WO2000078946A2

WO2000078946A2 - Treatment of viral influenza with antisense oligonucleotides

Info

Publication number: WO2000078946A2
Application number: PCT/US2000/016810
Authority: WO
Inventors: Evan T. Keller; Stefan Gravenstein; David Mark Hall
Original assignee: Eastern Virginia Medical School
Priority date: 1999-06-17
Filing date: 2000-06-19
Publication date: 2000-12-28
Also published as: WO2000078946A3; AU6336000A

Abstract

A therapy for treating viral influenza entails inhibiting the synthesis of inducible nitric oxide synthase (iNOS) by means of using antisense oligonucleotides that hybridize with iNOS RNA. The resultant inhibition of iNOS synthesis in vivo reduces the production of NO, which in turn lessens damage to the lungs due to NO toxicity. This lessening of damage allows patients to recover more rapidly from a viral influenza infection, even if antisense oligonucleotides are administered more than 48 hours after the onset of a viral influenza infection.

Description

TREATMENT OF VIRAL INFLUENZA WITH ANTISENSE OLIGONUCLEOTIDES

BACKGROUND OF THE INVENTION

Viral influenza can develop despite appropriate vaccination. Once infected, ensuing morbidity and mortality is greatest among high-risk populations, such as the very old or young, those with chronic disease, and the immunocompromised population. There are relatively few available compounds that have significant anti-viral activity against influenza.

In the United States, amantadine and rimantadine are the only drugs available that have a proven efficacy in diminishing viral influenza-induced morbidity after infection. Both drugs work by blocking the influenza M2 protein ion channel. Their impact has been limited by under-utilization, a lack of activity against influenza B, the rapid development of viral resistance to the drugs, and adverse effects.

A new class of antiviral agents designed to inhibit influenza neuraminidase, an important surface glycoprotein, is in development for use in the prophylaxis and treatment of influenza A and B infections. Two of these compounds, zanamivir (GG167) and GS4104 (the ethyl ester prodrug of GS4071), have reached clinical trials. Most studies of zanamivir have involved topical administration by inhalation of dry powder aerosols and/or intranasal doses of aqueous solutions. These routes rapidly provide high local concentrations at the sites of delivery. GS4104 is administered orally, which allows for greater ease of administration, and probably more uniform distribution of the active compound in the respiratory tract. Both drugs retard the local spread of influenza virus in animal models and experimental human influenza, and are well tolerated. Zanamivir treatment has been shown to reduce the severity and duration of naturally occurring, uncomplicated influenza illness in adults. In some instances, however, these drugs are ineffective and are limited in their use. This is in part because they must be administered within 48 hours post-infection to provide benefit. Unfortunately, many patients fail to present to their health provider until they have been infected for over 48 hours. Such late clinical presentation largely ablates any hope for a therapeutic effect in these patients, who may go on to develop severe morbidity or death. Accordingly, a therapy to diminish viral influenza induced morbidity and mortality that can be administered later than 48 hours post-infection is needed.

Many people suffer from viral influenza mediated morbidity or mortality due to immunoprophylaxis failure and/or ineffective post-infection therapy (e.g., amantadine). Furthermore, no available therapies, when administered more than 48 hours post-infection, have been demonstrated to reduce the incidence or severity of late complications. Viral influenza pulmonary pathology is due to a variety of factors, and among the most important is the induction of inducible nitric oxide synthase (iNOS) activity, and the subsequent production of the radical, nitric oxide (NO). Three isoforms of the nitric oxide synthase (NOS) have been cloned. Two of the isoforms, endothelial and neuronal NOS, are generally expressed constitutively and are Ca²⁺ and calmodulin dependent. These constitutive forms of nitric oxide synthase are associated with the physiologic functions of NO in a healthy host. The other isoform of nitric oxide synthase is expressed by transcriptional induction and is thus called inducible nitric oxide synthase (iNOS). iNOS produces nitric oxide in response to inflammation and infection. The inducible form of nitric oxide synthase has been found to be present in activated macrophages and is induced in endothelial cells and vascular smooth muscle cells by various cytokines and/or microbial products.

Systemic pharmacological inhibition of iNOS protects against viral influenza- mediated lung pathology and death in mice. Because NO is a key regulator of many critical physiologic functions, however, systemic inhibition of iNOS activity can be associated with severe side effects. Systemic inhibition of NO may be extremely dangerous particularly in the elderly or immunocompromised population. In summary, there is a real need for another method to inhibit influenza pathology, particularly after 48 hours from the start of infection. SUMMARY OF THE INVENTION

It is therefore an object of the present invention to provide an antisense oligonucleotide therapy capable of treating viral influenza infection, including more than 48 hours after the onset of infection and/or in the presence of other infectious etiologies. It is a further object of this invention to treat viral influenza and/or prevent influenza complications by specific inhibition of the synthesis of inducible nitric oxide synthase with antisense oligonucleotides. The iNOS antisense inhibitor may be administered directly to the lung tissue throughout and beyond the duration of a viral influenza infection. It is a further object of this invention to provide compositions that include antisense oligonucleotides that inhibit inducible nitric oxide synthase and can be administered directly to the lungs.

Another object of this invention is to provide a combination treatment for viral influenza using an antisense oligonucleotide iNOS inhibitor and specific antiviral agents active against viral influenza or other respiratory pathogens, with or without additional anti-inflammatory agents. It is a further object of the invention to provide compositions of inducible nitric oxide synthase antisense oligonucleotides inhibitors in a suitable pharmaceutical vehicle for delivery into the lungs. Such compositions may also include antiviral and anti-inflammatory agents. One aspect of this invention is a method of treatment of viral influenza in a patient in need of said treatment, comprising administering to the patient an antisense oligonucleotide that specifically hybridizes to mRNA transcribed by a gene that encodes inducible nitric oxide synthase, such that synthesis of inducible nitric oxide synthase is inhibited in the patient. An example of an antisense oligonucleotides that may be used with the current invention is the following:

5' GGTGCTGCTTGTTAGGAGGTCAAGTAAAGGGC 3'

The antisense oligonucleotides of the present invention may have modified nucleotides and/or modifications to the phosphate backbone, such as wherein at least one phosphate bond groups comprises phosphorothioate or alkylphosphonate. The antisense oligonucleotides are preferably delivered to the lungs in a pharmaceutically acceptable carrier such as a cationic lipid in a nebulized or aerosolized form. Another aspect of this invention is a pharmaceutical composition comprising a pharmaceutically effective amount of at least one antisense oligonucleotide that specifically hybridizes to mRNA transcribed by the gene encoding inducible nitric oxide synthase, and inhibits the synthesis of inducible nitric oxide synthase, and a pharmaceutically acceptable vehicle that can deliver said at least one antisense oligonucleotide to the lungs. This composition may be combine with at least one drug for the treatment of viral influenza.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides a therapy for treating viral influenza by inhibiting the synthesis of inducible nitric oxide synthase (iNOS). The invention is based on the use of antisense oligonucleotides that hybridize with iNOS RNA and thereby inhibit the synthesis of iNOS. Hybridization occurs when an antisense oligonucleotide effectively binds to a target iNOS mRNA so that a reduction occurs in the synthesis of the iNOS protein. The inhibition of iNOS synthesis occurs because of steric hindrance of macromolecular translating mechanism and/or the activation of RNAase enzymes. Inhibition of the synthesis of iNOS reduces the production of nitric oxide, thus lessening damage to the lungs caused by the toxicity of NO. This allows patients to recover more easily and with less morbidity and mortality from a viral influenza infection.

The present invention also includes pharmaceutical compositions comprising an effective amount of at least one iNOS inhibiting antisense oligonucleotide in a pharmaceutical vehicle that can effectively deliver the oligonucleotide to the lung.

The method of the present invention will be utilized in patient treatment as long as it is necessary to reduce the inflammatory effects of iNOS on the lungs resulting from an influenza infection. One of skill in the art will be able to optimize the starting point and treatment duration of the present invention. For example, treatment can begin immediately at the time symptoms of influenza are detected and end within a week or two after the symptoms of influenza subside.

Effectiveness of an influenza treatment can be demonstrated clinically by methods well known to one of ordinary skill in the art. Such methods include observation of improvement in a patient's symptoms or samples of lung tissue taken through an endoscope. Signs of recovery from influenza include defervescence, improved respiration, reduced cough and sputum, and an increased appetite. The duration of the iNOS antisense therapy will generally last until the patient has recovered from influenza. This will most often be at least one week after the onset of infection, with treatment optionally continuing for several weeks.

A. Inhibiting iNOS with Antisense Oligonucleotides Without limiting the invention to any specific theory, it has been postulated that NO achieves this toxicity by combining with superoxide radical to form peroxynitrate.

Squadrito and Pryor, Chem. Biol. Interact. , 96: 203 (1995).

"Nitric oxide" (NO) is defined herein as an inorganic radical produced by different isoforms of NO synthase (NOS). "Nitric oxide" or "NO" is also used herein to collectively refer to the reactive intermediates of nitric oxide and oxygen and water such as other radicals (e.g. NO₂), anions (e.g. NO2^" or NO3^"), higher oxides (e.g. N2O3) and peroxides (ONOO ).

At nanomolar concentrations, NO regulates many physiological processes. At higher levels, however, NO is cytotoxic. Viral influenza infection increases peroxynitrate in murine lung tissue. Akaike, et al , Proc. Nat'l Acad. Sci. U SA, 93: 2448 (1996). This may account for the destruction of lung tissue during a viral influenza infection because peroxynitrate is a highly cytotoxic agent in lung tissue. Wizemann, et al., J. Leukoc.

Biol , 56: 759 (1994); Wizemann and Laskin, Am. J. Respir. Cell Mol. Biol , 11 : 358

(1994). The present invention employs an antisense oligonucleotide that is targeted to mRNA associated with inducible nitric oxide synthase. Persons of ordinary skill in the art will be aware that mRNA includes not only the coding or translated region, which carries the information to encode a protein using the three letter genetic code, but also associated ribonucleotides that form the 3' and 5 '-untranslated region, including the 5 '-cap region.

The invention also contemplates hybridization with the intron regions and intron/exon or splice junction ribonucleotides. Thus, oligonucleotides may preferably be formulated which are targeted wholly or in part to these associated ribonucleotides.

Antisense oligonucleotides have already been used to inhibit human iNOS. Selleri et al, Br J Haem 99:481 (1997), have used an antisense oligonucleotide sequence,

5'GGTGCTGCTTGTTAGGAGGTCAAGTAAAGGGC3', to inhibit iNOS in human haemopoietic cells. The present invention also contemplates the use of other antisense oligonucleotide sequences that have been used to inhibit human iNOS.

Those knowledgeable in this area will appreciate that suitable antisense oligonucleotides can be selected empirically for the present invention. For example, a suitable antisense oligonucleotide can be designed to target a translation initiation site (the AUG start codon) and/or sites that are close to the initiation site, such as those that are within about 20 bases of the AUG start codon. In another embodiment, the antisense oligonucleotide is targeted to nucleotides that include the 5' untranslated region of the iNOS mRNA. Antisense oligonucleotides can be targeted to the 5' untranslated region and the initiation site, to the translated region and the initiation site, or to a combination of the 5' untranslated region, the initiation site and the translated region.

In another embodiment, the antisense oligonucleotide is targeted to a site on the mRNA molecule that contains regions that are accessible to hybridization with an antisense oligonucleotide. The secondary and tertiary structure adopted by mRNA molecules leaves only a few sequence stretches accessible to hybridization with antisense mRNA. Such accessible sites can lie in the translated region, the untranslated region or both regions.

Various conventional methods can be employed to predict or to identify regions accessible to hybridization. Thus, to guide the design of mRNA molecules, computer modeling programs such as Mfold are available, as evidenced by Zuker et al. in RNA BIOCHEMISTRY AND BIOTECHNOLOGY (Kluwer Academic Publishers, 1999), for example, and by websites such as http://www.ibc.wustl.edu/ ^" zuker/. The screening of multiple sequences is another approach to identifying effective antisense sequences. By probing with a library of chemically synthesized, semi-random, chimeric oligonucleotides, Ho et al , Nature Biotechnology, 16: 59 (1998), have identified sites on mRNA, for example, that are most accessible to hybridization with mRNA molecules. Regions accessible to RNA were then cleaved with a RNase H and subsequently sequenced. A similar method has been described wherein a completely randomized library of oligonucleotides is used with Rnase H. See SeLima et al, J. Biol. Chem. 272: 626 (1997). Southern et al , Nature Biotechnology, 15: 537 (1997), have used a combinatorial method which employs an array of 1 ,938 oligodeoxynucleotides to assess sequences open to hybridization with the first 122 bases of the 5' end (the 5' untranslated region and bases 1 to 69 of the first exon) of an mRNA molecule.

In accordance with the present invention, the functions of the RNA that are to be interfered with or inhibited include all vital functions, such as translocation of the RNA to the site for protein translation, actual translation of protein from the RNA, splicing or maturation of the RNA, and possibly even independent catalytic activity. The overall effect of such interference with the RNA function is to interfere or inhibit iNOS protein expression, and thereby reducing the synthesis of nitric oxide.

In the context of this invention, "hybridization" means hydrogen bonding between complementary bases, also known as Watson-Crick base pairing, usually on opposite nucleic acid strands or two regions of a nucleic acid strand. Guanine and cytosine are examples of complementary bases that are known to form three hydrogen bonds between one another. Adenine and thymine or adenine and uracil are examples of complementary bases that form two hydrogen bonds between them. The phrases "specifically hybridizable" and "specifically hybridizes" indicate that stable, specific binding occurs between the RNA target and the antisense oligonucleotide. It is understood that an oligonucleotide need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when binding of the oligonucleotide to the target interferes with the previously uninfluenced function of the target molecule, causing a loss of its effectiveness while tending to avoid non-specific binding to non-target sequences.

To select the preferred length for an antisense oligonucleotide, a balance should be struck to gain the most favorable characteristics. Shorter oligonucleotides 6-15 bases in length readily enter cell, but have lower specificity. In contrast, longer oligonucleotides of 20-32 bases are more specific, but show decreased kinetics of uptake into the cell. In a preferred embodiment this invention uses oligonucleotides from about 7 to about 32 nucleotides long. Because in the present invention antisense mRNA is administered directly to the lungs, specificity of the oligonucleotides is less of a concern than if the oligonucleotides were to be administered systemically.

Illustrated in Figure 1 is the sequence of a cDNA produced from a human iNOS mRNA obtained from airway epithelium. See also Proc. Nat'l Acad. Sci. U.S.A. 92: 7809 (1995) (Genbank accession number U20141). Figure 2 includes the 5 '-untranslated region of the cDNA of human iNOS mRNA, as published in J. Mol. Cell Cardiol. 29 (4) 1,153- 65 (1997) (Genbank accession number AF068236).

The term "influenza" refers to all viral types of influenza, including influenza A, influenza B, and influenza C. B. Preparation of Antisense Oligonucleotides

As used in the herein specification and appended claims, the terms

"oligonucleotide" and "antisense oligonucleotide" denote oligomers both of a ribonucleotide, and oligomers of deoxyribonucleotide. Oligodeoxynucleotides are preferred. The term "oligonucleotide" also includes oligomers that may be large enough to be "polynucleotides."

The terms "oligonucleotide" and "antisense oligonucleotide" include not only oligomers and polymers of the common biologically significant nucleotides, i.e., the nucleotides adenine ("A"), deoxyadenine ("dA"), guanine ("G"), deoxyguanine ("dG"), cytosine ("C"), deoxycytosine ("dC"), thymine ("T") and uracil ("U"), but also include oligomers and polymers hybridizable to the iNOS mRNA transcript, such as 5- propynyluracil, 5-methylcytsine, 5-propynylcytosine, and 2-aminoadenine.

"Oligonucleotide" and "antisense oligonucleotide" also denote oligomers and polymers wherein one or more purine or pyrimidine moieties, sugar moieties or internucleotide linkages are synthetically modified. This includes oligonucleotides having portions wherein at least one building block of the oligonucleotide differs from the building blocks of a natural oligonucleotide such as wherein the sugar moieties and/or inter-sugar linkages are modified. The bases may also be modified to increase binding properties such as duplex or triplex stability, specificity, or the like, as described, for example, by Scheit, NUCLEOTIDE ANALOGS (John Wiley, New York, 1980). These terms also are understood to encompass oligonucleotide derivatives in which the internucleotide phosphodiester bond has been modified. The present invention contemplates the use of all such oligonucleotides, so long as they are capable of binding to nucleic acids found in nature.

Modifications to the phosphate backbone include other species such as phosphorodithioate, sulfate, sulfonate, sulfonamide, sulfone, sulfite, sulf oxide, sulfide, formacetal, 3'-thioformacetal, 5'-thioether, see International Application WO 92/20823), morpholino-carbamate (see U.S. patent No: 5,034,506) or peptide nucleic acids, (see Nielsen et al , Science 254: 1497 (1991)) which are known for use in the art. For reviews concerning these modified nucleotides, see Milligan et al, J. Med. Chem. 36: 1923 (1993), and Uhlmann et al , Chemical Reviews 90: 543 (1990). In accordance with a preferred embodiment, at least one of the phosphodiester bonds of the oligonucleotide has been substituted with a structure that functions to enhance the ability of the compositions to penetrate into the region of cells where the mRNA to be hybridized to is located. This avoids extensive degradation of the oligonucleotide derivative by nucleases, which would result in ineffective products. It is preferred that such substitutions comprise phosphorothioate bonds, phosphorodithioate bonds, methyl phosphonate bonds, phosphoramidate bonds, amide bonds, boranophosphate bonds, phosphotriester bonds, short chain alkyl or cycloalkyl structures, or heteroatom-substituted short chain alkyl structures, and most especially phosphorothioate bonds or methyl phosphonate bonds. Persons knowledgeable of this field will be able to select other linkages for use in the present invention.

C. Administration of Antisense Oligonucleotides

Because the uptake of oligonucleotides into cells is not efficient, the present invention contemplates the use of a variety of well-known methods to augment this process. Oligonucleotides can be conjugated with synthetic polypeptides such as poly-L-lysine, or with acridine, cholesterol, and poly-rA. Liposomes, especially those involving cationic lipids, have been use extensively to enhance the uptake of antisense oligonucleotides. A preferred embodiment of the present invention employs cationic lipids such as N-[l(-2,3- dioleyloxy)propy]-N,N,N-trimethylammonium chloride (DOTMA) (available from Gibco BRL as Lipofectin^®), dimethyldictadecylammonium bromide (DDAB) or N, N, N', N'- tetramethyl-N, N'-bis [2-hydroxyethyl]-2,3-dioleoyloxy-l, 4-butanediammonium iodide (available from Promega as Tfx-10).

Any of the well-known methods of delivering DΝA to the lungs can be used with the present invention. For example, methods for the gene therapy of cystic fibrosis have been extensively researched. See Wheeler et al, Proc. Nat'l Acad. Sci. USA 93: 1454 (1996). More generally, with this methodology cationic lipids, such as (+)-N-(3- anήonpropyl)-N,N-dimemyl-2,3-bw(dodecyloxy)-l-propanaminium bromide (GAP- DLRIE), could be used to deliver antisense oligonucleotides. See also Lee et al, Human Gene Therapy 7: 1701 (1996), for a discussion of the structures and formulations of cationic lipids for delivering genes into the lungs.

Antisense oligonucleotides can be encapsulated within liposomes using standard techniques. Those of skill in the art know a variety of different liposome compositions and methods of synthesis. See, for example, U.S. patents No. 4,844,904, No. 5,000,959, No. 4,863,740, and No. 4,975,282. Liposomes can be targeted to particular cells by varying phospholipid composition or by inserting target-specific receptors or ligands into the liposomes.

Another potential form of packaging would be to freeze dry the antisense oligonucleotide, and suitably package it in a dry powder, such as lactose. This formulation would facilitate inhalation in conjunction with other medicines or compounds formulated for dry powder inhalation, e.g. zanamir. It is contemplated that some combination of dry powder and liposome may also be a successful formulation for topical intrapulmonary administration.

In general, the dosage of administered oligonucleotides will vary, depending upon such factors as the patient's age, weight, height, sex, general medical condition, and previous medical history. Dose ranges for particular formulations can be determined by resort to a suitable animal model and clinical trials. Dosage amounts of the present invention include, but are not limited to, from about .01 to about 50 mg/kg of vehicle with a pharmaceutically effective amount of antisense oligonucleotides administered to the lungs as a dry powder or aerosol. Another embodiment includes a range from about .1 to about 10 mg/kg.

The antisense oligonucleotides of the present invention can be applied to the lungs with varying frequency and for varying duration. In this regard, the skilled artisan will appreciate how to alter the frequency and duration of application to achieve the desired effect. For example, the antisense oligonucleotides of the instant invention can be taken at varying frequencies, including one or more times daily. Again, the skilled artisan will appreciate the interaction between frequency and duration of use in order to achieve and/or maintain the desired effect.

In addition, the skilled artisan will appreciate how to vary concentrations of the instant invention in conjunction with the frequency and duration of use to achieve the desired effect. For example, the antisense oligonucleotides in a composition of higher concentration or a slow-release formulation might be applied with less frequency or for a shorter duration. In contrast, antisense oligonucleotides of a lower concentration might be applied more frequently or for a longer duration.

D. Measurement of Effects of Antisense Oligonucleotides

The blocking of NO production in by iNOS antisense oligodeoxynucleotides can be demonstrated in vitro by various methods well known to one of ordinary skill in the art. For example, dose response can be measured in Raw264.7 murine macrophage lines ±

IFNγ with 0, 2, 5, or 10 μM of antisense. Sense and mixed oligonucleotides (i.e., the same nucleotides as in antisense, but in random order) can be used as negative controls.

The efficacy is preferably measured by NO production. Dose response can also be measured by observing NOS activity and the relationship between iNOS mRNA and

GADPH mRNA.

Animal models known to one of ordinary skill in the art can also be used to demonstrate that iNOS antisense therapy increases the survival chances from an influenza infection. One preferred animal model is influenza-challenged mice. Virus is prepared in eggs and viral titer is determined using MDCK cells. Animals are then inoculated with influenza to determine the lethal dose at which 50% and 90% of the animals die (LD50 and

LD90, respectively).

To demonstrate that iNOS antisense improves survival, animals are inoculated with

LD50 or LD90 of influenza. Then antisense, sense, or mixed oligonucleotides are administered using nebulization or tracheal injection on a daily basis. The survival rate is noted and samples are taken to evaluate lung histopathology. Additionally, plaque-forming units (PFU) can be quantified to determine viral burden.

One of ordinary skill in the art will also appreciate that the production of NO/NOS in influenza infected animals can be measured with numerous methods. One such method is to measure NO production in lung by various methods including a MGD spintrap, Greiss reagent, or fluorometer. NOS activity can be measured by L-[¹⁴C] arginine conversion and

NOS mRNA levels by Northern blotting. Metabolic byproducts of NO, such as peroxynitrite or nitrotyrosine can be measured by spintraps or antibodies, respectively.

Outcome measures include standard toxicity measures such as weight change, general gross and histologic pathology, the pulmonary histology post-infection studies, the pulmonary weight and appearance at specified intervals post-infection, and survival.

The use of iNOS antisense as a prophylaxis or a treatment can be optimized in various ways. The timing of administration can be optimized by pre-inoculation treatment, simultaneous inoculation and treatment, and post-inoculation treatment. Various formulations and methods of administration known to one of ordinary skill in the art can also be used to optimize the in vivo application of the present antisense oligonucleotides.

These formulations include the previously discussed cationic lipids and liposomes.

Methods of administration include administration by a pressurized meter dose inhaler, such as the kinds used to deliver drugs to treat asthma therapies, or nebuliziers that deliver aerosols by compression or ultrasonic means, as well as inhalation of powder.

The knowledgeable reader will appreciate that a demonstration of the efficacy of antisense oligonucleotides, in treating influenza and reducing mortality in an animal model, is indicative that this treatment will also be effective for human patients. The experimental results derived from animal data, regarding variables such as the optimal carrier, dosage form, concentration of oligonucleotides, toxicity, and frequency of dosage, can be extrapolated, in a conventional manner, to a human application. Before human testing of an antisense treatment of influenza begins, moreover, animal data can be interpreted in light of further in vitro experiments on human lung cell lines that synthesize iNOS. Additional in vivo data can be derived from transgenic animals, such as mice wherein an endogenous iNOS gene has been replaced by a human iNOS gene.

Effectiveness of an influenza treatment can be demonstrated clinically by methods well known to one of ordinary skill in the art. Such methods include observation of improvement in a patient's symptoms or samples of lung tissue taken with for an endoscope. Signs of recovery from influenza include a reduction in fever, improved respiration, increased production of sputum, and an increased appetite. The duration of the iNOS antisense therapy will generally last until the patient has recovered from the influenza infection and its complications. This will often be one week after the onset of infection, with treatment optionally continuing for several weeks.

Combination therapies also can be evaluated using animal models. Thus, antisense oligonucleotides can be administered with zanamivir or another antiviral, with a steroids such as beclamethasone, for example, or with a combination of an antiviral and a steroid drug.

Cited Documents:

1. Squadrito, G.L. and W.A. Pry or, The formation of peroxynitrite in vivo from nitric oxide and superoxide. Chem Biol Interact, 1995. 96(2): p. 203-6.

2. Akaike, T., et al , Pathogenesis of viral influenza virus-induced pneumonia: involvement of both nitric oxide and oxygen radicals. Proc Natl Acad Sci U S A, 1996.

93(6): p. 2448-53.

3. Wizemann, T.M., et al , Production of nitric oxide and peroxynitrite in the lung during acute endotoxemia. J Leukoc Biol, 1994. 56(6): p. 759-68.

4. Wizemann, T.M. and D.L. Laskin, Enhanced phagocytosis, chemotaxis, and production of reactive oxygen intermediates by interstitial lung macrophages following acute endotoxemia. Am J Respir Cell Mol Biol, 1994. 11(3): p. 358-65.

5. Wheeler, M.A. , et al , Bacterial infection induces nitric oxide synthase in human neutrophils. J Clin Invest, 1997. 99(1): p. 110-6.

6. Ding, M., et al , Antisense blockade of inducible nitric oxide synthase in glial cells derived from adult SJL mice. Neurosci Lett, 1996. 220(2): p. 89-92.

10. Arima, H., et al , Specific inhibition of nitric oxide production in macrophages by phosphorothioate antisense oligonucleotides. J Pharm Sci, 1997. 86(10): p. 1079-84.

11. Weisz, A., L. Cicatiello, and H. Esumi, Regulation of the mouse inducible-type nitric oxide synthase gene promoter by interferon-gamma, bacterial lipopolysaccharide and NG- monomethyl-L-arginine. Biochem J, 1996. 316(Pt 1): p. 209-15.

12. Ding, M., et al , Antisense knockdown of inducible nitric oxide synthase inhibits induction of experimental autoimmune encephalomyelitis in SJL/J mice. J Immunol, 1998. 160(6): p. 2560-4.

13. Nyce, J.W. and W.J. Metzger, DNA antisense therapy for asthma in an animal model. Nature, 1997. 385(6618): p. 721-5.

14. Akaike, T., et al , Dependence on Oϊ Generation by Xanthine Oxidase of Pathogensis of Influenza Virus Infection in Mice. J. Clin. Infect. 85(3): p. 739-745.

Claims

What We Claim Is:

1. A method of treating viral influenza in a patient in need of such treatment, comprising administering to the patient an antisense oligonucleotide that specifically hybridizes to mRNA transcribed by a gene that encodes inducible nitric oxide synthase, such that synthesis of inducible nitric oxide synthase is inhibited in the patient.

2. The method of claim 1, wherein said treatment is begun at least 48 hours after the onset of said viral influenza.

3. A method according to claim 1 , wherein said antisense oligonucleotide is an oligonucleotide comprising a sequence selected from the group consisting of:

5' GGTGCTGCTTGTTAGGAGGTCAAGTAAAGGGC 3'

4. A method according to claim 1 , wherein at least one of the phosphate bond groups is modified into phosphorothioate or alkylphosphonate.

5. A method according to claim 1 , wherein at least one of the nucleotides of said oligonucleotides has a base modified to enhance binding properties.

6. A method according to claim 1, wherein said antisense oligonucleotide is delivered to the lungs in a pharmaceutically acceptable carrier.

7 A method according to claim 1, wherein said antisense oligonucleotide is delivered to the lungs in a nebulized, aerosolized, or powdered form in a pharmaceutically acceptable carrier.

8. A method according to claim 6, wherein said carrier comprises at least one cationic lipid.

9. A method according to claim 7, wherein said carrier comprises at least one cationic lipid.

10. A method according to claim 7, wherein said carrier comprises a dry carrier.

11. A method according to claim 10, wherein said dry carrier is lactose.

12. A method according to claim 7, wherein said carrier comprises a cationic lipid and a dry carrier.

13. A pharmaceutical composition comprising (i) a pharmaceutically effective amount of at least one antisense oligonucleotide that specifically hybridizes to mRNA transcribed by the gene which codes for inducible nitric oxide synthase, inhibiting synthesis of inducible nitric oxide synthase, and (ii) a pharmaceutically acceptable vehicle that can deliver said antisense oligonucleotide to the lungs.

14. The composition according to claim 13, wherein said vehicle is selected from the group consisting of an aerosol or a powder.

15. A method according to claim 13, wherein said vehicle comprises at least one cationic lipid.

16. The composition according to claim 13, further comprising at least one drug for the treatment of viral influenza.

17. The composition according to claim 13, wherein said at least one drug is an antiviral compound, a steroid or an influenza neuraminidase inhibitor.

18. The composition according to claim 13, wherein said at least one drug is selected from the group consisting of amantadine, rimantadine, zanamivir, GS4071, GS4104, and beclamethasone.