-1 Blue (Stratagene, La Jolla, CA) and titered as described above.
  • the 0 library of antibody cDNAs in the culture after transfromation was then expressed on bacteriophage by superinfection with helper phage Ml 3. These phage preparations were precipitated by addition of 20% volume/volume of a solution containing 20% polyethylene glycol (PEG) 8000 weight/volume and 2.5M NaCl and incubation on ice
  • PEG polyethylene glycol
  • This DNA was digested with Xho-I and Xba-I to determine the presence of a 1.7kB insert, indicating the presence of both Fd and K chain inserts.
  • Clones containing both Fd and K chain inserts were converted to soluble Fab expression constructs and sequenced to determine the V-region sequences.
  • VH forward primer CCTCACTAAAGGGAACAAAAGCT
  • VH reverse primer IgM ATGGAGTCGGGAAGGAAGTCCTGT
  • VH reverse primer IgG GTTCGGGGAAGTAGTCCTTGAGGAG
  • VL forward primer ACGAATTCTAAACTAGCTAGTCGC (SEQ ID NO: 99)
  • VL reverse primer GGGATAGAAGTTATTCAGCA (SEQ ID NO: 100).
  • the forward primer sequences are based on unique vector sequences approximately 100 nucleotides 5' of the cloning sites for either the Fd fragment or K chain.
  • the reverse primer sequences are based on the sequence of the appropriate constant region, and located approximately 100 nucleotides 3' of the J/C slice site. Germline gene assignment was performed using Vbase (12). Expression and purification of soluble Fab fragments
  • Constructs for the expression of Fab were prepared by digesting the relevant pComb3 construct with Spe-I and Nhe-I and re-ligating, thus eliminating coat protein 3 gene and allowing expression of Fab.
  • Two of the clones isolated contained internal Spe-I sites, but this potential problem was circumvented by isolating the additional fragment, ligating it into the rest of the plasmid, then checking the resulting clones carefully to ensure correct orientation of the insert.
  • Expression of soluble Fab fragments was achieved by growing XL-1 Blue containing the relevant phagemid overnight at 30°C in 2xYT medium containing ampicillin (50 ⁇ g/mL), IPTG (ImM) and MgCl (20mM).
  • the bacteria were then harvested by centrifugation, and the release of the Fab fragments was achieved by hypotonic lysozyme treatment using previously described protocols (15).
  • the resulting Fab preparations were purified on anti-Fab columns as previously described (3). Biotinylation was performed using biotin-LC-hydrazide (Pierce, Rockford, II) in accordance with the manufacturer's instructions.
  • ELISAs were performed using standard methods with recombinant gpl20 or viral lysates as antigens. Microtiter plates were coated with antigen in carbonate/ bicarbonate buffer, pH 9.4, at lOOng/well in a volume of 100 ⁇ L.
  • an Fab construct was made containing the V-region genes from F105, a human monoclonal antibody isolated using human hybridoma technology (9). The gene sequences were based on the published sequences of the F105 V-region genes (7), and constructed by overlapping long oligonucleotides by Midland (Austin, TX).
  • V-region genes were confirmed by sequencing, then subcloned into Fab expression vector pL604 (3) and expressed as Fab fragments as described above. Binding assays were performed with purified, biotinylated Fab fragments detected with Europium (Eu) labelled streptavidin (Wallac, Gaithersburg, MD). Binding was measured using a Wallac 1232 Delphia Research Fluorimeter in accordance with the manufacturer's instructions.
  • the phage display libraries of this invention were deposited on June 8, 1999, with the American Type Culture Collection (ATCC).
  • ATCC accession numbers for the phage display libraries L938, L939 and L944 are PTA-193, PTA-194 and PTA-195, respectively.
  • Fabs 1-6 Seven colonies were recovered from panning with the three phage display libraries for the presence of Fabs that specifically recognized the CD4 binding site of HIV-1 envelope protein gpl20. Restriction analysis revealed that six were from the IgG library (Fabs 1-6) and one from the IgM library (Fab 7). The phage isolated from the three libraries were converted to soluble Fab expression plasmids, by digestion of phagemid DNA with Spe-I and Nhe-I followed by re-ligation, thus eliminating the gene for Ml 3 cpIII.
  • V-region sequences from Fabs 1-7 indicated that they were all different ( Figures 1 and 2) , and analysis of the CHI sequences from Fabs 1-6 showed that they were all IgGj.
  • Assignment of V-region germline genes indicated that 4 V H genes were from the V H 3 family (Fabs 1 , 3, 5 and 6), 2 were from the VH4 family (Fabs 2 and 7) and one form the VHI family (Fab 4), while 5 of the V ⁇ genes were from the V ⁇ 3 family (Fabs 1, 2, 3, 5 and 6) and 2 were from the V ⁇ 1 family (Fabs 4 and 7).
  • Fab 6 was the least resistant to inhibition by soluble CD4, with 50% inhibition observed at a CD4 concentration of approximately 0.2 ⁇ g/mL.
  • Fabs 4 and 7 were most resistant to inhibition by CD4, with 50% inhibition occurring at between 0.7 and 0.8 ⁇ g/mL.
  • F105 Fab showed 50% inhibition at a CD4 concentration of approximately 0.6 ⁇ g/mL ( Figure 7).
  • Fabs 2 and 5 were similar to F 105 with 50% inhibition occurring at a CD4 concentration of 0.5 ⁇ g/mL, while two, Fabs 1 and 3, showed 50% inhibition at a CD4 concentration of approximately 0.3 ⁇ g/mL. Overall, all eight Fabs tested showed broadly similar susceptibility to inhibition by CD4.
  • Fabs were selected was derived from a clone of HIV-1 derived from HIV-1 m t ,. The binding to HIV-I M N and HIV-l ⁇ a-L was mixed; only Fab 2 bound about equally well to all three isolates; Fab 3 showed little reactivity to either MN or Ba-L; Fabs 5 and 7
  • Fabs (Fabs 1 , 2 and 4) showed relatively strong reactivity with all three isolates of 35 HIV-1 tested, while only one Fab (Fab 3) appeared to be restricted to only Illb. No binding to HIV-2, sy / s bi was seen with any of the Fabs.

Abstract

This invention relates to 21 monoclonal antibodies to HIV-1 gp120 which were isolated from three Fab libraries prepared from RNA isolated from the lymph node of a type 1 human immunodeficiency virus (HIV-1) seropositive individual. Of the 21 antibodies, seven recognize the CD4 binding site of gp120, eight recognize the V3 loop and six recognize an as yet unidentified epitope of gp120. This invention further relates to diagnostic methods which utilize the antibodies and to pharmaceutical compositions which employ these antibodies therapeutically and prophylactically.

Description

TITLE OF THE INVENTION
HUMAN MONOCLONAL ANTIBODIES TO HIV-1 ENVELOPE GLYCOPROTEIN GP120
5 FIELD OF THE INVENTION
The present invention relates to human monoclonal antibodies to type 1 human immunodeficiency virus (HIV-1) envelope glycoprotein gpl20. The present invention also relates to the phage display libraries from which the antibodies were j p. isolated. This invention further relates to diagnostic methods and to pharmaceutical compositions which employ these antibodies therapeutically and prophylactically.
BACKGROUND OF THE INVENTION
Human immunodeficiency virus (HIV), a member of the lentivirus ^ family of animal retroviruses, is the causative agent of Acquired Immune Deficiency
Syndrome (AIDS). To date, two closely related types of HIV, type 1 (HIV-1) and type 2 (HIV-2), have been identified and characterized on the molecular level. In addition to the typical retrovirus genes such as gag, env and pol, the HIV genome also includes 20 vpr, vif, tat, rev, nef and vpu genes which regulate viral production in various ways.
Many antibodies immunoreactive with various proteins encoded by HIV have been isolated and these antibodies provide a useful tool for the diagnosis of HIV. However, given the strain heterogeneity of the HIV viruses, there continues to be a need to identify large numbers of additional human antibodies to HIV. In addition,
25 the study of large numbers of human antibodies to HIV would accelerate the development of vaccines against HIV.
Recent advances in recombinant antibody technology have greatly increased the ease with which antibodies can be modified to manipulate their
30 specificity and binding characteristics. The most promising of these advances has been the construction of antibody phage display libraries from variable heavy and light chain antibody genes using a phage display vector specifically designed for the expression of antibody fragments to an antigen (2, 16). From such libraries, large 35 numbers of human monoclonal antibodies to an antigen of choice including HIV-1, can be cloned and isolated.
The HIV env gene encodes two envelope glycoproteins, gpl20 and gp41, and the binding of gpl20 to the CD4 molecule on the surface of a primate T cell or mononuclear phagocyte is the first step during an HIV infection.
Comparison of different HIV-1 isolates have revealed that the structure of gpl20 can be divided into five conservative domains (Cl through C5) and five variable domains (VI through V5) (17). The third variable domain (V3 loop) and the CD4 binding site on the gpl20 protein have been identified as the principle 0 neutralizing determinants of HIV-1.
In the present invention, a phage display vector for the expression of human Fabs (20, 21) was used to construct a series of Fab libraries from RNA isolated from the lymph node of a type 1 human immunodeficiency virus (HIV-1) seropositive 5 individual undergoing surgery for lymph-adenopathy and twenty-one human monoclonal antibodies to the HIV-1 gρl20 protein were selected from these libraries.
SUMMARY OF THE INVENTION
The present invention relates to human monoclonal antibodies to the 0 HIV-1 envelope glycoprotein gpl20 or peptide fragments thereof. In particular, the present invention relates to the isolation and characterization of 21 monoclonal antibodies, seven of which recognize the CD4 binding site of gpl20, eight of which recognize the V3 loop and six of which recognize an as yet unidentified epitope of 5 gpl20.
The invention also relates to nucleic acid molecules encoding the heavy and light chain immunoglobulin variable region amino acid sequences of the 21 antibodies to the HIV gρl20 protein. 30 The invention further relates to diagnostic methods which utilize these human monoclonal antibodies to screen for the presence of HIV in biological samples.
The invention also relates to the use of these human monoclonal antibodies as diagnostic and therapeutic reagents, and to pharmaceutical compositions _ _ which comprise these human monoclonal antibodies. o As these antibodies were isolated from three Fab phage display libraries prepared from lymph node RNA isolated from an HIV-1 -seropositive patient, the invention also relates to the three Fab phage display libraries. These libraries provide a tool for identifying additional human antibodies to HIV-1 or to other pathogens that the individual from whose RNA the libraries were prepared may have been exposed to.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows deduced heavy chain variable region amino acid sequences for Fabs 1-7. 10 Figure 2 shows deduced light chain variable region amino acid sequences for Fabs 1-7.
Figure 3 shows alignment of VH DNA sequences for Fabs 1 -7 with the nearest described germline sequences. , r Figure 4 shows alignment of Vk DNA sequences for Fabs 1-7 with the nearest described germline sequences.
Figure 5 shows the relative binding of biotinylated Fab fragments to gpl20 as measured by ELISA in a 2-fold dilution series. Data points represent the mean of 4 determinations and error bars are the standard error of the mean. 20
Figure 6 shows competition of the binding of biotinylated Fab fragments to recombinant gpl20 in ELISA by recombinant F105 Fab. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
2* Figure 7 shows competition of the binding of biotinylated Fab fragments to recombinant gpl20 in ELISA by recombinant CD4. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
30 Figure 8 shows competition of binding of biotinylated Fabs 1-7 to recombinant gpl20 in ELISA by each of the other unbiotinylated Fab fragments. Data points represent the mean of 4 determinations and error bars are the standard error of the mean. o Figure 9 shows binding of biotinylated Fabs 1-7 to HIV-1 lysates of different strains of HIV-1 as measured by ELISA. Data points represent the mean of 4 determinations and error bars are the standard error of the mean.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to human monoclonal antibodies to HIV-1 gpl20, where the antibodies are isolated as Fab fragments from three Fab phage display libraries prepared from lymph node RNA isolated from an HIV-1 -seropositive patient. The phrase "antibody" as used throughout the specification and claims 0 includes immunoglobulin molecules (i.e. two Fab fragments and one Fc fragment) and antigen binding fragments of intact immunoglobulin molecules such as Fab fragments. Methods for producing an intact immunoglobulin from isolated Fab fragments by combining Fab fragments with an Fc domain are known to those of skilled in the art. , In particular, the present invention relates to twenty-one human monoclonal antibodies having specified heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences in pairs (H:L) which confer the ability to bind to specific epitopes on the gpl20 of HIV-1.
The present invention therefore relates to the heavy chain 0 immunoglobulin variable region amino acid sequences shown in the sequence listing as SEQ ID NO: 43 through SEQ ID NO: 49, SEQ ID NO: 5-7 through SEQ ID NO: 64, and SEQ ID NO: 73 through SEQ ID NO: 78, and the light chain immunoglobulin variable region amino acid sequences shown in the sequence listing as SEQ ID NO: 50 5 through SEQ ID NO: 56, SEQ ID NO: 65 through SEQ ID NO: 22, and SEQ ID NO:
79 through SEQ ID NO: 84.
In one embodiment, the human monoclonal antibody of this invention immunoreacts with the CD4 binding site of gpl20 protein of HIV-1, and has a heavy 0 chain amino acid sequence selected from the group of sequences consisting of SEQ ID
NO: 43 through SEQ ID NO: 49, and a light chain immunoglobulin variable region amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 50 through SEQ ID NO: 56.
In another embodiment, the human monoclonal antibody of this 5 invention immunoreacts with the V3 loop of gpl20 protein of HIV-1, and has a heavy chain amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 57 through SEQ ID NO: 64, and a light chain immunoglobulin variable region amino acid sequence selected from the group of sequences consisting of SEQ ID NO: 65 through SEQ ID NO: 72.
The present invention also relates to nucleic acid molecules encoding the heavy and light chain immunoglobulin variable region amino acid sequences of this invention where these sequences are shown in the sequence listing as SEQ ID NO: 1 through SEQ ID NO: 42 (SEQ ID NO: 1 encodes SEQ ID NO:43; SEQ ID NO: 2 encodes SEQ ID NO. 44, etc.).
Of course, due to the degeneracy of the genetic code, variations are contemplated in the sequences shown in SEQ ID NO: 1 through SEQ ID NO: 42 which will result in nucleic acid sequences that are capable of directing production of antibodies that are identical to the antibodies encoded by the sequences shown in SEQ ID NO: 1 through SEQ ID NO: 42. It should be noted that the DNA sequences set forth above represent a preferred embodiment of the present invention.
The present invention also relates to human antibodies comprising an Fab fragment derived from a human monoclonal antibody of this invention and the human Fc domain derived from an IgG subtype. The intact immunoglobulin IgG molecules are preferable to immunoglobulin molecules containing Fab fragments alone.
The present invention also relates to the three Fab phage display libraries from which the human monoclonal antibodies of this invention were isolated. These phage display libraries have been deposited with the American Type Culture Collection (ATCC). The ATCC accession numbers for the phage display libraries L938, L939 and L944 are PTA-193, PTA-194 and PTA-195, respectively.
The invention further relates to methods of making human monoclonal antibodies from the phage display libraries L938, L939 and L944.
In a preferred embodiment, the method for isolating a human monoclonal antibody from these phage display libraries involves (1) using immunoaffinity techniques such as panning to select phage particles that immunoreact with a preselected antigen; (2) transforming bacteria with the selected phage particles; (3) preparing and analyzing the phagemid DNA from the colonies recovered; and (4) expressing and purifying soluble Fab fragments from clones of interest for further analysis.
By using the method disclosed above, additional human monoclonal antibodies to HIV- 1 or to any other pathogens that may exist in the individual from whose RNA the libraries were prepared can be isolated from the phage display libraries of this invention.
The invention also relates to the use of these human monoclonal antibodies as diagnostic agents.
The antibodies can be used as an in vitro diagnostic agent to test for the presence of HIV-1 in biological samples. In one embodiment, a sample such as biological fluid or tissue obtained from an individual is contacted with a diagnostically effective amount of one or more of the human monoclonal antibodies of this invention under conditions which will allow the formation of an immunological complex between the antibody and the HIV-1 antigen that may be present in the sample. The formation of an immunological complex which indicates the presence of HIV-1 in the sample, is then detected by immunoassays. Such assays include, but are not limited to, radioimmunoassays, Western blot assay, immunofluorescent assay, enzyme immunoassay, chemiluminescent assay, immunohistochemical assay and the like. In a preferred embodiment, a human monoclonal antibody which is cross-reactive with multiple HIV strains is used for diagnosing HIV-1. Of the 21 antibodies disclosed in this invention, preferred antibodies are Fabs 1 , 2 and 4 which are immunoreactive with all three isolates of HIV-1 tested (Illb, Ba-L and MN), and Fabs 5, 6, and 7 which are immunoreactive with two of the three isolates of HIV-1 tested.
As the human monoclonal antibodies of this invention may possess the ability to neutralize HIV-1 isolates, the invention also relates to the use of the antibodies of the invention in passive immunotherapy of HIV infection.
To determine whether the twenty-one antibodies described in the Examples or any other antibodies isolated from the phage display libraries L938, L939 and L944 neutralize bound HIV-1 viruses, different neutralization assays may be employed. In a preferred method, neutralization is measured as the ability of the antibody to inhibit HIV-1 infection. In this method, target cells are incubated with HIV-1 in the presence of the antibody to be tested, and the degree of infection is assessed after at least about 5 days in culture by immunofluorescence staining for HIV- 1 to assess percent of HIV-1 positive cells. Target cells can be any HIV-1 susceptible cells, although H9 cells are preferred. Well-characterized HIV-1 neutralizing antibodies are run in parallel as controls. Neutralizing antibody titer are defined as the reciprocal of the monoclonal antibody concentration at which infectivity levels are 60% of control following normalization of the data to control values.
When used in passive immunotherapy, the patient is administered a therapeutically effective amount of one or more neutralizing human monoclonal antibodies. The passive immunotherapy of this invention may be practiced on individuals exhibiting AIDS or related conditions caused by HIV infection, or individuals at risk of HIV infection.
A therapeutically effective amount of a human monoclonal antibody for individual patients may be determined by titrating the amount of antibody given to the individual to arrive at the therapeutic or prophylactic effect while minimizing side effects. The effective amount can be measured by serological decreases in the amount of HIV-1 antigens in the individual. The plasma concentration for individuals receiving the treatment is typically between 0.1 ug/ml to 100 ug/ml.
The human monoclonal antibodies of this invention may be administered via one of several routes including, but not limited to intravenous, intraperitoneal, intramuscular, subcutaneous, transdermal and the like.
The present invention therefore relates to pharmaceutical compositions comprising at least one antibody of the invention and a pharmaceutically acceptable carrier where such carriers may include physiologically acceptable buffers, for example, saline or phosphate buffered saline.
The present invention further relates to anti-idiotypic antibodies to the monoclonal antibodies of this invention. In one embodiment, an anti-idiotypic antibody can be prepared by immunizing a host animal with a monoclonal antibody of this invention by methods known to those of skill in the art. To eliminate an immunogenic response to the Fc region, antibodies produced by the same species as the host animal can be used or the Fc region of the administered antibodies can be removed. The anti-idiotypic antibodies produced can be used to prepare pharmaceutical compositions rather than using the monoclonal antibodies of this invention.
The present invention will now be described by way of examples, which are meant to illustrate, but not limit, the scope of the invention.
EXAMPLE
Isolation and Characterization of Human Monoclonal Antibodies to the CD-4 binding Site of HIV-1
Materials and Methods
Construction of Fab phage display vector pL537
Vector pL537 was constructed from previously described vector pCOMB3 (1, 2) but differs from pCOMB3 in several aspects. More specifically, the cloning of heavy chains has been simplified by the addition of the human IgGl hinge region, two restriction sites present in human immunoglobulin genes have been removed, and some sequences have included to enhance the expression and ease of Fab purification.
The Sac-I restriction site, used in vector pCOMB3 for the cloning of light chains, was replaced with a Bgl-II restriction site by using mutagenic PCR primers (SEQ ID NO: 85: CCGCTTAACTCTAGAACTGACGAGATCTGCATG and
SEQ ID NO:86: GTGAAACTGCTCGAGGTCGAC) to amplify and then replace part of vector pCOMB3 from Xho-I and Xba-I. Sac-I sites occur in the human Ck gene, and in all human VHiv family genes. The cloning of Fd fragments was changed by including part of the human IgGl hinge region, and using Sfi-I in place of Spe-I to clone these genes. This was done because of previous observation that Spe-I sites occur with a frequency of approximately 25% in human VH genes, though they are rarely found in germline genes (13).
The heavy chain leader sequence was changed by inserting a linker formed with oligonucleotides SEQ ID NO: 87: CATGGGCGGTGGGGTCAC and
SEQ ID NO: 88: TCGAGTGACCCACCGCC. This replaced the first five amino acid residues of a mouse VH (AQVKL) region present in pCOMB3, with the amino acid sequence GGGS. The light chain leader sequence was similarly modified by inserting a linker formed by oligonucleotides SEQ ID NO: 89: CATGGGGGGAGGCTCA and SEQ ID NO: 90: GATCTGAGCCTCCCCC, together with the Nhe-I/Nco-I fragment of pCOMB 3 via Nhe-1 and Bgl-II. This construct was sequenced throughout the modified region, to ensure not only that the modifications were correct, but that the PCR amplified regions had not been subject to Taq polym erase error.
The incorporation of a metal co-ordination site composed of six histidines ([His]6) was accomplished by inserting a phosphorylated linker formed from oligonucleotides SEQ ID NO: 91 : CTAGTGCCTAGGTTGGTACCGAGAGGTTC- GCACCATCACCACCATCATG and SEQ ID NO: 92: CTAGCATGATGGTGGTG- ATGG-TGCGAACCTCTCGGTACCAACCTAGGCA into the Nhe-I site. In the resulting construct, the original Nhe-I site is retained, and an Avr-II site has been added 30 nucleotides before the Nhe-1 site. The 30 nucleotides between the Avr-II and Nhe-I sites encode Factor Xa (FXa) recognition site and six histidines that form the metal coordination site.
Library Construction
Total RNA was prepared from the enriched B-lymphocyte population from a lymph node of a HIV-1 seropositive individual using standard techniques (10). The heavy (γl , Fd region) and light chain (K) immunoglobulin genes in this RNA were amplified as described previously (13) with the single exception of the reverse primers for the heavy chain, which were changed to accommodate the Sfi-I site in vector pL537. These primers were IgG: GGGCTCGGCCTTCTTGGCCACCTTGGTGTTGCT (SEQ ID NO: 93); IgA: GCAGGGGGCCGTCACGGCCTGGGCTGGGATTCGT (SEQ ID NO: 94); IgM:
CACTGGGGCCGGCACGG-CCTTTTCTTTGTTGCCG (SEQ ID NO: 95). K light chains amplified in this way were cloned in to pL537 via Xba-I and Bgl-II (Boehringer-Mannheim, Indianapolis, IN), using 2μg of digested vector and 300ng of digested PCR products, ligated overnight at 12°C with T4 ligase (Stratagene, La Jolla, CA) and electroporated into E.coli strain DH10B using the Cell-Porator (both from Life Technologies Inc, Gaithersburg, MD). The electroporated DHlOBs were grown in SOC for lhr at room temperature, then titered in serial 100-fold dilutions (to estimate the size of the libraries) by plating onto LB plates supplemented with 100 μg/mL ampicillin. The remaining bacteria were expanded to a final volume of 500 mL in LB broth containing lOOμg/mL ampicillin and 2% D-glucose, and grown overnight at room temperature. Plasmid was prepared from this cultures using standard techniques (10), the K-chain library was composed of 7 xl0? members. Plasmid prepared from this library was digested with Xho-I and Sfi-I and ligated to similarly digested PCR-amplified Fd fragments, as described for the K chains. Electroporation, titration and plasmid preparation were performed exactly as described for the K libraries, and the final library titers were as follows: IgG/κ: 2 xlO7; IgA/κ: 2 xlO6, IgM/κ: 1 xl06. The plasmids produced from these constructs were then introduced into E.coli XL-1 Blue (Stratagene, La Jolla, CA) and titered as described above. The 0 library of antibody cDNAs in the culture after transfromation was then expressed on bacteriophage by superinfection with helper phage Ml 3. These phage preparations were precipitated by addition of 20% volume/volume of a solution containing 20% polyethylene glycol (PEG) 8000 weight/volume and 2.5M NaCl and incubation on ice
* for 1 hour followed by centrifugation. Phage pellets were resuspended in PBS-T
(phosphate buffered saline with 0.05% Tween-20) with 3% BSA added, passed through a 0.2μm filter, titered and used in selection experiments. Titers were typically close to 1012 cfu/mL, and restriction digest analysis of colonies from the titer plates
20 indicated that approximately 88% of the phage contained both Fd and K genes.
Selection of Fab Fragments Binding to gpl20
Wells of a 96-well plate (Costar) were coated with 50 μL of gpl20 (Intracell) at 2 μg/mL in carbonate/ bicarbonate buffer, pH 9.4 for 2 hours at 37°C,
25 then blocked with 3% BSA in the same buffer for 2 hours at 37°C, and washed four times with 250μL of PBS-T. The concentrated phage prepared from the libraries were then applied to the wells in a volume of 50 μL, and incubated a room temperature for 2 hours. Unbound phage were then removed by washing 20 times with PBS-T allowing π each wash to remain in the well for approximately 3 minutes. Each well was then rinsed twice with PBS before initiating the specific elution of phage recognizing the CD4 binding site of gpl20 by adding 50μL of CD4 (duPont) at 100 μg/mL in PBS. After 15 mins of elution, the mixture in the well was removed and the phage present were rescued by incubating the phage/CD4 mixture with 200 μL of E.coli XL-1 blue,
35 freshly grown to a density of 0.6 (A 0o) for 30 minutes at 37°C. lOOμL of the resulting cells were plated onto 2xYT plates supplemented with 2% D-glucose, 100 μg/mL ampicillin and 5 μg/mL tetracycline, and grown at 30°C overnight. The resulting colonies were picked, grown in 2xYT medium with 2% D-glucose, 100 μg/mL ampicillin and 5 μg/mL tetracycline and DNA was prepared from the resulting cultures (Wizard minipreps, Promega, Madison, WI). This DNA was digested with Xho-I and Xba-I to determine the presence of a 1.7kB insert, indicating the presence of both Fd and K chain inserts. Clones containing both Fd and K chain inserts were converted to soluble Fab expression constructs and sequenced to determine the V-region sequences.
Sequencing of Immunoglobulin Genes
Clones containing inserts were sequenced using standard dideoxy techniques (6, 11). The primers used were as follows: VH forward primer: CCTCACTAAAGGGAACAAAAGCT (SEQ ID NO: 96); VH reverse primer IgM: ATGGAGTCGGGAAGGAAGTCCTGT (SEQ ID NO: 97); VH reverse primer IgG: GTTCGGGGAAGTAGTCCTTGAGGAG (SEQ ID NO: 98); VL forward primer: ACGAATTCTAAACTAGCTAGTCGC (SEQ ID NO: 99); VL reverse primer: GGGATAGAAGTTATTCAGCA (SEQ ID NO: 100). The forward primer sequences are based on unique vector sequences approximately 100 nucleotides 5' of the cloning sites for either the Fd fragment or K chain. The reverse primer sequences are based on the sequence of the appropriate constant region, and located approximately 100 nucleotides 3' of the J/C slice site. Germline gene assignment was performed using Vbase (12). Expression and purification of soluble Fab fragments
Constructs for the expression of Fab were prepared by digesting the relevant pComb3 construct with Spe-I and Nhe-I and re-ligating, thus eliminating coat protein 3 gene and allowing expression of Fab. Two of the clones isolated contained internal Spe-I sites, but this potential problem was circumvented by isolating the additional fragment, ligating it into the rest of the plasmid, then checking the resulting clones carefully to ensure correct orientation of the insert. Expression of soluble Fab fragments was achieved by growing XL-1 Blue containing the relevant phagemid overnight at 30°C in 2xYT medium containing ampicillin (50 μg/mL), IPTG (ImM) and MgCl (20mM). The bacteria were then harvested by centrifugation, and the release of the Fab fragments was achieved by hypotonic lysozyme treatment using previously described protocols (15). The resulting Fab preparations were purified on anti-Fab columns as previously described (3). Biotinylation was performed using biotin-LC-hydrazide (Pierce, Rockford, II) in accordance with the manufacturer's instructions.
Binding Assays
ELISAs were performed using standard methods with recombinant gpl20 or viral lysates as antigens. Microtiter plates were coated with antigen in carbonate/ bicarbonate buffer, pH 9.4, at lOOng/well in a volume of 100 μL. As a positive control, an Fab construct was made containing the V-region genes from F105, a human monoclonal antibody isolated using human hybridoma technology (9). The gene sequences were based on the published sequences of the F105 V-region genes (7), and constructed by overlapping long oligonucleotides by Midland (Austin, TX). These V-region genes were confirmed by sequencing, then subcloned into Fab expression vector pL604 (3) and expressed as Fab fragments as described above. Binding assays were performed with purified, biotinylated Fab fragments detected with Europium (Eu) labelled streptavidin (Wallac, Gaithersburg, MD). Binding was measured using a Wallac 1232 Delphia Research Fluorimeter in accordance with the manufacturer's instructions.
Deposit of Materials
The phage display libraries of this invention were deposited on June 8, 1999, with the American Type Culture Collection (ATCC). The ATCC accession numbers for the phage display libraries L938, L939 and L944 are PTA-193, PTA-194 and PTA-195, respectively.
Results Recovery of eluted phage
Seven colonies were recovered from panning with the three phage display libraries for the presence of Fabs that specifically recognized the CD4 binding site of HIV-1 envelope protein gpl20. Restriction analysis revealed that six were from the IgG library (Fabs 1-6) and one from the IgM library (Fab 7). The phage isolated from the three libraries were converted to soluble Fab expression plasmids, by digestion of phagemid DNA with Spe-I and Nhe-I followed by re-ligation, thus eliminating the gene for Ml 3 cpIII.
Sequence Analysis
Initial analysis of the V-region sequences from Fabs 1-7 indicated that they were all different (Figures 1 and 2) , and analysis of the CHI sequences from Fabs 1-6 showed that they were all IgGj. Assignment of V-region germline genes indicated that 4 VH genes were from the VH3 family (Fabs 1 , 3, 5 and 6), 2 were from the VH4 family (Fabs 2 and 7) and one form the VHI family (Fab 4), while 5 of the Vκ genes were from the Vκ 3 family (Fabs 1, 2, 3, 5 and 6) and 2 were from the Vκ 1 family (Fabs 4 and 7). Analysis of J-region gene usage showed that five of the Fabs used JH4b (Fabs 2, 4, 5, 6, and 7) and 2 used JH6b (Fabs 1 and 3), while four used Jkl (Fabs 2, 3, 4 and 6), two used Jk5 (Fabs 1 and 7) and one used Jk2 (Fab 5). D segment usage could not be determined in 3 cases (Fabs 3, 5 and 6), the other 4 were most closely related to D-segments DXP3 (Fab 1), D3 (Fab 2), D21.9 (Fab 4) and DLR1 (Fab 7). Individual Fab gene assignments are shown in Table 1 ; the only VH gene seen in more than one Fab was dp38 (Fabs 1 and 6), but Vκ genes A27 (Fabs 3 and 5) and L6 (Fabs 1 and 6) were both present in 2 Fabs. Alignment of the VH genes for Fabs 1- 7 with the germline genes from which they are putatively derived, showed that the degree of divergence was 0.7% for Fabl, 1.0% for Fabs 2 and 7, 1.4% for Fab4, 2.4% for Fab3 and 2.8% for Fabs 5 and 6 (mean = 2.1%) (Figure 3). Similar analysis for the Vκ sequences indicated that the degree of divergence was 0% for Fab 2, 1.9% for Fabs 4, 5 and 6, 2.3% for Fab 7, 2.6% for Fabl, and 4.9% for Fab3 (mean = 2.2%) (Figure 4).
Table 1
Figure imgf000016_0001
* = not attributable Binding of Fabs to gpl20
First, the binding of biotinylated Fab fragments to the antigen gpl20 was examined. In order to assess the relative affinity of these Fab fragments with that of antibodies isolated by more conventional methods, antibody F105, which recognizes the CD4 binding site of HIV-1 gpl20, was expressed and purified in the same way as Fabs 1-7. A 2-fold dilution series of each antibody was them tested for binding to gpl20 by ELISA. The results of these assays showed that Fabs 1-7 showed that all of the Fabs had binding curves that were similar to F 105 (Figure 5). The relative concentration at which 50% binding was observed differed by less than ten-fold across the 8 Fabs tested, with F 105 in the middle of the group. Fab 6 gave the strongest binding, with Fabs 1, 4 and F105 showing slightly lower affinities. The Fabs with the lowest relative affinities were Fabs 2 and 7.
The comparison with F105 was extended by binding competition studies, in which the binding of biotinylated Fab fragments to gpl20 was competed by unlabelled F105. In these assays, the phage derived Fabs fell into 2 groups; Fabs 1, 5, 6 and 7 showed 50% inhibition of binding by relative F105 Fab concentrations of between 0.2 and 0.5 with Fab 5 showing the most inhibition by F105 (Figure 6). Fabs 2, 3 and 4 showed 50% inhibition of binding by relative F105 Fab concentrations of between 3 and 4 (Figure 6). On the basis of this data, it would appear that Fabs 1-7 fall into 2 groups; those which are readily competed by F 105 (Fabs 1, 5, 6 and 7) and those which are relatively resistant to F105 competition (Fabs 2, 3 and 4).
Competition of Fab Binding by CD4
To further characterize Fabs 1-7, and to confirm the ability of CD4 to compete the binding of these Fabs, and therefore their de facto origins, inhibition studies with CD4 were performed. Fab 6 was the least resistant to inhibition by soluble CD4, with 50% inhibition observed at a CD4 concentration of approximately 0.2 μg/mL. Fabs 4 and 7 were most resistant to inhibition by CD4, with 50% inhibition occurring at between 0.7 and 0.8 μg/mL. In this assay F105 Fab showed 50% inhibition at a CD4 concentration of approximately 0.6 μg/mL (Figure 7). Of the remaining Fabs, Fabs 2 and 5 were similar to F 105 with 50% inhibition occurring at a CD4 concentration of 0.5 μg/mL, while two, Fabs 1 and 3, showed 50% inhibition at a CD4 concentration of approximately 0.3 μg/mL. Overall, all eight Fabs tested showed broadly similar susceptibility to inhibition by CD4.
Cross Competition between Fabs 1 -7
In an attempt to learn something about the similarity of the gpl20-Fab interaction for the different Fabs fragments isolated, binding competition experiments were conducted for all of the antibodies. The results of these experiments showed a pattern of moderate inhibition in most cases. There was no competition between Fabs 3 and 5 and very little competition between Fabs 1 and 2. Fabs 1 and 2 generally showed little competition with any of the other Fabs. Fab 3 showed limited 0 competition with any Fabs except 4 and 7. Fab 4 showed competition with Fabs 3,5 and 6, while Fab 5 showed competition with 4 and 7 and possibly 6. Fab 7 competed with 5 and possibly 3. Fab 6 showed some disagreement between the 2 sides of the assay, but the results indicated some competition with Fabs 3,4,5 and 7 (Figure 8). 15 These results suggest that Fabs 3-7 have overlapping binding sites, while Fabs 1 and 2 appear to be largely distinct from this group and from each other.
Strain Specificity
In order to confirm that the Fabs 1 -7, selected for their binding to recombinant gρl20, were also able to recognize native proteins binding to viral lysates was measured. To obtain information about the ability of these antibodies to recognize multiple strains of HIV-1, binding to three isolates of HIV-1 (Illb, Ba-L and MN) (5, 8) and one of HIV-2 (isy/sbl) (4) was measured. All of the Fabs reacted most strongly
25 with HlV-lnib, probably due to the fact that the recombinant gpl20 against which the
Fabs were selected was derived from a clone of HIV-1 derived from HIV-1 mt,. The binding to HIV-IMN and HIV-lβa-L was mixed; only Fab 2 bound about equally well to all three isolates; Fab 3 showed little reactivity to either MN or Ba-L; Fabs 5 and 7
,π bound to MN at about 50% the level seen with Illb, but showed little reactivity with
Ba-L, while Fab 6 bound Ba-L as well as Illb but showed no reactivity with MN
(Figure 9). The remaining two Fabs (Fabs 1 and 4) bound to both MN and Ba-L at intermediate levels (25-50% of the binding seen with Illb). Thus, three of the seven
Fabs (Fabs 1 , 2 and 4) showed relatively strong reactivity with all three isolates of 35 HIV-1 tested, while only one Fab (Fab 3) appeared to be restricted to only Illb. No binding to HIV-2,sy/sbi was seen with any of the Fabs.
The above results demonstrate that the Fab fragments derived from libraries constructed from improved phage vector show significant diversity in the usage of germline genes. In addition, these Fab fragments are similar to anti-gpl20 monoclonal antibody F 105 in their affinities for gpl20. Furthermore, these antibodies competed with CD4 and F105 for binding to gpl20, but they showed only limited competition with each other, suggesting that the CD4 binding site of gpl20 may overlap several discreet antibody binding sites.
Sequence diversity of the Fab fragments was demonstrated by the isolation of seven different Fab fragments in seven clones. Analysis showed that Fabs 3 and 6 are derived from the same VH and VK germline genes, but the CDR3 regions are clearly different, indicating that they must have been derived from different B- cells. These data are somewhat different from a previous study in which multiple clones were isolated that shared common V-D-J and V-J rearrangements, but which apparently differed in the localization and extent of somatic mutation (2). In addition, the extent of divergence from the nearest germline genes that we observed (between 0 and 5%) is much lower than observed in the previous study (20-30% for most of the sequences) of anti-HIV-1 Fabs derived from phage libraries (2). The levels of somatic mutation in the Fab sequences are, however, very comparable to the levels of somatic mutation described for rearranged human VH genes isolated in conventional ways.
In addition to demonstrating that the Fab antibodies isolated were specific for gpl20, the findings presented herein also show that those antibodies recognize native HIV-1 gpl20 and that some of them have strain specificity that extends beyond HIV-lmb o
References
1. Barbas, C.F.III and Lerner, R.A. 1991. Combinatorial immunoglobulin libraries on the surface of phage (Phabs): Rapid selection of antigen specific phage. Methods, A Companion to methods in Enzymology 2, 119.
2. Barbas,C.F.IIL, A.S. Kang, R.A. Lerner and S.J. Benkovik. 1991. Assembly of combinatorial antibody libraries on phage surfaces: the gene III site. Proc. Natl. Acad. Sci. USA, 88: 7978.
3. Fiorentini, S., Reitz, M. S., Mactzak, E., Gallo, R. C, Keydar, I. and Watkins, B. A. Humanization of an antibody recognizing a breast cancer specific epitope by CDR-grafting. Immunotechnology, 3; 45-59, 1997. 0 4. Franchini, G., Fargnoli, K.A., Giombini, F., Jagodzinski, L., De Rossi, A.,
Bosch, M., Biberfeld, G., Fenyo, E.M., Albert, J., Gallo, R.C. 1989. Molecular and biological characterization of a replication competent human immunodeficiency type 2 (HIV-2) proviral clone. Proc. Natl. Acad. Sci. USA 86:2433-7
5. Gartner, S., Markovits, P., Markovitz, D.M., Kaplan, M.H. Gallo, R.C. & 5 Popovic, M. 1986. The role of mononuclear phagocytes in HTLV-III/LAV infection. Science 233:215-9
6. Hattori, M., and Sakaki, Y. 1986. Dideoxy Sequencing Method Using Denatured Plasmid Templates. Analytical Biochemistry 152:232.
7. Marasco, W.A., Bagley, J., Zani, C, Posner, M., Cavacini, L., Haseltine, W.A. & Sodroski J. 1992. Characterization of the cDNA of a broadly reactive 0 neutralizing human anti-gpl20 monoclonal antibody. J Clin Invest 90; 1467-
78
8. Popovic, M., Sarngadharan, M.G., Read, E., Gallo, R.C. 1984. Detection, isolation, and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS. Science 224;497-500 5 9. Posner, M. R., T. Hideshima, T. Cannon, M. Mukherjee, K. H. Mayer, and R.
A. Byrn. 1991. An IgG human monoclonal antibody that reacts with HIV- l/gpl20, inhibits virus binding to cells, and neutralizes infection. J. Immunol.
146:4325-4332.
10. Sambrook ., Fritsch,E.F. and Maniatis,T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor University Press, Cold Spring Harbor, 0 NY.
1 1. Sanger,F., Nicklen,S. and Coulsen,A.R.1977. DNA sequencing with chain- terminating inhibiters Proc. Natl. Acad. Sci. USA. 74;5463.
12. Tomlinson, I.M., Walter, G., Marks, J.D., Llewelyn, M.B., Winter, G. (1992) J. Mol. Biol. 227,776-798 5 13. Watkins, B. A., Davis, A. E., Fiorentini, S. and Reitz, M.S. (1995) Scand. J.
Immunol. 42, 442-448. 14. Watkins, B. A., Davis, A. E., Fiorentini, S., Veronese, F. D. and Reitz, M.S. (1996) J. Immunol. 156, 1676-1683.
15. Witholt, B., Boekhout, M., Brock, M., Kingma, J., van Heerikuizen, H. and de Liu, L. 1976. An efficient and reproducible procedure for the formation of speroplasts from variously grown Escherichia coli. Analytical Biochemistry 74; 160.
16. McCafferty, J., Griffiths, AD, Winter, G and Chiswell, DJ. (1990) Nature 348:552-554.
17. Starcich BR et al. (1986) Cell 45:637-648.

Claims

1. A human monoclonal antibody that is immunoreactive with the HIV-1 glycoprotein gpl20, said antibody having heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences selected from the group consisting of SEQ ID NO: 43 through SEQ ID NO: 84.
2. The human monoclonal antibody of claim 1, wherein said antibody has heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences selected from the group consisting of SEQ ID NO: 43 through SEQ ID NO: 56 and is immunoreactive with the CD4 binding site of the HIV-1 glycoprotein gpl20.
3. The human monoclonal antibody of claim 1, wherein said antibody has heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences selected from the group consisting of SEQ ID NO: 57 through SEQ ID NO: 72 and is immunoreactive with the V3 loop of the HIV-1 glycoprotein gpl20.
4. A human monoclonal antibody according to claim 1, wherein the heavy (H) and light (L) chain immunoglobulin variable region amino acid sequences are encoded by nucleic acid sequences selected from the group consisting of
SEQ ID NO: 1 through SEQ ID NO: 42.
5. A phage display library selected from the group consisting of phage display libraries L938, L939 and L944 having ATCC accession numbers PTA- 193, PTA-194 and PTA-195, respectively.
6. A human monoclonal antibody isolated from the phage display library of claim 5.
7. The antibody of claim 6, wherein said antibody is immunoreactive with HIV-1.
8. The antibody of claim 7, wherein said antibody is immunoreactive with HIV glycoprotein gpl20.
9. The antibody of claim 8, wherein said antibody is immunoreactive with the CD4 binding site of the HIV glycoprotein gpl20.
10. The antibody of claim 8, wherein said antibody is immunoreactive with the V3 loop of the HIV glycoprotein gpl20.
11. A method of detecting HIV-1 in a biological sample, comprising:
(a) contacting the sample with at least one human monoclonal antibody according to claim 1 under conditions suitable to form a complex between the antibody and HIV-1 gpl20 protein; and
(b) detecting the presence of said immune complex.
12. A method of detecting HIV-1 in a biological sample, comprising:
(a) contacting the sample with at least one human monoclonal antibody according to claim 7 under conditions suitable to form a complex between the antibody and HIV-1 gpl20 protein; and
(b) detecting the presence of said immune complex.
13. The method of claim 11, wherein the biological sample is selected from the group consisting of serum, saliva, lymphocytes or other mononuclear cells.
14. The method of claim 12, wherein the biological sample is selected from the group consisting of serum, saliva, lymphocytes or other mononuclear cells.
15. A pharmaceutical composition comprising at least one human monoclonal antibody according to claim 1 and a suitable excipient, diluent or carrier.
16. A pharmaceutical composition comprising at least one human monoclonal antibody according to claim 7 and a suitable excipient, diluent or carrier.
17. The composition of claim 15, further comprising a drug or a gene conjugated to said antibody.
18. The composition of claim 16, further comprising a drug or a gene conjugated to said antibody.
19. A method of providing passive immunotherapy to a mammal infected with HIV-1 comprising administering to said mammal a therapeutically effective amount of at least one human monoclonal antibody according to claim 1.
20. A method of providing passive immunotherapy to a mammal infected with HIV-1 comprising administering to said mammal a therapeutically effective amount of at least one human monoclonal antibody according to claim 7.
21. An anti-idiotypic antibody to the antibody of claim 1.
22. An anti-idiotypic antibody to the antibody of claim 7.
PCT/US2000/017327 1999-06-30 2000-06-23 Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120 WO2001000678A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU57619/00A AU5761900A (en) 1999-06-30 2000-06-23 Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US14170199P 1999-06-30 1999-06-30
US60/141,701 1999-06-30

Publications (1)

Publication Number Publication Date
WO2001000678A1 true WO2001000678A1 (en) 2001-01-04

Family

ID=22496840

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/017327 WO2001000678A1 (en) 1999-06-30 2000-06-23 Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120

Country Status (2)

Country Link
AU (1) AU5761900A (en)
WO (1) WO2001000678A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10311248A1 (en) * 2003-03-14 2004-09-30 Müller-Hermelink, Hans Konrad, Prof. Dr. Human monoclonal antibody
EP1498426A1 (en) * 2003-07-16 2005-01-19 CCL Holdings Co., Ltd. Preparation of fully human antibodies
US7604799B2 (en) * 2003-06-06 2009-10-20 Medimmune, Llc EphA4 Antibodies
US9718883B2 (en) 2003-09-10 2017-08-01 Amgen Fremont Inc. Antibodies to M-CSF

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BARBAS C F ET AL: "Molecular profile of an antibody response to HIV-1 as probed by combinatorial libraries.", JOURNAL OF MOLECULAR BIOLOGY, (1993 APR 5) 230 (3) 812-23., XP000942828 *
DITZEL H J ET AL: "MAPPING THE PROTEIN SURFACE OF HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 GP120 USING HUMAN MONOCLONAL ANTIBODIES FROM PHAGE DISPLAY LIBRARIES", JOURNAL OF MOLECULAR BIOLOGY,GB,LONDON, vol. 267, no. 3, March 1997 (1997-03-01), pages 684 - 695, XP000885564, ISSN: 0022-2836 *
PARREN P W ET AL: "Protection against HIV-1 infection in hu-PBL-SCID mice by passive immunization with a neutralizing human monoclonal antibody against the gp120 CD4 - binding site.", AIDS, (1995 JUN) 9 (6) F1-6., XP000942822 *
THOMPSON J ET AL: "Affinity maturation of a high-affinity human monoclonal antibody against the third hypervariable loop of human immunodeficiency virus: use of phage display to improve affinity and broaden strain reactivity.", JOURNAL OF MOLECULAR BIOLOGY, (1996 FEB 16) 256 (1) 77-88., XP000942832 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10311248A1 (en) * 2003-03-14 2004-09-30 Müller-Hermelink, Hans Konrad, Prof. Dr. Human monoclonal antibody
US7604799B2 (en) * 2003-06-06 2009-10-20 Medimmune, Llc EphA4 Antibodies
EP1498426A1 (en) * 2003-07-16 2005-01-19 CCL Holdings Co., Ltd. Preparation of fully human antibodies
US9718883B2 (en) 2003-09-10 2017-08-01 Amgen Fremont Inc. Antibodies to M-CSF
US10280219B2 (en) 2003-09-10 2019-05-07 Amgen Fremont Inc. Antibodies to M-CSF

Also Published As

Publication number Publication date
AU5761900A (en) 2001-01-31

Similar Documents

Publication Publication Date Title
Ditzel et al. Neutralizing recombinant human antibodies to a conformational V2-and CD4-binding site-sensitive epitope of HIV-1 gp120 isolated by using an epitope-masking procedure.
US7223844B2 (en) Broadly cross-reactive neutralizing antibodies against human immunodeficiency virus selected by Env-CD4-co-receptor complexes
Roben et al. Recognition properties of a panel of human recombinant Fab fragments to the CD4 binding site of gp120 that show differing abilities to neutralize human immunodeficiency virus type 1
Zwick et al. Broadly neutralizing antibodies targeted to the membrane-proximal external region of human immunodeficiency virus type 1 glycoprotein gp41
Moore et al. A human monoclonal antibody to a complex epitope in the V3 region of gp120 of human immunodeficiency virus type 1 has broad reactivity within and outside clade B
US6057421A (en) Variable heavy and light chain regions of murine monoclonal antibody 1F7
Zhang et al. Broadly cross-reactive HIV neutralizing human monoclonal antibody Fab selected by sequential antigen panning of a phage display library
Zhang et al. Improved breadth and potency of an HIV-1-neutralizing human single-chain antibody by random mutagenesis and sequential antigen panning
Parren et al. In vitro antigen challenge of human antibody libraries for vaccine evaluation: the human immunodeficiency virus type 1 envelope
EP2230250B1 (en) Anti-hiv monoclonal antibody
Marasco et al. Characterization of the cDNA of a broadly reactive neutralizing human anti-gp120 monoclonal antibody.
EP1765398B1 (en) Human antibodies interacting with hiv gp41
Bitton et al. Characterization of T cell‐expressed chimeric receptors with antibody‐type specificity for the CD4 binding site of HIV‐1 gp120
WO2001000678A1 (en) Human monoclonal antibodies to hiv-1 envelope glycoprotein gp120
US8246957B2 (en) Lupus antibodies for passive immunotherapy of HIV/AIDS
Pilkington et al. Recombinant human Fab antibody fragments to HIV-1 Rev and Tat regulatory proteins: direct selection from a combinatorial phage display library
Pincus et al. Variants selected by treatment of human immunodeficiency virus-infected cells with an immunotoxin.
Samuelsson et al. Chimeric macaque/human Fab molecules neutralize simian immunodeficiency virus
Koefoed et al. Molecular characterization of the circulating anti-HIV-1 gp120-specific B cell repertoire using antibody phage display libraries generated from pre-selected HIV-1 gp120 binding PBLs
Watkins et al. Evidence for distinct contributions of heavy and light chains to restriction of antibody recognition of the HIV-1 principal neutralization determinant.
US20110059015A1 (en) Vaccine
JAVAHERIAN et al. Random copolymers containing specific ratios of negatively charged and aromatic amino acids bind V3 disulfide loop and neutralize diverse HIV type 1 isolates
De Haard et al. Selection of human anti-human immunodeficiency virus type 1 envelope single-chain antibodies from a peripheral blood cell-based phage repertoire
Warncke Generation of bispecific antibodies against the human immunodeficiency virus (HIV) envelope protein
Labrijn Neutralizing antibodies to the HIV-1 envelope glycoproteins

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP