WO2000078784A1 - treP - Google Patents

Abstract

The invention provides treP promoter polynucleotides and methods for producing and using such polynucleotides, as well as their variants, agonists and antagonists, and their uses.

Description

treP

RELATED APPLICATIONS

Tins application claims benefit to US Proλisional Patent Application Number 60/140.554. filed June 23. 1999

FIELD OF THE INVENTION

This invention relates to newlv identified polvTiucleotides. and their production and uses, as well as their agonists and antagonists, and their uses In particular, the invention relates to promoter pohnucleotides. as well as their variants, hereinafter referred to as "treP." "treP promoter polynucleotιde(s)." and "treP polvmιcleotιde(s)" as the case may be

BACKGROUND OF THE INVENTION

The Streptococci make up a medicalh important genera of microbes known to cause several tvpes of disease in humans, mcluding. for example, otitis media, conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularly meningitis, such as for example infection of cerebrospinal fluid Since its isolation more than 100 years ago. Streptococcus pneumoniae has been one of the more intensively studied microbes For example, much of our early understanding that DNA is. in fact, the genetic mateπal was predicated on the work of Gnffith and of Aver}'. Macleod and McCarty using this microbe Despite the vast amount of research with S pneumoniae. many questions concerning the virulence of this microbe remain It is particularly preferred to emplov Streptococcal genes and gene products as targets for the development of antibiotics

The frequency of Streptococcus pneumoniae infections has πsen dramatically in the past few decades This has been attributed to the emergence of multiple antibiotic resistant strains and an increasing population of people with weakened immune systems It is no longer uncommon to isolate Streptococcus pneumoniae strains that are resistant to some or all of the standard antibiotics This phenomenon has created an unmet medical need and demand for new anti-microbial agents, vaccines, drug screening methods, and diagnostic tests for this organism

Moreover, the drug discovery process is currently undergoing a fundamental revolution as it embraces "functional genomics." that is, high throughput genome- or gene-based biologv This approach is rapidly superseding earlier approaches based on "positional cloning" and other methods Functional genomics relies heavily on the various tools of bioinformatics to identify gene sequences of potential interest from the many molecular biology databases now available as well as from other sources There is a continuing and significant need to identify and characterize further genes and other polvnucleotides sequences and their related polvpeptides. as targets for drug discovers

Clearlv . there exists a need for polvnucleotides. such as the treP polynucleoUde embodiments of the invention, that have a present benefit of. among other things, being useful to screen compounds for antimicrobial activitv Such factors are also useful to determine their role in gene regulation, pathogenesis of infection, dysfunction and disease There is also a need for identification and characterization of such factors and their antagonists and agonists to find wavs to prevent, ameliorate or correct such infection, dysfunction and disease

SUMMARY OF THE INVENTION

The present invention relates to treP. in particular treP promoter polvnucleotides. recombinant materials and methods for their production In another aspect, the invention relates to methods for using such polvnucleotides. including treatment of microbial diseases, amongst others In a further aspect, the invention relates to methods for identifv ing agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with the identified agonist or antagonist compounds In a still further aspect, the invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting treP promoter driven expression or activity

Vaπous changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following descπptions and from reading the other parts of the present disclosure

DESCRIPTION OF THE INVENTION

The invention relates to treP polynucleotides as descnbed in greater detail below In particular, the invention relates to polvnucleotides of a treP of Streptococcus pneumoniae. which is related by sequence homologv to no homolog polynucleotide or bv the presence of characteristic motifs The invention relates especially to treP promoter polynucleotides having the nucleotides sequences set out in Table 1 Note that sequences recited in the Sequence Listing below as "DNA^"' represent an exemplification of the invention, since those of ordinary skill w ill recognize that such sequences can be usefully employed in polynucleotides in general, including πbopolynucleotides

TABLE 1 treP Polynucleotide Promoter Sequences (A) Streptococcus pneumoniae treP polynucleotide sequence [SEQ ID NO 1]

5 ' -

CATTTTGCCTGCTTAAATAGGTTTTTAGTCTAGTTTAATGAACACCTGTATCTATTTTACCATACAAGTGCTAGA AAATTTACAAAAAAACACCCTTTTTATACCAAACAAGTTGCAGACAAGTTTGGTATCGTTTACAATATACTTATC AAATCAAACTTGCTTTGACAAGTATAAGGAGAATCAAATG-3 '

Methods to identifv promoters include techniques known in the art as ell as those provided herein Art techniques include, but are not limited to. the following RT-PCR RT-PCR analv sis of total RNA isolated from infected tissue or in vitro grown cells Using genome databases, primer pairs are designed to predict transcripts of the selected pathogen and arrayed in microtiter dish format Total RNA is isolated from an in vitro grown pathogen and RT- PCR performed with all the primer pairs Similarly RT-PCR is performed with total RNA isolated at varying times from infections of the selected pathogen m a variety of appropriate animal models Comparison of the PCR profiles which reflect the ratio of a given mRNA to internal standards such as rRNA or housekeeping genes provides identification of those transcπpts which are essentially absent in vitro, but are on throughout, or during, various phases of infection

Putative promoters are characterized using TaqMan quantitative RT-PCR. or expression of reporter genes Specific sequence detection occurs bv amplification of target sequences in the PE Applied

Biosystems 7700 Sequence Detection System in the presence of an ohgonucleotide probe labeled at the 5' and 3' ends with a reporter and quencher fluorescent dve. respectively (TaqMan FQ probe), which anneals between the two PCR primers Only specific product will be detected when the probe is bound between the primers As PCR amplification proceeds, the 5'-nuclease activity of Taq polymerase initially cleaves the reporter dye from the probe The signal generated when the reporter dye is physicallv separated from the quencher dye is measured with an attached CCD camera Each signal generated equals one probe cleaved which corresponds to amplification of one target strand RT/PCR controls may include +/- reverse transcπptase reactions, amplification along side genes known to be transcribed under the conditions of study and amplification of serial dilutions of genomic DNA The level of transcription under in vivo and in vitro conditions is quantified by comparison of signal generated from these samples to that of a standard curve generated from signal resulting from amplification of the genomic DNA

FAM and TAMRA labeling of primers and the uses of such primers has been reported (Lee, LG. Connell. CR. and Bloch. W 1993 Allehc discrimination by nick-translation PCR with fluorogemc probes Nucleic Acids Research 21 3761-3766. Livak. KJ. Flood. SJA. Marmaro, J , Giusti. W. and Deetz. K 1995 Ohgonucleotides with fluorescent dves at opposite ends provide a quenched probe svstem useful for detecting PCR product and nucleic acid hybridization PCR Methods and Applications 4 357-362 )

And/or the promoter region can be cloned upstream of a reporter gene m a vector appropriate for the selected pathogen Bv "appropriate" it is meant a vector capable of replicating stably in a selected pathogen

Potential reporter genes include, but are not limited to. beta-galactosidase. beta-lactamase. bacterial luciferase. fireflv luciferase. beta-glucuromdase Many other reporter genes known m the art may be used in the methods and compositions of matter of the invention Primer extension

A primer especific for the gene which transcription to be analyse is designed at the appropiate distance from the ATG start codon Total RNA is isolated from an in vitro grown pathogen and a reverse transcπptase reaction is carried out Primers are fluorescently labelled at the 5 'end using FAM. HEX or NED dv es Primer extension products can be separated on a polyacrylamide sequencing gel and detected using a suitable gel scanning system (e g ABI Prism™ 377 Sequencer using GeneScan™ software as supplied by Perkm Elmer)

Deposited materials

A deposit containing a Streptococcus pneumoniae 0100993 strain has been deposited with the National Collections of Industrial and Marine Bacteπa Ltd (herein "NCIMB"), 23 St Machar Dnve, Aberdeen AB2 IRY. Scotland on 11 Apπl 1996 and assigned deposit number 40794 The deposit was descπbed as Streptococcus pneumoniae 0100993 on deposit

On 17 Apπl 1996 a Streptococcus pneumoniae 0100993 DNA library in E co was similarly deposited with the NCIMB and assigned deposit number 40800 The Streptococcus pneumoniae strain deposit is referred to herein as "the deposited strain" or as "the DNA of the deposited strain " The deposited strain contains the full length treP gene compnsing the promoter polynucleotide of the invention The sequence of the promoter polynucleotides contained in the deposited strain, are controlling in the event of any conflict with any descπption of sequences herein

The deposit of the deposited strain has been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for Purposes of Patent Procedure The deposited strain will be irrevocably and without restπction or condition released to the public upon the issuance of a patent The deposited strain is provided merely as convemence to those of skill in the art and is not an admission that a deposit is required for enablement. such as that required under 35 U S C §112 A license may be required to make, use or sell the deposited strain, and compounds deπved therefrom, and no such license is herebv granted

- A - In one aspect of the invention there is provided an isolated nucleic acid molecule functional in the

Streptococcus pneumoniae 0100993 strain, which polynucleotide is contained in the deposited strain Further provided bv the invention are treP polvnucleotide sequences in the deposited strain, such as DNA and RNA and ammo acid sequences encoded therebv Also provided by the invention are treP polvnucleotide sequences isolated from the deposited strain

Polvnucleotides

It is an object of the invention to provide promoter polvnucleotides from a treP gene In a particularly preferred embodiment of the invention the polynucleotide compπses a promoter region from treP gene compπsrng a sequence set out in Table 1 [SEQ ID NO 1]. or a variant thereof As a further aspect of the invention there are provided isolated promoter nucleic acid molecules from a treP gene, including, for example, polvnucleotides deπved from such molecules, such as. unprocessed RNAs. nbozyme RNAs. mRNAs. cDNAs. genomic DNAs. B- and Z-DNAs Further embodiments of the invention include biologically, diagnosticall} . prophylacticallv . chnicallv or therapeutically useful polvnucleotides. and vaπants thereof, and compositions compπsing the same Another aspect of the invention relates to isolated polynucleotides. including, for example polynucleotides closelv related to a treP promoter having a polvnucleotide sequence of Table 1 [SEQ ID NO l]

In another particularly preferred embodiment of the invention there is a treP polvnucleotide from Streptococcus pneumoniae compπsmg or consistmg of an nucleotide sequence of Table 1 [SEQ ID NO 1], or a variant thereof

Using the information provided herein, such as a promoter polynucleotide sequence set out in Table 1 [SEQ ID NO 1], a polvnucleotide of the invention may be obtained using standard cloning and screening methods, such as those for cloning and sequencmg chromosomal (genomic) DNA fragments from bacteπa using Streptococcus pneumoniae 0100993 cells as starting mateπal. followed by obtaining a related or equivalent sequence For example, to obtain a polvnucleotide sequence of the mvention. such as a polynucleotide sequence given in Table 1 [SEQ ID NO 1], typically a library of clones of chromosomal DNA of Streptococcus pneumoniae 0100993 in E coh or some other suitable host is probed with a radiolabeled ohgonucleotide. preferablv a 17-mer or longer, derived from a partial sequence Clones carrying DNA identical to that of the probe can then be distinguished using stπngent hybπdization conditions By sequencing the individual clones thus identified by hybπdization with sequencmg primers designed from the original polvnucleotide sequence it is then possible to extend the polynucleotide sequence m both directions to determine a functional promoter region sequence or full length gene sequence Convenientlv . such sequencmg is performed, for example, using denatured double stranded DNA prepared from a plasmid clone Suitable techniques are descπbed by Maniatis. T . Fπtsch. E F and Sambrook et al . MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor. New York (1989) (see m particular Screening Bv Hvbπdization 1 90 and Sequencing Denatured Double-Stranded DNA Templates 13 70) Direct genomic DNA sequencing mav also be performed to obtain a promoter sequence of expressiblv linked full length gene sequence Illustrative of the mvention. each polynucleotide set out m Table 1 [SEQ ID NO 1] was discovered m a DNA library deπved from Streptococcus pneumoniae 0100993

In a further aspect, the present mvention provides for an isolated polvnucleotide comprising or consisting of a polvnucleotide sequence which has at least 70% identit) . preferably at least 80% identit} . more preferably at least 90% identity, yet more preferably at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO 1 over the entire length of SEQ ID NO 1

A polvnucleotide encoding a polvpeptide of the present mvention. including homologs and orthologs from species other than Streptococcus pneumoniae, may be obtained by a process which compπses the steps of screening an appropπate library under stringent hybπdization conditions with a labeled or detectable probe consisting of or compπsmg the sequence of SEQ ID NO 1 or a fragment thereof, and isolating a promoter and/or full-length gene and or genomic clones containing said polynucleotide sequence

The mvention also mcludes a polynucleotide consisting of or compπsmg a polynucleotide of the formula

X-(R₁)_m-(R₂)-(R₃)_n-Y wherein, at the 5' end of the molecule, X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule. Y is hvdrogen. a metal, or a modified nucleotide residue, or together with X defines the covalent bond, each occurrence of Rj and R3 is independently any nucleic acid residue or modified nucleic acid residue, m is an integer between 1 and 3000 or zero . n is an integer between 1 and 3000 or zero, and R is a nucleic acid sequence or modified nucleic acid sequence of the mvention, particularlv a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof In the polynucleotide formula above, R₂ is oriented so that its 5' end nucleic acid residue is at the left, bound to R\ and its 3' end nucleic acid residue is at the right, bound to R3 Any stretch of nucleic acid residues denoted by either Ri and/or R₂, where m and/or n is greater than 1. may be either a heteropolymer or a homopolymer. preferably a heteropolymer Where, in a preferred embodiment. X and Y together define a covalent bond, the polynucleotide of the above formula is a closed, circular polvnucleotide. which can be a double-stranded polynucleotide herein the formula shows a first strand to which the second strand is complementary In another preferred embodiment m and/or n is an integer between 1 and 1000. Other preferred embodiments of the mvention are provided where m is an integer between 1 and 50. 100 or 500, and n is an integer between 1 and 50, 100. or 500 It is most preferred that a polvnucleotide of the mvention is deπved from Streptococcus pneumoniae. however, it mav preferablv be obtained from other organisms of the same taxonomic genus A polvnucleotide of the mvention mav also be obtained, for example, from organisms of the same taxonomic family or order

Preferred embodiments are polvnucleotides that retain substantially the same biological function or activαtv as the promoter region DNA of Table 1 [SEQ ID NO 1]

In accordance with certain preferred embodiments of this mvention there are provided polvnucleotides that hv bπdize. particularlv under stringent conditions, to treP polvnucleotide sequences, such as those polvnucleotides m Table 1 In this regard, the mvention especially relates to polvnucleotides that hybπdize under stringent conditions to the polvnucleotides descπbed herem As herem used, the terms "stringent conditions" and "stringent hybπdization conditions" mean h bπdization occurring only if there is at least 95% and preferablv at least 97% identitv between the sequences A specific example of stπngent hv bridization conditions is overnight incubation at 42°C in a solution comprising 50% formamide, 5x

SSC (150mM NaCl. 15mM tπsodium citrate). 50 mM sodium phosphate (pH7 6). 5x Denhardt's solution. 10% dextran sulfate. and 20 micrograms/ml of denatured, sheared salmon sperm DNA. followed bv washing the hv bridization support in 0 lx SSC at about 65°C Hybridization and wash conditions are well known and exemplified m Sambrook. et al . Molecular Cloning A Laboratory

Manual. Second Edition. Cold Spring Harbor. N Y , (1989). particularly Chapter 11 therein Solution hybridization may also be used with the polvnucleotide sequences provided by the mvention Preferred polynucleotides that hybπdize under stπngent conditions are polynucleotide sequences compπsmg of at least 50. 100, 500. 1000, or 3000 nucleotides

As discussed elsewhere herem regarding polynucleotide assays of the mvention. for instance, the polynucleotides of the mvention. may be used as a hybπdization probe genomic DNA to isolate genomic clones encoding treP and to isolate genomic clones of other genes that have a high identity, particularly high sequence identity, to the treP gene Such probes generally will compπse at least 15 nucleotide residues or base pairs Preferably, such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs Particularly preferred probes w ll have at least 20 nucleotide residues or base pairs and ill have lee than 30 nucleotide residues or base pairs

The polvnucleotides of the mvention may be employed, for example, as research reagents and matenals for discovery of treatments of and diagnostics for diseases, particularly human diseases, as further discussed herem relatmg to polynucleotide assays

For each and every polvnucleotide of the mvention there is provided a polvnucleotide complementary to it It is preferred that these complementary polvnucleotides are fully complementary to each polynucleotide with winch they are complementary In addition to the standard A, G, C, T U representations for nucleotides, the term "N" may also be used in describing certain polynucleotides of the invention "N" means that any of the four DNA or RNA nucleotides may appear at such a designated position in the DNA or RNA sequence, except it is preferred that N is not a nucleic acid that when taken in combination with adjacent nucleotide positions, when read in the correct reading frame, would have the effect of generating a premature termination codon in such reading frame Vectors, Host Cells, Expression Systems

The mvention also relates to vectors that compπse a polvnucleotide or polvnucleotides of the mvention. host cells that are geneticallv engmeered with v ectors of the mv ention and the production of polvnucleotides of the mvention bv recombmant techniques Further the promoter polynucleotides of the mvention can be used to dπve the expression of heterologous proteins or over-expression of naturally associated proteins Smce the promoter polvnucleotide of the mvention is inducible. such as by mannose or bv anv other appropπate inducers as the case mav be. m other aspect the further aspect relates to direct or indirect up- or down-regulation of expression or transcπption of a target gene Recombmant proteins (polypeptides) may be prepared bv processes well known m the art from genetically engmeered host cells compnsmg expression vectors

For recombmant production of the polvnucleotides of the mvention. host cells can be genetically engmeered to mcorporate replication systems or portions thereof or polvnucleotides of the mvention Introduction of a polynucleotide mto the host cell can be effected by methods descπbed m many standard laboratory manuals, such as Davis, el al , BASIC METHODS IN MOLECULAR BIOLOGY. (1986) and Sambrook. el al . MOLECULAR CLONING A LABORATORY MANUAL. 2nd Ed . Cold Spring Harbor Laboratory Press. Cold Spring Harbor. N Y (1989). such as. calcium phosphate transfection. DEAE-dextran mediated transfection. transvection. mιcrom)ectιon. catiomc lipid-mediated transfection, electroporation. transduction. scrape loading, ballistic mtroduction and infection Representative examples of appropπate hosts mclude bacteπal cells, such as cells of streptococci, staphylococci. enterococci, E coll. streptomyces, cyanobacteπa. Bacillus subtihs. and Streptococcus pneumoniae. fungal cells, such as cells of a yeast, Kluveromyces. Saccharomyces. a basidiomycete. Candida albicans and Aspergillus. insect cells such as cells of Drosop la S2 and Spodoptera Sf9. animal cells such as CHO. COS. HeLa. C127. 3T3. BHK. 293, CV- 1 and Bowes melanoma cells, and plant cells, such as cells of a gvmnosperm or angiosperm A great vanety of replication systems can be used to produce the polvnucleotides of the mvention

Such vectors mclude. among others, chromosomal-, episomal- and virus-deπved vectors, for example, vectors deπved from bacteπal plasmids. from bacteπophage. from transposons. from east episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculovrruses, papova viruses, such as SV40. vaccinia viruses, adenovrruses. fowl pox viruses, pseudorabies viruses, picornaviruses and retroviruses. and vectors denved from combinations thereof, such as those deπved from plasmid and bacteπophage genetic elements, such as cosmids and phagemids The replication system constructs mav contain control regions other than the promoter of the mvention that regulate as ell as engender expression, such as marker gene expression Generally, am system or vector suitable to maintain, propagate or express polynucleotides m a host mav be used for expression in this regard The appropπate DNA sequence may be inserted mto the expression system by any of a vaπety of well-known and routme techniques, such as. for example, those set forth in Sambrook et al . MOLECULAR CLONING A LABORATORY MANUAL, (supra)

Assays, antagonists and Agonists Characterization of Function: Assays of the invention mav be performed by determining the effect of transcript level on cell phenotype These assays will help to characterize, among other things, temporal relevance of transcription to phenotype

Protein Expression: Promoter polvnucleotides of the invention mav be used for overproduction of heterologous proteins in bacteria Essentiality Testing: Promoter polvnucleotides of the invention may be used to assess gene essentiality in a bacteria Example 2 provides one embodiment of this type of assay Skilled artisans can readily determine other ways to perform such analyses based on the present invention and the teachmgs herein

Polynucleotides of the mvention may also be used to assess the binding of small molecule substrates and hgands in, for example, cells, cell-free preparations, chemical libraπes. and natural product mixtures These substrates and hgands may be natural substrates and gands or may be structural or functional mimetics See, e g . Coligan et al , Current Protocols in Immunology' 1(2) Chapter 5 (1991)

Polynucleotides of the present mvention are responsible for many biological functions, mcluding many disease states, m particular the Diseases herembefore mentioned It is therefore desirable to devise screenmg methods to identify compounds which stimulate or which inhibit the function of the polvnucleotide Accordingly, m a further aspect, the present mvention provides for a method of screening compounds to identify those which stimulate or which inhibit the function of a polvnucleotide of the mvention, as well as related polynucleotides In general, agonists or antagonists may be employed for therapeutic and prophv lactic purposes for such Diseases as herembefore mentioned Compounds may be identified from a vaπety of sources, for example, cells, cell-free preparations, chemical libraπes. and natural product mixtures Such agonists, antagonists or inhibitors so-identified may be natural or modified substrates, hgands. receptors, enzymes, etc . as the case mav be, of treP polvnucleotides. or mav be structural or functional mimetics thereof (see Coligan et al . Current Protocols in Immunology 1(2) Chapter 5 (1991)) The screenmg methods mav simplv measure the binding of a candidate compound to the polynucleotide. or to cells or membranes beaπng the polvnucleotide Alternativelv . the screenmg method mav involve competition w ith a labeled competitor Further, these screenmg methods may test whether the candidate compound results m a signal generated bv activation or inhibition of the polynucleotide. using detection sv stems appropnate to the cells compnsing the polvnucleotide Inhibitors of activation are generally assayed in the presence of a known agomst and the effect on activation by the agonist bv the presence of the candidate compound is observed Constitutively active promoter polvnucleotides and or constitutivelv expressed polvnucleotides may be employed m screenmg methods for inverse agonists or inhibitors, in the absence of an agonist or inhibitor, bv testing whether the candidate compound results in inhibition of activation of the polvnucleotide. as the case may be

Further, the screening methods mav simply comprise the steps of mixing a candidate compound with a solution containing a polvnucleotide of the present invention, to form a mixture, measuring treP promoter polv nucleotide activitv m the mixture, and comparing the treP promoter polynucleotide activity of the mixture to a standard Fusion proteins, such as those made from Fc portion and treP promoter polynucleotide. as hereinbefore described, can also be used for high-throughput screenmg assays to identify' antagonists of the polvnucleotide of the present invention, as well as of phylogenetically and and/or functional!} related promoters

The polynucleotides, polypeptides and antibodies that bind to and/or interact with a polynucleotide of the present invention may also be used to configure screening methods for detectmg the effect of added compounds on the production of mRNA and/or promoter polvnucleotide m cells

The mvention also provides a method of screenmg compounds to identify those which enhance (agonist) or block (antagonist) the action of treP polynucleotides. particularly those compounds that are bacteπstatic and/or bacteπcidal The method of screenmg may mvolve high-throughput techniques For example, to screen for agonists or antagonists, a synthetic reaction mix. a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, compπsmg treP polynucleotide and a labeled substrate or ligand of such polynucleotide is mcubated m the absence or the presence of a candidate molecule that may be a treP agomst or antagonist The ability of the candidate molecule to agonize or antagonize the treP polvnucleotide is reflected m decreased binding of the labeled ligand or decreased production of product from such substrate Molecules that bmd gratuitously. i e . without inducing the effects of treP polvnucleotide are most likely to be good antagonists Molecules that bmd well and. as the case mav be. mcrease the rate of product production from substrate, mcrease signal transduction. or mcrease chemical channel activity are agonists Detection of the rate or level of. as the case may be, production of product from substrate, signal transduction, or chemical channel activity may be enhanced by using a reporter system Reporter systems that may be useful m this regard mclude but are not limited to coloπmetπc. labeled substrate converted mto product, a reporter gene that is responsive to changes m treP polynucleotide activit}. and bmdmg assa} s known m the art

Polynucleotides of the invention ma} be used to identify promoter bmdmg protems. such as sigma factors, if an} . for such pohnucleotide. through standard bindmg techniques known in the art. for example, gel retardation assa}s Other of these techniques include, but are not limited to. ligand binding and crosshnking assays in which the pohnucleotide is labeled with a radioactive isotope (for instance, -^p) chemicalh modified (for instance, biotmylated or fluorescent tagged), or fused to a pohnucleotide sequence suitable for detection or purification, and mcubated with a source of the putative binding compound or ligand (e g . cells, cell membranes, cell supernatants. tissue extracts, bodilv materials) Other methods include bioph} sical techniques such as surface plasmon resonance and spectroscop} These screening methods ma} also be used to identify agonists and antagonists of the polynucleotide which compete with the binding of the pohnucleotide to its hgand(s). if any Standard methods for conducting such assays are well understood m the art

The fluorescence polarization value for a fluorescent]} -tagged molecule depends on the rotational correlation time or tumbling rate Protem-polynucleotide complexes, such as formed by treP polynucleotide associating with polypeptide or other factor, labeled to comprise a fluorescently-labeled molecule will have higher polarization values than a fluorescently labeled monomeπc polynucleotide It is preferred that this method be used to characteπze small molecules that disrupt polypeptide- polynucleotide complexes Fluorescence energy transfer ma} also be used to characterize small molecules that interfere with the formation of treP polynucleotide-polypeptide dimers. tπmers. tetramers or higher order structures, or structures formed by treP pohnucleotide and a polypeptide or polypeptides TreP polynucleotides can be labeled with both a donor and acceptor fluorophore Upon mixing of the two labeled species and excitation of the donor fluorophore. fluorescence energy transfer can be detected by observing fluorescence of the acceptor Compounds that block dimeπzation will inhibit fluorescence energy transfer

In other embodiments of the mvention there are provided methods for identifying compounds which bmd to or otherwise mteract with and inhibit or activate an activity or expression of a polynucleotide of the mvention compnsmg contacting a pohnucleotide of the mvention with a compound to be screened under conditions to permit bmdmg to or other mteraction between the compound and the polynucleotide to assess the bmdmg to or other mteraction with the compound, such bmdmg or mteraction preferably bemg associated with a second component capable of providing a detectable signal m response to the bmdmg or mteraction of the polynucleotide with the compound, and determining whether the compound bmds to or otherwise interacts with and activates or inhibits an activit} or expression of the polvnucleotide b} detecting the presence or absence of a signal generated from the bmdmg or mteraction of the compound with the pohnucleotide

Another example of an assav for treP agonists or antagonists is a competitive assay that combines treP and a potential agonist or antagonist with treP-binding molecules, recombmant treP bmdmg molecules. natural substrates or hgands. or substrate or ligand mimetics. under appropπate conditions for a competitive inhibition assav TreP can be labeled, such as b} radioactivity or a coloπmetπc compound, such that the number of treP molecules bound to a bmdmg molecule or converted to product can be determined accurateh to assess the effectiveness of the potential antagonist or agonist

Numerous assa} s ma} be used with the preferred inducible promoters of the invention, as provided herein an as known in the art These assa} s include, but are not limited to the following

Antimicrobial Compound Testing

Promoter polynucleotides of the invention may also be used to determine a target of unknown antibacterial susceptibility

Promoter polynucleotides of the invention may also be used to assess the effect of transcπpt level on antibacterial susceptibi t)

Still further, promoter polynucleotides of the invention ma} also be used in whole cell screens

Inducible promoters can be used to up and down regulate expression of target gene directly, or indirectly b} transcription anti-sense RNA or πbozymes Potential antagonists mclude. among others, small organic molecules, peptides. polypeptides that bmd to a polynucleotide of the mvention and thereb} inhibit or extinguish its activity or expression Potential antagonists also may be small organic molecules, a peptide. a pohpeptide such as a closely related protein that bmds the same sites on a bmdmg molecule, such as a bmdmg molecule, without mducmg treP promoter- induced activities, thereby preventmg the action of treP polynucleotides by excluding treP polynucleotides from bmdmg

Potential antagonists mclude a small molecule that bmds to and occupies the bmdmg site of the polynucleotide thereby preventmg bmdmg to cellular bmdmg molecules, such that normal biological activity is prevented Examples of small molecules mclude but are not limited to small organic molecules, peptides or peptide-like molecules Other potential antagonists mclude antisense molecules (see Okano. J Neurochem 56 560 ( 1991 ). OLIGODEOXYNUCLEOTIDES AS ANTISENSE INHIBITORS OF GENE EXPRESSION, CRC Press. Boca Raton. FL (1988), for a descπption of these molecules) Preferred potential antagonists mclude compounds related to and vaπants of treP

Other examples of potential pohpeptide antagonists mclude oligonucleotides or proteins which are closely related to the hgands. substrates, receptors, enzymes, etc , as the case mav be. of the polynucleotide, e g . a fragment of the hgands. substrates, receptors, enzymes, etc . or small molecules which bmd to the pohnucleotide of the present mvention but do not elicit a response, so that the activit} of the pohnucleotide is prevented

Certain of the polynucleotides of the mvention are biomimetics. functional mimetics of the natural treP pohnucleotide These functional mimetics may be used for. among other things, antagonizing the activity of treP pohnucleotide Functional mimetics of the polynucleotides of the mvention mclude but are not limited to truncated polvnucleotides For example, preferred functional mimetics mclude. a pohnucleotide compπsmg the polvnucleotide sequence set forth m SEQ ID NO 1 lacking 5. 10. 20. 30. 40, 50. 60. 70 or 80 5' and/or 3' nucleotide residues, including fusion promoters compπsmg one or more of these truncated sequences Pohnucleotides of tliese functional mimetics mav be used to dπve the expression of expression cassettes and marker genes It is preferred that these cassettes compnse 5' and 3' restπction sites to allow for a convenient means to ligate the cassettes together when desired It is further preferred that these cassettes compnse gene expression signals known m the art or descπbed elsewhere herem

Thus, in another aspect, the present invention relates to a screening kit for identifying agonists antagonists, hgands. receptors, substrates, enzymes, etc for a polynucleotide of the present invention, or compounds which decrease or enhance the production of such polynucleotides . which compπses (a) a polynucleotide of the present invention, or (b) a recombmant cell expressing a pohnucleotide of the present invention , which polynucleotide is preferably that of SEQ ID NO 1

It will be appreciated that m any such kit, (a) or (b) may compnse a substantial component It will be readily appreciated by the skilled artisan that a polynucleotide of the present mv ention may also be used in a method for the structure-based design of an agonist, antagonist or inhibitor of the polynucleotide. by (a) determining in the first instance the three-dimensional structure of the polynucleotide. or complexes thereof, (b) deducing the three-dimensional structure for the hkelv reactive sιte(s), binding sιte(s) or motιf(s) of an agonist, antagonist or inhibitor, (c) synthesizing candidate compounds that are predicted to bind to or react with the deduced bindmg sιte(s). reactive sιte(s). and/or motιf(s). and (d) testing whether the candidate compounds are indeed agonists, antagonists or inhibitors

It will be further appreciated that this will normally be an iterative process, and this iterative process may be performed using automated and computer-controlled steps

In a further aspect, the present mvention provides methods of treatmg abnormal conditions such as. for instance, a Disease, related to either an excess of, an under-expression of. an elevated activit}' of. or a decreased activity of treP polynucleotide

If the expression and/or activity of the polynucleotide is m excess, several approaches are available One approach compπses administering to an individual m need thereof an inhibitor compound (antagonist) as herem descπbed. optionally m combination with a pharmaceutically acceptable earner, m an amount effective to inhibit the function and/or expression of the polvnucleotide. such as. for example, b} blocking the bmdmg of hgands. substrates, receptors, enzymes, etc . or b} inhibiting a second signal, and thereb} alleviating the abnormal condition

In still another approach, promoter activit} can be inhibited using expression blockmg techniques This blocking is preferabh targeted against transcnption An examples of a known technique of this sort involve the use of antisense sequences, either internally generated or separately administered (see. for example O'Connor. J Neurochem (1991) 56 560 in Ohgodeoxynucleotides as Antisense Inhibitors of Gene Expression CRC Press. Boca Raton. FL (1988)) Alternative]} , ohgonucleotides which form triple helices with the gene can be supplied (see. for example. Lee et al , Nucleic Acids Res (1979) 6 3073. Coone} et al Science (1988) 241 456. Dervan et al , Science (1991) 251 1360) These ohgomers can be administered per se or the relev ant ohgomers can be expressed in vivo Thus promoter po nucleotides of the invention are useful for ascertaining the functionality or essentiality of the target gene (gene-of-mterest) in a cell through expression blocking techniques A method compnses "knocking -out" the transcription or expression of gene-of-mterest by expressing an anti-sense sequence to the gene-of-interest under the transcriptional control of the promoter pohnucleotides of the invention, particularh those contained in SEQ ID NO 1 In another embodiment, the method comprises, in a cell, (a) disabling ("knockmg-out") the gene-of-interest. (b) reintroducing. at the target gene locus, the gene- of-interest now under the operational control of the inducible promoter polynucleotides of the invention (particularly those contained in SEQ ID NO 1). and (c) adding the mducer thereby providing information to the essentiality or functionality of the gene of interest

Helicobacter pylori (herein "H pylori") bacteπa infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastntis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Helicobacter Pylori (International Agency for Research on Cancer, Lyon, France, http //www uicc ch/ecp/ecp2904 htm) Moreover, the International Agenc} for Research on Cancer recently recognized a cause-and-effect relationship between H pylori and gastric adenocarcmoma. classifying the bactenum as a Group I (definite) carcinogen Preferred antimicrobial compounds of the invention (agomsts and antagonists of treP polynucleotides) found usmg screens provided by the invention, or known in the art. particularly narrow-spectrum antibiotics, should be useful m the treatment of H pylori infection Such treatment should decrease the advent of H pylori -induced cancers, such as gastrointestinal carcinoma Such treatment should also prevent, inhibit and/or cure gastric ulcers and gastritis

GLOSSARY The following definitions are provided to facilitate understanding of certain terms used frequenth herem

"Bodih mateπal(s) means anv matenal denved from an individual or from an organism infecting, infesting or inhabiting an individual, including but not limited to. cells, tissues and waste, such as. bone, blood, serum, cerebrospinal fluid, semen, saliva, muscle, cartilage, organ tissue, skin. unne. stool or autops) matenals

"Dιsease(s)" means anv disease caused b} or related to infection by a bacteπa. including , for example, otitis media conjunctivitis, pneumonia, bacteremia. meningitis, sinusitis, pleural empyema and endocarditis, and most particularh meningitis, such as for example infection of cerebrospinal fluid "Host cell(s)" is a cell which has been transformed or transfected. or is capable of transformation or transfection bv an exogenous pohnucleotide sequence

"Identit ." as known m the art, is a relationship between two or more pohpeptide sequences or two or more polynucleotide sequences, as the case may be. as determined by comparing the sequences In the art. "identity" also means the degree of sequence relatedness between polypeptide or pohnucleotide sequences, as the case ma} be. as determined bv the match between stnngs of such sequences "Identity" can be readih calculated b} known methods, including but not limited to those descnbed m (Computational Molecular Biology. Lesk. A M . ed . Oxford University Press. New York. 1988, Biocomputing Informatics and Genome Projects. Smith. D W , ed . Academic Press, New York, 1993, Computer Analysis of Sequence Data, Part I, Gπffin, A M . and Gnffin. H G , eds . Humana Press. New Jersev . 1994 Sequence Analysis in Molecular Biology, von Hemje. G . Academic Press, 1987, and Sequence Analysis Primer. Gπbskov, M and Devereux, J , eds . M Stockton Press, New York, 1991. and Caπllo. H . and Lipman. D , SIAM J Applied Math , 48 1073 (1988) Methods to determine identify are designed to give the largest match between the sequences tested Moreover, methods to determine identity are codified in publicly available computer programs Computer program methods to determine identity between two sequences include, but are not limited to. the GCG program package (Devereux. J . et al . Nucleic Acids Research 12(1) 387 (1984)), BLASTP. BLASTN, and FASTA (Altschul. S F et al . J Molec Biol 215 403-410 (1990) The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S . et al , NCBI NLM NIH Bethesda. MD 20894. Altschul. S . et al . J Mo! B ol 215 403-410 (1990) The well known Smith Waterman algorithm ma} also be used to determine identify'

Parameters for pohpeptide sequence comparison include the following Algonthm Needleman and Wunsch. J Mol Biol 48 443-453 (1970)

Comparison matrix BLOSSUM62 from Hentikoff and Hentikoff. Proc Natl Acad Sci USA 89 10915-10919 (1992) Gap Penalt} 12 Gap Length Penalt) 4

A program useful ith these parameters is pub ch available as the "gap" program from Genetics Computer Group. Madison WI The aforementioned parameters are the default parameters for peptide comparisons (along with no penalty for end gaps)

Parameters for pohnucleotide companson include the following Algorithm Needleman and Wunsch. J Mol Biol 48 443-453 (1970) Comparison matrix matches = +10. mismatch = 0 Gap Penalt} 50 Gap Length Penaltv 3

Available as The "gap" program from Genetics Computer Group. Madison WI These are the default parameters for nucleic acid comparisons

A preferred meaning for "identit} " for pohnucleotides and polypeptides. as the case may be. are provided in (1) and (2) below (1) Polynucleotide embodiments further include an isolated polvnucleotide comprising a polynucleotide sequence having at least a 50, 60, 70. 80. 85. 90, 95. 97 or 100% identity to the reference sequence of SEQ ID NO 1 , wherein said pohnucleotide sequence ma} be identical to the reference sequence of SEQ ID NO 1 or may mclude up to a certain mteger number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion. or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or m one or more contiguous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO 1 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides m SEQ ID NO 1, or

ⁿn ≤ ^~n " (^xn * y),

wherein n_n is the number of nucleotide alterations. x_n is the total number of nucleotides in SEQ ID

NO 1. y is 0 50 for 50%. 0 60 for 60%, 0 70 for 70%. 0 80 for 80%. 0 85 for 85%. 0 90 for 90%. 0 95 for 95%. 0 97 for 97% or 1 00 for 100%, and • is the symbol for the multiplication operator, and wherem an)' non-integer product of x_n and y is rounded down to the nearest mteger prior to subtractmg Bv vvav of example, a pohnucleotide sequence of the present mvention ma) be identical to the reference sequence of SEQ ID NO 1. that is it ma) be 100% identical, or it ma) mclude up to a certain mteger number of nucleic acid alterations as compared to the reference sequence such that the percent identit} is less than 100% identitv Such alterations are selected from the group consisting of at least one nucleic acid deletion, substitution, including transition and transversion or insertion, and vvherem said alterations mav occur at the 5' or 3' terminal positions of the reference pohnucleotide sequence or anywhere bet een those terminal positions, interspersed either mdividualh among the nucleic acids m the reference sequence or in one or more contiguous groups withm the reference sequence The number of nucleic acid alterations for a given percent identity is determined bv multiph ing the total number of nucleic acids in SEQ ID NO 1 by the integer defining the percent identitv divided b) 100 and then subtracting that product from said total number of nucleic acids in SEQ ID NO 1. or

ⁿn ≤ ^xn ^" (^xn * y),

wherein n_n is the number of nucleic acid alterations. x_n is the total number of nucleic acids in SEQ ID NO 1. y is for instance 0 70 for 70% 0 80 for 80%. 0 85 for 85% etc . • is the s}mbol for the multiplication operator, and wherein anv non-integer product of x_n and y is rounded down to the nearest integer prior to subtracting it from x_n

"Indιvιdual(s)" means a multicellular eukaryote. mcluding. but not limited to a metazoan. a mammal, an ovid. a bovid. a simian, a primate, and a human

"Isolated" means altered "by the hand of man" from its natural state, i e . if it occurs m nature it has been changed or removed from its onginal environment or both For example a pohnucleotide or a pol)peptide naturally present m a Irving organism is not "isolated ^' but the same polynucleotide or pohpeptide separated from the coexisting matenals of its natural state is "isolated", as the term is employed herem Moreover, a polynucleotide or polypeptide that is mtroduced mto an organism b) transformatioa genetic manipulation or by any other recombmant method is "isolated" even if it is still present in said organism, which organism ma) be living or non-living

"Organιsm(s)" means a (I) prokaryote, including but not limited to. a member of the genus Streptococcus Staphylococcus Bordetella Corynebacterium Mycobactenum Neissena Haemophύus Actinomycetes Streptomycetes Nocardia Enterobacter Yersmia Fancisella Pasturella Moraxella Acmetobacter Erys pelothrix Branhamella Actinobacillus Streptobacillus Listena Calymmatobactenum Brucella Bacillus Clostridium Treponema Eschenchia Salmonella Kleibsiella Vibrio Proteus Erwinia Borrelia Leptospira Spirillum Campylobacter Shigella, Legionella Pseudomonas Aeromonas Rickettsia Chlamydia Borrelia and Mycoplasma. and further mcluding but not limited to. a member of the species or group. Group A Streptococcus, Group B Streptococcus, Group C Streptococcus. Group D Streptococcus. Group G Streptococcus, Streptococcus pneumoniae. Streptococcus pyogenes. Streptococcus agalactiae. Streptococcus faecalis. Streptococcus faecnim. Streptococcus durans, Neisseria gonorrheae, Neissena menmgitidis, Staphylococcus aureus. Staphylococcus epidermidis, Corynebacterium dipthenae. Gardnerella vaginalis, Mycobactemim tuberculosis, Mycobactenum bovis. Mycobactenum ulcerans. Mycobactenum leprae, Actinomyctes israelii, Listena monocytogenes, Bordetella pertusis. Bordatella parapertusis, Bordetella bronchiseptica. Eschenchia coll. Shigella dysentenae. Haemophilus influenzae. Haemophilus aegyptius, Haemophilus parainfluenzae, Haemophilus ducreyi, Bordetella, Salmonella typhi. Citrobacter freundn, Proteus mirabilis, Proteus vulgans. Yersima pestis, Kleibsiella pneumoniae, Serratia marcessens. Serratia hquefaciens. Vibrio cholera. Shigella dysentem, Shigella flexnen. Pseudomonas aeruginosa. Franscisella tularensis. Brucella abortis, Bacillus anthracis, Bacillus cereus, Clostndium perfnngens, Clostndium tetani, Clostndium botuhnum. Treponema pallidum, Rickettsia rickettsu and Chlamydia trachomitis, (ii) an archaeon, including but not limited to Archaebacter. and (iii) a unicellular or filamentous eukaryote. mcluding but not limited to. a protozoan, a fungus, a member of the genus Saccharomyces. Kluveromyces, or Candida, and a member of the species Saccharomyces cenviseae, Kluveromyces lactis, or Candida albicans.

"Polynucleotide(s)" generally refers to any polyribonucleotide or polydeoxyribonucleotide. which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide(s)" include, without limitation, single- and double-stranded DNA DNA that is a mixture of single- and double-stranded regions or single-, double- and tnple-stranded regions, single- and double-stranded RNA. and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or. more typically, double-stranded, or tnple-stranded regions, or a mixture of single- and double-stranded regions. In addition, "polynucleotide" as used herem refers to tnple-stranded regions compnsmg RNA or DNA or both RNA and DNA. The strands m such regions may be from the same molecule or from different molecules The regions may mclude all of one or more of the molecules, but more fypically involve onl}- a region of some of the molecules. One of the molecules of a triple-helical region often is an ohgonucleotide. As used herein, the term "polynucleotide(s)" also mcludes DNAs or RNAs as described above that contain one or more modified bases Thus. DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is mtended herein Moreover, DNAs or RNAs compnsmg unusual bases, such as inosine. or modified bases, such as tritvlated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great vanety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term "pohnucleotide(s)" as it is employed herem embraces such chemically, enzymatically or metabolically modified forms of pohnucleotides. as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including. for example, simple and complex cells "Pohnucleotide(s)" also embraces short pohnucleotides often refened to as olιgonucleotιde(s)

"Pohpeptιde(s)" refers to an} peptide or protem compnsmg two or more ammo acids jomed to each other b) peptide bonds or modified peptide bonds "Pohpeptιde(s)" refers to both short chains, commonly refened to as peptides. oligopeptides and ohgomers and to longer chains generally refened to as proteins Pohpeptides ma) contain ammo acids other than the 20 gene encoded ammo acids "Polypeptide(s)" mclude those modified either b} natural processes, such as processmg and other post-translational modifications, but also b) chemical modification techniques Such modifications are ell descnbed m basic texts and m more detailed monographs, as well as m a voluminous research literature, and the) are well known to those of skill m the art It will be appreciated that the same t}pe of modification may be present m the same or varymg degree at several sites m a given pohpeptide Also, a given pohpeptide may contain many types of modifications Modifications can occur an) where m a pohpeptide. including the peptide backbone, the ammo acid side-chains, and the ammo or carbox)l termini Modifications mclude. for example, acetylation. acylation. ADP-πbos) lation. amidation. covalent attachment of flavin, covalent attachment of a heme moiety. covalent attachment of a nucleotide or nucleotide denvative. covalent attachment of a lipid or lipid deπvative. covalent attachment of phosphotidylinositol, cross-linking, cvclization. disulfide bond formation, demethylation. formation of covalent cross-links, formation of cysteine. formation of pyroglutamate, formylation. gamma-carbox} lation. GPI anchor formation, hydroxylation. lodination. methylation, myπstoylation. oxidation, proteolytic processmg, phosphorylation. prenylation. racemization. glycosylation, lipid attachment, sulfation, gamma-carboxvlation of glutamic acid residues, hydroxylation and ADP- πbosylation. selenoylation. sulfation. transfer-RNA mediated addition of ammo acids to proteins, such as arginylation. and ubiquitination See, for instance. PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES. 2nd Ed , T E Creighton. W H Freeman and Company. New York (1993) and Wold. F . Posttranslational Protem Modifications Perspectives and Prospects, pgs 1-12 m POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B C Johnson. Ed . Academic Press. New York (1983), Seifter et al . Meth Enzymol 182 626-646 (1990) and Rattan et al . Protein Synthesis Posttranslahonal Modifications and Aging. Aim N Y Acad Sci 663 48-62 (1992) Polypeptides may be branched or cyclic, with or without branching Cyclic, branched and branched circular pohpeptides may result from posttranslational natural processes and ma) be made by entirely synthetic methods, as well "Recombmant expression s)stem(s)" and "recombmant replication system(s) "refers to expression systems or portions thereof or pohnucleotides of the mvention mtroduced or transformed mto a host cell or host cell lysate for the production of the polynucleotides and pohpeptides of the mvention

'"Variants)" as the term is used herein, is a pohnucleotide or polypeptide that differs from a reference polynucleotide or pohpeptide respective!}', but retains essential properties A typical vanant of a polvnucleotide differs in nucleotide sequence from another, reference pohnucleotide Changes m the nucleotide sequence of the variant ma} or ma) not alter the ammo acid sequence of a pohpeptide encoded b) the reference polvnucleotide Nucleotide changes ma) result in ammo acid substitutions, additions, deletions, fusion proteins and truncations in the pohpeptide encoded bv the reference sequence, as discussed below A ty pical variant of a polypeptide differs in ammo acid sequence from another, reference pohpeptide Generalh . differences are limited so that the sequences of the reference pohpeptide and the variant are closeh similar overall and. m man} regions, identical A variant and reference pohpeptide mav differ in ammo acid sequence b) one or more substitutions, additions, deletions in an) combination A substituted or inserted ammo acid residue ma}' or may not be one encoded b) the genetic code The present mvention also mcludes mclude vanants of each of the pohpeptides of the mvention. that is pohpeptides that vary from the referents b} conservative ammo acid substitutions, whereb} a residue is substituted by another with like charactenstics T)pιcal such substitutions are among Ala. Val. Leu and He. among Ser and Thr. among the acidic residues Asp and Glu. among Asn and Gin. and among the basic residues Lys and Arg. or aromatic residues Phe and T}τ Particularly preferred are vaπants m which several. 5-10, 1-5. 1-3, 1-2 or 1 ammo acids are substituted, deleted, or added m an} combination A variant of a polynucleotide or polypeptide may be a naturalh occurnng such as an allehc variant, or it ma) be a variant that is not known to occur naturalh Non-naturally occurnng variants of pohnucleotides and polypeptides may be made by mutagenesis techniques, by direct synthesis, and by other recombmant methods known to skilled artisans

EXAMPLES The examples below are earned out usmg standard techniques, which are well known and routme to those of skill in the art, except where otheuvise descπbed m detail The examples are illustrative, but do not limit the mvention Example 1 Strain selection, Library Production and Sequencing

The polynucleotide having a DNA sequence given m Table 1 [SEQ ID NO 1] was obtained from a library of clones of chromosomal DNA of Streptococcus pneumoniae in E cob The sequencmg data from two or more clones containing overlapping Streptococcus pneumoniae DNAs was used to construct the contiguous DNA sequence in SEQ ID NO 1 Libraries may be prepared by routme methods, for example Methods 1 and 2 below

Total cellular DNA is isolated from Streptococcus pneumoniae 0100993 according to standard procedures and size-fractionated by either of two methods Method 1 Total cellular DNA is mechanicalh sheared b) passage through a needle in order to size- fractionate according to standard procedures DNA fragments of up to 1 lkbp in size are rendered blunt b} treatment with exonuclease and DNA polymerase. and EcoRI linkers added Fragments are hgated into the vector Lambda ZapII that has been cut with EcoRI, the hbrar} packaged b) standard procedures and E coh infected with the packaged hbrarv The hbrar} is amplified b) standard procedures

Method 2

Total cellular DNA is partialh hydrohzed with a one or a combination of restriction enzymes appropriate to generate a senes of fragments for cloning into hbrar) vectors (e g . Rsal. Pall. Alul. Bshl235I). and such fragments are size-fractionated according to standard procedures EcoRI linkers are hgated to the DNA and the fragments then hgated into the vector Lambda ZapII that hav e been cut with EcoRI. the library packaged b) standard procedures, and E coh infected with the packaged hbrarv The hbrar) is amplified by standard procedures Example 2 Gene Essentiality Assay A promoter replacement cassette is generated using PCR technolog} The cassette consists of a pair of 500bp chromosomal DNA fragments flanking an erythromycin resistance gene divergently transcribed with respect to the mducible/repressible promoter The chromosomal DNA sequences are the 500bp preceding and following the promoter region of the gene whose essentiality is gomg to be tested The promoter replacement cassette is introduced into S pneumoniae R6 by transformation

Competent cells are prepared according to published protocols DNA is introduced into the cells b} incubation of μg quantities of promoter replacement cassette with 10" cells at 30°C for 30 minutes The cells are transferred to 37°C for 90 minutes to allow expression of the enthromycin resistance gene Cells are plated in agar containing 1 μg erythromycin per ml and the appropriate concentration of the inducer molecule Following mcubation at 37°C for 36 hours, colomes are picked and grown overnight in Todd-Hewitt broth supplemented with 0 5% yeast extract and the appropiate amount of mducer Gene essentiality is tested by decreasing the amount of inducer and/or increasing the amount of repressor and monitoring cell viability If the promoter replacement has occurred upstream of an essential gene, viability of the bacteπa will be absolutely dependent on the presence of mducer or the absence of repressor

Example 3 Identification of promoter sequences

Blast searches are run using proteins involved in sugar metabolism in E coh and B subtihs against SmithKlme Beecham's proprietor}' S pneumoniae genome sequence database This allows the identification of genes belonging to sugar operons The location of groups of sugar metabolism genes is used to ldentif) mtergenic (noncodmg) regions which are considered to contain promoters In addition, putative promoter sequences are identified b} homolog) with a consensus sequence for bacterial promoters Such a sequence consists of a -10 region (TATAAT). a 17bp/19bp spacer and a -35 region (TTGACA) S pneumoniae promoters have sometimes a characteπstic extended -10 region (TNTGNTATAAT) [SEQ ID NO 2] and lack a -35 region In Seq ID N°l a -10 (^13oTACAAT¹⁴¹) and -35 (¹¹³TTGCAG ) regions have been identified This promoter controls the expression of the trehalose metabolism operon The first gene of the operon (treP) encodes a trehalose permease

Example 4 treP Characterization

Identification of the treP gene transcription initiation site. a) Preparation of pre-inoculum and growth conditions

S pneumoniae R6 is grown statically at 37oC in the semi-defined AGCH media (Lacks S (1968) Genetics 60 4685-706 ). supplemented with 0 2% yeast extract (YE) and different test sugars added as the sole sugar source In a prelrmmar) experiment, S pneumoniae was shown to grow to an OD₆5o of 0 6 at approximately the same growth rate, when sucrose, glucose, trehalose or lactose were added to the medium at the point of inoculation as the sugar source at 1% (vv/v) final concentration Where S pneumoniae was unable to utilize a sugar as the smgle carbon source (fucose and galactose), or showed a significantly reduced growth rate (raffinose). glucose was supplemented to the media at a concentration of 0 2% (w/v) to maintain growth

The sugar growth conditions tested are 1 % glucose. 1 % sucrose. 1 % lactose. 1 % trehalose. 1% fructose. 1% mannose, 0 2% glucose. 0 2% glucose + 1% fucose. 0 2% glucose+1% galactose, 0 2% glucose + 0 5% raffinose and 1% raffinose

To adapt S pneumoniae to growth m the test sugar(s). lOOμl of a glycerol stock of S pneumoniae R6 is diluted in 4ml of AGCH +YE media supplemented with the test sugar(s) and grown to exponential phase until OD₆so reached 0 29 -0 31 Cultures (0 1ml) are rediluted in 4ml fresh AGCH +YE containing the same sugar(s) and re-incubated at 37°C to exponential phase This is repeated for a third time Glycerol is added to 10% (v/v) final concentration, and cells are frozen in dry ice/ ethanol bath and stored at -70oC as stocks of "s}nchromsed " S pneumoniae cells adapted to different sugar(s ) as carbon source(s)

To isolate RNA. S pneumoniae cells are grown under appropnate sugar conditions to an OD₆₅₀ of 0 6 b) Isolation of Streptococcus pneumoniae R6 RNA RNA is extracted using the FastRNA Kit (Bio 101) according to the manufacturers instuctions with slight modifications Briefly, 5ml of S pneumoniae cells are centπfuged at 6000 rpm and 4oC, the supernatanrt is removed and the pellet is resuspended in 200μl of AGCH and added to a FastPrep tube containing lysing matrix and 1 ml of extraction reagents (FastRNA) The tubes are shaken in a reciprocatmg shaker (FastPrep FP 120 BIO 101) at 6000 m for 45 sec The crude RNA preparation is extracted with chloroform/isoamv 1 alcohol (24 1). and precipitated with DEPC-treated/Isopropanol Precipitation Solution (BIO 101) RNA preparations are stored in this isopropanol solution at -80°C if necessars The RNA is pelleted (12.000g for 10 mm ). washed with 75% ethanol (v/v in DEPC-treated water), air-dried for 5-10 mm. and resuspended in 0 1 ml of DEPC-treated water, followed bv 5-10 minutes at 55 oC Finalh . after at least 1 mmute on ice. 200 units of Rnasin (Promega) are added

RNA preparations are stored at -80 oC for up to one month For longer term storage the RNA precipitate can be stored at the wash stage of the protocol in 75% ethanol for at least one ear at -20 oC Quaht} of the RNA isolated is assessed by running samples on 1 % agarose gels 1 x TBE gels stained with ethidium bromide are used to visualise total RNA yields c) The removal of DNA from Streptococcus pneumoniae-denved RNA

DNA is removed from 50 microgram samples of RNA b} a 30 minute treatment at 37°C with 20 units of RNAase-free DNAasel (GenHunter) m the buffer supplied in a final volume of 57 microhters

The DNAase is inactivated and removed bv treatment with TRIzol LS Reagent (Gibco BRL Life Technologies) according to the manufacturers protocol

DNAase treated RNA is resuspended in 100 microhtres of DEPC treated water with the addition of Rnasin as described before d) Primer extension analysis

15μg of DNAse-treated RNA is denatured together with 5pmol of 6-FAM-5' fluorescently tagged primer (5 ' GACTCGATAGCTTTAACATTAGCCTTCTTATC3 ' ) [SEQ ID NO 3] (PE Applied Biosystems) corresponding to the 5' end of the treP gene, in lOμl final volume at 70oC for 10 mm The mixture is allowed to cool down to 55oC over a 30 mm period and lOμl of cDNA synthesis reagents (Thermoscript RT-PCR S}stem. Gibco BRL) are added cDNA svnthesis is performed at 55oC for 60 min After denaturation of the reverse transcπptase at 85oC for 5mιn. the RNA is degraded b) a RNAse treatment at 37oC for 20 min with 2 umts of RNAse H and 2196 umts of RNAse T Primers are eliminated from the cDNA samples usmg a QIAquick PCR Puπfication Kit (QIAGEN) according to the manufacturers instructions but eluting the cDNA in 20μl of DEPC- treated water m the final step The cDNA is precipitated with 2 5 volumes 100%EtOH. 1/10 vol 3M NaOAc and lOmg/ml yeast tRNA overnight at -20oC and recovered b) centπfugation at 15.000g for 10 minutes Air dried pellets are resuspended in 2μl formamide. 0 5μl Blue Dextran loading dye and 0 5μl Genescan 500XL Rox Size Standard (PE Applied Bios) stems) Samples are loaded onto 34well. 48cm Sequencing gel (BMA) and separated using Perkin Elmer's ABI 377XL Sequencer Electrophoresis set Data is examined using Perkin Elmer's ABI Prism Genescan Analysis 2 1 Software The transcription initiation site for the treP gene was the A located at position 148 from Seq

ID Nol. 7 bp downstream of the predicted -10 region confirming the existance of the promoter Example 5 Expression of the treP promoter is regulated by sugars

Growth conditions and preparation of RNA are identical to that especified in example 4 a) The preparation of cDNA from RNA samples 5 microgram samples of DNAase-treated RNA are reverse transcribed usmg a SuperScπpt

Preamphfication System for First Strand cDNA Synthesis kit (Gibco BRL, Life Technologies) according to the manufacturers instructions 250 nanogram of random hexamers is used to prime each reaction Controls without the addition of SuperScnptll reverse transcπptase (RT) are also run Both +/-RT samples are treated with RnaseH cDNA samples were stored at -20oC b) The use of PCR and SybrGreen dye accumulation to quantitate bacterial mRNA

Specific sequence quantification occurs b} amplification of target sequences m the PE Applied Biosystems 7700 Sequence Detection S}stem with template specific pπmers and in the presence of Sybr Green d}e Amplification with annealing temperatures that only allow specific product foπnation is monitored by measuring the signal generated by accumulation of Sybr Green dye with an attached CCD camera Standardization to chromosomal DNA allows correlation between signal generated and product accumulated Relative quantitation is normalized to a housekeeping gene and a calibrator sample (uninduced control)

PCR reactions are set up using the PE Applied Biosystem SybrGreen PCR Core Reagent Kit according to the instructions supplied such that each reaction contains 5 microhters 1 OX SybrGreen buffer. 7 microhters 25 mM MgCl , 5 microhters 300 nM forward pnmer. 5 microhters reverse pnmer. 1 microhter each 10 mM dATP. 10 mM dCTP. 10 mM dGTP and 20 mM dUTP. 13 25 microhters distilled water. 0 5 microhters AmpErase UNG. and 0 25 microhters AmpliTaq DNA polymerase to give a total volume of 45 microhters Amplification proceeds under the following thermal cycling conditions 50°C hold for 2 minutes. 95 °C hold for 10 minutes. 40 cycles of 95 °C for 15 seconds and 60°C for 1 minute, followed b) a 25 °C hold until sample is retrieved Detection occurs real-tune Data is collected at the end of the reaction RT/PCR controls ma) include no reverse transcπptase reactions to venfy the absence of contaminating genomic DNA

Primers used for Example 5 are as follow s

CGGATGCGGTTTGTTTTAGGAGA [SEQ ID NO 4] fwd pnmer

ACCAGGCAACCAGAGGAAGTGATT [SEQ ID NO 5] rev pnmer S) br Green quantitation of accumulatmg PCR product and the uses of such a technique have reported

(Morrison T B. Weis J J and Wittwer C T 1998 Quantification of low -copy transcπpts by continuous SYBR green I momtonng during amplification BioTechniques 24 954-962 Wittwer C T . Herrmann M G . Moss A A . Rasmussen R P 1997 Continuous fluorescence momtonng of rapid cycle DNA amplification Biotechniques 22 130-131. 134-1388)

Such an experiment showed that expression of the treP promoter is induced by 1% trehalose and is repressed by 0 2% or 1% glucose

All publications and references, including but not limited to patents and patent applications, cited in this specification are herein incoφorated by reference m their entirety as if each individual publication or reference were specifically and mdividually indicated to be incoφorated by reference herem as being full}' set forth An)' patent application to which this application claims pnonfy is also incoφorated by reference herein in its entiret) in the manner described abov e for publications and references

Claims

What is claimed is: 1 An isolated pohnucleotide selected from the group consisting of

(1) an isolated pohnucleotide compπsmg a nucleotide sequence which has at least

(a) 70% identit) .

(b) 80% identit) ,

(c) 90% identity, or

(d) 95% identity. to that of SEQ ID NO 1 ov er the entire length of SEQ ID NO 1 ,

(n) an isolated pohnucleotide which is the polynucleotide of SEQ ID NO 1 ,

(m) an isolated pohnucleotide obtainable by screenmg an appropnate library under stπngent hybπdization conditions with a probe havmg the sequence of SEQ ID NO 1 or a fragment thereof,

(iv) an isolated polynucleotide compπsmg a promoter expressibh linked to the treP gene contained m the Streptococcus pneumoniae. and

(v) a polynucleotide sequence complementary to said isolated polynucleotide of (I). (u), (m) or

(iv)

2 A method for the treatment of an individual

(I) in need of enhanced activity of the polynucleotide of claim 1 compnsmg the step of administering to the individual a therapeutically effective amount of an agonist to said polynucleotide, or

(n) having need to inhibit activity or expression of the polynucleotide of claim 1 comprising

(a) administering to the individual a therapeutically effective amount of an antagonist to said polynucleotide, or

(b) administering to the individual a therapeutically effective amount of a compound that competes with said polynucleotide for its ligand or bmding factor

3 A method for screening to identify compounds that activate or that inhibit the function of the polynucleotide of claim 1 which compπses a method selected from the group consisting of

(a) mixing a candidate compound with a solution containing a polynucleotide of claim 1. to form a mixture, measuring activity of the pohnucleotide m the mixture, and comparing the activity of the mixture to a standard, or (b) detecting the effect of a candidate compound on the production of mRNA or pohpeptide b) promoter activit) of the pohnucleotide m cells, using for instance, an ELISA assay, or

(C) (1) contacting a composition compπsmg the pohnucleotide with the compound to be screened under conditions to permit mteraction between the compound and the polynucleotide to assess the mteraction of a compound, such mteraction bemg associated with a second component capable of providing a detectable signal in response to the mteraction of the pohnucleotide with the compound, and

(2) determining whether the compound interacts with and activates or inhibits an activit) of the po nucleotide b) detecting the presence or absence of a signal generated from the mteraction of the compound with the poh nucleotide

4 An agonist or an antagonist of the activit) of or expression from pohnucleotide of claim 1

5 A host cell comprising the polynucleotide of claim 1

6 A polynucleotide consisting of a polynucleotide of the formula

X-(R₁)_rn-(R₂)-(R₃)_n-Y wherein, at the 5' end of the molecule. X is hydrogen, a metal or a modified nucleotide residue, or together with Y defines a covalent bond, and at the 3' end of the molecule, Y is hydrogen, a metal, or a modified nucleotide residue, or together with X defines the covalent bond, each occurrence of R\ and R3 is mdependentl) any nucleic acid residue or modified nucleic acid residue, m is an integer between 1 and 3000 or zero . n is an integer between 1 and 3000 or zero, and R₂ is a nucleic acid sequence or modified nucleic acid sequence set forth in SEQ ID NO 1

7 The method of ascertaining the functionality or essentiality of the target gene (gene-of- mterest) in a cell comprising the transcription or expression of gene-of-interest by expressing an anti- sense sequence to the gene-of-interest under the transcriptional control of the promoter polynucleotides of claim 1

8 The method of ascertaining the functionality' or essentiality of the target gene (gene-of interest), in a cell, compnsmg

(a) disabling ("knocking-out") the gene-of-interest,

(b) re-introducmg. at the target gene locus, the gene-of-interest now under the operational control of the inducible promoter pohnucleotides of claim 1, and (c) adding the inducer thereb}' providing information to the essentiality or functionality of the gene of interest

9 A method of determining a functionality or essentiality of the target gene (gene-of interest), in a cell, compnsmg

(a) replacing the promoter sequence of the gene-of-mterest b) the promoter polynucleotide of claim 1. and

(b) adding the repressor thereby providing information to the essentiality or functionality of the gene-of-mterest

10 A method of determining a protein target of a antibacterial compound compnsmg

(a) placing the protein target under the control of the promoter polynucleotide of claim 1. and

(b) adding the mducer or repressor thereb}' changing accordingly the susceptibility of the bacteria to the compound