WO2000074726A1 - METHODS AND COMPOSITIONS FOR PREVENTING p53 MEDIATED APOPTOSIS - Google Patents

Abstract

Methods and compositions are provided for preventing p53 mediated apoptosis in host. In the subject methods, an effective amount of an agent having hAPP anti-p53 apoptotic activity is administered to the host. The subject methods find use in the treatment of disease conditions associated with p-53 mediated apoptosis, particularly p53 mediated neuronal apoptosis, e.g., neurodegenerative diseases such as Alzheimer's Disease.

Description

METHODS AND COMPOSITIONS FOR PREVENTING _P53 MEDIATED APOPTOSIS

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT This invention was made with Government support under Grant No. AG1 1385 awarded by the National Institute of Health. The Government has certain rights in this invention.

CROSS-REFERENCE TO RELATED APPLICATIONS Pursuant to 35 U.S.C. § 119 (e), this application claims priority to the filing date of the United States Provisional Patent Application Serial No. 60/138,157 filed on June 7, 1999; the disclosure of which is herein incorporated by reference.

INTRODUCTION Field of the Invention

The field of the invention is apoptosis, particularly p53 mediated apoptosis. Background of the Invention Apoptosis (or programmed cell death) is a fundamental biological process fulfilling many important functions in developing and adult organisms that involves a sequence of regulated cellular events culminating in cell death. The aberrant induction of apoptosis by disease processes can have tragic consequences, particularly if it involves cells that are largely irreplaceable, such as neurons. There is now evidence that activation of pro-apoptotic pathways may contribute to diverse neurological disorders, including stroke, Alzheimer's Disease (AD), HIN-associated dimentia, and amyotrophic lateral sclerosis. The p53 tumor antigen is found in increased amounts in a wide variety of transformed cells. The protein is also detectable in many actively proliferating, nontransformed cells, but it is undetectable or present at low levels in resting cells. Several lines of evidence suggest its involvement in cell cycle regulation. Indeed, it has been called the "the cellular gatekeeper for growth and division." Levine. A. J, Cell (1997) 88: 323-331. The open reading frame of p53 is 393 amino acids long, with the central region (consisting of amino acids from about 100 to 300) containing a DNA-binding domain. This proteolysis-resistant core is flanked by a C-terminal end mediating oligomerization and an N-terminal end containing a strong transcription activation signal. The structure of p53 appears to be unique, consisting of a large beta-sandwich that acts as a scaffold for 3 loop-based elements. The sandwich is composed of 2 anti-parallel beta-sheets containing 4 and 5 beta-strands, respectively. The first loop binds to DNA within the major groove, the second loop binds to DNA within the minor groove, and the third loop packs against the second loop to stabilize it. Among other functions, evidence suggests that p53 plays a role is apopoptosis. Biochemical and pharmacologic experiments suggest that p53 results in apoptosis through a 3 -step process: (1) the transcriptional induction of redox-related genes; (2) the formation of reactive oxygen species; and (3) the oxidative degradation of mitochondrial components, culminating in cell death. Indeed, p53 mediated apoptosis has been implicated as playing a role in the progression of neurodegenerative diseases, such as Alzheimer's Disease. See de la Monte. Laboratory Investigation (1998) 78: 401-41 1.

Because of its role in neurodegenerative diseases, such as AD. there is continued interest in the identification of protocols and therapeutic agents for the control of p53 mediated apopoptosis. Relevant Literature

References of interest include: Masliah. J Neural Transm Suppl (1998) 53:147-58; Small. Neurochem Res (May 1998)23:795-806: Masliah. Histol Histopathol (April 1995)10:509-19: Velez-Pardo et al.. Gen Pharmacol (November 1998) 31 :675-81: Hardy. Trends Neurosci (April 1997)20(4): 154-9; Ariga et al.. J. Lip. Res. (1998) 39: 1 -16; Kitamura et al.. Biochem. Biophys. Res. Comm. (1997) 232:418-421 : de la Monte. Laboratory Investigation (April 1998) 78:401-41 1 ; Polyak et al.. Nature (September 18. 1997)389:300-5; Caelles et al.. Nature (July 21. 1994) 370:220-3; Yonish-Rouach. Experientia (October 31. 1996) 52:1001-7; Shaw, Pathol Res Pract (July. 1996)192:669-75; Yonish-Rouach et al.. Behring Inst Mitt (October, 1996) (97):60-71 ; Haffner & Oren. Curr Opin Genet Dev (February, 1995)5:84-90; Chen et al.. Genes Dev (October 1 , 1996) 10:2438-51 ; Wyllie. Nature (September

18,1997)389:237-8; and Lane et al.. Philos Trans R Soc Lond B Biol Sci (August 30, 1994)345:277-80.

SUMMARY OF THE INVENTION Methods and compositions for preventing p53 mediated apoptosis in a host are provided. In the subject methods, an effective amount of an agent having hAPP anti- p53 apoptotic activity is administered to the host. The agent may be hAPP. a nucleic acid encoding hAPP or an hAPP mimetic exhibiting hAPP anti-p53 apoptotic activity, including an hAPP mutant or mimetic thereof. The subject methods and compositions find use in the treatment of disease conditions associated with p53 mediated apoptosis, particularly neuronal p53 mediated apoptosis. including neurodegenerative diseases such as Alzheimer's Disease.

DETAILED DESCRIPTION OF THE INVENTION Methods and compositions for preventing neuronal apoptosis in a host are provided. In the subject methods, an effective amount of an agent having hAPP anti- p53 apoptotic activity is administered to the host. The subject methods and compositions find use in the treatment of diseases characterized by neuronal apoptosis, such as neurodegenerative diseases, e.g., Alzheimer's Disease (AD).

Before the subject invention is further described, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the appended claims. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. Instead, the scope of the present invention will be established by the appended claims. In this specification and the appended claims, the singular forms "a." "an." and "the" include plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs.

As summarized above, the subject invention provides methods and compositions for at least reducing, if not preventing, neuronal apoptosis in a host. By "at least reduce" is meant that number of apoptotic neuronal cells following treatment according to the subject methods as determined by TUNEL analysis (see methods section, infra) is at least 20% less, often at least 30% less, usually at least 40% less and more usually at least 50% less that the number observed in a control, where in certain embodiments treatment results in the appearance of at least about 60% less positively identified apoptotic neuronal cells as compared to a control. As evaluated by DNA fragmentation assay (see methods section infra), the amount of fragmented DNA observed following treatment is generally at least 20%. often at least 30%. usually at least 40% and more usually at least 50% less than that observed in a control. In particular, the subject invention provides a method of reducing, if not preventing, p53 mediated apoptosis. More particularly, the subject invention is directed to a method of at least reducing, if not preventing. p53 mediated neuronal apoptosis.

Critical to the subject methods is the administration to the host or cell of an effective amount of an agent having hAPP anti-p53 apoptotic activity. By "hAPP anti- p53 apoptotic activity" is meant that the agent has an activity analogous to wild-type, non- mutant hAPP. at least with respect to p53. i.e.. it blocks the p53 apoptotic activity. In other words, the agent modulates APP-p53 interactions in the host or cell to mimic or mirror wt hAPP-p53 interactions. In particular, agents finding use in the subject invention directly or indirectly inhibit p53 DNA binding activity and p53- mediated gene transactivation. Those agents that directly provide such activities are agents that interact directly with p53 in a manner analogous to hAPP. e.g.. hAPP or a mimetic thereof, e.g., mutant hAPP exhibiting wt hAPP antiapoptotic activity, an hAPP fragment exhibiting wt hAPP antiapoptotic activity, etc. Those agents that indirectly provide such activities are agents which provide for an agent that directly interacts with p53. e.g.. an agent that increases expression of endogenous hAPP, a nucleic acid encoding hAPP, and the like.

A variety of agents may be administered in the subject methods, as long as the agent has hAPP anti-p53 apoptotic activity, as described above. Directly acting agents include hAPP or mimetics thereof. By hAPP is meant the wild type, non-mutant, human -amyloid precursor protein. The amino acid sequence of hAPP is known and has a GENPEPT accession no. of 1070623. Methods of preparing purified hAPP are also known. See e.g.. Masters, et al. "Amyloid plaque core protein in Alzheimer disease and Down syndrome," Proc. Nat. Acad. Sci. (1985) 82: 4245-4249. Methods for preparing hAPP are also provided in the references cited in the GENPEPT report for accession no. 1070623.

Also of interest are hAPP mimetics having hAPP anti-p53 apoptotic activity. Mimetics of interest include hAPP polypeptides. as well as hAPP fragments and derivatives thereof. hAPP mimetics include hAPP polypeptides which vary from the naturally occurring protein but retain the desired anti-p53 apoptotic activity. By hAPP polypeptide is meant an amino acid sequence encoded by an open reading frame (ORF) of the hAPP gene, described in greater detail below, where the polypeptide is a mutant and/or fragment of the full length hAPP protein (e.g., a deletion mutant, a point mutant, an insertion mutant, etc.), particularly a biologically active fragment and/or fragments corresponding to a functional domain(s). hAPP polypeptides include fusions of the subject polypeptides to other proteins or parts thereof. Fragments of interest will typically be at least about 10 aa in length, usually at least about 50 aa in length, and may be as long as 300 aa in length or longer, but will usually not exceed about 1000 aa in length, where the fragment will have a stretch of amino acids that is identical to a stretch of wild type hAPP of at least about 10 aa. and usually at least about 15 aa, and in many embodiments at least about 50 aa in length.

The subject proteins and polypeptides may be obtained, e.g. purified, from naturally occurring sources or synthetically produced, e.g. by expressing a recombinant gene encoding the protein of interest in a suitable host, as described in greater detail below. Any convenient protein purification procedures may be employed, where suitable protein purification methodologies are described in Guide to Protein Purification. (Deuthser ed.) (Academic Press, 1990). For example, a lysate may prepared from the original source and purified using HPLC. exclusion chromatography. gel electrophoresis. affinity chromatography. and the like.

Of particular interest in certain embodiments are hAPP polypeptides that are mutants of wt hAPP. Representative mutants include, but are not limited to: point mutants, in which one or more amino acid residues in the wt protein is replaced with a different residue; deletion mutants, in which one or more domains of the wt protein is deleted, e.g.. all but the cytoplasmic tail: insertion mutants, in which one or more regions is inserted into the wt protein: and the like. In one embodiment, the hAPP mutants of interest are those that do not give rise to the Aβ42 peptide or an analogous metabolite. In these embodiments, the hAPP mutants are generally ones that lack a β- secretase cleavage site, at least in a position that, upon cleavage by β-secretase. would give rise to the Aβ42 peptide or an analogous metabolite. In many embodiments where the hAPP mutant is a deletion mutant, preferably substantially all of or all of the cytoplasmic tail of wt hAPP is present in the mutant. By substantially all of is meant at least about 50%. usually at least about 60% and more usually at least about 75%. In those embodiments, where the hAPP fragment includes all of or substantially all of the cytoplasmic tail, the fragment may be modified with respect to the types of proteins to which it binds. As such, fragments of interest are those that retain the ability to bind to the G₀ alpha subunit and Fe6J. Fragments of interest also include those that have been modified so as not to bind to XI 1 or Dabl . In certain embodiments, it is preferred if the fragment has been modified so as to abolish its ability to bind to XI 1.

Also of interest as hAPP mimetics are naturally occurring or synthetic small molecule compounds that exhibit hAPP anti-p53 apoptotic activity. Compounds of interest include numerous chemical classes, though typically they are organic molecules, preferably small organic compounds having a molecular weight of more than 50 and less than about 2.500 daltons. Agents of interest typically comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine. carbonyl. hydroxyl or carboxyl group, preferably at least two of the functional chemical groups. The agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Agents are also found among biomolecules including peptides. saccharides. fatty acids, steroids, purines. pyrimidines. derivatives, structural analogs or combinations thereof.

As mentioned above, agents that indirectly produce the desired hAPP anti-p53 apoptotic activity in a host are also of interest. Such agents include nucleic acid compositions, such as nucleic acids that encode hAPP or mimetics thereof having the desired anti-p53 apoptotic activity, as well as agents that provide for enhanced expression of a cell or host's endogenous hAPP.

Nucleic acid compositions finding use in the subject invention include nucleic acids encoding hAPP proteins or fragments thereof, as well as homologues thereof encoding APP proteins or polypeptides having anti-p53-apoptotic activity. By hAPP nucleic acid composition is meant a composition comprising a sequence of DNA having an open reading frame that encodes hAPP. i.e. an hAPP gene, and is capable, under appropriate conditions, of being expressed as hAPP. Also encompassed in this term are nucleic acids that are homologous or substantially similar or identical to the nucleic acids encoding hAPP and encode a product that exhibits hAPP anti-p53 apoptotic activity. Thus, of interest are genes encoding hAPP and homologues thereof. The sequence for human JRR gene is known. See e.g. the references cited GENPEPT report no. 1070623. The source of homologous genes may be any species, e.g., primate species, particularly human; rodents, such as rats and mice, canines, felines, bovines. ovines, equines, yeast, nematodes. etc. Between mammalian species, e.g.. human and mouse, homologues have substantial sequence similarity, e.g. at least 75% sequence identity, usually at least 90%. more usually at least 95% between nucleotide sequences. Sequence similarity is calculated based on a reference sequence, which may be a subset of a larger sequence, such as a conserved motif, coding region, flanking region, etc. A reference sequence will usually be at least about 18 nt long, more usually at least about 30 nt long, and may extend to the complete sequence that is being compared. Algorithms for sequence analysis are known in the art. such as BLAST. described in Altschul et al. (1990). J. Mol. Biol. 215:403-10 (using default settings). The nucleic acid compositions employed in the subject invention may be cDNA or genomic DNA or a fragment thereof. The term "hAPP gene" shall be intended to mean the open reading frame encoding specific hAPP proteins and polypeptides. and hAPP introns. as well as adjacent 5' and 3' non-coding nucleotide sequences involved in the regulation of expression, up to about 20 kb beyond the coding region, but possibly further in either direction. The gene may be introduced into an appropriate vector for extrachromosomal maintenance or for integration into a host genome.

The term "cDNA" as used herein is intended to include all nucleic acids that share the arrangement of sequence elements found in native mature mRNA species, where sequence elements are exons and 3 ' and 5 ' non-coding regions. Normally mRNA species have contiguous exons. with the intervening introns, when present, being removed by nuclear RNA splicing, to create a continuous open reading frame encoding the hAPP protein.

A genomic sequence of interest comprises the nucleic acid present between the initiation codon and the stop codon. as defined in the listed sequences, including all of the introns that are normally present in a native chromosome. It may further include the 3 ' and 5 ' untranslated regions found in the mature mRNA. It may further include specific transcriptional and translational regulatory sequences, such as promoters, enhancers, etc.. including about 1 kb, but possibly more, of flanking genomic DNA at either the 5' or 3 ' end of the transcribed region. The genomic DNA may be isolated as a fragment of 100 kbp or smaller; and substantially free of flanking chromosomal sequence. The genomic DNA flanking the coding region, either 3' or 5', or internal regulatory sequences as sometimes found in introns. contains sequences required for proper tissue and stage specific expression.

The nucleic acid compositions of the subject invention may encode all or a part of an hAPP protein, as well as the above described mutants thereof, as long as the encoded product exhibits the desired anti-p53 apoptotic activity. Double or single stranded fragments may be obtained from the DNA sequence by chemically synthesizing oligonucleotides in accordance with conventional methods, by restriction enzyme digestion, by PCR amplification, etc. For the most part. DNA fragments will be of at least 15 nt. usually at least 18 nt or 25 nt. and may be at least about 50 nt.

Also of interest are compounds that upregulate the expression of endogenous hAPP in the host or cell to be treated. Such compounds include: protein kinase C and its family members, elements in the protein kinase C pathways, compounds that activate protein kinase C. its family members and its pathways; protein kinase A and its family members, elements in the protein kinase A pathways, compounds that activate protein kinase A, its family members, and its pathways; compounds that affect hAPP processes including compounds that activate or inhibit alpha, beta, or gamma secretases; and the like.

As mentioned above, an effective amount of the agent is administered to the host, e.g. host organism, cell, etc., depending on the application, to achieve the desired reduction or prevention in p53 mediated apoptosis. By "effective amount" is meant a dosage sufficient to inhibit p53 mediated apoptosis in an individual cell or reduce the number of p53 mediated apoptotic cells in a collection of cells, e.g. as found in a tissue sample or host organism. Those of skill in the art will readily appreciate that dose levels can vary as a function of the specific compound, the severity of the symptoms and the susceptibility of the subject to side effects. Preferred dosages for a given compound are readily determinable by those of skill in the art by a variety of means. In the subject methods, the active agent(s) may be administered to the host using any convenient means capable of resulting in the desired reduction in, or prevention of, p53-mediated apoptosis. Thus, the agent can be incorporated into a variety of formulations for therapeutic administration. More particularly, the agents of the present invention can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols. As such, administration of the agents can be achieved in various ways, including oral, buccal. rectal, parenteral. intraperitoneal. intradermal. transdermal. intracheal,etc. administration.

In pharmaceutical dosage forms, the agents may be administered in the form of their pharmaceutically acceptable salts, or they may also be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds. The following methods and excipients are merely exemplary and are in no way limiting. For oral preparations, the agents can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol. corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose: with lubricants, such as talc or magnesium stearate: and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.

The agents can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides. esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. The agents can be utilized in aerosol formulation to be administered via inhalation. The compounds of the present invention can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like.

Furthermore, the agents can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. The compounds of the present invention can be administered rectally via a suppository. The suppository can include vehicles such as cocoa butter, carbowaxes and polyethylene glycols. which melt at body temperature, yet are solidified at room temperature.

Unit dosage forms for oral or rectal administration such as syrups, elixirs, and suspensions may be provided wherein each dosage unit, for example, teaspoonful, tablespoonful. tablet or suppository, contains a predetermined amount of the composition containing one or more inhibitors. Similarly, unit dosage forms for injection or intravenous administration may comprise the inhibitor(s) in a composition as a solution in sterile water, normal saline or another pharmaceutically acceptable carrier.

The term "unit dosage form." as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of compounds of the present invention calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the novel unit dosage forms of the present invention depend on the particular compound employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the host.

The pharmaceutically acceptable excipients. such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.

Where the agent is a polypeptide. polynucleotide. analog or mimetic thereof, it may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection. or fusion of vesicles. Jet injection may also be used for intramuscular administration, as described by Furth et al. (1992), Anal Biochem 205:365-368. The DNA may be coated onto gold microparticles. and delivered intradermally by a particle bombardment device, or "gene gun" as described in the literature (see, for example, Tang et al. (1992), Nature 356:152-154). where gold microprojectiles are coated with the therapeutic DNA, then bombarded into skin cells. Where the therapeutic agent is a nucleic acid composition as described above, gene replacement therapy may be employed. Specifically, one or more copies of a normal hAPP gene or a portion of the hAPP gene that directs the production of a hAPP gene product exhibiting normal hAPP gene function, may be inserted into the appropriate cells within a host, using vectors which include, but are not limited to adenovirus. adeno-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.

In those preferred embodiments directed to the prevention of p-53 mediated neuronal apoptosis. of interest are gene therapy protocols capable of delivering hAPP gene sequences to neuronal cells in the CNS. Thus, the techniques for delivery of gene sequences should be able to readily cross the blood-brain barrier, which are well known to those of skill in the art (see. e.g.. PCT application, publication No. W089/10134, which is incorporated herein by reference in its entirety), or. alternatively, should involve direct administration of such gene sequences to the site of the neuronal cells in which the gene sequences are to be expressed. With respect to delivery which is capable of crossing the blood-brain barrier, viral vectors such as, for example, those described above, are preferable. The subject methods may be used to reduce or prevent p53-mediated apoptosis in a variety of different hosts. Generally such hosts are "mammals" or "mammalian," where these terms are used broadly to describe organisms which are within the class mammalia, including the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), lagomorph, e.g. rabbit, and primates (e.g., humans, chimpanzees, and monkeys). In many embodiments, the hosts will be humans.

The subject methods find use in the treatment of disease conditions associated with p-53 mediated apoptosis. particularly in neuronal cells. Such disease conditions include neurodegenerative diseases, such as: Alzheimer's disease, diffuse Lewy body disease. Pick's disease, progressive supranuclear palsy, multiple system atrophy, Parkinson's disease, amvotrophic lateral sclerosis, and the like. Of particular interest is the use of the subject methods in the treatment of Alzheimer's disease.

By treatment is meant at least an amelioration of the symptoms associated with the pathological condition afflicting the host, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g. symptom. associated with the pathological condition being treated, such as magnitude of neuronal apoptosis. as well as phenotypic symptoms, such as a slowing in the progression of the disease, a reduction in the magnitude of a symptom thereof, e.g. a reduction in the level of learning impairment, and the like.

The following examples are offered by way of illustration and not by way of limitation.

EXPERIMENTAL

I. METHODS A. Cells and Treatment.

B103 cells obtained from Dr. E. Masliah (University of California. San Diego), were maintained in Dulbecco's modified Eagle's medium (DMEM) (Life Technologies, Grand Island. NY) containing 10% fetal bovine serum and 5% horse serum at 37°C with 5% C0₂. For differentiation, cells were washed twice with serum- free DMEM and cultured for 48 h in Neurobasal medium containing N-2 supplement (Life Technologies). At the end of this culture period, B103 cells had assumed a neuronal morphology, with several neurites extending from their cell bodies. Neurites and cell bodies of differentiated B103 cells were immunolabeled with antibodies against the neuronal marker microtubule-associated protein 2 (data not shown). Cells were transfected in the undifferentiated state. After differentiation for 48 h, cells were exposed to UV-C (20 J/m²) or staurosporine (Sigma) (diluted in differentiation medium to a final concentration of 5 μM), or infected with p53-rAd [multiplicity of infection (m.o.i.) = 5] or LacZ-rAd (m.o.i. = 5). B. hAPP constructs and transfections. cDNAs encoding wild-type or FAD-mutant hAPP695 (Masliah. et al. (1997) Neuroscience 78, 135-146) were subcloned into a CMV promoter/enhancer-driven expression vector (Dai, Y. et al.(1995) Proc. Natl. Acad. Sci. USA 92, 1401-1405.). The resulting constructs (hAPP695wt and hAPP695mut) were transfected transiently into B103 cells with Lipofectamine (Life Technologies). To monitor transfection efficiency, a construct encoding green fluorescent protein (pGreen Lantern, Life Technologies) was cotransfected in all experiments. Select findings obtained in transiently transfected B103 cells were confirmed in stably transfected B103 cells. For this purpose, B 103 cells were transfected with the APP cDNA constructs encoding hAPP695wt or hAPP695mut, with a previously characterized hAPP minigene construct (Rockenstein et al. (1995) J. Biol. Chem. 270, 28257-28267.) that encodes the FAD-associated N642F substitution (hAPP695 numbering) (Murrell. et al. (1991) Science 254, 97-99) or with a similar hAPP minigene construct encoding wild-type hAPP. B103 cell lines stably expressing these constructs were selected by cotransfection with pSV2neo (Clontech, Palo Alto, CA) and incubation in G418- containing medium, essentially as described ( Wyss-Coray. et al. (1996) J. Clin. Invest. 97, 789-798.). The expression levels of hAPP in the stably transfected B103 lines were ascertained by western blot analysis. C. Apoptosis Assessments

Three assays were used to detect and quantitate apoptosis. (1 ) Nuclear fragmentation indicative of apoptosis was detected by in situ labeling with the TUNEL assay kit from Boehringer Biotech (Indianapolis. IN). Briefly, cells plated on 8-well chamberslides (Fisher) were fixed with 4% paraformaldehyde. permeabilized with 0.1% Triton X-100, and incubated with fluorescently labeled dUTP and terminal deoxynucleotide transferase at 37° C for 1 h. After three rinses with PBS. cells were inspected with an epifluorescence microscope. (2) Genomic DNA was isolated from cell cultures and separated by electrophoresis on ethidium bromide-stained 3%> agarose gels to reveal DNA fragmentation. DNA laddering typical of apoptosis was visualized by UV. (3) DNA fragments released from nuclei into the cytoplasm during apoptosis were measured with the ELISA apoptosis kit from Boehringer. Briefly, 1 χl0⁴B103 cells were seeded into each well of a 96-well plate and incubated overnight. The medium was then replaced with differentiation medium containing BrdU, and cells were incubated for another 48 h. DNA fragmentation induced by subsequent exposure to UV-IR, staurosporine treatment, or infection with p53-rAd was then quantitated in cell lysates with a peroxidase-conjugated anti-BrdU antibody.

D. Immunostaining and microscopy. Cells cultured in chamberslides were first fixed in methanol at -20° C for 5 min, and then with acetone at 4° C for 2 min, followed by a wash in PBS. To block nonspecific immunostaining, cells were incubated for 30 min at 37°C in PBS with 3% normal rabbit serum. hAPP expression in B 103 cells was assessed 72 h after transient transfection with hAPP695 cDNA constructs and 48 h after exposure to differentiation medium by incubating cells with the monoclonal antibody 22C11 (Boehringer; final concentration 0.5 μg/ml) at 4°C overnight. For p53 immunostaining, cells were incubated with the monoclonal antibody p53Abl (Oncogene. Cambridge, MA; final concentration 0.5 μg/ml) at 4°C overnight. After three washes with PBS. cells were then incubated with fluorescein isothiocyanate-labeled rabbit anti-mouse IgG for 1 h at room temperature. After three washes with PBS. immunolabeled cells were examined with an MRC 1024 laser scanning confocal microscope (BioRad. Hercules. CA). E. Western blot analysis.

B103 cell lysates (lysis buffer: 20 mM Tris-HCl. pH 7.8. 150 mM NaCl, 0.5% SDS, 0.5% NP40, 1 μM DTT, 1 μM EDTA, and 1 μM PMSF) or cell culture media concentrated using a PD-1 1 column (Pharmacia Biotech/ Amersham Life Science, Chicago. IL) were subjected to SDS-polyacrylamide gel electrophoresis. Gels were blotted onto Immobilon membranes (Millipore, Chicago, IL). Immobilized proteins were then detected with the appropriate antibodies: monoclonal antibody p53Abl against p53 (Oncogene; 0J g/ml final concentration), monoclonal antibody 8E5 against hAPP (Athena Neurosciences. South San Francisco. CA; diluted 1 :2000 in PBS), and monoclonal antibody 22C1 1 against APP (Boehringer: 0J μg/ml final concentration). The target proteins were revealed with the ECL system (Amersham).

F. Electrophoretic mobility shift assay (EMSA).

Nuclear proteins were extracted from cell cultures essentially as described previously (Xu. X.et al. (1994) Mol. Cell. Biol. 14, 5371-5383.). The p53 nuclear binding activities were determined by EMSA using the p53 consensus binding site sequence (5'- AGACATGCCTAGACATGCCT - 3 ^') (SEQ ID NO:01) as a probe. Protein-DNA binding reactions optimized for this probe contained 5 μg of total nuclear protein. 0.5 ng of the radioactive probe. 200 ng of the nonspecific competitor poly (dl-dC), and 1 μg of the p53Abl . which stabilizes the p53-DNA- binding complexes. Mixtures were incubated for 30 min at room temperature in 40 μl of 10 mM Tris-HCl, pH 7.5. 75 mM NaCl. 10 mM EDTA. 7% glycerol. and 1 mM DTT. The free and protein-bound DNA probes were then resolved by polyacrylamide gel electrophoresis. Gels were dried and autoradiographed. For EMSA competition assays, the p53-DNA binding complexes were competed by adding at increasing molar excess either cold probe (see above) or cold probe (5 ' - AGAGATCCCTAGAGATCCCT - 3 ^') (SEQ ID NO:02) carrying point mutations (in bold) that diminish its specific DNA binding activity. G. Luciferase assay.

A p53-responsive luciferase construct (p53Juc) or a p53 -unresponsive luciferase construct (p531uc) (Sun. Y. et al. (1997) Oncogene 14, 385-393.) were transiently cotransfected with hAPP695wt or hAPP695mut into B103 cells. After UV- IR, staurosporine treatment, or infection with p53-rAd, protein extracts were prepared from cells, and luciferase activity was measured with the acetyl-CoA luciferase assay system (Promega). The level of luciferase expression was determined with a luminometer.

II. RESULTS AND DISCUSSION

To assess the antiapoptotic capacity of human APP (hAPP), we transfected hAPP constructs into the rat neuroblastoma cell line B103 (Schubert. D. & Behl, C. (1993) Brain Res. 629. 275-282.). Because this cell line lacks expression of endogenous APP and APP-like proteins, it allows comparison of wild-type and mutant hAPP without interference by rodent APP. Apart from their deficiency in endogenous APP expression. B103 cells share many typical neuronal properties with other commonly used neuronal cell lines in which endogenous APP is expressed, including outgrowth of neurites upon differentiation, synthesis of neurotransmitters, possession of neurotransmitter receptors, and electrical excitability of surface membranes.

A. Comparable Expression of Wild-type versus FAD-mutant hAPP695 in APP- deficient B103 Neuroblastoma Cells.

B103 cells were transfected with a wild-type hAPP695 cDNA construct (hAPP695wt) or a mutant hAPP695 cDNA construct (hAPP695mut) containing a valine-to-isoleucine substitution at amino acid 642 (V642I). The V642I mutation (corresponding to V717I with respect to hAPP770 sequence) was the first hAPP mutation implicated by genetic linkage analysis in the pathogenesis of early onset FAD and. since then, has been identified in at least 16 different families. Similar expression levels of hAPP were detected by western blot analysis in cell lysates and culture media from B103 cultures transfected with hAPP695wt or hAPP695mut. Wild- type and mutant hAPP695 also showed a similar intracellular distribution in transfected B103 cells; APP immunoreactivity was detectable in soma and neurites but not in the nucleus. This expression pattern of transfected hAPP closely resembles the distribution of endogenous APP observed in untransfected primary neurons (Yamazaki. T. et al. (1995) J Cell Biol. 129. 431 -442). hAPP695mut-transfected B103 cells showed no increase in apoptosis compared with mock-transfected and hAPP695wt-transfected B103 cultures.

B. Wild-type but not FAD-mutant hAPP Inhibits Apoptosis Induced by UV or Staurosporine.

To compare the effect of wild-type and mutant hAPP695 on the susceptibility of B 103 cells to apoptosis. we first challenged B 103 cells with two well-established methods of apoptosis induction: UV-IR and staurosporine. The extent of apoptosis in differentiated B 103 cells was measured by DNA laddering, nuclear terminal deoxyribonucleotidyl transferase(TdT)-mediated dUTP nick-end labeling (TUNEL), and ELISA DNA fragmentation analysis. Six hours after UV-IR or staurosporine treatment, mock-transfected B 103 cells showed significantly increased DNA fragmentation and nuclear segmentation consistent with apoptosis. Expression of hAPP695wt, but not of hAPP695mut. in transfected B103 cells substantially inhibited UV- or staurosporine-induced apoptosis. The differential anti-apoptotic capacity of wild-type and mutant hAPP695 was quantitated by two independent methods, namely counting of TUNEL-positive nuclei and measuring levels of fragmented DNA by ELISA. Both approaches yielded comparable results: expression of hAPP695wt decreased the number of cells showing fragmented or condensed TUNEL-positive nuclei by approximately 60% and reduced the level of fragmented DNA by 50%. In contrast, expression of hAPP695mut did not significantly decrease the number of TUNEL-positive nuclei or the level of fragmented DNA, although an inhibitory tendency was seen compared with mock-transfected B 103 cells. Thus, wild-type hAPP695 protects B103 cells against apoptosis induced by UV or staurosporine. V642I-mutant hAPP695 does not.

C. Limited Anti-apoptotic Capacity of Secreted hAPP695.

The B103 cells described above were able to synthesize and secrete hAPP effectively, despite their lack of endogenous APP. It is conceivable that the anti- apoptotic effect of wild-type hAPP is mediated by the large secreted N-terminal ectodomain of hAPP that results from cleavage of APP at the β-secretase site (α-s- APP), since this APP product has previously been shown to protect neurons against excitotoxicity. However, the V642I substitution, which significantly reduced the anti- apoptotic capacity of hAPP, was observed to not affect the production and secretion of α-s-APP. Furthermore, untransfected B103 cells treated with conditioned medium from hAPP695wt-transfected B103 cells or with recombinant hAPP695 (rhAPP695) corresponding to α-s-hAPP (Mattson. et al. (1993) Neuron 10, 243-254.) were significantly less protected against staurosporine-induced apoptosis than hAPP695wt- transfected B103 cells, and were not at all protected against apoptosis induced by UV- IR.

D. Wild-type, but not FAD-mutant. hAPP Effectively Inhibits p53-activation and p53-dependent Transcription after UV or Staurosporine Treatment. We examined whether hAPP695 inhibits critical pro-apoptotic pathways. We focused on the tumor suppressor protein p53, a key transcription factor that targets genes involved in cell-cycle control and apoptosis. In neuron-like cells, latent p53 is retained mainly in the cytoplasm. While the precise mechanisms that convert latent into active p53 have not yet been defined, it is well established that activated p53 translocates into the nucleus, binds to DNA, and upmodulates the expression of diverse target genes. In B 103 cells. UV-IR or staurosporine treatment prominently increased p53 immunoreactivity in the nucleus, indicating nuclear translocation of p53. Consistent with this nuclear translocation of p53. UV-IR or staurosporine also strongly increased specific nuclear p53 DNA-binding activity and p53 -mediated transactivation of a p53 -responsive indicator gene. As in many other cell types, activation of endogenous p53 by UV or staurosporine was associated with apoptosis in B 103 cells, as evidenced by TUNEL, DNA laddering, and cell loss.

To evaluate the impact of wild-type versus FAD-mutant hAPP695 on p53 activation, we compared p53 DNA-binding activity and p53-mediated gene transactivation in mock-. hAPP695wt-. or hAPP695mut-transfected B 103 cells.

Expression of hAPP695wt. but not of hAPP695mut. effectively inhibited p53 DNA- binding activity and p53-mediated transactivation after UV-IR or staurosporine treatment. This differential effect of wild-type and mutant hAPP695 on p53 activation is consistent with their differential effect on apoptosis.

E. Differential Effects of Wild-type versus FAD-mutant hAPP on Apoptosis and Indicator Gene Transactivation Induced Specifically by p53.

Because UV-IR and staurosporine can also cause p53 -independent apoptosis, APP-mediated anti-apoptotic effects and APP-dependent inhibition of p53 activation might be parallel events. To determine if hAPP695 can specifically protect against p53-mediated apoptosis. we used a p53-encoding recombinant adenovirus (p53-rAd) that has previously been shown to elicit apoptosis in primary neuronal cultures to induce apoptosis in B 103 cells. After differentiation, B103 cells were infected with an equal dose of p53-rAd or of a control recombinant adenovirus encoding -galactosidase (LacZ-rAd). p53-rAd infection increased p53 expression in hAPP695wt-transfected and hAPP695mut-transfected B103 cells to similar levels. Expression of hAPP695wt strongly protected B103 cells against p53-induced apoptosis. whereas expression of hAPP695mut did not. These results clearly pinpoint p53 as a prime target for antiapoptotic hAPP functions; they do not exclude potential additional effects of hAPP on other transcription factors.

Wild-type and FAD-mutant forms of hAPP695 were also compared with respect to their ability to inhibit p53-mediated gene transactivation. B103 cells cotransfected with p53Juc and either hAPP695wt or hAPP695mut were infected with p53-rAd or LacZ-rAd. Consistent with the DNA fragmentation analysis, expression of hAPP695wt. but not of hAPP695mut. significantly inhibited p53-mediated transcriptional transactivation of the p53Juc reporter gene. Although the overall expression levels of wildtype and FAD-mutant forms of hAPP695 were comparable in the above experiments, transient transfections do not allow reliable control of hAPP levels in individual cells. To further substantiate the difference in the anti-apoptotic capacity of wildtype versus mutant hAPP. we established two expression-matched sets of B 103 cell lines that were stably transfected to express wildtype or mutant hAPP695 at high or low levels. At both levels of APP expression, wildtype hAPP695 protected B103 cells against p53-mediated apoptosis, whereas mutant hAPP695 did not. The fact that wildtype and mutant hAPP695 differed in their anti-apoptotic capacity over a range of APP expression levels indicates that this difference is robust and that it did not result from minor variations in APP expression levels that may occur in transiently transfected cultures. Another FAD-linked mutation, V642F , also significantly interfered with hAPP's ability to prevent p53-mediated apoptosis and gene transactivation when wild-type and V642F- mutant forms of hAPP were expressed at comparable levels in stably transfected B103 cell lines.

The above demonstrates that wild-type human APP effectively prevents neuronal apoptosis and provides evidence that it does so by inhibiting p53 activation at the posttranslational level. In addition, the above shows that FAD mutations interfere with this APP function.

III. hAPP Mutants

A. The cytoplasmic domain of human APP was modified by deletions or point mutations known to disrupt the interaction of APP with adapter proteins. These mutant forms of APP were expressed in B 103 cells to determine what specific region of APP is required for its antiapoptotic function, and what adapter proteins and interacellular pathways may be involved. The resultant data indicated that deletion of most of the cytoplasmic region of APP eliminates APP's antiapoptotic capacity. Mutation of the putative binding site of the G₀ alpha subunit and/or the Fe65 binding site significantly reduced APP's antiapoptotic activity. In contrast, inhibition of binding with Dabl had no effect, whereas inhibition of binding with XI 1 increased APP's antiapoptotic function. The above results indicate that the interaction of APP's cytoplasmic tail with specific intracellular proteins plays a role in APP's ability to control the proapoptotic p53 pathway.

B. To determine whether the diminished antiapoptotic effect of FAD-mutant hAPP is due to an overproduction of Aβ42. we inhibited Aβ production from FAD- mutant hAPP by replacing a single amino acid adjacent to the β-secretase cleavage site (M596I in hAPP695). In stably transfected B103 cell lines expressing comparable levels of different hAPP constructs. FAD-mutant hAPP was able to effectively inhibit p53-induced apoptosis and p-53 dependent gene transactivation when β-secretase cleavage was inhibited. These results indicate that the poor antiapoptotic function of FAD-mutant hAPP is due to the increased production of Aβ or of closely related hAPP metabolites. The results also indicated that the β-secretase products counteract hAPP's neuroprotective function at or upstream of the p53-induced gene transactivation. Results from experiments indicate that Aβ42 generated in the endoplasmic reticulum (ER) may play a particularly important role in counteracting the antiapoptotic function of hAPP.

It is apparent from the above results and discussion that the subject invention provides for improved methods of preventing p-53 mediated neuronal apoptosis. As such, the subject invention provides for additional targets in the treatment of neurodegenerative disorders, such as Alzheimer's disease. Accordingly, the subject invention provides for a significant advance in the art.

All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method for preventing a cell from undergoing apoptosis. said method comprising: administering to said cell an effective amount of an agent having hAPP anti- p53 apoptotic activity.

2. The method according to Claim 1, wherein said cell is a neuronal cell.

3. The method according to Claim 1. wherein said agent inhibits p53 DNA binding activity.

4. The method according to Claim 1. wherein said agent inhibits p53-mediated gene transactivation.

5. The method according to Claim 1, wherein said agent is wild-type hAPP.

6. The method according to Claim 1 , wherein said agent is a nucleic acid encoding wild-type hAPP.

7. The method according to Claim 1, wherein said agent is an hAPP mimetic.

8. A method for preventing neuronal apoptosis in a host, said method comprising: administering to said host an effective amount of an agent having hAPP anti- p53 apoptotic activity.

9. The method according to Claim 8. wherein said agent inhibits p53 DNA binding activity.

10. The method according to Claim 8. wherein said agent inhibits p53-mediated gene transactivation.

.1").

11. The method according to Claim 8. wherein said agent is wild-type hAPP.

12. The method according to Claim 8, wherein said agent is a nucleic acid encoding wild-type hAPP.

13. The method according to Claim 8, wherein said agent is an hAPP mimetic.

14. A method for treating a host suffering from a disease condition associated with the presence of neuronal apoptosis, said method comprising: administering to said host an effective amount of an agent having hAPP anti- p53 apoptotic activity.

15. The method according to Claim 14, wherein said agent inhibits p53 DNA binding activity.

16. The method according to Claim 14, wherein said agent inhibits p53-mediated gene transactivation.

17. The method according to Claim 14, wherein said agent is wild-type hAPP.

18. The method according to Claim 14, wherein said agent is a nucleic acid encoding wild-type hAPP.

19. The method according to Claim 14, wherein said agent is an hAPP mimetic.

20. The method according to Claim 14, wherein said disease condition is Alzheimer's Disease.

21. A pharmaceutical composition comprising an agent having hAPP anti-p53 apoptotic activity.

22. The pharmaceutical composition according to Claim 21 , wherein said agent is wild-type hAPP.

23. The pharmaceutical composition according to Claim 21. wherein said agent is a nucleic acid encoding wild-type hAPP.

24. The pharmaceutical composition according to Claim 21 , wherein said agent is an hAPP mimetic.