WO2000078336A1 - Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13 - Google Patents

Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13 Download PDF

Info

Publication number
WO2000078336A1
WO2000078336A1 PCT/US2000/017103 US0017103W WO0078336A1 WO 2000078336 A1 WO2000078336 A1 WO 2000078336A1 US 0017103 W US0017103 W US 0017103W WO 0078336 A1 WO0078336 A1 WO 0078336A1
Authority
WO
WIPO (PCT)
Prior art keywords
tissue
seq
acid sequence
amino acid
protein
Prior art date
Application number
PCT/US2000/017103
Other languages
English (en)
Inventor
Mary Collins
Debra Donaldson
Lori Fitz
Tamlyn Neben
Matthew J. Whitters
Clive Wood
Marsha Wills-Karp
Original Assignee
Genetics Institute, Inc.
Johns Hopkins University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genetics Institute, Inc., Johns Hopkins University filed Critical Genetics Institute, Inc.
Priority to AU57561/00A priority Critical patent/AU5756100A/en
Publication of WO2000078336A1 publication Critical patent/WO2000078336A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1793—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A61K38/2026—IL-4
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to the treatment and inhibition of fibrosis by antagonism of the interaction of IL-13 with its receptor and receptor components.
  • IL-13 interleukin-13
  • IL-13 interleukin-13
  • IL-13 Various protein forms of IL-13 and DNA encoding various forms of IL-13 activity are described in McKenzie et al., Proc. Natl. Acad. Sci. USA 90:3735 (1993); Minty et al., Nature 362:248 (1993); and Aversa et al., WO94/04680.
  • the term "IL-13” includes proteins having the sequence and/or biological activity described in these documents, whether produced by recombinant genetic engineering techniques; purified from cell sources producing the factor naturally or upon induction with other factors; or synthesized by chemical techniques; or a combination of the foregoing.
  • IL-13 is a cytokine that has been implicated in production of several biological activities including: induction of IgG4 and IgE switching, including in human immature B cells (Punnonen et al. , J. Immunol. 152:1094 ( 1994)) ; induction of germ line IgE heavy chain ( €) transcription and CD23 expression in normal human B cells (Punnonen et al., Proc. Natl. Acad. Sci. USA 90:3730 (1993)); and induction of B cell proliferation in the presence of CD40L or anti-CD40 mAb (Cocks et al., Int. Immunol. 5:657 (1993)).
  • IL-13 does not have growth promoting effects on activated T cells or T cell clones (Zurawski et al., EMBO J. 12:2663 (1993)).
  • IL- 13 Like most cytokines, IL- 13 exhibits certain biological activities by interacting with an IL- 13 receptor ("IL- 13R”) on the surface of target cells. IL- 13R and the IL-4 receptor (“IL-4R”) sharing a common component, which is required for receptor activation; however, IL-13 does not bind to cells transfected with the 130 kD IL-4R (Zurawski et al., supra). Thus, the IL-13R must contain at least one other ligand binding chain. Cytokine receptors are commonly composed or two or three chains. The cloning of one ligand binding chain for EL-13 has been recently reported (Hilton et al., Proc. Natl. Acad. Sci. 93:497-501).
  • polynucleotides encoding the IL-13 binding chains of the interleukin-13 receptor are disclosed, including without limitation those from the murine and human receptors.
  • the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
  • nucleotide sequence capable of hybridizing under stringent conditions to the nucleotide specified in (a) or (b);
  • nucleotide sequence encoding a species homologue of the sequence specified in (a) or (b);
  • nucleotide sequence encodes a protein having a biological activity of the human EL- 13 receptor.
  • the nucleotide sequence may be operably linked to an expression control sequence.
  • the polynucleotide comprises the nucleotide sequence of SEQ ID NO:l from nucleotide 256 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:l from nucleotide 319 to nucleotide 1257; the nucleotide sequence of SEQ ID NO:l from nucleotide 1324 to nucleotide 1404; the nucleotide sequence of SEQ ID NO:3 from nucleotide 103 to nucleotide 1242; the nucleotide sequence of SEQ ID NO:3 from nucleotide 178 to nucleotide 1125; or the nucleotide sequence of SEQ ID NO:3 from nucleotide 1189 to nucleotide 1242.
  • the invention also provides isolated polynucleotides comprising a nucleotide sequence encoding a peptide or protein comprising an amino acid sequence selected from the group consisting of:
  • Host cells preferably mammalian cells, transformed with the polynucleotides are also provided.
  • the invention provides a process for producing a IL-13bc protein. The process comprises:
  • the present invention also provides for an isolated IL-13bc protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2;
  • the protein comprises the amino acid sequence of SEQ ID NO:2; the sequence from amino acid 22 to 334 of SEQ ID NO:2; the sequence of SEQ ID NO:4; or the sequence from amino acid 26 to 341 of SEQ ID NO:4.
  • the specified amino acid sequence is part of a fusion protein (with an additional amino acid sequence not derived from IL-13bc).
  • Preferred fusion proteins comprise an antibody fragment, such as an Fc fragment.
  • Particularly preferred embodiments comprise the amino acid sequence of SEQ ID NO:2 from amino acids 1 to 331 and the amino acid sequence of SEQ ID NO:2 from amino acids 26 to 331.
  • compositions comprising a protein of the present invention and a pharmaceutically acceptable carrier are also provided.
  • the present invention further provides for compositions comprising an antibody which specifically reacts with a protein of the present invention.
  • Methods of identifying an inhibitor of IL-13 binding to the IL-13bc or IL-13 receptor are also provided. These methods comprise:
  • Methods of inhibiting binding of IL- 13 to the IL- 13bc proteins or EL- 13 receptor in a mammalian subject comprise administering a therapeutically effective amount of a composition containing an EL-13bc protein, an EL-13bc or IL-13R inhibitor or an antibody to an IL-13bc protein.
  • Methods are also provided for potentiating IL-13 activity, which comprise combining a protein having EL- 13 activity with a protein of the present invention and contacting such combination with a cell expressing at least one chain of IL- 13R other than DL-13bc.
  • the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject.
  • Further methods are provided for treating an IL-13-related condition in a mammalian subject, said method comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
  • Other methods provide for a method of inhibiting the interaction of IL- 13 with an IL-13bc protein in a mammalian subject comprising administering a therapeutically effective amount of a composition comprising an IL-13 antagonist and a pharmaceutically acceptable carrier.
  • the antagonist is selected from the group consisting of an EL-13bc protein, a soluble form of IL-13R l, an antibody to EL- 13 or an IL-13 -binding fragment thereof, an antibody to EL-13bc or an IL-13bc-binding fragment thereof, an antibody to EL-13RCC1 or an EL- 13R ⁇ l -binding fragment thereof, EL-13R- binding mutants of IL-4, a small molecule capable of inhibiting the interaction of EL- 13 with IL- 13bc and a small molecule capable of inhibiting the interaction of IL- 13 with EL- 13R ⁇ l.
  • the invention provides for a method of treating tissue fibrosis in a mammalian subject.
  • the method comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a protein and a pharmaceutically acceptable carrier, wherein the protein comprises an amino acid sequence selected from the group consisting of:
  • the invention also provides for a method of inhibiting formation of tissue fibrosis in a mammalian subject.
  • the method comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a protein and a pharmaceutically acceptable carrier, wherein the protein comprises an amino acid sequence selected from the group consisting of:
  • inventions provide for a method of treating or inhibiting tissue fibrosis in a mammalian subject.
  • the method comprises administering a therapeutically effective amount of a composition comprising (a) a molecule selected from the group consisting of an IL-13 antagonist and an IL-4 antagonist, and (b) a pharmaceutically acceptable carrier.
  • the tissue fibrosis affects a tissue selected from the group consisting of liver, skin epidermis, skin endodermis, muscle, tendon, cartilage, cardiac tissue, pancreatic tissue, lung tissue, uterine tissue, neural tissue, testis, ovary, adrenal gland, artery, vein, colon, small intestine, biliary tract and gut; most preferably, liver tissue (including tissue infected with schistosoma).
  • the fibrois results from the healing of a wound (including a surgical incision).
  • an antagonist preferably such antagonist is selected from the group consisting of an IL-13bc protein, a soluble form of EL-13RC.1, an antibody to IL-13 or an IL-13-binding fragment thereof, an antibody to IL-13bc or an IL-13bc -binding fragment thereof, an antibody to EL-13R0.1 or an IL- 13R 1 -binding fragment thereof, EL- 13R-binding mutants of IL-4, a small molecule capable of inhibiting the interaction of IL-13 with EL-13bc and a small molecule capable of inhibiting the interaction of IL-13 with EL-13R0.1.
  • the antagonist is an EL-13bc protein comprising an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of SEQ ID NO:2;
  • the antagonist is selected from the group consisting of a soluble form of IL-4R, an antibody to IL-4 or an EL-4-binding fragment thereof, an antibody to EL-4R or an EL-4R-binding fragment thereof, and a small molecule capable of inhibiting the interaction of IL-4 with
  • FIG. 1 The figure presents photographs of IL-13, EL-4, EL-11 andmock transfected
  • Fig. 2 Characterization of the roles of IL-4 and IL-13 in schistosomiasis pathogenesis.
  • C57BL/6 WT and EL-4-def ⁇ cient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and then sacrificed at week 8 post-infection to evaluate the size of liver granulomas (panel A), tissue eosinophilia (panel B), and hepatic fibrosis (panel C).
  • Separate groups of mice were treated with control-Fc or sIL- 13R ⁇ 2-Fc as described in the Methods section. The data shown are measurements from individual mice and the lines designate the means for each group.
  • FIG. 3 Liver collagen is reduced in sIL-13R ⁇ 2-Fc -treated /infected mice. Liver sections were prepared 8 weeks after challenge infection. Sections from control Fc-treated (panels A and B) and sEL-13R ⁇ 2-Fc-treated WT infected mice that contained nearly identical tissue egg burdens were stained with picrosirius red (panels A and C) and illuminated using polarized light to highlight the areas rich in collagen (panels B and D).
  • Fig. 4 The Thl/Th2-type cytokine profile is unaffected by sIL-13R ⁇ 2-Fc treatment.
  • C57BL/6 WT and IL-4-def ⁇ cient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and separate groups of mice were treated with control-Fc or sIL- 13Ro-2-Fc as described in the Methods section.
  • Mesenteric lymph node cells were isolated from individual mice and single cell suspensions were prepared (3 x 10 6 cells/well in 24 well plates) and stimulated with medium alone (squares), SEA at 20 ug/ml (circles), or with SEA and 50 ug/ml of anti-CD4 mAb (triangles). All cytokines were assayed in culture supematants by ELISA 72 hrs post-stimulation as described in the Methods section.
  • the symbols represent values for individual mice and the bars indicate the means within each group.
  • Fig. 5 Th2-type cytokine mRNA expression is reduced in the livers of infected IL-4-deficient mice but unaffected by EL- 13 blockade.
  • C57BL/6 WT and EL-4-deficient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and separate groups of mice were treated with control-Fc or sIL-13R ⁇ 2-Fc as described in the Methods section. All animals were sacrificed on wk 8 postinfection and liver specimens were prepared for RT-PCR analysis as described in the Methods section. The data shown are the individual values of 9 to 10 animals per group and the bar indicates the average within each group.
  • the * symbol indicates that the data are significantly different from the WT control-Fc group as determined by Student' s t-test (p ⁇ .05).
  • the average values from five uninfected WT (black circle) and five uninfected IL-4-deficient mice (open circle) are shown on the Y-axis for each cytokine. All data were reproduced in a second study.
  • Fig. 6 Collagen I and Collagen III mRNA expression is reduced in the livers of infected sIL- 13R ⁇ 2-Fc treated mice, but unaffected by IL-4-deficiency .
  • C57BL/6 WT and EL-4-deficient (4KO) mice were infected with 25 cercariae of Schistosoma mansoni and separate groups of mice were treated with control-Fc or sIL-13R ⁇ 2-Fc as described in the Methods section. All animals were sacrificed on wk 8 postinfection and liver specimens were prepared for RT-PCR analysis as described in the Methods section. The data shown are the individual values of 9 to 10 animals per group and the bar indicates the average within each group.
  • IL-13 induces type I collagen synthesis in murine 3T3 fibroblasts. Cells were stimulated with media (lane 1), rEL-4 at 1000 Units/ml (lane 2) or rIL-13 at 20 ng/ml (lanes 3 and 4, from R&D Systems and Genetics Institute, respectively) for 48 h.
  • SEQ D NO: 1 provides the nucleotide sequence of a cDNA encoding the murine
  • SEQ ID NO:2 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-21.
  • the mature murine IL- 13bc is believed to have the sequence of amino acids 22-383 of SEQ ID NO:2.
  • the mature murine receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 22-334 of SEQ ID NO:2), a transmembrane domain (comprising approximately amino acids 335-356 of SEQ ID NO:2) and an intracellular domain (comprising approximately amino acids 357-383 of SEQ ID NO:2).
  • SEQ ID NO: 3 provides the nucleotide sequence of a cDNA encoding the human EL- 13bc.
  • SEQ ID NO:4 provides predicted the amino acid sequence of the receptor chain, including a putative signal sequence from amino acids 1-25.
  • the mature human IL-13bc is believed to have the sequence of amino acids 26-380 of SEQ ID NO:4.
  • the mature human receptor chain has at least three distinct domains: an extracellular domain (comprising approximately amino acids 26-341 of SEQ ID NO:4), a transmembrane domain (comprising approximately amino acids 342-362 of SEQ ED NO:4) and an intracellular domain (comprising approximately amino acids 363-380 of SEQ ED NO:4).
  • the first 81 amino acids of the human EL-13bc sequence are identical to the translated sequence of an expressed sequence tag (EST) identified as "yg99f lO.rl Homo sapiens cDNA clone 41648 5'" and assigned database accession number R52795.gb_est2. There are no homologies or sequence motifs in this EST sequence which would lead those skilled in the art to identify the encoded protein as a cytokine receptor.
  • EST expressed sequence tag
  • a cDNA clone conesponding to this database entry is publicly-available from the I.M. A.G.E. Consortium. Subsequent to the priority date of the present application, such clone was ordered by applicants and sequenced. The sequence of such clone was determined to be the sequence previously reported by applicants as SEQ ED NO: 3 herein.
  • Soluble forms of IL-13bc protein can also be produced.
  • Such soluble forms include without limitation proteins comprising amino acids 1-334 or 22-334 of SEQ ID NO:2 or amino acids 1-341 or 26-341 of SEQ ID NO:4.
  • the soluble forms of the EL-13bc are further characterized by being soluble in aqueous solution, preferably at room temperature.
  • IL-13bc proteins comprising only the intracellular domain or a portion thereof may also be produced.
  • IL-13bc proteins of less than full length may be produced by expressing a corresponding fragment of the polynucleotide encoding the full-length IL-13bc protein (SEQ ID NO:l or SEQ ID NO:3). These corresponding polynucleotide fragments are also part of the present invention. Modified polynucleotides as described above may be made by standard molecular biology techniques, including construction of appropriate desired deletion mutants, site-directed mutagenesis methods or by the polymerase chain reaction using appropriate oligonucleotide primers.
  • a protein has "a biological activity of the IL- 13 receptor binding chain” if it possess one or more of the following characteristics : ( 1 ) the ability to bind IL-13 or a fragment thereof (preferably a biologically active fragment thereof); and/or (2) the ability to interact with the second non-IL- 13 -binding chain of IL- 13R to produce a signal characteristic of the binding of EL- 13 to IL-13R.
  • the biological activity possessed by the protein is the ability to bind IL-13 or a fragment hereof, more preferably with a K D of about 0.1 to about 100 nM.
  • EL-13bc or active fragments thereof may be fused to carrier molecules such as immunoglobulins.
  • carrier molecules such as immunoglobulins.
  • soluble forms of the IL-13bc may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
  • Other fusions proteins such as those with GST, Lex-A or MBP, may also be used.
  • the invention also encompasses allelic variants of the nucleotide sequences as set forth in SEQ ID NO:l or SEQ ID NO:3, that is, naturally-occu ing alternative forms of the isolated polynucleotide of SEQ ID NO: 1 or SEQ ID NO:3 which also encode IL- 13bc proteins, preferably those proteins having a biological activity of IL- 13bc. Also included in the invention are isolated polynucleotides which hybridize to the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO:3 under highly stringent conditions (for example, O.lxSSC at 65°C).
  • Isolated polynucleotides which encode IL-13bc proteins but which differ from the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO:3 by virtue of the degeneracy of the genetic code are also encompassed by the present invention. Variations in the nucleotide sequence as set forth in SEQ ID NO: 1 or SEQ ID NO:3 which are caused by point mutations or by induced modifications are also included in the invention.
  • the present invention also provides polynucleotides encoding homologues of the murine and human EL-13bc from other animal species, particularly other mammalian species.
  • Species homologues can be identified and isolated by making probes or primers from the murine or human sequences disclosed herein and screening a library from an appropriate species, such as for example libraries constructed from PBMCs, thymus or testis of the relevant species.
  • the isolated polynucleotides of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 ( 1991), in order to produce the EL- 13bc protein recombinantly.
  • an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al., Nucleic Acids Res. 19, 4485-4490 ( 1991)
  • Many suitable expression control sequences are known in the art. General methods of expressing recombinant proteins are also known and are exemplified in R. Kaufman, Methods in Enzymology 185. 537-566 (1990).
  • operably linked means enzymatically or chemically ligated to form a covalent bond between the isolated polynucleotide of the invention and the expression control sequence, in such a way that the IL-13bc protein is expressed by a host cell which has been transformed (transfected) with the ligated polynucleotide/expression control sequence.
  • a number of types of cells may act as suitable host cells for expression of the IL- 13bc protein. Any cell type capable of expressing functional IL- 13bc protein may be used.
  • Suitable mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary (CHO) cells, human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CN-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-60, U937, HaK, Rat2, BaF3, 32D, FDCP-1, PC12, Mix or C2C12 cells.
  • monkey COS cells Chinese Hamster Ovary (CHO) cells
  • human kidney 293 cells human epidermal A431 cells
  • human Colo205 cells human Colo205 cells
  • 3T3 cells 3T3 cells
  • CN-1 cells other transformed primate cell lines
  • normal diploid cells cell
  • the EL-13bc protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, California, U.S.A. (the MaxBac® kit), and such methods are well known in the art, as described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). incorporated herein by reference. Soluble forms of the IL-13bc protein may also be produced in insect cells using appropriate isolated polynucleotides as described above.
  • the IL-13bc protein may be produced in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
  • suitable yeast strains include Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins.
  • Suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins.
  • Expression in bacteria may result in formation of inclusion bodies incorporating the recombinant protein.
  • refolding of the recombinant protein may be required in order to produce active or more active material.
  • Several methods for obtaining coreectly folded heterologous proteins from bacterial inclusion bodies are known in the art. These methods generally involve solubilizing the protein from the inclusion bodies, then denaturing the protein completely using a chaotropic agent.
  • cysteine residues are present in the primary amino acid sequence of the protein, it is often necessary to accomplish the refolding in an environment which allows conect formation of disulfide bonds (a redox system).
  • General methods of refolding are disclosed in Kohno, Meth. Enzvm.. 185:187-195 (1990).
  • EP 0433225 and copending application USSN 08/163,877 describe other appropriate methods.
  • the IL-13bc protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a polynucleotide sequence encoding the IL-13bc protein.
  • the IL-13bc protein of the invention may be prepared by growing a culture transformed host cells under culture conditions necessary to express the desired protein. The resulting expressed protein may then be purified from the culture medium or cell extracts. Soluble forms of the IL-13bc protein of the invention can be purified from conditioned media. Membrane-bound forms of IL-13bc protein of the invention can be purified by preparing a total membrane fraction from the expressing cell and extracting the membranes with a non-ionic detergent such as Triton X-100.
  • a non-ionic detergent such as Triton X-100.
  • the IL-13bc protein can be purified using methods known to those skilled in the art.
  • the IL-13bc protein of the invention can be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit.
  • the concentrate can be applied to a purification matrix such as a gel filtration medium.
  • an anion exchange resin can be employed, for example, a matrix or substrate having pendant diethylaminoethyl (DEAE) or polyetheyleneimine (PEI) groups.
  • the matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification.
  • a cation exchange step can be employed.
  • Suitable cation exchangers include various insoluble matrices comprising sulfopropyl or carboxymethyl groups. Sulfopropyl groups are preferred (e.g., S-Sepharose® columns).
  • the purification of the IL- 13bc protein from culture supernatant may also include one or more column steps over such affinity resins as concanavalin A-agarose, heparin-toyopearl® or Cibacromblue 3GA Sepharose®; or by hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or by immunoaffinity chromatography.
  • one or more reverse-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the EL- 13bc protein.
  • Affinity columns including EL- 13 or fragments thereof or including antibodies to the EL-13bc protein can also be used in purification in accordance with known methods.
  • Some or all of the foregoing purification steps, in various combinations or with other known methods, can also be employed to provide a substantially purified isolated recombinant protein.
  • the isolated EL-13bc protein is purified so that it is substantially free of other mammalian proteins.
  • EL-13bc proteins of the invention may also be used to screen for agents which are capable of binding to DL-13bc or EL-13R or which interfere with the binding of IL-13 to the IL-13 or IL-13bc (either the extracellular or intracellular domains) and thus may act as inhibitors of normal binding and cytokine action ("EL-13R inhibitors").
  • Binding assays using a desired binding protein, immobilized or not, are well known in the art and may be used for this purpose using the EL-13bc protein of the invention. Purified cell based or protein based (cell free) screening assays may be used to identify such agents.
  • IL-13bc protein may be immobilized in purified form on a carrier and binding to purified IL-13bc protein may be measured in the presence and in the absence of potential inhibiting agents.
  • a suitable binding assay may alternatively employ a soluble form of EL-13bc of the invention.
  • Another example of a system in which inhibitors may be screened is described in Example 2 below. In such a screening assay, a first binding mixture is formed by combining EL- 13 or a fragment thereof and EL-13bc protein, and the amount of binding in the first binding mixture (B 0 ) is measured.
  • a second binding mixture is also formed by combining IL-13 or a fragment thereof, IL-13bc protein, and the compound or agent to be screened, and the amount of binding in the second binding mixture (B ) is measured.
  • the amounts of binding in the first and second binding mixtures are compared, for example, by performing a calculation of the ratio B/B 0 .
  • a compound or agent is considered to be capable of inhibiting binding if a decrease in binding in the second binding mixture as compared to the first binding mixture is observed.
  • the second chain of EL- 13R can be added to one or both of the binding mixtures.
  • the formulation and optimization of binding mixtures is within the level of skill in the art, such binding mixtures may also contain buffers and salts necessary to enhance or to optimize binding, and additional control assays may be included in the screening assay of the invention.
  • Compounds found to reduce the binding activity of IL-13bc protein to IL-13 or its fragment to any degree, preferably by at least about 10%, more preferably greater than about 50% or more, may thus be identified and then secondarily screened in other binding assays and in vivo assays.
  • compounds having inhibitory activity for IL- 13bc binding which may be suitable as therapeutic agents may be identified.
  • IL-13bc proteins may also be used as diagnostic agents for detecting the expression or presence of IL-13bc, IL-13R, IL-13 or cells expressing EL-13bc, EL-13R or EL-13.
  • the proteins or polynucleotides may be employed for such purpose in standard procedures for diagnostics assays using these types of materials. Suitable methods are well known to those skilled in the art.
  • IL-13R refers to IL-13bc and/or a second EL-13 receptor chain known as 'TL-13R0-1" or "NR4" (see: murine receptor chain, Hilton et al., Proc. Natl. Acad. Sci. USA 1996, 93:497-501; human receptor chain, Aman et al., J. Biol. Chem. 1996, 271:29265-70, and Gauchat et al., Eur. J. Immunol. 1997, 27:971-8).
  • IL-13bc acts as a mediator of the known biological activities of IL-13.
  • IL- 13bc protein particularly, soluble IL- 13bc proteins
  • EL- 13R inhibitors i.e., antagonists of interaction of IL- 13 with IL- 13R (such as, for example, antibodies to IL- 13R (including particularly to IL-13bc or to IL-13RC-1) and fragments thereof, antibodies to EL-13 and fragments thereof, soluble IL-13R ⁇ l proteins, and small molecule and other inhibitors of the interaction of IL- 13 with IL- 13R (including with EL- 13bc and or with EL-13R l)) may be useful in treatment or modulation of various medical conditions in which EL-13 is implicated or which are effected by the activity (or lack thereof) of IL- 13 (collectively "IL- 13-related conditions").
  • IL-13 antagonists see, for example, those disclosed in Shanafelt et al., Proc. Natl. Acad. Sci. USA 1998, 95:9454-8; Aversa et al., J. Exp. Med. 1993, 178:2213-8; and Grunewald et al., J. Immunol. 1998, 160:4004-9).
  • IL-13-related conditions include without limitation Ig-mediated conditions and diseases, particularly IgE-mediated conditions (including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)); inflammatory conditions of the lungs; immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
  • IgE-mediated conditions including without limitation atopy, allergic conditions, asthma, immune complex diseases (such as, for example, lupus, nephrotic syndrome, nephritis, glomerulonephritis, thyroiditis and Grave's disease)
  • inflammatory conditions of the lungs immune deficiencies, specifically deficiencies in hematopoietic progenitor cells, or disorders relating thereto; cancer and other disease.
  • pathological states may result from disease, exposure to radiation or drugs, and include, for example, leukopenia, bacterial and viral infections, anemia, B cell or T cell deficiencies such as immune cell or hematopoietic cell deficiency following a bone marrow transplantation.
  • IL-13 inhibits macrophage activation
  • IL-13bc proteins may also be useful to enhance macrophage activation (i.e., in vaccination, treatment of mycobacterial or intracellular organisms, or parasitic infections).
  • IL-13bc proteins may also be used to potentiate the effects of IL-13 in vitro and in vivo.
  • an IL-13bc protein can be combined with a protein having EL-13 activity (preferably IL-13) and the resulting combination can be contacted with a cell expressing at least one chain of IL- 13R other than IL- 13bc (preferably all chains of IL- 13R other than IL-13bc, such as EL-13R ⁇ l).
  • the contacting step is performed by administering a therapeutically effective amount of such combination to a mammalian subject in vivo.
  • the pre-established association of the IL-13 protein with the IL-13bc protein will aid in formation of the complete IL- 13/IL- 13R complex necessary for proper signaling. See for example the methods described by Economides et al., Science 270: 1351 (1995).
  • EL-13bc protein and EL-13R inhibitors purified from cells or recombinantly produced, may be used as a pharmaceutical composition when combined with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier may contain, in addition to IL- 13bc or inhibitor and carrier, various diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the carrier will depend on the route of administration.
  • the pharmaceutical composition of the invention may also contain cytokines, lymphokines, or other hematopoietic factors such as M-CSF, GM-CSF, interleukins (such as, EL-1, EL-2, EL-3, IL-4 . . . IL-24, IL-25), G-CSF, stem cell factor, and erythropoietin.
  • the pharmaceutical composition may also include anti-cytokine antibodies.
  • the pharmaceutical composition may further contain other anti-inflammatory agents. Such additional factors and/or agents may be included in the pharmaceutical composition to produce a synergistic effect with isolated IL-13bc protein or IL-13bc inhibitor, or to minimize side effects caused by the isolated IL-13bc or IL-13bc inhibitor.
  • isolated IL-13bc or EL-13bc inhibitor may be included in formulations of the particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent.
  • the pharmaceutical composition of the invention may be in the form of a liposome in which isolated IL-13bc protein or IL-13bc inhibitor is combined, in addition to other pharmaceutically acceptable carriers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers which in aqueous solution.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Patent No. 4,235,871; U.S. Patent No. 4,501,728; U.S. Patent No. 4,837,028; and U.S. Patent No. 4,737,323, all of which are incorporated herein by reference.
  • the term "therapeutically effective amount” means the total amount of each active component of the pharmaceutical composition or method that is sufficient to show a meaningful patient benefit, e.g., amelioration of symptoms of, healing of, or increase in rate of healing of such conditions.
  • a therapeutically effective amount of isolated IL-13bc protein or IL-13bc inhibitor is administered to a mammal.
  • Isolated IL-13bc protein or EL-13bc inhibitor may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cytokines, lymphokines or other hematopoietic factors.
  • IL-13bc protein or IL-13bc inhibitor may be administered either simultaneously with the cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially.
  • IL-13bc protein or EL-13bc inhibitor used in the pharmaceutical composition or to practice the method of the present invention can be earned out in a variety of conventional ways, such as oral ingestion, inhalation, or cutaneous, subcutaneous, or intravenous injection. Intravenous administration to the patient is preferred.
  • IL-13bc protein or IL-13bc inhibitor When a therapeutically effective amount of IL- 13bc protein or EL- 13bc inhibitor is administered orally, IL-13bc protein or IL-13bc inhibitor will be in the form of a tablet, capsule, powder, solution or elixir.
  • the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain from about 5 to 95% IL- 13bc protein or IL-13bc inhibitor, and preferably from about 25 to 90% IL-13bc protein or IL-13bc inhibitor.
  • a liquid carrier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
  • the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
  • the pharmaceutical composition When administered in liquid form, contains from about 0.5 to 90% by weight of IL-13bc protein or IL-13bc inhibitor, and preferably from about 1 to 50% EL-13bc protein or IL-13bc inhibitor.
  • IL-13bc protein or IL-13bc inhibitor When a therapeutically effective amount of EL-13bc protein or IL-13bc inhibitor is administered by intravenous, cutaneous or subcutaneous injection, IL-13bc protein or IL-13bc inhibitor will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • parenterally acceptable protein solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
  • a preferred pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to IL-13bc protein or EL-13bc inhibitor an isotonic vehicle such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium
  • the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additive known to those of skill in the art.
  • the amount of IL-13bc protein or IL-13bc inhibitor in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of IL- 13bc protein or EL-13bc inhibitor with which to treat each individual patient. Initially, the attending physician will administer low doses of EL-13bc protein or IL-13bc inhibitor and observe the patient's response. Larger doses of IL-13bc protein or EL-13bc inhibitor may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not generally increased further.
  • compositions used to practice the method of the present invention should contain about 0.1 ⁇ g to about 100 mg (preferably about 20 ⁇ g to about 500 ⁇ g) of IL-13bc protein or EL- 13bc inhibitor per kg body weight.
  • the duration of intravenous therapy using the pharmaceutical composition of the present invention will vary, depending on the severity of the disease being treated and the condition and potential idiosyncratic response of each individual patient. It is contemplated that the duration of each application of the IL-13bc protein or IL-13bc inhibitor will be in the range of 12 to 24 hours of continuous intravenous administration. Ultimately the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.
  • IL-13bc proteins of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the IL-13bc protein and which may inhibit binding of IL-13 or fragments thereof to the receptor.
  • Such antibodies may be obtained using the entire IL-13bc as an immunogen, or by using fragments of EL-13bc, such as the soluble mature IL-13bc. Smaller fragments of the IL- 13bc may also be used to immunize animals.
  • the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH). Additional peptide immunogens may be generated by replacing tyrosine residues with sulfated tyrosine residues. Methods for synthesizing such peptides are known in the art, for example, as in R.P. Merrifield, J.Amer.Chem.Soc. 85, 2149-2154 (1963); J.L. Krstenansky, et al., FEBS Lett. 211, 10 (1987).
  • Neutralizing or non-neutralizing antibodies binding to EL-13bc protein may also be useful therapeutics for certain tumors and also in the treatment of conditions described above. These neutralizing monoclonal antibodies may be capable of blocking IL- 13 binding to the IL- 13bc.
  • Example 1 Isolation of IL-13bc cDNAs Isolation of the murine EL-13 receptor chain. 5 ug of poly A+ RNA was prepared from the thymuses of 6-8 week old C3H HeJ mice. Double stranded, hemimethylated cDNA was prepared using Stratagene' s cDNA synthesis kit according to manufacturers instructions. Briefly, the first strand was primed with an oligodT-Xho primer, and after second strand synthesis, EcoRI adapters were added, and the cDNA was digested with Xhol, and purified.
  • the cDNA was ligated to the XhoI-EcoRI sites of the Zap Express (Stratagene) lambda vector, and packaged using Gigapak II Gold packaging extracts (Stratagene) according to the manufacturers instructions.
  • a library of 1.5 x 10 6 resulting recombinant phage was amplified following manufacturer's instructions.
  • PCR using oligonucleotides derived from the murine sequence was prepared from human testis polyA+ R ⁇ A that was obtained from Clontech. A D ⁇ A fragment of 274 base pairs was amplified from this cD ⁇ A by PCR with the following oligonucleotides: ATAGTTAAACCATTGCCACC (SEQ ID ⁇ O:6) and CTCCATTCGCTCCAAATTCC (SEQ ID NO:7) using AmpliTaq polymerase (Promega) in IX Taq buffer containing 1.5 mM MgC12 for 30 cycles of incubation (94°C x 1 minute, 42°C for 1 minute, and 72°C for 1 minute).
  • the DNA sequence of this fragment was determined, and two oligonucleotides were prepared from an internal portion of this fragment with the following sequence: AGTCTATCTTACTTTTACTCG (SEQ ID NO:8) and CATCTGAGCAATAAATATTCAC (SEQ ID NO:9). These oligonucleotides were used as probes to screen a human testis cDNA library purchased from CLONTECH (cat #HL1161) . Filters were hybridized at 52°C using standard 5XSSC hybridization conditions and washed in 2X SSC at 52°C . Twenty two clones were isolated that hybridized to both oligonucleotides in a screen of 400,000 clones. DNA sequence was determined from four of the cDN A clones, and all encoded the same novel hematopoietin receptor. The predicted DNA sequence of the full length human receptor chain is shown as SEQ ID NO:3.
  • the human clone was deposited with ATCC as phA25#l lpDR2 at accession number 69998 on February 22, 1996.
  • IL-13bc-Ig was produced from DEAE-dextran transfected COS-1 cells and purified via protein A sepharose chromatography (Pharmacia).
  • the B9 cell line proliferated in response to EL-13, IL-4 or EL-6. Only responses to
  • IL-13 were inhibited by the soluble EL-13bc-Ig, indicating that this receptor binds IL-13 specifically, but not EL-4 or EL-6.
  • the tables show cpm. Two separate experiments are shown.
  • a Biacore biosensor was used to measure directly the specific binding of IL- 13 to purified IL-13bc-Ig (Pharmacia, Johnsson et al., 1991). Approximately 10,000 to 17,000 resonance units (RU) of purified IL-13bc-I , human IgGl or inelevant receptor were each covalently immobilized to different flow cells on the sensor chip as recommended by the manufacturer. (RU's are a refelction of the mass of protein bound to the sensor chip surface.) Purified IL-13 was injected across the flow cells at 5 ul/min for 10 mins in the presence or absence of excess purified EL-13bc-Ig. Binding was quantified as the difference in RU before and after sample injection.
  • Expression vectors for IL-13, IL-4, IL-11 or empty vector were transfected into COS-1 cells in duplicated plates via the DEAE-dextran method. Two days after transfection cells were washed twice in phosphate buffered saline (PBS) and fixed in the culture dish for 10' at 4° C with methanol. Following fixation cells were washed twice with PBS then rinsed once with binding buffer (PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide) and incubated for two hours at 4° C in binding buffer with IL- 13bc-Fc at 1.0ug/ml or with relevant anti-cytokine antisera.
  • PBS phosphate buffered saline
  • binding buffer PBS, 1% (w/v) bovine serum albumin, ).1% (w/v) sodium azide
  • Example 5 Other Systems for Determination Biological Activity of IL-13bc Protein
  • Other systems can be used to determine whether a specific EL- 13bc protein exhibits a "biological activity" of IL-13bc as defined herein. The following are examples of such systems.
  • IL-13bc protein The ability of a IL-13bc protein to bind IL-13 or a fragment thereof can be determine by any suitable assays which can detect such binding. Some suitable examples follow. B inding of EL- 13 to the extracellular region of the IL- 13bc protein will specifically cause a rapid induction of phosphotyrosine on the receptor protein. Assays for ligand binding activity as measured by induction of phosphorylation are described below.
  • a IL-13bc protein (such as, for example, a soluble form of the extracellular domain) is produced and used to detect IL- 13 binding.
  • a DNA construct is prepared in which the extracellular domain (truncated prior, preferably immediately prior, to the predicted transmembrane domain) is ligated in frame to a cDNA encoding the hinge C H 2 and C H 3 domains of a human immunoglobulin (Ig) ⁇ l.
  • This construct is generated in an appropriate expression vector for COS cells, such as pED ⁇ C orpMT2.
  • the plasmid is transiently transfected into COS cells.
  • the secreted EL- 13bc-Ig fusion protein is collected in the conditioned medium and purified by protein A chromatography.
  • the purified IL-13bc-Ig fusion protein is used to demonstrate IL-13 binding in a number of applications.
  • EL-13 can be coated onto the surface of an enzyme-linked immunosorbent assay (ELISA) plate, and then additional binding sites blocked with bovine serum albumin or casein using standard ELISA buffers.
  • the IL-13bc-Ig fusion protein is then bound to the solid-phase EL-13, and binding is detected with a secondary goat anti- human Ig conjugated to horseradish peroxidase.
  • the activity of specifically bound enzyme can be measured with a colorimetric substrate, such as tetramethyl benzidine and absorbance readings.
  • IL-13 may also be expressed on the surface of cells, for example by providing a transmembrane domain or glucosyl phosphatidyl inositol (GPI) linkage.
  • Cells expressing the membrane bound IL-13 can be identified using the IL-13bc-Ig fusion protein.
  • the soluble IL-13bc-Ig fusion is bound to the surface of these cells and detected with goat anti- human Ig conjugated to a fluorochrome, such as fluorescein isothiocyanate and flow cytometry.
  • a yeast genetic selection method the "interaction trap” [Gyuris et al, Cell 75:791-803, 1993] can be used to determine whether a EL-13bc protein has a biological activity of EL-13bc as defined herein.
  • the expression of reporter genes from both LexAop-Leu2 and LexAop-LacZ relies on the interaction between the bait protein, for example in this case a species which interacts with human IL-13bc, and the prey, for example in this case the human IL-13bc protein.
  • the prey for example in this case the human IL-13bc protein.
  • Leu2 or LacZ expression The most simple method is to measure the activity of the LacZ encoded protein, ⁇ -galactosidase.
  • This activity can be judged by the degree of blueness on the X-Gal containing medium or filter.
  • standard assays can be found in "Methods in Yeast Genetics” Cold Spring Harbor, New York, 1990 (by Rose, M.D., Winston, F., and Hieter, P.).
  • IL-13bc protein interacts with a particular species (such as, for example, a cytosolic protein which binds to the intracellular domain of the EL-13bc in vivo), that species can be used as the "bait" in the interaction trap with the IL-13bc protein to be tested serving as the "prey”, or vice versa.
  • a particular species such as, for example, a cytosolic protein which binds to the intracellular domain of the EL-13bc in vivo
  • Such conditions include, without limitation, fibrositis, formation of fibromas (fibromatosis), fibrogenesis (including pulmonary fibrogenesis), fibroelastosis (including endocardial fibroelastosis), formation of fibromyomas, fibrous ankylosis, formation of fibroids, formation of fibroadenomas, formation of fibromyxomas, and fibrocystotitis (including cystic fibrosis).
  • the EL-13 receptor complex is composed of at least three distinct components, including the IL-4 receptor, the low-affinity binding IL-13Ral chain, and the high affinity binding chain, IL-13R 2 35,42-44
  • a soluble IL-13Ra2-Fc fusion protein was prepared and has been used successfully to neutralize IL-13 both in vitro 35 and j n v i vo 30,39-41 since the fusion protein binds EL- 13 with high affinity, but fails to neutralize EL- 4, the protein provided an excellent tool to determine the specific roles of EL-13.
  • mice displayed on average a 40 to 50% reduction in granuloma volume when compared with either control or sEL- 13R 2-Fc-treated WT animals, and more than a 75% reduction when compared with control-Fc-treated EL-4-deficient mice.
  • Th2-type cytokine production is reduced in IL-4-deficient mice but unaffected by IL-13 inhibition.
  • liver mRNA from the various groups of mice at 8 wk postinfection and performed quantitative RT-PCR.
  • infected WT mice displayed a strong Th2-type cytokine mRNA profile, showing marked increases in EL-4, IL-13, IL-5, and IL-10 mRNA.
  • the WT mice also showed modest increases in the expression of IFN- ⁇ mRNA, which was consistent with previous observations 19.
  • IL-13 and IL-5 mRNA levels were much lower in IL-4-deficient mice, while IL-10 and TNF- ⁇ mRNA significantly increased and IFN- ⁇ mRNA expression did not change.
  • IL-13 blockade had no significant effect on the pattern of cytokine mRNA expression in either WT or IL-4-deficient mice.
  • Collagen I and collagen III mRNA levels are reduced in the livers ofsIL- 13Rc2-Fc-treated mice but unaffected by IL-4-deficiency.
  • the in vitro and in vivo cytokine studies described above suggested that the anti- fibrotic effect of sEL-13R 2-Fc was unlikely to be explained by changes in Thl or Th2- type cytokine expression. Therefore, in subsequent experiments, we investigated the patterns of collagen I (Col I) and collagen El (Col El) mRNA expression to determine whether the sEL-13R 2-Fc-induced reduction in fibrosis was accompanied by direct changes in the expression of these two important collagen producing genes 19.
  • IL-13 blockade significantly reduced Col I and Col IE mRNA expression in both WT and IL-4-deficient mice. There was no change in the infection-induced levels Col I or Col III mRNAs in EL-4-deficient mice and when compared with sIL-13Ro-2-Fc- treated WT mice, there was no further reduction in similarly treated IL-4-deficient mice.
  • IL-13 stimulates collagen production in mouse 3T3 fibroblasts.
  • EL-4 also induced collagen I synthesis (lane 2) and high levels of secreted collagen were easily detectable in the supematants obtained from both cytokine-stimulated cultures (data not shown).
  • the specificity of the reaction was confirmed by using purified collagen type I (lane 5) and bacterial collagenase treatments showed that the antibodies were specific for collagen (data not shown).
  • E-.- 4 and IL-13 both signal through Stat ⁇ , therefore the apparent differences in pathology observed between infected IL-4-deficient and Stat ⁇ -deficient mice may be explained by EL- 13. Nevertheless, the distinct contributions of IL-4 and EL- 13 in disease progression can not be discerned from studies in Stat ⁇ or EL-4-deficient mice alone. In this study, we used a potent inhibitor of EL-13 in infected WT and IL-4-deficient mice and demonstrate that EL-13 and IL-4 exhibit redundant, as well as unique roles in the pathogenesis of schistosomiasis.
  • Th2-type cytokine responses can develop in vivo in the absence of IL-4 or the IL-4 receptor 26,39 ⁇ hich is consistent with our findings since reduced but significant IL-13, IL-10, and IL-5 expression was detected in the mesenteric lymph nodes (Fig.4) and livers (Fig. 5) of infected IL-4-deficient mice. Their production was also highly dependent on a CD4 + T cell response (Fig. 4), further indicating that a conventional Th2-type response was established.
  • EL-4 is the dominant cytokine responsible for the development of eosinophil and mast cell populations within granulomas.
  • Blocking IL-13 had no significant effect on the production of IFN- ⁇ , IL-4, EL-5, IL-10, or IL-13 by mesenteric lymph node (Fig. 4) or spleen cells in vitro and there was also no change in cytokine mRNA expression in vivo, at the site of lesion formation (Fig. 5).
  • IL-4-deficient mice displayed an increased IFN- ⁇ response in the draining lymph nodes (Fig. 4) and decreased IL-5 and IL-13 expression in both the lymph nodes (Fig. 4) and liver (Fig. 5).
  • fibrosis detected in IL-4- deficient mice by hydroxyproline analysis may be attributable to decreased IL- 13 production.
  • IL- 13 production was unaffected by EL- 13 blockade, yet fibrosis was maximally reduced in these animals emphasizes the important role played by IL-13.
  • sEL-13R ⁇ 2-Fc-treated IL-4-deficient mice showed little additional decrease in hydroxyproline levels (Fig. 2C) and no difference in Collagen I or III mRNA expression (Fig. 6) over that observed in similarly-treated WT mice.
  • IL-4 9 are both capable of promoting collagen production in fibroblasts, the fact that cultured lymph node cells produced nearly 100-fold more EL-13 than IL-4 (Fig. 4), only serves to emphasize the potentially important contribution of EL- 13 in this process. Indeed, studies in the pulmonary granuloma model revealed that IL-4 mRNA expression is more tightly regulated at the site of lesion formation, while the induction of EL-13 mRNA is much more sustained over time 30. Nevertheless, we have not examined the kinetics of EL-4 and IL-13 mRNA expression in infected animals, so we can not say whether a similar pattern holds in the granulomatous livers.
  • IL-13 was also recently shown to be important for resistance against intestinal nematodes 27,37-39
  • IL- 13 was found to be necessary and sufficient for the expression of allergic asthma 40,41
  • Subepithelial fibrosis and airway smooth muscle hypertrophy are common features of chronic severe asthma and chronic pulmonary fibrosis is associated with the production of type IE and type I collagen in the early and late stages of the disease, respectively.
  • the link between IL-13 and fibrosis revealed in our study elucidates the etiology of several important human diseases and provides more effective modes of treatment of fibrotic diseases in general.
  • IL-12 is less capable of modulating established Th2-type responses 53, which likely explains the failure to modulate pathology in the latter study 5 .
  • sIL- 13R ⁇ 2-Fc was extremely effective at reducing hepatic fibrosis, even though administered only during the later stages of infection.
  • IL- 13 inhibitors such as the sEL- 13R 2-Fc, are of general therapeutic benefit in preventing fibrosis associated with chronic infectious disease and demonstrate the important and non-redundant role of IL-13 in the pathogenesis of schistosomiasis.
  • mice 6-8 week old female C57BL/6 and IL-4-deficient mice (C57BL/6 background, 10 th backcross) were obtained from Taconic Farms, Inc. (Germantown, NY). All mice were housed in a NIH American Association for the Accreditation of Laboratory Animal Care-approved animal facility in sterile filter-top cages and maintained on sterile water. Cercariae of a Puerto Spainn strain of Schistosoma mansoni (NMRI) were obtained from infected Biomphalaria glabrata snails (Biomedical Research Institute, Rockville, MD). Soluble egg antigen (SEA) was purified from homogenized eggs, as previously described 15.
  • soluble IL-13 receptor ⁇ -2-Fc fusion protein (sIL-13R ⁇ 2-Fc) was prepared as previously described 35 and provided by Genetics Institute, Cambridge MA. Endotoxin contamination was ⁇ 2 EU/mg, as determined with the Cape Cod Associates LAL assay (Limulus Amebocyte Lysate, Woods Hole, MA). The in vitro ID50, as determined by the ability to neutralize 3ng/ml of murine IL-13 in the B9 proliferation assay, was approximately 10 ng/ml.
  • control-Fc Human IgG
  • control-Fc Human IgG
  • mice were infected by percutaneous challenge of tail skin for 40 min in water containing between 20 and 25 cercariae.
  • Animals were treated with either a human control-Fc or with the sEL-13R ⁇ 2-Fc by i.p. injection in 0.5 ml PBS, every other day after the onset of egg production (week 5).
  • the optimal concentration for in vivo use 200 ⁇ g/mouse/day was chosen based on kinetic assays and on dose response experiments in sensitized i. v. egg-injected mice 0.
  • Sera were collected from mice on the day of sacrifice. All animals were sacrificed by i.p. administration of sodium pentobarbital (18 mg/mouse, Sigma, St. Louis, MO) on week 8 and perfused with citrated saline to assess worm burdens 15. No mortality was observed among any of the treated groups.
  • granulomas For measurement of granulomas, approximately half of the liver was fixed with Bouin-Hollander fixative and processed as previously described 15. The size of hepatic granulomas was determined in histological sections stained by Wright's Giemsa stain (Histopath of America, Clinton, MD). The diameters of each granuloma containing a single viable egg were measured with an ocular micrometer and the volume of each granuloma calculated assuming a spherical shape. The mean of the longest diameter and the diameter perpendicular to that was used. The percentage of eosinophils, mast cells and other cell types were evaluated in the same sections.
  • Parenchymal necrosis was scored on a scale of 0-4, with 0 being the least and 4 being the most extensive necrosis.
  • the frequency of mast cells was also assigned on a similar scale, using a range from 0-4.
  • Fibrosis was also scored histologically using sections stained with picrosirius red. The picrosirius reagent stains collagen specifically and when sections are viewed under polarizing light, the bright areas where collagen is deposited are illuminated.
  • RNA-STAT 60 (Tel-Test), frozen on dry ice and kept at -70°C until use. Tissues were homogenized using a tissue polytron (Omni International Inc., Waterbury, CT) and total RNA was extracted following the recommendations of the manufacturer. The RNA was resuspended in DEPC-treated water and quantitated spectrophotometrically.
  • RT-PCR procedure was used to determine relative quantities of mRNA for IL-4, IL-5, IL-10, EL-13, IFN- ⁇ , collagen I, collagen IE, TGF ⁇ l, TGF ⁇ 2, and HPRT (hypoxanthine-guanine phosphoribosyl transferase).
  • the cDNA was obtained after reverse transcription of 1 ⁇ g of RNA as described 14.
  • the primers and probes for all genes were previously published 14,19,54
  • the PCR cycles used for each cytokine were as follows: IL-4 (33), IL-5 (31), IFN- ⁇ (29), collagen I (26), collagen IE (22), TGF ⁇ l (34), TGF ⁇ 2 (34), and HPRT (23).
  • the amplified DNA was analyzed by electrophoresis, Southern blotting and hybridization with non-radioactive cytokine-specific probes as previously described 14.
  • the PCR products were detected using a ECL detection system (Amersham).
  • the chemiluminescent signals were quantified using a flat-bed scanner (Microtek model 600 ZS, Torrance, CA).
  • the amount of PCR product was determined by comparing the ratio of cytokine-specific signal density to that of HPRT-specific signal density for individual samples. Arbitrary densitometric units for individual samples were subsequently multiplied by a factor of 100.
  • MNN Mesenteric lymph node
  • spleens were extracted from the mice and single cell suspensions were prepared.
  • Red blood cells were lysed by osmotic treatment with ACK lysing buffer (Biofluids, Inc., Rockville, MD).
  • Cells were placed in RPMI 1640 medium supplemented with 10% FCS, 2mM glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 25 mM HEPES, ImM sodium pyruvate, 0.1 mM nonessential amino acids, and 50 ⁇ M 2-ME at 37°C in 5% CO 2 .
  • IL-4, EL-5, IL-10, IL-13 and IFN-g were plated in 24-well plates (3 x 10 6 /ml, 1ml) and stimulated with SEA (20 ⁇ g/ml) and supematants were collected after 72 h to measure the levels of IL-4, EL-5, IL-10, IL-13 and IFN-g. Additional SEA-stimulated cultures were also treated with 50 ⁇ g/ml of anti-CD4 mAb (GK1.5). Cultures treated with anti-CD4 mAb alone showed no change in cytokine expression when compared with that observed in medium control cultures (data not shown). EL-5, IL-10, and EFN-g were measured using specific sandwich ELISA 15.
  • IL- 13 levels were measured using murine IL- 13 ELISA kits (R&D Systems, Minneapolis, MN). Cytokine levels were calculated from curves prepared with recombinant cytokines. IL-4 was measured using the IL-4 sensitive cell line CT.4S. Proliferation of these cells was quantified by ( 3 H)TdR incorporation, and the amount of cytokine was determined by comparison with known amounts of recombinant IL-4.
  • 3T3 fibroblasts were cultured in RPMI 1640 medium supplemented with 10% FCS, 2mM glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 25 mM HEPES, ImM sodium pyruvate, 0.1 mM nonessential amino acids, and 50 ⁇ M 2-ME at 37°C in 5% CO 2 .
  • Confluent cells were plated in 24-well plates (500,000 cells/ml) and stimulated with IL-4 (1000 U/ml) or rIL- 13 (R&D Systems, Minneapolis, MN) (20 ng/ml) for 6, 24 and 48 hs. Culture supematants were collected to analyze secreted collagen I.
  • the bands were visualized using a western blot chemiluminescence reagent (NEN Life Science Products, Boston, MA). To confirm identity of the collagen bands, cell lysates were treated with 0.5 mg/ml of collagenase (Boehringer Mannheim, Indianapolis, IN) in PBS, supplemented with 1 mM CaCl 2 and 1 % FCS, for 1 h at 37°C. A purified rat collagen I preparation was also used as a control.
  • Schistosome worm and egg numbers, changes in cytokine mRNA, and values for secreted cytokine proteins were compared using Student's two-tailed t test. Hepatic fibrosis was compared by analysis of covariance, using the log of total liver eggs as the covariate and the log of hydroxyproline per egg. p ⁇ 0.05 was considered significant.
  • Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362, 248-250 (1993).
  • EL- 12 Endogenous interleukin 12 regulates granuloma formation induced by eggs of Schistosoma mansoni and exogenous IL-12 both inhibits and prophylactically immunizes against egg pathology. J.Exp.Med. 179, 1551-1561 (1994).

Abstract

L'invention concerne des méthodes destinées au traitement ou à la prévention de la formation d'une fibrose tissulaire, utilisant des antagonistes de IL-13, notamment toute forme soluble du récepteur de IL-13.
PCT/US2000/017103 1999-06-21 2000-06-21 Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13 WO2000078336A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU57561/00A AU5756100A (en) 1999-06-21 2000-06-21 Treatment of fibrosis by antagonism of il-13 and il-13 receptor chains

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US33451299A 1999-06-21 1999-06-21
US09/334,512 1999-06-21

Publications (1)

Publication Number Publication Date
WO2000078336A1 true WO2000078336A1 (fr) 2000-12-28

Family

ID=23307566

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/017103 WO2000078336A1 (fr) 1999-06-21 2000-06-21 Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13

Country Status (2)

Country Link
AU (1) AU5756100A (fr)
WO (1) WO2000078336A1 (fr)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US8092804B2 (en) 2007-12-21 2012-01-10 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4Rα)-173
WO2016044707A1 (fr) * 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions et procédés de traitement de la fibrose
WO2017103108A1 (fr) * 2015-12-16 2017-06-22 Singapore Health Services Pte Ltd Traitement de la fibrose
US11078268B2 (en) 2016-12-16 2021-08-03 Singapore Health Services Pte Ltd IL-11 antibodies
US11078269B2 (en) 2016-12-16 2021-08-03 Singapore Health Services Pte Ltd IL-11Rα antibodies
WO2021249555A1 (fr) * 2020-06-12 2021-12-16 Beijing Vdjbio Co., Ltd. Polypeptide de fusion
US11319368B2 (en) 2019-01-21 2022-05-03 Singapore Health Services Pte Ltd. Treatment of hepatotoxicity with IL-11 antibody

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CAPUT ET AL.: "Cloning and characterization of a specific interleukin (IL)-13 binding protein structurally related to the IL-5 receptor alpha chain", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, no. 28, 12 July 1996 (1996-07-12), pages 16921 - 16926, XP002933080 *
HANCOCK ET AL.: "Production of interleukin-13 by alveolar macrophages from normal and fibrotic lung", AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY, vol. 18, no. 1, January 1998 (1998-01-01), pages 60 - 67, XP002933081 *

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7615213B2 (en) 2004-06-09 2009-11-10 Wyeth Antibodies against human interleukin-13 and pharmaceutical compositions thereof
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
US8092804B2 (en) 2007-12-21 2012-01-10 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4Rα)-173
US8877189B2 (en) 2007-12-21 2014-11-04 Medimmune Limited Binding members for interleukin-4 receptor alpha (IL-4Rα) - 173
US10245298B2 (en) 2014-09-18 2019-04-02 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
WO2016044707A1 (fr) * 2014-09-18 2016-03-24 Cedars-Sinai Medical Center Compositions et procédés de traitement de la fibrose
US11547738B2 (en) 2014-09-18 2023-01-10 Cedars-Sinai Medical Center Compositions and methods for treating fibrosis
AU2018229482B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
US10865239B2 (en) 2015-12-16 2020-12-15 Singapore Health Services Pte Ltd. Treatment of fibrosis with interleukin-11 antibody
EP3428188A1 (fr) * 2015-12-16 2019-01-16 Singapore Health Services Pte Ltd Traitement de la fibrose de le système cardiovasculaires a des anticorps antagonistes de la liaison il-11:il11ralpha
EP3428187A1 (fr) * 2015-12-16 2019-01-16 Singapore Health Services Pte Ltd Traitement de la fibrose de le système respiratoire a des anticorps antagonistes de la liaison il-11:il11ralpha
EP3431500A1 (fr) * 2015-12-16 2019-01-23 Singapore Health Services Pte Ltd Traitement de la fibrose cutanée a des anticorps antagonistes de la liaison il-11:il11ralpha
EP3431499A1 (fr) * 2015-12-16 2019-01-23 Singapore Health Services Pte Ltd Traitement de la fibrose de l' il a des anticorps antagonistes de la liaison il-11:il11ralpha
EP3431498A1 (fr) * 2015-12-16 2019-01-23 Singapore Health Services Pte Ltd Traitement de la fibrose du tractus gastro-intestinal a des anticorps antagonistes de la liaison il-11:il11ralpha
US10106603B2 (en) 2015-12-16 2018-10-23 Singapore Health Services Pte Ltd Treatment of fibrosis
AU2018229486B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
AU2018229483B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
AU2018229485B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
US10035852B2 (en) 2015-12-16 2018-07-31 Singapore Health Services Pte Ltd Treatment of fibrosis
AU2018229484B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
AU2018229487B2 (en) * 2015-12-16 2019-08-08 National University Of Singapore Treatment of fibrosis
AU2018229484B9 (en) * 2015-12-16 2019-09-12 National University Of Singapore Treatment of fibrosis
US10822405B2 (en) 2015-12-16 2020-11-03 Singapore Health Services Pte Ltd. Treatment of fibrosis with IL-11 receptor alpha antibody
US10865240B2 (en) 2015-12-16 2020-12-15 Singapore Health Services Pte Ltd. Treatment of fibrosis with interleukin-11 antibody
EP3428186A1 (fr) * 2015-12-16 2019-01-16 Singapore Health Services Pte Ltd Traitement de la fibrose hepatique grace a des anticorps antagonistes de la liaison il-11:il11ralpha
US10865241B2 (en) 2015-12-16 2020-12-15 Singapore Health Services Pte Ltd. Treatment of fibrosis with interleukin-11 antibody
US10870697B2 (en) 2015-12-16 2020-12-22 Singapore Health Services Pte Ltd. Treatment of fibrosis with interleukin-11 antibody
US10870696B2 (en) 2015-12-16 2020-12-22 Singapore Health Services Pte Ltd. Treatment of fibrosis with interleukin-11 antibody
US10889642B2 (en) 2015-12-16 2021-01-12 Singapore Health Services Pte Ltd Treatment of fibrosis with interleukin-11 receptor alpha antibody
US10894825B2 (en) 2015-12-16 2021-01-19 Singapore Health Services Pte Ltd Treatment of fibrosis with interleukin-11 antibody
US10894826B2 (en) 2015-12-16 2021-01-19 Singapore Health Services Pte Ltd Treatment of fibrosis with interleukin-11 receptor alpha antibody
US10894827B2 (en) 2015-12-16 2021-01-19 Singapore Health Services Pte Ltd Treatment of fibrosis with interleukin-11 receptor alpha antibody
US10899832B2 (en) 2015-12-16 2021-01-26 Singapore Health Services Pte Ltd Treatment of fibrosis with interleukin-11 receptor alpha antibody
US10927169B2 (en) 2015-12-16 2021-02-23 Singapore Health Services Pte Ltd Treatment of fibrosis with Interleukin-11 receptor alpha antibody
US11939374B2 (en) 2015-12-16 2024-03-26 Singapore Health Services Pte Ltd. Treatment of fibrosis
WO2017103108A1 (fr) * 2015-12-16 2017-06-22 Singapore Health Services Pte Ltd Traitement de la fibrose
US11078269B2 (en) 2016-12-16 2021-08-03 Singapore Health Services Pte Ltd IL-11Rα antibodies
US11078268B2 (en) 2016-12-16 2021-08-03 Singapore Health Services Pte Ltd IL-11 antibodies
US11319368B2 (en) 2019-01-21 2022-05-03 Singapore Health Services Pte Ltd. Treatment of hepatotoxicity with IL-11 antibody
WO2021249555A1 (fr) * 2020-06-12 2021-12-16 Beijing Vdjbio Co., Ltd. Polypeptide de fusion

Also Published As

Publication number Publication date
AU5756100A (en) 2001-01-09

Similar Documents

Publication Publication Date Title
EP1173484B1 (fr) Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13
ES2367352T3 (es) Tratamiento de la fibrosis meidante el antagonismo de la il-3 y de las cadenas del receptor del il-3.
US6214559B1 (en) Methods of identifying inhibitors of binding of IL-13 to the IL-13 receptor chain
US6197525B1 (en) Assay kits for detection and methods of inhibiting IL-17 binding
EP0797664B1 (fr) Utilisation d'un recepteur de l'interleukine-11 humaine
AU780031B2 (en) Cytokine receptor chain
WO2000078336A1 (fr) Traitement de la fibrose par antagonisme de il-13 et de chaines receptrices de il-13
US7078494B1 (en) Antibodies to human IL-13bc and methods of their use in inhibiting IL-13 binding
US6680057B1 (en) Methods of treating autoimmune disease by administering interleukin-17 receptor
US20070111939A1 (en) Human interleukin-11 receptor
MXPA97004618A (en) Receiver of the interleucine-11 hum

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AL AM AT AU AZ BA BB BG BR BY CA CH CN CU CZ DE DK EE ES FI GB GE GH GM HR HU ID IL IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG UZ VN YU ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP