WO2000073320A1 - CHIMIOKINE PROVENANT D'UNE LIBRAIRIE D'ADNc DE TISSU FOETAL HEPATO-SPLENIQUE - Google Patents

CHIMIOKINE PROVENANT D'UNE LIBRAIRIE D'ADNc DE TISSU FOETAL HEPATO-SPLENIQUE Download PDF

Info

Publication number
WO2000073320A1
WO2000073320A1 PCT/US2000/014572 US0014572W WO0073320A1 WO 2000073320 A1 WO2000073320 A1 WO 2000073320A1 US 0014572 W US0014572 W US 0014572W WO 0073320 A1 WO0073320 A1 WO 0073320A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
protein
polynucleotide
sequence
cell
Prior art date
Application number
PCT/US2000/014572
Other languages
English (en)
Inventor
John Ford
George Yeung
Original Assignee
Hyseq Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hyseq Inc. filed Critical Hyseq Inc.
Priority to AU54454/00A priority Critical patent/AU5445400A/en
Publication of WO2000073320A1 publication Critical patent/WO2000073320A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7158—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for chemokines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention provides novel polynucleotides and proteins encoded by such polynucleotides, along with therapeutic, diagnostic and research utihties for these polynucleotides and proteins.
  • chemokine 25 known to have biological activity by virtue of their secreted nature in the case of leader sequence cloning, or by virtue of the cell or tissue source in the case of PCR-based techniques. It is to these proteins and the polynucleotides encoding them that the present invention is directed. In particular, the invention is directed to a novel chemokine.
  • the name "chemokine” is derived from the ability of these proteins to stimulate chemotaxis of leukocytes. Indeed, chemokines comprise the main attractants for inflammatory cells during inflammatory and immune responses. See generally, Baggiolini et al., Advances in Immunology, 55:97-179 (1994).
  • the chemokine superfamily represents a class of small cytokines that recruit a wide range of leukocytes to sites of infection, inflammation and disease. They have been shown to be directly involved in the inflammatory process associated with conditions such as allergies (J Clin
  • Chemokines generally exhibit 20-70% amino acid identity to each other and contain several highly-conserved cysteine residues. Chemokines can be classified into various subclasses or subfamilies by virtue of the position and spacing of a set of conserved cysteines, designated C-X-C (e.g. IL-8), C-C
  • the C-X-C subfamily has the first two conserved cysteines separated by one amino acid, and the genes encoding the C-X-C subfamily are predominantly located on human chromosome 4.
  • the C-C subfamily has two adjacent cysteines, and the genes encoding the C-C subfamily are predominantly located on human chromosome 17.
  • the C subfamily has one of the first two conserved cysteines and the genes encoding the C subfamily are predominantly located on human chromosome 17.
  • compositions of the present invention include novel isolated polypeptides, in particular, novel chemokine polypeptides, isolated polynucleotides encoding such polypeptides, including recombinant DNA molecules, cloned genes or degenerate variants thereof, especially naturally occurring variants such as allelic variants, and antibodies that specifically recognize one or more epitopes present on such polypeptides.
  • compositions of the present invention additionally include vectors, including expression vectors, containing the polynucleotides of the invention, cells genetically engineered to contain such polynucleotides and cells genetically engineered to express such polynucleotides.
  • the isolated polynucleotides of the invention include, but are not limited to, a polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 3.
  • the isolated polynucleotides of the invention further include, but are not limited to a polynucleotide comprising the nucleotide sequence of SEQ ID NOS: 1 2, or nucleotides 261- 641 of SEQ ID NO: 2.
  • the polynucleotides of the present invention still further include, but are not limited to, a polynucleotide comprising the nucleotide sequence of the cDNA insert of clone pl2616HY deposited with the American Type Culture Collection (ATCC; 10801 University Boulevard., Manassas, Virginia, 20110-2209, U.S.A.); a polynucleotide comprising a nucleotide sequence encoding a polypeptide comprising the amino acid sequence encoded by the cDNA insert of clone pl2616HY; a polynucleotide comprising the full length protein coding sequence of SEQ ID NO: 3; a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NO: 3.
  • polynucleotides of the present invention also include, but are not limited to, a polynucleotide that hybridizes to the complement of the nucleotide sequence of SEQ ID NOS:
  • nucleotides 261-641 of SEQ ID NO:2 (the first nucleotide is designated as 1) under stringent hybridization conditions; a polynucleotide which is an allelic variant of any polynucleotide recited above; a polynucleotide which encodes a species homologue of any of the proteins recited above; or a polynucleotide that encodes a polypeptide comprising a specific domain or truncation of the polypeptide of SEQ ID NO: 3.
  • polynucleotides of the invention additionally include the complement of any of the polynucleotides recited above.
  • the isolated polypeptides of the invention include, but are not limited to, a polypeptide comprising the amino acid sequence of SEQ ID NO:3.
  • polypeptides of the present invention further include, but are not limited to, a polypeptide comprising the amino acid sequence encoded by the cDNA insert of clone pl2616HY deposited with the American Type Culture Collection (ATCC; 10801 University
  • Protein compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e.g.. pharmaceutically acceptable, carrier.
  • an acceptable carrier such as a hydrophilic, e.g.. pharmaceutically acceptable, carrier.
  • the invention also relates to methods for producing a polypeptide comprising growing a culture of the cells of the invention in a suitable culture medium, and purifying the protein from the culture.
  • Preferred embodiments include those in which the protein produced by such process is a mature form of the protein.
  • Polynucleotides according to the invention have numerous applications in a variety of techniques known to those skilled in the art of molecular biology. These techniques include use as hybridization probes, use as oligomers for PCR, use for chromosome and gene mapping, use in the recombinant production of protein, and use in generation of anti-sense DNA or RNA, their chemical analogs and the like. For example, when the expression of an mRNA is largely restricted to a particular cell or tissue type, polynucleotides of the invention can be used as hybridization probes to detect the presence of the particular cell or tissue mRNA in a sample using, e.g., in situ hybridization.
  • the polynucleotides are used in diagnostics as expressed sequence tags for identifying expressed genes or, as well known in the art and exemplified by Vollrath et al., Science 258:52-59 (1992). as expressed sequence tags for physical mapping of the human genome.
  • polypeptides according to the invention can be used in a variety of conventional procedures and methods that are currently applied to other proteins.
  • a polypeptide of the invention can be used to generate an antibody that specifically binds the polypeptide.
  • the polypeptides of the invention having ATPase activity are also useful for inhibiting platelet aggregation and can therefore be employed in the prophylaxis or treatment of pathological conditions caused by the inflammatory response.
  • the polypeptides of the invention can also be used as molecular weight markers, and as a food supplement.
  • Methods are also provided for preventing, treating or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of a composition comprising a protein of the present invention and a pharmaceutically acceptable carrier.
  • polypeptides and polynucleotides of the invention can be utilized, for example, as part of methods for modulation of the immune and inflamatory responses, and hematopoiesis.
  • the polypeptides and polynucleotides of the invention may. therefore, be utilized, for example, as part of methods for treatment of allergies, autoimmune disorders, e.g. arthritis, transplantation rejection, tissue repair or wound healing, e.g.. treatment of surgical incisions, and ulcers, such as stomach or diabetic ulcers.
  • the polynucleotides and polypeptides of the invention can further be utilized, for example, as part of methods for the prevention and or treatment of-disorders involving cell fate and differentiation, such as leukemias.
  • the methods of the present invention further relate to methods for detecting the presence of the polynucleotides or polypeptides of the invention in a sample. Such methods can, for example, be utilized as part of prognostic and diagnostic evaluation of disorders as recited above and for the identification of subjects exhibiting a predisposition to such conditions. Furthermore, the invention provides methods for evaluating the efficacy of drugs, and monitoring the progress of patients, involved in clinical trials for the treatment of disorders as recited above.
  • the invention also provides methods for the identification of compounds that modulate the expression of the polynucleotides and/or polypeptides of the invention. Such methods can be utilized, for example, for the identification of compounds that can ameliorate symptoms of disorders as recited above. Such methods can include, but are not limited to, assays for identifying compounds and other substances that interact with (e.g., bind to) the polypeptides of the invention.
  • the methods of the invention also include methods for the treatment of disorders as recited above which may involve the administration of such compounds to individuals exhibiting symptoms or tendencies related to disorders as recited above.
  • the invention encompasses methods for treating diseases or disorders as recited above by administering compounds and other substances that modulate the overall activity of the target gene products. Compounds and other substances can effect such modulation either on the level of target gene expression or target protein activity. 5. BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 shows the sequence alignment of SEQ ID No. 3 with members of two subfamilies of the chemokines.
  • K- Lysine M- Methionine; F- Phenylalanine; P- Proline; S- Serine; T- Threonine; W-
  • RANTES MURRANTES
  • HUMLYMTC Human Lymphotactin
  • FIG. 2 shows the nucleic acid sequences that were obtained from the b HFLS20W cDNA library using standard per, sequencing by hybridization signature analysis, and single pass gel sequencing technology. These sequences are designated as SEQ ID Nos. land 2.
  • SEQ ID Nos. land 2 A- adenosine;
  • FIG. 3 shows the amino acid sequences which correspond to the polynucleotide sequences of SEQ ID No. 2. These sequences are designated as SEQ ID No. 3. A- Alanine; R- Arginine; N-
  • nucleotide sequence refers to a heteropolymer of nucleotides or the sequence of these nucleotides.
  • nucleic acid and polynucleotide are also used interchangeably herein to refer to a heteropolymer of nucleotides.
  • nucleic acid segments provided by this invention may be assembled from fragments of the genome and short oligonucleotide linkers, or from a series of oligonucleotides, or from individual nucleotides, to provide a synthetic nucleic acid which is capable of being expressed in a recombinant transcriptional unit comprising regulatory elements derived from a microbial or viral operon, or a eukaryotic gene.
  • oligonucleotide fragment or a “polynucleotide fragment”, “portion,” or “segment” is a stretch of polypeptide nucleotide residues which is long enough to use in polymerase chain reaction (PCR) or various hybridization procedures to identify or amplify identical or related parts of mRNA or DNA molecules.
  • PCR polymerase chain reaction
  • oligonucleotides or "nucleic acid probes” are prepared based on the polynucleotide sequences provided in the present invention. Oligonucleotides comprise portions of such a polynucleotide sequence having at least about 15 nucleotides and usually at least about 20 nucleotides. Nucleic acid probes comprise portions of such a polynucleotide sequence having fewer nucleotides than about 6 kb, usually fewer than about 1 kb. After appropriate testing to eliminate false positives, these probes may, for example, be used to determine whether specific mRNA molecules are present in a cell or tissue or to isolate similar nucleic acid sequences from chromosomal DNA as described by Walsh et al. (Walsh, P.S. et al., 1992, PCR Methods Appl 1:241-250).
  • probes includes naturally occurring or recombinant or chemically synthesized single- or double-stranded nucleic acids. They may be labeled by nick translation,
  • Probes of the present invention their preparation and/or labeling are elaborated in Sambrook, J. et al., 1989,
  • stringent is used to refer to conditions that are commonly understood in the art as stringent.
  • Stringent conditions can include highly stringent conditions (i.e., hybridization to filter-bound DNA under in 0.5 M NaHPO 4 , 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C, and washing in 0.1xSSC/0J% SDS at 68° C), and moderately stringent conditions
  • additional exemplary stringent hybridization conditions include washing in 6xSSC/0.05% sodium pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base oligos), 55°C (for 20-base oligos), and 60°C (for 23-base oligos).
  • recombinant when used herein to refer to a polypeptide or protein, means that a polypeptide or protein is derived from recombinant (e.g., microbial or mammalian) expression systems.
  • Microbial refers to recombinant polypeptides or proteins made in bacterial or fungal (e.g., yeast) expression systems.
  • "recombinant microbial” defines a polypeptide or protein essentially free of native endogenous substances and unaccompanied by associated native glycosylation.
  • Polypeptides or proteins expressed in most bacterial cultures, e.g.. E. coli, will be free of glycosylation modifications; polypeptides or proteins expressed in yeast will have a glycosylation pattern in general different from those expressed in mammalian cells.
  • recombinant expression vehicle or vector refers to a plasmid or phage or virus or vector, for expressing a polypeptide from a DNA (RNA) sequence.
  • An expression vehicle can comprise a transcriptional unit comprising an assembly of (1) a genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers, (2) a structural or coding sequence which is transcribed into mRNA and translated into protein, and
  • Structural units intended for use in yeast or eukaryotic expression systems preferably include a leader sequence enabling extracellular secretion of translated protein by a host cell.
  • recombinant protein may include an N-terminal methionine residue. This residue may or may not be subsequently cleaved from the expressed recombinant protein to provide a final product.
  • recombinant expression system means host cells which have stably integrated a recombinant transcriptional unit into chromosomal DNA or carry the recombinant transcriptional unit extrachromosomally.
  • Recombinant expression systems as defined herein will express heterologous polypeptides or proteins upon induction of the regulatory elements linked to the DNA segment or synthetic gene to be expressed.
  • This term also means host cells which have stably integrated a recombinant genetic element or elements having a regulatory role in gene expression, for example, promoters or enhancers.
  • Recombinant expression systems as defined herein will express polypeptides or proteins endogenous to the cell upon induction of the regulatory elements linked to the endogenous DNA segment or gene to be expressed.
  • the cells can be prokaryotic or eukaryotic.
  • open reading frame ORF, means a series of nucleotide triplets coding for amino acids without any termination codons and is a sequence translatable into protein.
  • EMF expression modulating fragment
  • EMFs include, but are not limited to, promoters, and promoter modulating sequences (inducible elements).
  • One class of EMFs are fragments which induce the expression or an operably linked
  • ORF in response to a specific regulatory factor or physiological event.
  • an "uptake modulating fragment,” UMF means a series of nucleotides which mediate the uptake of a linked DNA fragment into a cell.
  • UMFs can be readily identified using known UMFs as a target sequence or target motif with the computer-based systems described below.
  • UMF The presence and activity of a UMF can be confirmed by attaching the suspected UMF to a marker sequence.
  • the resulting nucleic acid molecule is then incubated with an appropriate host under appropriate conditions and the uptake of the marker sequence is determined.
  • a UMF will increase the frequency of uptake of a linked marker sequence.
  • active refers to those forms of the polypeptide which retain the biologic and/or immunologic activities of any naturally occurring polypeptide.
  • naturally occurring polypeptide refers to polypeptides produced by cells that have not been genetically engineered and specifically contemplates various polypeptides arising from post-translational modifications of the polypeptide including, but not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation.
  • derivative refers to polypeptides chemically modified by such techniques as ubiquitination, labeling (e.g., with radionuclides or various enzymes), pegylation (derivatization with polyethylene glycol) and insertion or substitution by chemical synthesis of amino acids such as omithine, which do not normally occur in human proteins.
  • recombinant variant refers to any polypeptide differing from naturally occurring polypeptides by amino acid insertions, deletions, and substitutions, created using recombinant DNA techniques.
  • Guidance in determining which amino acid residues may be replaced- added or deleted without abolishing activities of interest, such as cellular trafficking, may be found by comparing the sequence of the particular polypeptide with that of homologous peptides and minimizing the number of amino acid sequence changes made in regions of high homology.
  • amino acid substitutions are the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, i.e., conservative amino acid replacements.
  • Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and or the amphipathic nature of the residues involved.
  • nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine. and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
  • “deletions” are typically in the range of about 1 to 5 amino acids. The variation allowed may be experimentally determined by systematically making insertions, deletions, or substitutions of amino acids in a polypeptide molecule using recombinant DNA techniques and assaying the resulting recombinant variants for activity.
  • insertions, deletions or non- conservative alterations can be engineered to produce altered polypeptides.
  • Such alterations can, for example, alter one or more of the biological functions or biochemical characteristics of the polypeptides of the invention.
  • such alterations may change polypeptide characteristics such as ligand-binding affinities, interchain affinities, or degradation/turnover rate.
  • such alterations can be selected so as to generate polypeptides that are better suited for expression, scale up and the like in the host cells chosen for expression.
  • cysteine residues can be deleted or substituted with another amino acid residue in order to eliminate disulfide bridges.
  • substantially equivalent can refer both to nucleotide and amino acid sequences, for example a mutant sequence, that varies from a reference sequence by one or more substitutions, deletions, or additions, the net effect of which does not result in an adverse functional dissimilarity between the reference and subject sequences.
  • a substantially equivalent sequence varies from one of those listed herein by no more than about 20% (i.e.. the number of individual residue substitutions, additions, and/or deletions in a substantially equivalent sequence, as compared to the corresponding reference sequence, divided by the total number of residues in the substantially equivalent sequence is about 0.2 or less).
  • Such a sequence is said to have 80% sequence identity to the listed sequence.
  • a substantially equivalent, e.g., mutant, sequence of the invention varies from a listed sequence by no more than 10% (90% sequence identity); in a variation of this embodiment, by no more than -5% (95% sequence identity); and in a further variation of this embodiment, by no more than 2% (98% sequence identity).
  • Substantially equivalent, e.g., mutant, amino acid sequences according to the invention generally have at least 95% sequence identity with a listed amino acid sequence, whereas substantially equivalent nucleotide sequence of the invention can have lower percent sequence identities, taking into account, for example, the redundancy or degeneracy of the genetic code.
  • sequences having substantially equivalent biological activity and substantially equivalent expression characteristics are considered substantially equivalent.
  • truncation of the mature sequence e.g., via a mutation which creates a spurious stop codon
  • nucleic acid sequences encoding such substantially equivalent sequences can routinely be isolated and identified via standard hybridization procedures well known to those of skill in the art.
  • an expression vector may be designed to contain a "signal or leader sequence" which will direct the polypeptide through the membrane of a cell.
  • a signal or leader sequence may be naturally present on the polypeptides of the present invention or provided from heterologous protein sources by recombinant DNA techniques.
  • a polypeptide "fragment,” “portion,” or “segment” is a stretch of amino acid residues of at least about 5 amino acids, often at least about 7 amino acids, typically at least about 9 to 13 amino acids, and, in various embodiments, at least about 17 or more amino acids. To be active, any polypeptide must have sufficient length to display biologic and/or immunologic activity.
  • recombinant variants encoding these same or similar polypeptides may be synthesized or selected by making use of the "redundancy" in the genetic code.
  • Various codon substitutions such as the silent changes which produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system.
  • Mutations in the polynucleotide sequence may be reflected in the polypeptide or domains of other peptides added to the polypeptide to modify the properties of any part of the polypeptide, to change characteristics such as ligand-binding affinities, interchain affinities, or degradation/turnover rate.
  • activated cells are those which are engaged in extracellular or intracellular membrane trafficking, including the export of neurosecretory or enzymatic molecules as part of a normal or disease process.
  • purified denotes that the indicated nucleic acid or polypeptide is present in the substantial absence of other biological macromolecules, e.g., polynucleotides, proteins, and the like.
  • the polynucleotide or polypeptide is purified such that it constitutes at least 95% by weight, more preferably at least 99.8% by weight, of the indicated biological macromolecules present (but water, buffers, and other small molecules, especially molecules having a molecular weight of less than 1000 daltons, can be present).
  • isolated refers to a nucleic acid or polypeptide separated from at least one other component (e.g., nucleic acid or polypeptide) present with the nucleic acid or polypeptide in its natural source.
  • the nucleic acid or polypeptide is found in the presence of (if anything) only a solvent, buffer, ion, or other component normally present in a solution of the same.
  • isolated and purified do not encompass nucleic acids or polypeptides present in their natural source.
  • infection refers to the introduction of nucleic acids into a suitable host cell by use of a virus or viral vector.
  • transformation means introducing DNA into a suitable host cell so that the
  • DNA is replicable, either as an extrachromosomal element, or by chromosomal integration.
  • transfection refers to the taking up of an expression vector by a suitable host cell, whether or not any coding sequences are in fact expressed.
  • intermediate fragment means a nucleic acid between 5 and 1000 bases in length, and preferably between 10 and 40 bp in length.
  • secreted protein includes a protein that is transported across or through a membrane, including transport as a result of signal sequences in its amino acid sequence when it is expressed in a suitable host cell.
  • Stecreted proteins also includes without limitation proteins secreted wholly (e.g., soluble proteins) or partially (e.g., receptors) from the cell in which they are expressed.
  • “Secreted” proteins also include without limitation proteins which are transported across the membrane of the endoplasmic reticulum.
  • Stecreted” proteins are also intended to include proteins containing non-typical signal sequences (e.g.
  • Interleukin-1 Beta see Krasney, P.A. and Young, P.R. (1992) Cytokine 4(2): 134 -143) and factors released from damaged cells (e.g. Interleukin-1 Receptor Antagonist, see Arend, W.P. et. al. (1998) Annu.
  • Fragments of the proteins of the present invention which are capable of exhibiting biological activity are also encompassed by the present invention. Fragments of the protein may be in linear form or they may be cyclized using known methods, for example, as described in H. U. Saragovi, et al.,
  • fragments may be fused to carrier molecules such as immunoglobulins for many purposes, including increasing the valency of protein binding sites.
  • fragments of the protein may be fused through "linker" sequences to the Fc portion of an immunoglobulin.
  • linker For a bivalent form of the protein, such a fusion could be to the Fc portion of an IgG molecule.
  • Other immunoglobulin isotypes may also be used to generate such fusions.
  • a protein-IgM fusion would generate a decavalent form of the protein of the invention.
  • the present invention also provides both full-length and mature forms (e.g. without a signal sequence) of the disclosed proteins.
  • the full-length form of the such proteins is identified in the sequence listing by translation of the nucleotide sequence of each disclosed clone.
  • the mature form of such protein may be obtained by expression of the disclosed full- length polynucleotide (for example, obtained from using the clones deposited with ATCC using standard techniques) in a suitable mammalian cell or other host cell.
  • the sequence of the mature form of the protein is also determinable from the amino acid sequence of the full-length form.
  • the present invention also provides genes corresponding to the cDNA sequences disclosed herein.
  • the corresponding genes can be isolated in accordance with known methods using the sequence information disclosed herein. Such methods include the preparation of probes or primers from the disclosed sequence information for identification and/or amplification of genes in appropriate genomic libraries or other sources of genomic materials.
  • the present invention also provides for soluble forms of such protein.
  • part or all of the domains of the protein causing the protein to be membrane bound are deleted such that the protein is fully secreted from the cell in which it is expressed.
  • Species homologs of the disclosed polynucleotides and proteins are also provided by the present invention. Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.
  • the invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotide which also encode proteins which are identical, homologous or related to that encoded by the polynucleotides.
  • compositions of the present invention include isolated polynucleotides, including recombinant DNA molecules, cloned genes or degenerate variants thereof, especially naturally occurring variants such as allelic variants, novel isolated polypeptides, and antibodies that specifically recognize one or more epitopes present on such polypeptides.
  • Species homologs of the disclosed polynucleotides and proteins are also provided by the present invention. Species homologs may be isolated and identified by making suitable probes or primers from the sequences provided herein and screening a suitable nucleic acid source from the desired species.
  • the invention also encompasses allelic variants of the disclosed polynucleotides or proteins; that is, naturally-occurring alternative forms of the isolated polynucleotide which also encode proteins which are identical, homologous or related to that encoded by the polynucleotides.
  • SEQ ID No. 2 encodes the polypeptide sequence of SEQ ID No. 3.
  • the content and position of certain highly conserved amino acid residues identifies SEQ ID No. 3 as a member of the chemokine family.
  • Figure 1 presents an alignment of CC and C types of chemokines.
  • SEQ ID No. 3 has features common to both types but has differences significant enough to classify it as a new subfamily type. While SEQ ID No. 3 has only a C motif in the first cysteine position, it has a total of four conserved cysteines, a feature found only in the CC and
  • SEQ ID No. 2 represents a novel subtype of chemokine, with features of both C and CC types of chemokines.
  • a BLAST search revealed that SEQ ID No. 2 has significant homology (greater than 70% identity over a 100 nucleotide stretch) with a genomic fragment of chromosome 17.
  • SEQ ID No. 2 and possibly other subfamily members are situated on this chromosome. Since both the C and CC subtypes of chemokines are located on the same chromosome, perhaps this novel chemokine is physically linked to two of the other subtypes of chemokines.
  • a start codon is located at nucleotides 261-263 of SEQ ID NO: 2 and a stop codon at nucleotides 639-641 of SEQ ID NO: 2
  • Chemokines have been shown to be directly involved in the inflammatory process associated with conditions such as allergies (J Clin Invest 1997 Oct 1;100(7): 1657-1666 Teixeira
  • Chemokines are potent stimulants of neutrophils causing rapid shape change, chemotaxis, respiratory bursts, and degranulation. Chemokines are also known to be potent chemoattractantsfor a variety of blood cell components, including monocytes, eosinophils, and T-lymphocytes.
  • Chemokines have also been used in medical imaging, e.g., for imaging the site of infection, inflammation, and other sites having chemokine receptor molecules. Additionally , the established correlation between chemokine expression and inflammatory conditions and disease states provides diagnostic and prognostic indications for the use of chemokines. Chemokines promote the healing of wounds and/or the speed of recovery from conditions where inflammation is important to eradication of infection, such as, for example, pneumonia. Conversely, inhibition of inflammation is important in pathological conditions caused by the inflammatory response.
  • novel chemokines of the invention will facilitate the diagnosis and prognosis of these indications, and the modulation of the inflammatory and immune responses.
  • One example of this is found, for e.g., in a report by Gong et al, J. Exp. Med. 186:131-137 (1997), where agonists to a chemokine (MCP-1) were used to inhibit arthritis in a mouse model system.
  • the chemokines of the invention are also useful for making antibody substances that are specifically immunoreactive with chemokines.
  • Antibodies and other small molecules which bind to the chemokines of the invention can act as blocking agents, or as activators.
  • Chemokines have also been shown to regulate proliferation and/or differentiation of hematopoietic stem and progenitor cells in vitro and in vivo.
  • the novel chemokines of the invention are useful in methods of treating neutropenia caused by, for example, chemotherapy-or radiation treatments.
  • the novel chemokines of the invention are also useful in new methods for screening and treating patients with certain myelogenous leukemias as well as other hyperproliferativeblood diseases.
  • the novel chemokines can be used to identify, purify, and expand progenitor-specificcell populations in an ex vivo setting for re-introduction into a patient following radiation or chemotherapy.
  • the subclass of progenitor cells that respond to the presence of chemokines has been shown to include a cell population which contains the cell surface marker CD34. Therefore, the novel chemokine polypeptides can be used as diagnostic agents to identify CD34 + progenitor cells in a sample population. For example, a solid substrate or matrix coated with a novel chemokine polypeptide can be used to separate out cells that are responsive to the protein from a sample of cells removed from a patient. After culturing or expansion of these CD34 + cells ex vivo, these cells can be re-introduced into the patient following transplant, chemotherapy, or radiation therapy.
  • novel chemokine polypeptides of the invention can be administered as adjunctive agents before and/or during chemotherapy or radiation therapy to protect myeloid progenitor cells from the cytotoxic effects of the chemotherapeutic agents or radiation.
  • the novel proteins place myeloid cells into a myeloprotected, slow-cycling state, thereby inhibiting or decreasing cell damage that could otherwise be caused by cell-cycle active chemotherapy drugs such as cytosine arabinoside, 5-fluorouracil,or hydroxyurea.
  • cell-cycle active chemotherapy drugs such as cytosine arabinoside, 5-fluorouracil,or hydroxyurea.
  • the use of the novel proteins also permits the administration of higher doses of chemotherapeutics without compromising the ability of the patient to generate mature functional blood cells.
  • 0.01 mu g per animal is preferred. This translates into a dosage of approximately 0.5 to 500 mu g/kg. Assuming the average human patient weighs 70 kgs, the effective amount for a human would be approximately 0.035 to 35.0 mg. Thus, a suitable dosage for therapy in a human patient would be in the range of about 0.035 to 35.0 mg, with a preferred range of about 0.5 to 5 mg.
  • the novel chemokine polypeptides are useful for inhibiting hyperproliferative myeloid based diseases such as chronic myelogenous leukemia, polycythemiavera, and hypermegakaryocytopoieticdisorders. Hyperproliferative states in such disorders occur because the progenitor cells are unable to negatively regulate cell growth and replication.
  • Administration of the novel chemokine polypeptides inhibits cell replication resulting in the inhibition of the abnormal cell growth. Dosages of chemokine polypeptides for treating hyperproliferative myeloid based diseases would be similar to those dosages described above for use of the proteins as adjuncts to chemotherapy.
  • novel chemokine polypeptides also can be used to prevent myeloid progenitor cells from becoming leukemic as the result of the administration of chemotherapeutic agents.
  • the chemokine polypeptides are administered in the same way described above.
  • the isolated polynucleotides of the invention include, but are not limited to polynucleotides encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 3 as well as polynucleotides which encode specific domains thereof.
  • the isolated polynucleotides of the invention include, but are not limited to, a polynucleotide comprising the nucleotide sequence of SEQ ID NOJ, 2 or nucleotides 261-641 of SEQ ID NO: 2.
  • the polynucleotides of the present invention still further include, but are not limited to, a polynucleotide comprising the nucleotide sequence of the cDNA insert of clone pl2616HY; a polynucleotide comprising the nucleotide sequence encoding a polypeptide comprising the amino acid sequence encoded by the cDNA insert of clone pl2616HY; a polynucleotide comprising the full length protein coding sequence of SEQ ID NO: 3 which polynucleotide comprises the cDNA insert of -clone pl2616HY, or; a polynucleotide comprising the nucleotide sequence of the mature protein coding sequence of SEQ ID NO: 3 which polynucleotide comprises the cDNA insert of clone pl2616HY.
  • polynucleotides of the present invention also include, but are not limited to, a polynucleotide that hybridizes to the complement of the nucleotide sequence of SEQ ID NO: 1
  • nucleotides 261-641 of SEQ ID NO: 2 under stringent hybridization conditions; a polynucleotide which is an allelic variant of any polynucleotide recited above; a polynucleotide which encodes a species homologue of any of the proteins recited above; or a polynucleotide that encodes a polypeptide comprising an additional specific domain or truncation of the polypeptide of SEQ ID NO: 3.
  • polynucleotides of the invention additionally include the complement of any of the polynucleotides recited above.
  • polynucleotides of the invention also provide polynucleotides including nucleotide sequences that are substantially equivalent to the polynucleotides recited above.
  • Polynucleotides according to the invention can have at least about 80%, more typically at least about 90%), and even more typically at least about 95%, sequence identity to a polynucleotide recited above.
  • the invention also provides the complement of the polynucleotides including a nucleotide sequence that has at least about 80%, more typically at least about 90%, and even more typically at least about 95%, sequence identity to a polynucleotide encoding a polypeptide recited above.
  • the polynucleotide can be DNA (genomic, cDNA, amplified, or synthetic) or
  • RNA RNA.
  • Methods and algorithms for obtaining such polynucleotides are well known to those of skill in the art and can include, for example, methods for determining hybridization conditions which can routinely isolate polynucleotides of the desired sequence identities.
  • a polynucleotide according to the invention can be joined to any of a variety of other nucleotide sequences by well-established recombinant DNA techniques (see Sambrook J et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, NY).
  • nucleotide sequences for joining to polypeptides include an assortment of vectors, e.g., plasmids, cosmids, lambda phage derivatives, phagemids, and the like, that are well known in the art. Accordingly, the invention also provides a vector including a polynucleotide of the invention and a host cell containing the polynucleotide. In general, the vector contains an origin of replication functional- in at least one organism,. convenient restriction endonuclease sites, and a selectable marker for the host cell.
  • Vectors according to the invention include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.
  • a host cell according to the invention can be a prokaryotic or eukaryotic cell and can be a unicellular organism or part of a multicellular organism.
  • sequences falling within the scope of the present invention are not limited to the specific sequences herein described, but also include allelic variations thereof. Allelic variations can be routinely determined by comparing the sequence provided in SEQ ID NOSJ,
  • the invention includes nucleic acid molecules coding for the same amino acid sequences as do the specific ORFs disclosed herein. In other words, in the coding region of an
  • ORF substitution of one codon for another which encodes the same amino acid is expressly contemplated. Any specific sequence disclosed herein can be readily screened for errors by resequencing a particular fragment, such as an ORF, in both directions (i.e., sequence both strands).
  • the present invention further provides recombinant constructs comprising a nucleic acid having the sequence of SEQ ID NOSJ, 2 or nucleotides 261 - 641 of SEQ ID NO: 2, or a fragment thereof.
  • the recombinant constructs of the present invention comprise a vector, such as a plasmid or viral vector, into which a nucleic acid having the sequence of SEQ ID NOSJ , 2 or nucleotides 261 - 641 of SEQ ID NO: 2, or a fragment thereof is inserted, in a forward or reverse orientation.
  • the vector may further comprise regulatory sequences, including for example, a promoter, operably linked to the ORF.
  • the vector may further comprise a marker sequence or heterologous ORF operably linked to the EMF or UMF.
  • a marker sequence or heterologous ORF operably linked to the EMF or UMF.
  • Bacterial Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNHl ⁇ a, pNH18a, pNH46a (Stratagene); pTrc99A, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLneo, pSV2cat, pOG44, PXTI, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia).
  • the isolated polynucleotide of the invention may be operably linked to an expression control sequence such as the pMT2 or pED expression vectors disclosed in Kaufman et al.,
  • operably linked means that the isolated polynucleotide of the invention and an expression control sequence are situated within a vector or cell in such a way that the protein is expressed by a host cell which has been transformed
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , and trc.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retro virus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor. acid phosphatase, or heat shock proteins, among others.
  • PGK 3-phosphoglycerate kinase
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine
  • pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced or derepressed by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.
  • nucleic acid sequences of the invention include nucleic acid sequences that hybridize under stringent conditions to a fragment of the DNA sequences in Figure 2 or its complement, which fragment is greater than about 10 bp, preferably 20-50 bp, and even greater than 100 bp.
  • polynucleotide sequences which encode the novel nucleic acids, or functional equivalents thereof may be used to generate recombinant DNA molecules that direct the expression of that nucleic acid, or a functional equivalent thereof, in appropriate host cells.
  • the nucleic acid sequences of the invention are further directed to sequences which encode variants of the described nucleic acids.
  • These amino acid sequence variants may be prepared by methods known in the art by introducing appropriate nucleotide changes into a native or variant polynucleotide. There are two variables in the construction of amino acid sequence variants: the location of the mutation and the nature of the mutation.
  • the amino acid sequence variants of the nucleic acids are preferably constructed by mutating the polynucleotide to give an amino acid sequence that does not occur in nature. These amino acid alterations can be made at sites that differ in the nucleic acids from different species (variable positions) or in highly conserved regions (constant regions).
  • Sites at such locations will typically be modified in series, e.g., by substituting first with conservative choices (e.g., hydrophobic amino acid to a different hydrophobic amino acid) and then with more distant choices (e.g., hydrophobic amino acid to a charged amino acid), and then deletions or insertions may be made at the target site.
  • Amino acid sequence deletions generally range from about 1 to
  • Amino acid insertions include amino- and/or carboxyl-terminal fusions ranging in length from one to one hundred or more residues, as well as intrasequence insertions of single or multiple amino acid residues. Intrasequence insertions may range generally from about 1 to 10 amino residues, preferably from 1 to 5 residues. Examples of terminal insertions include the heterologous signal sequences necessary for secretion or for intracellular targeting in different host cells.
  • polynucleotides encoding the novel nucleic acids are changed via site-directed mutagenesis.
  • This method uses oligonucleotide sequences that encode the polynucleotide sequence of the desired amino acid variant, as well as a sufficient adjacent nucleotide on both sides of the changed amino acid to form a stable duplex on either side of the site of being changed.
  • site-directed mutagenesis is well known to those of skill in the art and this technique is exemplified by publications such as, Edelman et al., DNA 2:183 (1983).
  • a versatile and efficient method for producing site-specific changes in a polynucleotide sequence was published by Zoller and Smith, Nucleic Acids Res.
  • PCR may also be used to create amino acid sequence variants of the novel nucleic acids.
  • primer(s) that differs slightly in sequence from the corresponding region in the template DNA can generate the desired amino acid variant.
  • PCR amplification results in a population of product
  • a further technique for generating amino acid variants is the cassette mutagenesis technique described in Wells et al. Gene 34:315 (1985); and other mutagenesis techniques well known in the art, such as, for example, the techniques in Sambrook et al, supra, and Current
  • DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may be used in the practice of the invention for the cloning and expression of these novel nucleic acids.
  • DNA sequences include those which are capable of hybridizing to the appropriate novel nucleic acid sequence under stringent conditions.
  • the present invention further provides host cells genetically engineered to contain the polynucleotides of the invention.
  • host cells may contain nucleic acids of the invention introduced into the host cell using known transformation, transfection or infection methods.
  • the present invention still further provides host cells genetically engineered to express the polynucleotides of the invention, wherein such polynucleotides are in operative association with a regulatory sequence heterologous to the host cell which drives expression of the polynucleotides in the cell.
  • the host cell can be a higher eukaryotic host cell, such as a mammalian cell, a lower eukaryotic host cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the recombinant construct into the host cell can be effected by calcium phosphate transfection, DEAE, dextran mediated transfection, or electroporation
  • the host cells containing one of polynucleotides of the invention can be used in conventional manners to produce the gene product encoded by the isolated fragment (in the case of an ORF) or can be used to produce a heterologous protein under the control of the EMF.
  • Any host vector system can be used to express one or more of the ORFs of the present invention.
  • These include, but are not limited to, eukaryotic hosts such as HeLa cells, Cv-1 cell,
  • COS cells COS cells, and Sf9 cells, as well as prokaryotic host such as E coU and R subtilis.
  • the most preferred cells are those which do not normally express the particular polypeptide or protein or which expresses the polypeptide or protein at low natural level.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using
  • RNAs derived from the DNA constructs of the present invention are described by Sambrook, et al, in Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, New
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 25:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell tines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences.
  • DNA sequences derived from the SV40 viral genome for example, SV40 origin, early promoter, enhancer, splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • Recombinant polypeptides and proteins produced in bacterial culture are usually isolated by initial extraction from cell pellets, followed by one or more salting-out, aqueous ion exchange or size exclusion chromatography steps. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.
  • HPLC high performance liquid chromatography
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents.
  • Mammalian host cells include, for example, monkey COS cells, Chinese Hamster Ovary
  • CHO human kidney 293 cells, human epidermal A431 cells, human Colo205 cells, 3T3 cells, CV-1 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro culture of primary tissue, primary explants, HeLa cells, mouse L cells, BHK, HL-
  • yeast in lower eukaryotes such as yeast or in prokaryotes such as bacteria.
  • yeast strains include
  • Saccharomyces cerevisiae Schizosaccharomyces pombe, Kluyveromyces strains, Candida, or any yeast strain capable of expressing heterologous proteins.
  • Potentially suitable bacterial strains include Escherichia coli, Bacillus subtilis, Salmonella typhimurium, or any bacterial strain capable of expressing heterologous proteins. If the protein is made in yeast or bacteria, it may be necessary to modify the protein produced therein, for example by phosphorylation or glycosylation of the appropriate sites, in order to obtain the functional protein. Such covalent attachments may be accomplished using known chemical or enzymatic methods.
  • cells and tissues may be engineered to express an endogenous gene comprising the polynucleotides of the invention under the control of inducible regulatory elements, in which case the regulatory sequences of the endogenous gene may be replaced by homologous recombination.
  • gene targeting can be used to replace a gene's existing regulatory region with a regulatory sequence isolated from a different gene or a novel regulatory sequence synthesized by genetic engineering methods.
  • Such regulatory sequences may be comprised of promoters, enhancers, scaffold-attachment regions, negative regulatory elements, transcriptional initiation sites, regulatory protein binding sites or combinations of said sequences.
  • sequences which affect the structure or stability of the RNA or protein produced may be replaced, removed, added, or otherwise modified by targeting, including polyadenylation signals.
  • the targeting event may be a simple insertion of the regulatory sequence, placing the gene under the control of the new regulatory sequence, e.g., inserting a new promoter or enhancer or both upstream of a gene.
  • the targeting event may be a simple deletion of a regulatory element, such as the deletion of a tissue-specific negative regulatory element.
  • the targeting event may replace an existing element; for example, a tissue-specific enhancer can be replaced by an enhancer that has broader or different cell-type specificity than the naturally occurring elements.
  • the naturally occurring sequences are deleted and new sequences are added.
  • the identification of the targeting event may be facilitated by the use of one or more selectable marker genes that are contiguous with the targeting DNA, allowing for the selection of cells in which the exogenous DNA has integrated into the host cell genome.
  • the identification of the targeting event may also be facilitated by the use of one or more marker genes exhibiting the property of negative selection, such that the negatively selectable marker is linked to the exogenous DNA, but configured such that the negatively selectable marker flanks the targeting sequence, and such that a correct homologous recombination event with sequences in the host cell genome does not result in the stable integration of the negatively selectable marker.
  • Markers useful for this purpose include the
  • TK Herpes Simplex Virus thymidine kinase
  • gpt bacterial xanthine-guanine phosphoribosyl-transferase
  • the isolated polypeptides of the invention include, but are not limited to, a polypeptide comprising the amino acid sequence of SEQ ID NO:3.
  • the polypeptides of the invention further include polypeptides which comprise one or more specific domains of the amino acid sequence in SEQ ID NO: 3.
  • polypeptides of the present invention further include, but are not limited to, a polypeptide comprising the amino acid sequence encoded by the cDNA insert of clone pl2616HY deposited with the American Type Culture Collection (ATCC; 10801 University Boulevard., Manassas, Virginia, 201 10-2209, U.S.A.); a full length protein coding sequence of SEQ ID NO: 3 comprising the cDNA insert of clone pl2616HY; a mature protein coding sequence of SEQ ID NO: 3 comprising the cDNA insert of clone pl2616HY.
  • ATCC American Type Culture Collection
  • Protein compositions of the present invention may further comprise an acceptable carrier, such as a hydrophilic, e.g., pharmaceutically acceptable, earner.
  • an acceptable carrier such as a hydrophilic, e.g., pharmaceutically acceptable, earner.
  • the invention also relates to methods for producing a polypeptide comprising growing a culture of the cells of the invention in a suitable culture medium, and purifying the protein from the culture.
  • the methods of the invention include a process for producing a polypeptide in which a host cell containing a suitable expression vector that includes a polynucleotide of the invention is cultured under conditions that allow expression of the encoded polypeptide.
  • the polypeptide can be recovered from the culture, conveniently from the culture medium, and further purified.
  • Prefened embodiments include those in which the protein produced by such process is a full length or mature form of the protein.
  • the invention further provides a polypeptide including an amino acid sequence that is substantially equivalent to SEQ ID NOS: 3.
  • Polypeptides according to the invention can have at least about 95%, and more typically at least about 98%, sequence identity to SEQ ID NO: 3.
  • the present invention further provides isolated polypeptides encoded by the nucleic acid fragments of the present invention or by degenerate variants of the nucleic acid fragments of the present invention.
  • degenerate variant is intended nucleotide fragments which differ from a nucleic acid fragment of the present invention (e.g., an ORF) by nucleotide sequence but, due to the degeneracy of the genetic code, encode an identical polypeptide sequence.
  • Preferred nucleic acid fragments of the present invention are the ORFs that encode proteins.
  • a variety of methodologies known in the art can be utilized to obtain any one of the isolated polypeptides or proteins of the present invention.
  • the amino acid sequence can be synthesized using commercially available peptide synthesizers. This is particularly useful in producing small peptides and fragments of larger polypeptides.
  • Fragments are useful, for example, in generating antibodies against the native polypeptide.
  • the polypeptide or protein is purified from bacterial cells which naturally produce the polypeptide or protein.
  • One skilled in the art can readily follow known methods for isolating polypeptides and proteins in order to obtain one of the isolated polypeptides or proteins of the present invention. These include, but are not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-exchange chromatography, and immuno-affinity chromatography. See, e.g., Scopes, Protein
  • polypeptides and proteins of the present invention can alternatively be purified from cells which have been altered to express the desired polypeptide or protein.
  • a cell is said to be altered to express a desired polypeptide or protein when the cell, through genetic manipulation, is made to produce a polypeptide or protein which it normally does not produce or which the cell normally produces at a lower level.
  • One skilled in the art can readily adapt procedures for introducing and expressing either recombinant or synthetic sequences into eukaryotic or prokaryotic cells in order to generate a cell which produces one of the polypeptides or proteins of the present invention.
  • the purified polypeptides can be used in in vitro binding assays which are well known in the art to identify molecules which bind to the polypeptides.
  • These molecules include but are not limited to, for e.g., small molecules, molecules from combinatorial libraries, antibodies or other proteins.
  • the molecules identified in the binding assay are then tested for antagonist or agonist activity in in vivo tissue culture or animal models that are well known in the art. In brief, the molecules are titrated into a plurality of cell cultures or animals and then tested for either cell/animal death or prolonged survival of the animal/cells.
  • binding molecules may be complexed with toxins, e.g., ricin or cholera, or with other compounds that are toxic to cells.
  • toxins e.g., ricin or cholera
  • the toxin-binding molecule complex is then targeted to a tumor or other cell by the specificity of the binding molecule for SEQ ID NOS: 3.
  • the protein of the invention may also be expressed as a product of transgenic animals, e.g., as a component of the milk of transgenic cows, goats, pigs, or sheep which are characterized by somatic or germ cells containing a nucleotide sequence encoding the protein.
  • the protein may also be produced by known conventional chemical synthesis. Methods for constructing the proteins of the present invention by synthetic means are known to those skilled in the art.
  • the synthetically-constructed protein sequences by virtue of sharing primary, secondary or tertiary structural and/or conformational characteristics with proteins may possess biological properties in common therewith, including protein activity. Thus, they may be employed as biologically active or immunological substitutes for natural, purified proteins in screening of therapeutic compounds and in immunological processes for the development of antibodies.
  • the proteins provided herein also include proteins characterized by amino acid sequences similar to those of purified proteins but into which modification are naturally provided or deliberately engineered.
  • modifications in the peptide or DNA sequences can be made by those skilled in the art using known techniques.
  • Modifications of interest in the protein sequences may include the alteration, substitution, replacement, insertion or deletion of a selected amino acid residue in the coding sequence.
  • one or more of the cysteine residues may be deleted or replaced with another amino acid to alter the conformation of the molecule.
  • Techniques for such alteration, substitution, replacement, insertion or deletion are well known to those skilled in the art (see, e.g., U.S. Pat. No.
  • the protein may also be produced by operably linking the isolated polynucleotide of the invention to suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • suitable control sequences in one or more insect expression vectors, and employing an insect expression system.
  • Materials and methods for baculovirus/insect cell expression systems are commercially available in kit form from, e.g., Invitrogen, San Diego, Calif, U.S.A.
  • an insect cell capable of expressing a polynucleotide of the present invention is "transformed.”
  • the protein of the invention may be prepared by culturing transformed host cells under culture conditions suitable to express the recombinant protein.
  • the resulting expressed protein may then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography.
  • the purification of the protein may also include an affinity column containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, heparin- toyopearl.RTM. or Cibacrom blue 3GA Sepharose.RTM.; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; or immunoaffinity chromatography.
  • the protein of the invention may also be expressed in a form which will facilitate purification.
  • it may be expressed as a fusion protein, such as those of maltose binding protein (MBP), glutathione-S-transferase (GST) or thioredoxin (TRX). Kits for expression and purification of such fusion proteins are commercially available from New York.
  • the protein can also be tagged with an epitope and subsequently purified by using a specific antibody directed to such epitope.
  • an epitope is commercially available from
  • HPLC steps employing hydrophobic RP-HPLC media, e.g., silica gel having pendant methyl or other aliphatic groups, can be employed to further purify the protein.
  • Some or all of the foregoing purification steps, in various combinations, can also be employed to provide a substantially homogeneous isolated recombinant protein.
  • the protein thus purified is substantially free of other mammalian proteins and is defined in accordance with the present invention as an "isolated protein.
  • polypeptide sequences encoded by SEQ ID No. 3 have numerous applications in techniques known to those skilled in the art of molecular biology.
  • the polypeptides of the . invention are related to the chemokine family of proteins as demonstrated by the highly-conserved cysteine residues of this family.
  • the polypeptides of the invention and/or their agonists and antagonists are useful in methods for preventing neutropenia, preventing or augmenting inflammatory or other immune responses, and inhibiting diseased states associated with the hyperproliferative states of progenitor cells.
  • the polypeptides of the invention may also be used to generate antibodies for diagnosis or therapy of activated or inflamed cells and/or tissues.
  • pl2616HY was deposited with the American Type Culture
  • the 753 base pair cDNA insert of clone pl2616HY is contained in vector pT7T3Pac
  • the 3' end of the cDNA is at the EcoRI site of the vector.
  • the clone represent a plasmid clone as described in the Examples set forth below.
  • polynucleotides and proteins of the present invention are expected to exhibit one or more of the uses or biological activities (including those associated with assays cited herein) identified below.
  • Uses or activities described for proteins of the present invention may be provided by administration or use of such proteins or by administration or use of polynucleotides encoding such proteins (such as, for example, in gene therapies or vectors suitable for introduction of DNA).
  • the polynucleotides provided by the present invention can be used by the research community for various purposes.
  • the polynucleotides can be used to express recombinant protein for analysis, characterization or therapeutic use; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in disease states); as molecular weight markers on Southern gels; as chromosome markers or tags (when labeled) to identify chromosomes or to map related gene positions; to compare with endogenous DNA sequences in patients to identify potential genetic disorders; as probes to hybridize and thus discover novel, related DNA sequences; as a source of information to derive PCR primers for genetic fingerprinting; as a probe to "subtract-out" known sequences in the process of discovering other novel polynucleotides; for selecting and making oligomers for attachment to a "gene chip” or other support, including for examination of expression patterns; to raise anti-protein antibodies using
  • polynucleotide encodes a protein which binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction)
  • the polynucleotide can also be used in interaction trap assays (such as, for example, that described in Gyuris et al.,
  • the proteins provided by the present invention can similarly be used in assay to determine biological activity, including in a panel of multiple proteins for high-throughput screening; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its receptor) in biological fluids; as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state); and, of course, to isolate conelative receptors or ligands.
  • the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction)
  • the protein can be used to identify the other protein with which binding occurs or to identify inhibitors of the binding interaction. Proteins involved in these binding interactions can also be used to screen for peptide or small molecule inhibitors or agonists of the binding interaction.
  • Polynucleotides and proteins of the present invention can also be used as nutritional 5 sources or supplements. Such uses include without limitation use as a protein or amino acid supplement, use as a carbon source, use as a nitrogen source and use as a source of carbohydrate.
  • the protein or polynucleotide of the invention can be added to the feed of a particular organism or can be administered as a separate solid or liquid preparation, such as in the form of powder, pills, solutions, suspensions or capsules.
  • the protein or polynucleotide of the invention can be added to the medium in or on which the microorganism is cultured.
  • a protein of the present invention may exhibit cytokine, cell proliferation (either 5 inducing or inhibiting) or cell differentiation (either inducing or inhibiting) activity or may induce production of other cytokines in certain cell populations.
  • a polynucleotide of the invention can encode a polypeptide exhibiting such attributes.
  • Many protein factors discovered to date, including all known cytokines, have exhibited activity in one or more factor-dependent cell proliferation assays, and hence the assays serve as a convenient confirmation of cytokine 0 activity.
  • the activity of a protein of the present invention is evidenced by any one of a number of routine factor dependent cell proliferation assays for cell lines including, without limitation,
  • Tl 165, HT2, CTLL2, TF-1, Mo7e and CMK The activity of a protein of the invention may, among other means, be measured by the following methods: 5 Assays for T-cell or thymocyte proliferation include without limitation those described in: Cmrent Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies,
  • Assays for cytokine production and/or proliferation of spleen cells, lymph node cells or thymocytes include, without limitation, those described in: Polyclonal T cell stimulation,
  • Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, without limitation, those described in: Measurement of Human and Murine Interleukin
  • Assays for T-cell clone responses to antigens include, without limitation, those described in: Current
  • a protein of the present invention may also exhibit immune stimulating or immune suppressing activity, including without limitation the activities for which assays are described herein.
  • a polynucleotide of the invention can encode a polypeptide exhibiting such activities.
  • a protein may be useful in the treatment of various immune deficiencies and disorders
  • immune deficiencies may be genetic or be caused by vital (e.g., HIV) as well as bacterial or fungal infections, or may result from autoimmune disorders. More specifically, infectious diseases causes by viral, bacterial, fungal or other infection may be treatable using a protein of the present invention, including infections by HIV, hepatitis viruses, herpesviruses, mycobacteria, Leishmania spp., malaria spp. and various fungal . . infections such as candidiasis. Of course, in this regard, a protein of the present invention may also be useful where a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.
  • a boost to the immune system generally may be desirable, i.e., in the treatment of cancer.
  • Autoimmune disorders which may be treated using a protein of the present invention include, for example, connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pulmonary inflammation, Guillain-Bane syndrome, autoimmune thyroiditis, insulin dependent diabetes mellitis, myasthenia gravis, graft- versus-host disease and autoimmune inflammatory eye disease.
  • a protein of the present invention may also to be useful in the treatment of allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems.
  • Other conditions, in which immune suppression is desired may also be treatable using a protein of the present invention.
  • T cells may be inhibited by suppressing T cell responses or by inducing specific tolerance in T cells, or both.
  • Immunosuppression of T cell responses is generally an active, non-antigen-specific, process which requires continuous exposure of the T cells to the suppressive agent.
  • Tolerance which involves inducing non-responsiveness or anergy in T cells, is distinguishable from immunosuppression in that it is generally antigen- specific and persists after exposure to the tolerizing agent has ceased. Operationally, tolerance can be demonstrated by the lack of a T cell response upon reexposure to specific antigen in the absence of the tolerizing agent.
  • Down regulating or preventing one or more antigen functions (including without limitation B lymphocyte antigen functions (such as, for example, B7)), e.g., preventing high level lymphokine synthesis by activated T cells, will be useful in situations of tissue, skin and organ transplantation and in graft-versus-host disease (GVHD).
  • B lymphocyte antigen functions such as, for example, B7
  • GVHD graft-versus-host disease
  • blockage of T cell function should result in reduced tissue destruction in tissue transplantation.
  • rejection of the transplant is initiated through its recognition as foreign by T cells, followed by an immune reaction that destroys the transplant.
  • a molecule which inhibits or blocks interaction of a B7 lymphocyte antigen with its natural ligand(s) on immune cells can lead to the binding of the molecule to the natural ligand(s) on the immune cells without transmitting the corresponding costimulatory signal.
  • B7 lymphocyte antigen e.g., B7-1, B7-3 or blocking antibody
  • Blocking B lymphocyte antigen function in this matter prevents cytokine synthesis by immune cells, such as T cells, and thus acts as an immunosuppressant.
  • the lack of costimulation may also be sufficient to anergize the
  • B lymphocyte antigen-blocking reagents may avoid the necessity of repeated administration of these blocking reagents.
  • the efficacy of particular blocking reagents in preventing organ transplant rejection or GVHD can be assessed using animal models that are predictive of efficacy in humans.
  • appropriate systems which can be used include allogeneic cardiac grafts in rats and xenogeneic pancreatic islet cell grafts in mice, both of which have been used to examine the immunosuppressive effects of CTLA4Ig fusion proteins in vivo as described in Lenschow et al., Science 257:789-792 (1992) and Turka et al., Proc. Natl. Acad. Sci USA, 89: 11102-
  • Blocking antigen function may also be therapeutically useful for treating autoimmune diseases.
  • Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive against self tissue and which promote the production of cytokines and autoantibodies involved in the pathology of the diseases.
  • Preventing the activation of autoreactive T cells may reduce or eliminate disease symptoms.
  • Administration of reagents which block costimulation of T cells by disrupting recepto ⁇ ligand interactions of B lymphocyte antigens can be used to inhibit T cell activation and prevent production of autoantibodies or T cell-derived cytokines which may be involved in the disease process.
  • blocking reagents may induce antigen-specific tolerance of autoreactive T cells which could lead to long- term relief from the disease.
  • the efficacy of blocking reagents in preventing or alleviating autoimmune disorders can be determined using a number of well-characterized animal models of human autoimmune diseases. Examples include murine experimental autoimmune encephalitis, systemic lupus erythmatosis in MRL/lpr/lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD mice and BB rats, and murine experimental myasthenia gravis (see Paul ed., Fundamental Immunology, Raven Press, New
  • Upregulation of an antigen function (preferably a B lymphocyte antigen function), as a means of up regulating immune responses, may also be useful in therapy. Upregulation of immune responses may be in the form of enhancing an existing immune response or eliciting an . initial immune response. For example, enhancing an immune response through stimulating B lymphocyte antigen function may be useful in cases of viral infection. In addition, systemic viral diseases such as influenza, the common cold, and encephalitis might be alleviated by the administration of stimulatory forms of B lymphocyte antigens systemically.
  • anti-vital immune responses may be enhanced in an infected patient by removing T cells from the patient, costimulating the T cells in vitro with viral antigen-pulsed
  • APCs either expressing a peptide of the present invention or together with a stimulatory form of a soluble peptide of the present invention and reintroducing the in vitro activated T cells into the patient.
  • Another method of enhancing anti-viral immune responses would be to isolate infected cells from a patient, transfect them with a nucleic acid encoding a protein of the present invention as described herein such that the cells express all or a portion of the protein on their surface, and reintroduce the transfected cells into the patient.
  • the infected cells would now be capable of delivering a costimulatory signal to, and thereby activate, T cells in vivo.
  • tumor cells which lack MHC class I or MHC class II molecules, or which fail to reexpress sufficient mounts of MHC class I or MHC class II molecules, can be transfected with nucleic acid encoding all or a portion of (e.g., a cytoplasmic-domain truncated portion) of an MHC class I ⁇ .alpha, chain protein and .beta..sub.2 microglobulin protein or an MHC class
  • B lymphocyte antigen e.g., B7-1
  • B7-2, B7-3) induces a T cell mediated immune response against the transfected tumor cell.
  • a gene encoding an antisense construct which blocks expression of an MHC class II associated protein, such as the invariant chain can also be cotransfected with a DNA encoding a peptide having the activity of a B lymphocyte antigen to promote presentation of tumor associated antigens and induce tumor specific immunity.
  • a T cell mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Suitable assays for thymocyte or splenocyte cytotoxicity include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D.
  • Assays for T-cell-dependent immunoglobulin responses and isotype switching include, without limitation, those described in: Maliszewski, J.
  • MLR Mixed lymphocyte reaction
  • Dendritic cell-dependent assays (which will identify, among others, proteins expressed by dendritic cells that activate naive T-cells) include, without limitation, those described in:
  • lymphocyte survival/apoptosis (which will identify, among others, proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis) include, without limitation, those described in: Darzynkiewicz et al., Cytometry 13:795-808, 1992; Gorczyca et al., Leukemia 7:659-670, 1993; Gorczyca et al., Cancer
  • Assays for proteins that influence early steps of T-cell commitment and development include, without limitation, those described in: Antica et al., Blood 84:111-117, 1994; Fine et al., Cellular Immunology 155:111-122, 1994; Galy et al., Blood 85:2770-2778, 1995; Toki et al., Proc. Nat. Acad Sci. USA 88:7548-7551, 1991.
  • a protein of the present invention may be useful in regulation of hematopoiesis and, consequently, in the treatment of myeloid or lymphoid cell deficiencies. Even marginal biological activity in support of colony forming cells or of factor-dependent cell lines indicates involvement in regulating hematopoiesis, e.g.
  • erythroid progenitor cells alone or in combination with other cytokines, thereby indicating utility, for example, in treating various anemias or for use in conjunction with irradiation chemotherapy to stimulate the production of erythroid precursors and/or erythroid cells; in supporting the growth and proliferation of myeloid cells such as granulocytes and monocytes/macrophages (i.e., traditional CSF activity) useful, for example, in conjunction with chemotherapy to prevent or treat consequent myelo-suppression; in supporting the growth and proliferation of megakaryocytes and consequently of platelets thereby allowing prevention or treatment of various platelet disorders such as thrombocytopenia, and generally for use in place of or complimentary to platelet transfusions; and/or in supporting the growth and proliferation of hematopoietic stem cells which are capable of maturing to any and all of the above- mentioned hematopoietic cells and therefore find therapeutic utility in various stem cell disorders (such as those usually treated with transplantation, including, without
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assays for embryonic stem cell differentiation include, without limitation, those described in: Johansson et al. Cellular Biology 15:141-151, 1995; Keller et al., Molecular and Cellular Biology 13:473-486, 1993; McClanahan et al., Blood 81 :2903-2915, 1993.
  • Assays for stem cell survival and differentiation include, without limitation, those described in:
  • Methylcellulose colony forming assays Freshney, M. G. In Culture of Hematopoietic Cells. R.
  • a protein of the present invention also may have utility in compositions used for bone, cartilage, tendon, ligament and/or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers.
  • a protein of the present invention which induces cartilage and/or bone growth in circumstances where bone is not normally formed, has application in the healing of bone fractures and cartilage damage or defects in humans and other animals.
  • Such a preparation employing a protein of the invention may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery.
  • a protein of this invention may also be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone- forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells.
  • a protein of the invention may also be useful in the treatment of osteoporosis or osteoarthritis, such as through stimulation of bone and/or cartilage repair or by blocking inflammation or processes of tissue destruction (collagenase activity, osteoclast activity, etc.) mediated by inflammatory processes.
  • tissue regeneration activity that may be attributable to the protein of the present invention is tendon/ligament formation.
  • a protein of the present invention which induces tendon/ligament-like tissue or other tissue formation in circumstances where such tissue is not normally formed, has application in the healing of tendon or ligament tears, deformities and other tendon or ligament defects in humans and other animals.
  • Such a preparation employing a tendon/ligament-like tissue inducing protein may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue.
  • compositions of the present invention contributes to the repair of congenital, trauma induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments.
  • the compositions of the present invention may provide environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair.
  • the compositions of the invention may also be useful in the treatment of tendinitis, carpal tunnel syndrome and other tendon or ligament defects.
  • the compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art.
  • the protein of the present invention may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i.e. for the treatment of central and peripheral nervous system diseases and neuropathies, as well as mechanical and traumatic disorders, which involve degeneration, death or trauma to neural cells or nerve tissue. More specifically, a protein may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. Further conditions which may be treated in accordance with the present invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a protein of the invention.
  • Proteins of the invention may also be useful to promote better or faster closure of non- healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like.
  • a protein of the present invention may also exhibit activity for generation or regeneration of other tissues, such as organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac) and vascular endothelium, and vascular endothelium, and vascular endothelium, and vascular endothelium, and vascular endothelium, and vascular endothelium, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma, hematoma
  • a protein of the invention may also exhibit angiogenic activity.
  • a protein of the present invention may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage.
  • a protein of the present invention may also be useful for promoting or inhibiting differentiation of tissues described above from precursor tissues or cells; or for inhibiting the growth of tissues described above.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assays for tissue generation activity include, without limitation, those described in:
  • Patent Publication No. WO95/05846 (nerve, neuronal); International Patent Publication No.
  • WO91/07491 skin, endothelium.
  • Assays for wound healing activity include, without limitation, those described in:
  • a protein of the present invention may also exhibit activin- or inhibin-related activities.
  • a polynucleotide of the invention may encode a polypeptide exhibiting such characteristics.
  • Inhibins are characterized by their ability to inhibit the release of follicle stimulating hormone (FSH), while activins and are characterized by their ability to stimulate the release of follicle stimulating hormone (FSH).
  • FSH follicle stimulating hormone
  • a protein of the present invention alone or in heterodimers with a member of the inhibin ⁇ -family, may be useful as a contraceptive based on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in these mammals.
  • the protein of the invention may be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, U.S. Pat. No. 4,798,885.
  • a protein of the . invention may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs.
  • the activity of a protein of the invention may, among other means, be measured by the following methods: Assays for activin/inhibin activity include, without limitation, those described in: Vale et al, Endocrinology 91 :562-572, 1972; Ling et al.. Nature 321 :779-782, 1986; Vale et al, Nature 321 :776-779, 1986; Mason et al.. Nature 318:659-663, 1985; Forage et al., Proc. Natl. Acad. Sci. USA 83:3091-3095, 1986.
  • a protein of the present invention may have chemotactic or chemokinetic activity (e.g., act as a chemokine) for mammalian cells, including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells.
  • chemotactic or chemokinetic activity e.g., act as a chemokine
  • mammalian cells including, for example, monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells.
  • a polynucleotide of the invention can encode a polypeptide exhibiting such attributes.
  • Chemotactic and chemokinetic proteins can be used to mobilize or attract a desired cell population to a desired site of action.
  • Chemotactic or chemokinetic proteins provide particular advantages in treatment of wounds and other trauma to tissues, as well as in treatment of localized infections. For example, attraction of lymphocytes, monocytes or neutrophils to tumors or sites of infection may result in improved immune responses against the tumor or infecting agent.
  • a protein or peptide has chemotactic activity for a particular cell population if it can stimulate, directly or indirectly, the directed orientation or movement of such cell population.
  • the protein or peptide has the ability to directly stimulate directed movement of cells. Whether a particular protein has chemotactic activity for a population of cells can be readily determined by employing such protein or peptide in any known assay for cell chemotaxis.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assays for chemotactic activity consist of assays that measure the ability of a protein to induce the migration of cells across a membrane as well as the ability of a protein to induce the adhesion of one cell population to another cell population.
  • Suitable assays for movement and adhesion include, without limitation, those described in: Current Protocols in Immunology, Ed by J. E. Coligan,
  • a protein of the invention may also exhibit hemostatic or thrombolytic activity.
  • a polynucleotide of the invention can encode a polypeptide exhibiting such attributes.
  • Such a protein is expected to be useful, in treatment of various coagulation disorders (including hereditary disorders, such as hemophilias) or to enhance coagulation and other hemostatic events in treating wounds resulting from trauma, surgery or other causes.
  • a protein of the invention may also be useful for dissolving or inhibiting formation of thromboses and for treatment and prevention of conditions resulting therefrom (such as, for example, infarction of cardiac and central nervous system vessels (e.g., stroke).
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Assay for hemostatic and thrombolytic activity include, without limitation, those described in: Linet et al., J. Clin. Pharmacol. 26:131-140, 1986; Burdick et al., Thrombosis Res.
  • a protein of the present invention may also demonstrate activity as receptors, receptor ligands or inhibitors or agonists of receptor/ligand interactions.
  • a polynucleotide of the invention can encode a polypeptide exhibiting such characteristics. Examples of such receptors and ligands include, without limitation, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands, receptors involved in cell-cell interactions and their ligands (including without limitation, cellular adhesion molecules (such as selectins, integrins and their ligands) and receptor/ligand pairs involved in antigen presentation, antigen recognition and development of cellular and humoral immune responses).
  • Receptors and ligands are also useful for screening of potential peptide or small molecule inhibitors of the relevant receptor/ligand interaction.
  • a protein of the present invention (including, without limitation, fragments of receptors and ligands) may themselves be useful as inhibitors of receptor/ligand interactions.
  • the activity of a protein of the invention may, among other means, be measured by the following methods:
  • Suitable assays for receptor-ligand activity include without limitation those described in: Cwrent Protocols in Immunology, Ed by J. E. Coligan, A. M. Kruisbeek, D. H. Margulies,
  • Proteins of the present invention may also exhibit anti-inflammatory activity.
  • the anti- inflammatory activity may be achieved by providing a stimulus to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (such as, for example, cell adhesion), by inhibiting or promoting chemotaxis of cells involved in the inflammatory process, inhibiting or promoting cell extravasation, or by stimulating or suppressing production of other factors which more directly inhibit or promote an inflammatory response.
  • Proteins exhibiting such activities can be used to treat inflammatory conditions including chronic or acute conditions), including without limitation intimation associated with infection (such as septic shock, sepsis or systemic inflammatory response syndrome (SIRS)), ischemia- reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease or resulting from over production of cytokines such as TNF or IL-1. Proteins of the invention may also be useful to treat anaphylaxis and hypersensitivity to an antigenic substance or material. 6.3J2. LEUKEMIAS
  • Leukemias and related disorders may be treated or prevented by administration of a therapeutic that promotes or inhibits function of the polynucleotides and/or polypeptides of the invention.
  • leukemias and related disorders include but are not limited to acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, myeloblastic, promyelocytic, myelomonocytic, monocytic, erythroleukemia, chronic leukemia, chronic myelocytic
  • Nervous system disorders involving cell types which can be tested for efficacy of intervention with compounds that modulate the activity of the polynucleotides and/or polypeptides of the invention, and which can be treated upon thus observing an indication of therapeutic utility, include but are not limited to nervous system injuries, and diseases or disorders which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination. Nervous system lesions which may be treated in a patient
  • peripheral nervous systems include but are not limited to the following lesions of either the central (including spinal cord, brain) or peripheral nervous systems:
  • traumatic lesions including lesions caused by physical injury or associated with surgery, for example, lesions which sever a portion of the nervous system, or compression injuries;
  • ischemic lesions in which a lack of oxygen in a portion of the nervous system results in neuronal injury or death, including cerebral infarction or ischemia, or spinal cord infarction or ischemia;
  • malignant lesions in which a portion of the nervous system is destroyed or injured by malignant tissue which is either a nervous system associated malignancy or a malignancy derived from non-nervous system tissue;
  • infectious lesions in which a portion of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency virus, herpes zoster, or herpes simplex virus or with Lyme disease, tuberculosis, syphilis;
  • degenerative lesions in which a portion of the nervous system is destroyed or injured as a result of a degenerative process including but not limited to degeneration associated with Parkinson's disease, Alzheimer's disease, Huntington's chorea, or amyotrophic lateral sclerosis;
  • lesions associated with nutritional diseases or disorders in which a portion of the nervous system is destroyed or injured by a nutritional disorder or disorder of metabolism including but not limited to, vitamin B12 deficiency, folic acid deficiency, Wernicke disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary degeneration of the corpus callosum), and alcoholic cerebellar degeneration;
  • demyelinated lesions in which a portion of the nervous system is destroyed or injured by a demyelinating disease including but not limited to multiple sclerosis, human immunodeficiency virus-associated myelopathy, transverse myelopathy or various etiologies, progressive multifocal leukoencephalopathy, and central pontine myelinolysis.
  • Therapeutics which are useful according to the invention for treatment of a nervous system disorder may be selected by testing for biological activity in promoting the survival or differentiation of neurons.
  • therapeutics which elicit any of the following effects may be useful according to the invention:
  • a neuron-associated molecule in culture or in vivo, e.g., choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or
  • Arakawa et al. (1990, J. Neurosci. 10:3507-3515); increased sprouting of neurons may be detected by methods set forth in Pestronk et al. (1980, Exp. Neurol. 70:65-82) or Brown et al.
  • neuron-associated molecules may be measured by bioassay, enzymatic assay, antibody binding, Northern blot assay, etc., depending on the molecule to be measured; and motor neuron dysfunction may be measured by assessing the physical manifestation of motor neuron disorder, e.g., weakness, motor neuron conduction velocity, or functional disability.
  • motor neuron disorders that may be treated according to the invention include but are not limited to disorders such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as disorders that selectively affect neurons such as amyotrophic lateral sclerosis, and including but not limited to progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio-
  • a protein of the invention may also exhibit one or more of the following additional activities or effects: inhibiting the growth, infection or function of, or killing, infectious agents, including, without limitation, bacteria, viruses, fungi and other parasites; effecting (suppressing or enhancing) bodily characteristics, including, without limitation, height, weight, hair color, eye color, skin, fat to lean ratio or other tissue pigmentation, or organ or body part size or shape
  • a protein of the present invention may be administered to a patient in need, by itself, or in pharmaceutical compositions where it is mixed with suitable carriers or excipient(s) at doses to treat or ameliorate a variety of disorders.
  • Such a composition may also contain (in addition to protein and a carrier) diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials well known in the art.
  • pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredient(s). The characteristics of the canier will depend on the route of administration.
  • the pharmaceutical composition of the invention may also contain other factors such as, but not limited to, M-CSF, GM-CSF, TNF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL- 8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IFN, TNF0, TNF1, TNF2, G-CSF, Meg-CSF, thrombopoietin, stem cell factor, and erythropoietin.
  • the pharmaceutical composition may further contain other agents which either enhance the activity of the protein or compliment its activity or use in treatment.
  • protein of the present invention may be included in formulations of a particular cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti-inflammatory agent to minimize side effects of the cytokine, lymphokine, other hematopoietic factor, thrombolytic or anti-thrombotic factor, or anti- inflammatory agent.
  • a protein of the present invention may be active in multimers (e.g., heterodimers or homodimers) or complexes with itself or other proteins.
  • pharmaceutical compositions of the invention may comprise a protein of the invention in such multimeric or complexed form.
  • a therapeutically effective dose further refers to that amount of the compound sufficient to result in amelioration of symptoms, e.g., treatment, healing, prevention or amelioration of the relevant medical condition, or an increase in rate of treatment, healing, prevention or amelioration of such conditions.
  • a therapeutically effective dose refers to that ingredient alone.
  • a therapeutically effective dose refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in combination, serially or simultaneously.
  • a therapeutically effective amount of protein of the present invention is administered to a mammal having a condition to be treated.
  • Protein of the present invention may be administered in accordance with the method of the invention either alone or in combination with other therapies such as treatments employing cvtokines, lymphokines or other hematopoietic factors.
  • protein of the present invention may be administered either simultaneously with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors, or sequentially. If administered sequentially, the attending physician will decide on the appropriate sequence of administering protein of the present invention in combination with cytokine(s), lymphokine(s), other hematopoietic factor(s), thrombolytic or anti-thrombotic factors.
  • Suitable routes of administration may, for example, include oral, rectal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, subcutaneous, intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, intraperitoneal. intranasal, or intraocular injections.
  • Administration of protein of the present invention used in the pharmaceutical composition or to practice the method of the present invention can be canied out in a variety of conventional ways, such as oral ingestion, inhalation, topical application or cutaneous, subcutaneous, intraperitoneal, parenteral or intravenous injection. Intravenous administration to the patient is prefened.
  • the compounds may be administered topically, for example, as eye drops.
  • one may administer the drug in a targeted drug delivery system for example, in a liposome coated with a specific antibody, targeting, for example, arthritic or fibrotic tissue. The liposomes will be targeted to and taken up selectively by the afflicted tissue.
  • compositions for use in accordance with the present invention thus may be formulated in a conventional manner using one or more physiologically acceptable caniers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically.
  • These pharmaceutical compositions may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.Proper formulation is dependent upon the route of administration chosen. When a therapeutically effective amount of protein of the present invention is administered orally, protein of the present invention will be in the form of a tablet, capsule, powder, solution or elixir.
  • the pharmaceutical composition of the invention may additionally contain a solid carrier such as a gelatin or an adjuvant.
  • a solid carrier such as a gelatin or an adjuvant.
  • the tablet, capsule, and powder contain from about 5 to 95%) protein of the present invention, and preferably from about 25 to 90% protein of the present invention.
  • a liquid canier such as water, petroleum, oils of animal or plant origin such as peanut oil, mineral oil, soybean oil, or sesame oil, or synthetic oils may be added.
  • the liquid form of the pharmaceutical composition may further contain physiological saline solution, dextrose or other saccharide solution, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol.
  • the pharmaceutical composition contains from about
  • protein of the present invention 0.5 to 90% by weight of protein of the present invention, and preferably from about 1 to 50% protein of the present invention.
  • protein of the present invention When a therapeutically effective amount of protein of the present invention is administered by intravenous, cutaneous or subcutaneous injection, protein of the present invention will be in the form of a pyrogen-free, parenterally acceptable aqueous solution.
  • parenterally acceptable protein solutions having due regard to pH, isotonicity, stability, and the like, is within the skill in the art.
  • a prefened pharmaceutical composition for intravenous, cutaneous, or subcutaneous injection should contain, in addition to protein of the present invention, an isotonic vehicle such as Sodium Chloride Injection,
  • the pharmaceutical composition of the present invention may also contain stabilizers, preservatives, buffers, antioxidants, or other additives known to those of skill in the art.
  • the agents of the invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as
  • penetrants appropriate to the banier to be permeated are used in the formulation. Such penetrants are generally known in the art.
  • the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable earners well known in the art.
  • Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slunies, suspensions and the like, for oral ingestion by a patient to be treated.
  • Pharmaceutical preparations for oral use can be obtained solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores.
  • Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as.
  • polyvinylpynolidone for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpynolidone (PVP).
  • disintegrating agents may be added, such as the cross-linked polyvinyl pynolidone, agar, or alginic acid or a salt thereof such as sodium alginate.Dragee cores are provided with suitable coatings.
  • concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pynolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
  • Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
  • compositions which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
  • the push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers.
  • the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
  • stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.
  • the compositions may take the form of tablets or lozenges formulated in conventional manner.
  • the compounds for use according to the present . invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • the compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • compositions for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
  • the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • the compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
  • the compounds may also be formulated as a depot preparation.
  • Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • a pharmaceutical canier for the hydrophobic compounds of the invention is a cosolvent system comprising benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • the cosolvent system may be the VPD co-solvent system.
  • VPD is a solution of 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant polysorbate 80, and 65% w/v polyethylene glycol 300, made up to volume in absolute ethanol.
  • the VPD co-solvent system (VPD:5W) consists of VPD diluted 1 :1 with a 5% dextrose in water solution.
  • This co- solvent system dissolves hydrophobic compounds well, and itself produces low toxicity upon systemic administration.
  • the proportions of a co-solvent system may be varied considerably without destroying its solubility and toxicity characteristics.
  • identity of the co-solvent components may be varied: for example, other low-toxicity nonpolar surfactants may be used instead of polysorbate 80; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g. polyvinyl pynolidone; and other sugars or polysaccharides may substitute for dextrose.
  • other delivery systems for hydrophobic pharmaceutical compounds may be employed.
  • Liposomes and emulsions are well known examples of delivery vehicles or earners for hydrophobic drugs. Certain organic solvents such as dimethylsulfoxide also may be employed, although usually at the cost of greater toxicity. Additionally, the compounds may be delivered using a sustained-release system, such as semipermeable matrices of solid hydrophobic polymers containing the therapeutic agent. Various of sustained-release materials have been established and are well known by those skilled in the art. Sustained-release capsules may, depending on their chemical nature, release the compounds for a few weeks up to over 100 days. Depending on the chemical nature and the biological stability of the therapeutic reagent, additional strategies for protein stabilization may be employed.
  • the pharmaceutical compositions also may comprise suitable solid or gel phase caniers or excipients.
  • suitable solid or gel phase caniers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
  • Many of the proteinase inhibiting compounds of the invention may be provided as salts with pharmaceutically compatible counterions.
  • Such pharmaceutically acceptable base addition salts are those salts which retain the biological effectiveness and properties of the free acids and which are obtained by reaction with inorganic or organic bases such as sodium hydroxide, magnesium hydroxide, ammonia, trialkylamine, dialkylamine, monoalkylamine, dibasic amino acids, sodium acetate, potassium benzoate, triethanol amine and the like.
  • the pharmaceutical composition of the invention may be in the form of a complex of the protein(s) of present invention along with protein or peptide antigens.
  • the protein and/or peptide antigen will deliver a stimulatory signal to both B and T lymphocytes.
  • B lymphocytes will respond to antigen through their surface immunoglobulin receptor.
  • MHC proteins MHC and structurally related proteins including those encoded by class I and class II MHC genes on host cells will serve to present the peptide antigen(s) to T lymphocytes.
  • the antigen components could also be supplied as purified MHC-peptide complexes alone or with co-stimulatory molecules that can directly signal T cells.
  • antibodies able to bind surface immunoglobulin and other molecules on B cells as well as antibodies able to bind the TCR and other molecules on T cells can be combined with the pharmaceutical composition of the invention.
  • the pharmaceutical composition of the invention may be in the form of a liposome in which protein of the present invention is combined, in addition to other pharmaceutically acceptable caniers, with amphipathic agents such as lipids which exist in aggregated form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution.
  • Suitable lipids for liposomal formulation include, without limitation, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponin, bile acids, and the like. Preparation of such liposomal formulations is within the level of skill in the art, as disclosed, for example, in U.S. Pat. Nos. 4,235,871 ; 4,501,728; 4,837,028; and 4,737,323, all of which are incorporated herein by reference.
  • the amount of protein of the present invention in the pharmaceutical composition of the present invention will depend upon the nature and severity of the condition being treated, and on the nature of prior treatments which the patient has undergone. Ultimately, the attending physician will decide the amount of protein of the present invention with which to treat each individual patient. Initially, the attending physician will administer low doses of protein of the present invention and observe the patient's response. Larger doses of protein of the present invention may be administered until the optimal therapeutic effect is obtained for the patient, and at that point the dosage is not increased further.
  • compositions used to practice the method of the present invention should contain about 0.01 ⁇ g to about 100 mg (preferably about 0J ⁇ g to about 10 mg, more preferably about 0J ⁇ g to about 1 mg) of protein of the present invention per kg body weight.
  • the therapeutic method includes administering the composition topically, systematically, or locally as an implant or device.
  • the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form.
  • the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or tissue damage.
  • Topical administration may be suitable for wound healing and tissue repair.
  • Therapeutically useful agents other than a protein of the invention which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the composition in the methods of the invention.
  • the composition would include a matrix capable of delivering the protein-containing composition to the site of bone and/or cartilage damage, providing a structure for the developing bone and cartilage and optimally capable of being resorbed into the body.
  • matrices may be formed of materials presently in use for other implanted medical applications.
  • compositions may be biodegradable and chemically defined calcium sulfate, tricalciumphosphate, hydroxyapatite, polylactic acid, polyglycolic acid and polyanhydrides.
  • Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen.
  • Further matrices are comprised of pure proteins or extracellular matrix components.
  • Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics.
  • Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalciumphosphate.
  • the bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
  • a 50:50 (mole weight) copolymer of lactic acid and glycolic acid in the form of porous particles having diameters ranging from 150 to 800 microns.
  • a sequestering agent such as carboxymethyl cellulose or autologous blood clot, to prevent the protein compositions from disassociating from the matrix.
  • a prefened family of sequestering agents is cellulosic materials such as alkylcelluloses
  • hydroxyalkylcelluloses including methylcellulose, ethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropyl-methylcellulose, and carboxymethylcellulose, the most prefened being cationic salts of carboxymethylcellulose
  • CMC prefened sequestering agents
  • Other prefened sequestering agents include hyaluronic acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymer and poly(vinyl alcohol).
  • the amount of sequestering agent useful herein is 0.5-20 wt %, preferably 1-10 wt % based on total formulation weight, which represents the amount necessary to prevent desorbtion of the protein from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented from infiltrating the matrix, thereby providing the protein the opportunity to assist the osteogenic activity of the progenitor cells.
  • proteins of the invention may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, or tissue in question. These agents include various growth factors ⁇ such as epidermal growth factor (EGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-. alpha, and TGF-.beta.), and insulin-like growth factor (IGF).
  • compositions are also presently valuable for veterinary applications.
  • the dosage regimen of a protein-containing pharmaceutical composition to be used in tissue regeneration will be determined by the attending physician considering various factors which modify the action of the proteins, e.g., amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue (e.g., bone), the patient's age, sex, and diet, the severity of any infection, time of administration and other clinical factors.
  • the dosage may vary with the type of matrix used in the reconstitution and with inclusion of other proteins in the pharmaceutical composition.
  • IGF I insulin like growth factor I
  • the addition of other known growth factors, such as IGF I may also effect the dosage.
  • Progress can be monitored by periodic assessment of tissue/bone growth and/or repair, for example, X-rays, histomorphometric determinations and tetracycline labeling.
  • Polynucleotides of the present invention can also be used for gene therapy. Such polynucleotides can be introduced either in vivo or ex vivo into cells for expression in a mammalian subject. Polynucleotides of the invention may also be administered by other known methods for introduction of nucleic acid into a cell or organism (including, without limitation, in the form of viral vectors or naked DNA). Cells may also be cultured ex vivo in the presence of proteins of the present invention in order to proliferate or to produce a desired effect on or activity in such cells. Treated cells can then be introduced in vivo for therapeutic purposes.
  • compositions suitable for use in the present invention include compositions wherein the active ingredients are contained in an effective amount to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount effective to prevent development of or to alleviate the existing symptoms of the subject being treated. Determination of the effective amounts is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.
  • the therapeutically effective dose can be estimated initially from cell culture assays. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC50 as determined in cell culture (i.e., the concentration of the test compound which achieves a half-maximal inhibition of the C- proteinase activity). Such information can be used to more accurately determine useful doses in humans.
  • a therapeutically effective dose refers to that amount of the compound that results in amelioration of symptoms or a prolongation of survival in a patient.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio between LD50 and ED50.
  • Compounds which exhibit high therapeutic indices are prefened. The data obtained from these cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. See, e.g., Fingl et al, 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p.l .Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain the C-proteinase inhibiting effects, or minimal effective concentration (MEC).
  • MEC minimal effective concentration
  • MEC will vary for each compound but can be estimated from in vitro data; for example, the concentration necessary to achieve 50-90% inhibition of the C-proteinase using the assays described herein. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. However, HPLC assays or bioassays can be used to determine plasma concentrations.
  • Dosage intervals can also be determined using MEC value.
  • Compounds should be administered using a regimen which maintains plasma levels above the MEC for 10-90% of the time, preferably between 30-90% and most preferably between 50-90%.In cases of local administration or selective uptake, the effective local concentration of the drug may not be related to plasma concentration.
  • composition administered will, of course, be dependent on the subject being treated, on the subject's weight, the severity of the affliction, the manner of administration and the judgment of the prescribing physician.
  • compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
  • the pack may, for example, comprise metal or plastic foil, such as a blister pack.
  • the pack or dispenser device may be accompanied by instructions for administration.
  • Compositions comprising a compound of the invention formulated in a compatible pharmaceutical canier may also be prepared, placed in an appropriate container, and labelled for treatment of an indicated condition.
  • Another aspect of the invention is an antibody that specifically binds the polypeptide of the invention.
  • Such antibodies can be either monoclonal or polyclonal antibodies, as well fragments thereof and humanized forms or fully human forms, such as those produced in transgenic animals.
  • the invention further provides a hybridoma that produces an antibody according to the invention.
  • Antibodies of the invention are useful for detection and/or purification of the polypeptides of the invention.
  • Protein of the invention may also be used to immunize animals to obtain polyclonal and monoclonal antibodies which specifically react with the protein. Such antibodies may be obtained using either the entire protein or fragments thereof as an immunogen.
  • the peptide immunogens additionally may contain a cysteine residue at the carboxyl terminus, and are conjugated to a hapten such as keyhole limpet hemocyanin (KLH).
  • KLH keyhole limpet hemocyanin
  • Monoclonal antibodies binding to the protein of the invention may be useful diagnostic agents for the immunodetection of the protein.
  • Neutralizing monoclonal antibodies binding to the protein may also be useful therapeutics for both conditions associated with the protein and also in the treatment of some forms of cancer where abnormal expression of the protein is involved.
  • neutralizing monoclonal antibodies against the protein may be useful in detecting and preventing the metastatic spread of the cancerous cells, which may be mediated by the protein.
  • techniques for preparing polyclonal and monoclonal antibodies as well as hybridomas capable of producing the desired antibody are well known in the art
  • Any animal which is known to produce antibodies can be immunized with a peptide or polypeptide of the invention.
  • Methods for immunization are well known in the art. Such methods include subcutaneous or intraperitoneal injection of the polypeptide.
  • One skilled in the art will recognize that the amount of the protein encoded by the
  • ORF of the present invention used for immunization will vary based on the animal which is immunized, the antigenicity of the peptide and the site of injection.
  • the protein that is used as an immunogen may be modified or administered in an adjuvant in order to increase the protein's antigenicity.
  • Methods of increasing the antigenicity of a protein are well known in the art and include, but are not limited to, coupling the antigen with a heterologous protein (such as globulin or ⁇ -galactosidase) or through the inclusion of an adjuvant during immunization.
  • spleen cells from the immunized animals are removed, fused with myeloma cells, such as SP2/0-Agl4 myeloma cells, and allowed to become monoclonal antibody producing hybridoma cells.
  • myeloma cells such as SP2/0-Agl4 myeloma cells
  • Any one of a number of methods well known in the art can be used to identify the hybridoma cell which produces an antibody with the desired characteristics. These include screening the hybridomas with an ELISA assay, western blot analysis, or radioimmunoassay (Lutz et al, Exp. Cell Research. 775:109-124 (1988)).
  • Hybridomas secreting the desired antibodies are cloned and the class and subclass is determined using procedures known in the art (Campbell, A.M., Monoclonal Antibody Technology:
  • antibody containing antiserum is isolated from the immunized animal and is screened for the presence of antibodies with the desired specificity using one of the above-described procedures.
  • the present invention further provides the above- described antibodies in delectably labeled form.
  • Antibodies can be delectably labeled through the use of radioisotopes, affinity labels (such as biotin, avidin, etc.), enzymatic labels (such as horseradish peroxidase, alkaline phosphatase, etc.) fluorescent labels (such as FITC or rhodamine, etc.), paramagnetic atoms, etc. Procedures for accomplishing such labeling are well-known in the art, for example, see (Sternberger, L.A. et al, J. Histochem. Cytochem.
  • the labeled antibodies of the present invention can be used for in vitro, in vivo, and in situ assays to identify cells or tissues in which a fragment of the polypeptide of interest is expressed.
  • the antibodies may also be used directly in therapies or other diagnostics.
  • the present invention further provides the above-described antibodies immobilized on a solid support.
  • solid supports include plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, acrylic resins and such as polyacrylamide and latex beads. Techniques for coupling antibodies to such solid supports are well known in the art (Weir, D.M. et al, "Handbook of Experimental Immunology" 4th Ed.. Blackwell Scientific).
  • the immobilized antibodies of the present invention can be used for in vitro, in vivo, and in situ assays as well as for immuno-affinity purification of the proteins of the present invention.
  • a nucleotide sequence of the present invention can be recorded on computer readable media.
  • computer readable media refers to any medium which can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as floppy discs, hard disc storage medium, and magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media.
  • magnetic storage media such as floppy discs, hard disc storage medium, and magnetic tape
  • optical storage media such as CD-ROM
  • electrical storage media such as RAM and ROM
  • hybrids of these categories such as magnetic/optical storage media.
  • “recorded” refers to a process for storing information on computer readable medium.
  • a skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate manufactures comprising the nucleotide sequence information of the present invention.
  • a variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon a nucleotide sequence of the present invention.
  • the choice of the data storage structure will generally be based on the means chosen to access the stored information.
  • a variety of data processor programs and formats can be used to store the nucleotide sequence information of the present invention on computer readable medium.
  • the sequence information can be represented in a word processing text file, formatted in commercially-available software such as WordPerfect and Microsoft Word, or represented in the form of an ASCII file, stored in a database application, such as DB2, Sybase, Oracle, or the like.
  • a skilled artisan can readily adapt any number of dataprocessor structuring formats (e.g.
  • nucleotide sequence information of the present invention By providing the nucleotide sequence of SEQ ID NOSJ, 2 or nucleotides 261-641 of SEQ ID NO:2 or a representative fragment thereof, or a nucleotide sequence at least 99.9% identical to SEQ ID NOSJ, 2 or 5 in computer readable form, a skilled artisan can routinely access the sequence information for a variety of purposes. Computer software is publicly available which allows a skilled artisan to access sequence information provided in a computer readable medium. The examples which follow demonstrate how software which implements the BLAST (Altschul et al, J. Mol Biol. 275:403-410 (1990)) and BLAZE (Brutlag et al, Comp. Chem. 77:203-207
  • ORFs open reading frames
  • Such ORFs may be protein encoding fragments and may be useful in producing commercially important proteins such as enzymes used in fermentation reactions and in the production of commercially useful metabolites.
  • a computer-based system refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention.
  • the minimum hardware means of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means.
  • CPU central processing unit
  • the computer-based systems of the present invention comprise a data storage means having stored therein a nucleotide sequence of the present invention and the necessary hardware means and software means for supporting and implementing a search means.
  • data storage means refers to memory which can store nucleotide sequence information of the present invention, or a memory access means which can access manufactures having recorded thereon the nucleotide sequence information of the present invention.
  • search means refers to one or more programs which are implemented on the computer-based system to compare a target sequence or target structural motif with the sequence information stored within the data storage means. Search means are used to identify fragments or regions of a known sequence which match a particular target sequence or target motif.
  • search means are used to identify fragments or regions of a known sequence which match a particular target sequence or target motif.
  • a variety of known algorithms are disclosed publicly and a variety of commercially available software for conducting search means are and can be used in the computer-based systems of the present invention. Examples of such software includes, but is not limited to,
  • a target sequence can be any nucleic acid or amino acid sequence of six or more nucleotides or two or more amino acids.
  • the most prefened sequence length of a target sequence is from about 10 to 100 amino acids or from about 30 to 300 nucleotide residues.
  • searches for commercially important fragments, such as sequence fragments involved in gene expression and protein processing may be of shorter length.
  • a target structural motif refers to any rationally selected sequence or combination of sequences in which the sequence(s) are chosen based on a three-dimensional configuration which is formed upon the folding of the target motif.
  • target motifs include, but are not limited to, enzyme active sites and signal sequences.
  • Nucleic acid target motifs include, but are not limited to, promoter sequences, hairpin structures and inducible expression elements (protein binding sequences).
  • fragments of the present invention can be used to control gene expression through triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of a polynucleotide sequence to DNA or RNA.
  • Polynucleotides suitable for use in these methods are usually 20 to 40 bases in length and are designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl Acids Res. 5:3073 (1979); Cooney et al, Science 1524T.A56 (1988); and
  • RNA transcription from DNA while antisense RNA hybridization blocks translation of an mRNA molecule into polypeptide. Both techniques have been demonstrated to be effective in model systems. Information contained in the sequences of the present invention is necessary for the design of an antisense or triple helix oligonucleotide.
  • the present invention further provides methods to identify the presence or expression of one of the ORFs of the present invention, or homolog thereof, in a test sample, using a nucleic acid probe or antibodies of the present invention.
  • methods for detecting a polynucleotide of the invention can comprise contacting a sample with a compound that binds to and forms a complex with the polynucleotide for a period sufficient to form the complex, and detecting the complex, so that if a complex is detected, a polynucleotide of the invention is detected in the sample.
  • Such methods can also comprise contacting a sample under stringent hybridization conditions with nucleic acid primers that anneal to a polynucleotide of the invention under such conditions, and amplifying annealed polynucleotides, so that if a polynucleotide is amplified, a polynucleotide of the invention is detected in the sample.
  • methods for detecting a polypeptide of the invention can comprise contacting a sample with a compound that binds to and forms a complex with the polypeptide for a period sufficient to form the complex, and detecting the complex, so that if a complex is detected, a polypeptide of the invention is detected in the sample.
  • such methods comprise incubating a test sample with one or more of the antibodies or one or more of nucleic acid probes of the present invention and assaying for binding of the nucleic acid probes or antibodies to components within the test sample.
  • Conditions for incubating a nucleic acid probe or antibody with a test sample vary.
  • Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the nucleic acid probe or antibody used in the assay.
  • One skilled in the art will recognize that any one of the commonly available hybridization, amplification or immunological assay formats can readily be adapted to employ the nucleic acid probes or antibodies of the present invention. Examples of such assays can be found in
  • test samples of the present invention include cells, protein or membrane extracts of cells, or biological fluids such as sputum, blood, serum, plasma, or urine.
  • test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed.
  • Methods for preparing protein extracts or membrane extracts of cells are well known in the art and can be readily be adapted in order to obtain a sample which is compatible with the system utilized.
  • kits which contain the necessary reagents to cany out the assays of the present invention.
  • the invention provides a compartment kit to receive, in close confinement, one or more containers which comprises: (a) a first container comprising one of the probes or antibodies of the present invention; and (b) one or more other containers comprising one or more of the following: wash reagents, reagents capable of detecting presence of a bound probe or antibody.
  • a compartment kit includes any kit in which reagents are contained in separate containers.
  • Such containers include small glass containers, plastic containers or strips of plastic or paper.
  • Such containers allows one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another.
  • Such containers will include a container which will accept the test sample, a container which contains the antibodies used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound antibody or probe.
  • Types of detection reagents include labeled nucleic acid probes, labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody.
  • labeled nucleic acid probes labeled secondary antibodies, or in the alternative, if the primary antibody is labeled, the enzymatic, or antibody binding reagents which are capable of reacting with the labeled antibody.
  • the disclosed probes and antibodies of the present invention can be readily incorporated into one of the established kit formats which are well known in the art.
  • the present invention further provides methods of obtaining and identifying agents which bind to a polypeptide encoded by the ORF from a polynucleotide with a sequence of SEQ ID NOS: 1, 2, nucleotides
  • 261-641 of SEQ ID NO: 2 orjto a specific domain of the polypeptide encoded by the nucleic acid, or to a nucleic acid with a sequence of SEQ ID NOS: 1, 2, or nucleotides 261-641 of SEQ
  • such methods for identifying compounds that bind to a polynucleotide of the invention can comprise contacting a compound with a polynucleotide of the invention for a time sufficient to form a polynucleotide/compound complex, and detecting the complex, so that if a polynucleotide/compound complex is detected, a compound that binds to a polynucleotide of the invention is identified.
  • such methods for identifying compounds that bind to a polypeptide of the invention can comprise contacting a compound with a polypeptide of the invention for a time sufficient to form a polypeptide/compound complex, and detecting the complex, so that if a polypeptide/compound complex is detected, a compound that binds to a polynucleotide of the invention is identified.
  • Methods for identifying compounds that bind to a polypeptide of the invention can also comprise contacting a compound with a polypeptide of the invention in a cell for a time sufficient to form a polypeptide/compound complex, wherein the complex drives expression of a receptor gene sequence in the cell, and detecting the complex by detecting reporter gene sequence expression, so that if a polypeptide/compound complex is detected, a compound that binds a polypeptide of the invention is identified.
  • Compounds identified via such methods can include compounds which modulate the activity of a polypeptide of the invention (that is, increase or decrease its activity, relative to activity observed in the absence of the compound).
  • compounds identified via such methods can include compounds which modulate the expression of a polynucleotide of the invention (that is, increase or decrease expression relative to expression levels observed in the absence of the compound).
  • Compounds, such as compounds identified via the methods of the invention can be tested using standard assays well known to those of skill in the art for their ability to modulate activity/expression.
  • the agents screened in-the above assay can be, but are not limited to, peptides, carbohydrates, vitamin derivatives, or other pharmaceutical agents.
  • the agents can be selected and screened at random or rationally selected or designed using protein modeling techniques.
  • agents such as peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to the protein encoded by the ORF of the present invention.
  • agents may be rationally selected or designed.
  • an agent is said to be "rationally selected or designed" when the agent is chosen based on the configuration of the particular protein. For example, one skilled in the art can readily adapt cunently available procedures to generate peptides, pharmaceutical agents and the like capable of binding to a specific peptide sequence in order to generate rationally designed antipeptide peptides, for example see Hurby et al. , Application of Synthetic
  • one class of agents of the present invention can be used to control gene expression through binding to one of the ORFs or EMFs of the present invention. As described above, such agents can be randomly screened or rationally designed/selected. Targeting the ORF or EMF allows a skilled artisan to design sequence specific or element specific agents, modulating the expression of either a single ORF or multiple ORFs which rely on the same EMF for expression control.
  • One class of DNA binding agents are agents which contain base residues which hybridize or form a triple helix formation by binding to DNA or RNA. Such agents can be based on the classic phosphodiester, ribonucleic acid backbone, or can be a variety of sulfhydryl or polymeric derivatives which have base attachment capacity.
  • Agents suitable for use in these methods usually contain 20 to 40 bases and are designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl Acids Res. 5:3073 (1979); Cooney et al, Science 247:456 (1988); and Dervan et al, 5
  • Another aspect of the subject invention is to provide for polypeptide-specific nucleic acid hybridization probes capable of hybridizing with naturally occuning nucleotide sequences.
  • the hybridization probes of the subject invention may be derived from the nucleotide sequence of the SEQ ID NOSJ or 2. Because the conesponding gene is only expressed in a limited number of tissues, especially adult tissues, a hybridization probe derived from SEQ ID NOSJ or 2 can be used as an indicator of the presence of RNA of cell type of such a tissue in a sample. 5
  • any suitable hybridization technique can be employed, such as, for example, in situ hybridization.
  • PCR as described US Patent Nos 4,683,195 and 4,965,188 provides additional uses for oligonucleotides based upon the nucleotide sequences.
  • probes used in PCR may be of recombinant origin, may be chemically synthesized, or a mixture of both.
  • the probe will comprise a discrete nucleotide sequence for the detection of identical sequences or a degenerate pool of possible sequences for identification of closely related genomic sequences.
  • nucleic acid sequences include the cloning of nucleic acid sequences into vectors for the production of mRNA probes.
  • vectors are known in the art and are commercially available and may be used to synthesize
  • RNA probes in vitro by means of the addition of the appropriate RNA polymerase as T7 or SP6
  • RNA polymerase and the appropriate radioactively labeled nucleotides may be used to construct hybridization probes for mapping their respective genomic sequences.
  • the nucleotide sequence provided herein may be mapped to a chromosome or specific regions of a chromosome using well known genetic and/or chromosomal mapping techniques. These techniques include in situ hybridization, linkage analysis against known chromosomal markers, hybridization screening with libraries or flow-sorted chromosomal preparations specific to known chromosomes, and the like. The technique of fluorescent in situ hybridization of chromosome spreads has been described, among other places, in Verma et al.
  • Fluorescent in situ hybridization of chromosomal preparations and other physical chromosome mapping techniques may be conelated with additional genetic map data.
  • nucleotide sequences of the subject invention may be used to detect differences in gene sequences between normal, canier or affected individuals.
  • the nucleotide sequence may be used to produce purified polypeptides using well known methods of recombinant DNA technology.
  • Polypeptides may be expressed in a variety of host cells, either prokaryotic or eukaryotic. Host cells may be from the same species from which a particular polypeptide nucleotide sequence was isolated or from a different species. Advantages of producing polypeptides by recombinant DNA technology include obtaining adequate amounts of the protein for purification and the availability of simplified purification procedures.
  • TRW Inc. Los Angeles, CA
  • the three parameters that determine how the sequence comparisons run were window size, window offset, and enor tolerance.
  • the DNA database was searched for sequences containing regions of homology to the query sequence, and the appropriate sequences were scored with an initial value. Subsequently, these homologous regions were examined using dot matrix homology plots to distinguish regions of homology from chance matches. Smith- Waterman alignments were used to display the results of the homology search. Peptide and protein sequence homologies were ascertained using the
  • INHERIT 670 Sequence Analysis System in a way similar to that used in DNA sequence homologies. Pattern Specification Language and parameter windows were used to search protein databases for sequences containing regions of homology that were scored with an initial value. Dot-matrix homology plots were examined to distinguish regions of significant homology from chance matches.
  • BLAST which stands for Basic Local Alignment Search Tool, is used to search for local sequence alignments (Altschul SF (1993) J Mol Evol 36:290-300; Altschul, SF et al (1990) J Mol Biol 215:403-10). BLAST produces alignments of both nucleotide and amino acid sequences to determine sequence similarity. Because of the local nature of the alignments, BLAST is especially useful in determining exact matches or in identifying homologs. Whereas it is ideal for matches which do not contain gaps, it is inappropriate for performing motif-style searching. The fundamental unit of BLAST algorithm output is the
  • High-scoring Segment Pair An HSP consists of two sequence fragments of arbitrary but equal lengths whose alignment is locally maximal and for which the alignment score meets or exceeds a threshold or cutoff score set by the user.
  • the BLAST approach is to look for HSPs between a query sequence and a database sequence, to evaluate the statistical significance of any matches found, and to report only those matches which satisfy the user-selected threshold of significance.
  • the parameter E establishes the statistically significant threshold for reporting database sequence matches. E is interpreted as the upper bound of the expected frequency of chance occunence of an HSP (or set of HSPs) within the context of the entire database search.
  • BLAST analysis was used to search for related molecules within the libraries of the LIFESEQ database.
  • This process an "electronic northern” analysis is analogous to northern blot analysis in that it uses one cellubrevin sequence at a time to search for identical or homologous molecules at a set stringency.
  • the stringency of the electronic northern is based on "product score".
  • the product score is defined as (% nucleotide or amino acid [between the query and reference sequences] in Blast multiplied by the % maximum possible BLAST score [based on the lengths of query and reference sequences]) divided by
  • a plurality of novel nucleic acids were obtained from the b 2 HFLS20W cDNA library prepared from human fetal liver-spleen tissue, as described in Bonaldo et al., Genome Res. 6:791-
  • novel chemokine polypeptides of the invention are useful in medical imaging, e.g., imaging the site of infection, inflammation, and other sites having chemokine receptor molecules.
  • Such methods involve chemical attachment of a labelling agent, administration of the labelled chemokine to a subject in a pharmaceutically acceptable canier, ,and imaging the labelled chemokine in vivo at the target site.
  • the myelosuppressive activity of the novel chemokine polypeptides of the invention are assayed by injection of the novel chemokine polypeptides into mice, e.g., as described by Maze et al., J. Immunol., 149:1004-1009(1992) for the measurement of the myelosuppressiveaction of
  • MIP-1 alpha MIP-1 alpha .
  • a single dose of 0.2 to 10 ug of recombinant polypeptide is intravenously injected
  • Molecules which bind SEQ ID No. 3 will include, for e.g., monoclonal antibodies and and other small molecules which act as blocking agents, or as activators. See above. These molecules are identified as agonists or antagonists of SEQ ID No. 3 by the following types of assays. In prefened embodiments, the binding molecules will be antagonists which cause cell death.
  • Agonists and antagonists of chemotaxis are identified in a transmigration assay, e.g., leukocyte cells to be tested are added to the upper chamber of a transwell containing polycarbonate_membranes, 8.0 um pore size (Costar, Cambridge, Mass.). Novel chemokine polypeptide and the agonist or antagonist are added to the lower chamber of the transwell at various concentrations. At the end of the assay, cells that have transmigrated through the membrane into the lower chamber are collected and counted. Agonists and antagonists are identified by differences in chemotaxis from transwells using the novel chemokine alone.
  • Agonist and antagonists of the novel chemokine polypeptides may be identified by standard in vitro assays by measuring the inhibition of GM colony (CFU-GM) and cluster formation. Such assays are well known and representative assays are described in Gentile et al.,
  • Agonists and antagonists of the novel chemokine polypeptides activity with monocytes/macrophagesor human neutrophils are identified by, e.g., methods described by Devi et al., J. Immunol., 153:5376-5383 (1995). Indices of activation measured in such studies include . increased adhesion to fibrinogen due to integrin activation, chemotaxis, induction of reactive nitrogen intermediates, respiratory burst (superoxide and hydrogen peroxide production), and exocytosis of ly sozyme and elastase in the presence of cytochalasin B . As discussed by Devi et al., these activities conelate to several stages of the leukocyte response to inflammation.
  • This leukocyte response involves adherence of leukocytes to endothelial cells of blood vessels, migration through the endothelial layer, chemotaxis toward a source of chemokines, and site-specific release of inflammatory mediators.
  • Agonists and_antagonists of any one of these stages provide an important tools for clinical intervention, and for modulation of the inflammatory response.
  • Antibodies or other suitable binding molecules which bind to SEQ ID No. 3 are also useful in receptor protein purification and for in situ hybridization analyses.
  • Initial in situ analyses identify associations between the expression of SEQ ID No. 3 and genetic disorders of the immune system or development.
  • In situ hybridization with these binding molecules then diagnoses these genetic disorders of the immune system or development in potential patients.
  • Chromosome mapping technologies allow investigators to link genes to specific regions of chromosomes. Chromosomal mapping was performed with the Stanford G3 Radiation
  • Hybrid Panel (Research Genetics). The panel was screened with gene-specific primers (5' primer: ACCACACTGAGACTGCACTGA (SEQ ID NO:6); 3' primer:
  • Hybrid mapping email server at the Stanford Human Genome Center (SHGC).
  • SHGC Stanford Human Genome Center
  • SEQ ID NO. 2 is located on chromosome 2ql 1.
  • the STS was linked to the marker SHGC- 13273 with a LOD (log of the odds) score of 11.8 and cR-1000 of
  • chemokines have been found on chromosome 17, a substantial number of other chemokines have been mapped to a variety of other chromosomes, including chromosome 2 (LARC gene; Hieshaima et al., (Feb. 28, 1997) J. Biol. Chem.
  • Genomics 47(1):136-139 chromosme 9 (SLC gene; Yoshida et al., (Mar. 20, 1998) J. Biol.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

L'invention concerne des polynucléotides et des protéines codées par lesdits polynucléotides, ainsi que des procédés de thérapie, de diagnostic et de recherche correspondant à ces polynucléotides et protéines. En particulier, les polypeptides décrits comprennent des séquences d'acides aminés présentant des similitudes par rapport aux chimiokines considérées.
PCT/US2000/014572 1999-05-27 2000-05-25 CHIMIOKINE PROVENANT D'UNE LIBRAIRIE D'ADNc DE TISSU FOETAL HEPATO-SPLENIQUE WO2000073320A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU54454/00A AU5445400A (en) 1999-05-27 2000-05-25 A novel chemokine obtained from a cdna library of fetal liver-spleen

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US32213499A 1999-05-27 1999-05-27
US09/322,134 1999-05-27

Publications (1)

Publication Number Publication Date
WO2000073320A1 true WO2000073320A1 (fr) 2000-12-07

Family

ID=23253589

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/014572 WO2000073320A1 (fr) 1999-05-27 2000-05-25 CHIMIOKINE PROVENANT D'UNE LIBRAIRIE D'ADNc DE TISSU FOETAL HEPATO-SPLENIQUE

Country Status (2)

Country Link
AU (1) AU5445400A (fr)
WO (1) WO2000073320A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032631A1 (fr) * 1997-12-23 1999-07-01 Hyseq, Inc. CHIMIOKINE OBTENUE A PARTIR D'UNE BANQUE D'ADNc DE FOIE-RATE DE FOETUS

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999032631A1 (fr) * 1997-12-23 1999-07-01 Hyseq, Inc. CHIMIOKINE OBTENUE A PARTIR D'UNE BANQUE D'ADNc DE FOIE-RATE DE FOETUS

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
BAGGIOLINI M. ET AL.: "Human chemokines: an update", ANNU. REV. IMMUNOL.,, vol. 15, 1997, pages 675 - 705, XP002930485 *
ROLLINS B.J.: "Chemokines", BLOOD,, vol. 90, no. 3, August 1997 (1997-08-01), pages 909 - 928, XP002930486 *
WUYTS A. et al., "Chemokines" In: Cytokine Network Immune Function, editor, J. THEZE, Oxford University Press, Oxford, UK. 1999, pages 125-145, XP002930487. *

Also Published As

Publication number Publication date
AU5445400A (en) 2000-12-18

Similar Documents

Publication Publication Date Title
US6337072B1 (en) Interleukin-1 receptor antagonist and recombinant production thereof
US6339141B1 (en) Interleukin-1 Hy2 materials and methods
US6365726B1 (en) Polynucleotides encoding IL-1 Hy2 polypeptides
AU769262B2 (en) A interleukin-1 receptor antagonist and uses thereof
US6884872B1 (en) Methods and compositions relating to CD39-like polypeptides and nucleic acids
US6392018B1 (en) EGF MOTIF protein obtained from a cDNA library of fetal liver-spleen
US6294655B1 (en) Anti-interleukin-1 receptor antagonist antibodies and uses thereof
US6667391B1 (en) Stem cell growth factor-like polypeptide
US6392019B1 (en) Antibodies specific for EGF motif proteins
US6426191B1 (en) Assays involving an IL-1 receptor antagonist
US20040059098A1 (en) Egf motif protein, egfl6 materials and methods
US6783959B1 (en) Methods and compositions relating to CD39-like polypeptides and nucleic acids
US6899875B1 (en) Methods and compositions relating to CD39-like polypeptides and nucleic acids
WO1999032631A1 (fr) CHIMIOKINE OBTENUE A PARTIR D'UNE BANQUE D'ADNc DE FOIE-RATE DE FOETUS
US6800443B2 (en) Method of detecting a cancerous cell expressing an EGF motif polynucleotide
US6780977B1 (en) Methods and compositions relating to CD39-like polypeptides and nucleic acids
US20020107386A1 (en) Methods and compositions relating to bone-derived growth factor-like polypeptides
WO2000073320A1 (fr) CHIMIOKINE PROVENANT D'UNE LIBRAIRIE D'ADNc DE TISSU FOETAL HEPATO-SPLENIQUE
US20020081625A1 (en) Member of the immunoglobulin superfamily and uses thereof
AU6053899A (en) Methods and compositions relating to egf-repeat-containing polypeptides
WO1999045117A2 (fr) Interferon ien-hy et leurs utilisations
WO2001023569A1 (fr) Substances de reception des cytokines, et methodes associees
MXPA00009515A (en) A interleukin-1 receptor antagonist and uses thereof

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP