WO2000071726A9 - Methods to inhibit infectious agent transmission during xenotransplantation - Google Patents
Methods to inhibit infectious agent transmission during xenotransplantationInfo
- Publication number
- WO2000071726A9 WO2000071726A9 PCT/US2000/014296 US0014296W WO0071726A9 WO 2000071726 A9 WO2000071726 A9 WO 2000071726A9 US 0014296 W US0014296 W US 0014296W WO 0071726 A9 WO0071726 A9 WO 0071726A9
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cells
- ofthe
- seq
- virus
- perv
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- Xenotransplantation of animal organs is under consideration as a supplemental approach to alleviate this shortage (Policy et al., 1996).
- the pig is currently the donor of choice for cells, tissues and vascularized organs used in permanent and transient xenotransplantation treatments (Fishman, 1994). Swine offer a number
- HAR hyperacute rejection
- fetal pig neuronal cells producing dopamine have been tested in patients to replace cells destroyed by Parkinson's disease (Deacon et al., 1997); and fetal pig pancreatic islet cell clusters have been tested in protocols to treat diabetes (Groth et al., 1994).
- Another xenotransplantation approach has used pig liver and kidney xenografts as temporary support treatments for patients with fulminant organ failure (Breimer et al., 1996; Groth et al., 1994; Makowka et al., 1995).
- Xenotransplantation increases the risk of transferring infectious agents from pigs to humans due to the breach ofthe normal physical barriers against infectious agents upon introduction of pig cells, tissues or organs; the therapeutic immunosuppression ofthe recipient to prevent graft rejection which interferes with the mechanisms which defend human cells from infection by zoonotic viruses; and the genetic modifications of pigs, e.g., those being tested to control HAR or modify complement activation, may allow zoonotic viruses to evade immune surveillance or prevent the inactivation of invading enveloped viruses (Bergelson et al., 1995; Dorig et al., 1993; Fishman, 1994; Ward et al, 1994; Weiss, 1998).
- endogenous retroviruses in xenografts may be an infectious risk to xenotransplant patients.
- the risks of transmission to humans with endogenous viruses of non-humans are unknown and difficult to assess.
- Endogenous retroviruses from a variety of animals, including baboons, cats, and mice, can infect human cells (Boeke et al., 1997).
- MLVs murine leukemia viruses
- gibbon ape leukemia virus SEATO a virus most likely derived from an endogenous retro virus of Asian wild mice, can cause chronic myelogenous leukemia in normal juvenile gibbon apes highlights the potential risks of exposure to xenotic endogenous retroviruses (Kawakami et al, 1980; Lieber et al., 1975).
- Pig endogenous retroviruses released by established pig cell lines were observed in the 1970s, but the host range of these viruses was thought to be restricted to pig cells (Armstrong et al., 1971; Lieber et al., 1975; Moennig et al., 1974; Strandstrom et al., 1974; Todaro et al., 1974).
- PERVs have been associated with pig lymphomas (Bostock et al., 1973; Frazier, 1985; Moennig et al., 1974; Strandstrom et al., 1974; Suzuka et al., 1985).
- Heneine et al. (1998) and Patience et al. (1998) screened blood lymphocytes and sera from 10 diabetic patients that received porcine fetal islet cells, and 2 renal dialysis patients whose circulation had been linked with pig kidneys extracorporeally, respectively, neither group detected PERVs.
- the invention provides isolated and purified nucleic acid molecules and methods useful to inhibit or prevent the transmission of an infectious agent during xenogeneic or allogeneic cell, tissue or organ transplant.
- Infectious agents include, but are not limited to, viruses, bacteria and parasites.
- the invention includes prophylactic and therapeutic uses ofthe nucleic acid molecule of the invention which encodes at least a portion of a polypeptide of the infectious agent or which encodes at least a portion ofthe receptor employed by the infectious agent to enter the cells ofthe transplant recipient.
- the expression of the nucleic acid molecule in a donor cell, tissue or organ inhibits or prevents the transmission ofthe infectious agent from the donor cells, tissue or organ to a transplant recipient, or, alternatively, the transmission ofthe infectious agent from the recipient to the donor cell, tissue or organ.
- Preferred transplant recipients are mammals such as primates, e.g., humans, apes and monkeys, as well as canines, felines, bovines, ovines, swine, and equines.
- the transmission ofthe following infectious agents is inhibited or prevented: retroviruses, lentiviruses, herpesvirus, e.g., cytomegalovirus (CMV) and Epstein Barr virus (EBV), and hepatitis viruses, e.g., hepatitis A, B or C.
- retroviruses e.g., cytomegalovirus (CMV) and Epstein Barr virus (EBV)
- CMV cytomegalovirus
- EBV Epstein Barr virus
- hepatitis viruses e.g., hepatitis A, B or C.
- transplanted organs e.g., bioengineered organs, tissues, or cells, e.g., stem cells, including allografts, e.g., human-to-human transplants, or xenografts
- allografts e.g., human-to-human transplants, or xenografts
- xenografts are genetically modified to inhibit the infection of several major infectious pathogens that limit the success of transplantation (e.g., CMV, EBV, HIV and hepatitis viruses) or the infection by potential pathogens, e.g., endogenous viruses such as PERVs.
- nucleic acid molecules useful in the practice of the invention include a nucleic acid molecule which encodes gag, pol, env, protease, and accessory proteins (e.g., Vpr, Vif, Nef, Tat, or Rev) of retroviruses, lentiviruses and spumaviruses; a nucleic acid molecule which comprises a capsid or envelope gene of a herpesviruses, e.g., HSV 1 and 2, EBV and CMV; a nucleic acid molecule which comprises the C gene (nucleocapsid), ORFS/pre-S gene (viral surface glycoproteins), ORFX gene (regulatory protein), or ORFP gene (viral polymerase) of Hepadnaviruses, e.g., hepatitis B virus; a nucleic acid molecule which comprises the C gene (viral capsid) or the El and/or E2 gene of Flaviviruses, e.g., hepatit
- receptor interference refers to the expression of a receptor protein for the infectious agent or the ligand thereof, e.g., a viral ligand such as a viral glycoprotein.
- a viral ligand such as a viral glycoprotein.
- the genome ofthe donor cell, tissue or organ is augmented with DNA encoding the viral ligand thereby preventing infection.
- capsid-targeted viral inactivation may be employed to inhibit or prevent viral replication.
- Capsid- targeted viral inactivation reduces or eliminates the production of infectious virus by incorporating a degradative enzyme into newly synthesized viral particles, e.g., by expressing a fusion polypeptide comprising a viral polypeptide and a degradative enzyme.
- Degradative enzymes such as nucleases, e.g., RNase H, staphylococcal nuclease or ribozymes (see Marshall et al., 1994, and U.S. Patent No. 5,811,275), lipases or proteases, may be employed in the practice ofthe invention.
- Preferred fusion polypeptides include fusions of viral capsid, envelope or accessory proteins such as Vif, Vpx, Vpr and Nef, with degradative enzymes.
- a preferred xenograft for use in the methods of the invention is swine neuronal cells, pancreatic islet cells, hepatocytes, heart, liver or kidney. Therefore, the invention provides a method in which the genomic DNA of swine cells, tissue or organ to be transplanted is augmented with a recombinant DNA molecule encoding a polypeptide of an infectious agent which binds to a cell surface receptor of a transplant recipient, e.g., a viral glycoprotein, or a fusion polypeptide comprising at least a portion of an infectious agent polypeptide and a degradative enzyme.
- Infectious agents in this embodiment ofthe invention include, but are not limited to, those described in Table 1 of Fishman (1994), which is specifically incorporated by reference herein.
- PERVs are useful in CTVI methods to inhibit or prevent human-tropic PERV infection in xenotransplant patients.
- human tropic PERVs are produced by activated peripheral blood mononuclear cells.
- the relative PERV proviral copy number doubled upon passaging ofthe 1 -293 PERV-infected cells to fresh 293 cells, indicating that passaging the virus may amplify the replication-competent PERV.
- Only PERV-A env sequences were detected in DNA isolated from all three 293/PERV infected cultures by PCR analysis with PERV-A, PERV-B and PERV-C specific env primers.
- the 1 -293/PERV DNA contained a low level of PERV-C env.
- PERV-B env was not detected in any culture.
- PERVs are useful to determine the tissue tropism of various isolates and to determine the prevalence of anti-PERV antibodies in humans exposed to sources of PERV, e.g., pig slaughterhouse workers and xenotransplant patients such as those having a bioartificial liver with pig hepatocytes, as well as in the methods ofthe invention.
- a vector comprising a nucleic acid molecule ofthe invention may also be employed to deliver soluble env genes to mammalian donor cells, tissues or organs prior to cell, tissue or organ transplantation so that the transplanted cells, tissues or organs are less susceptible to infection by an infectious agent, the genome of which comprises the env gene.
- soluble PERV env genes are introduced to donor swine cells, tissues or organs to inhibit infection of the cells, tissues or organs by PERV, e.g., to inhibit infection by PERVs after the virus is reactivated following transplantation.
- ALV avian leukosis virus
- Stimulated pig peripheral blood mononuclear cells produce replication-competent human-tropic PERV.
- Porcine PBMC were cultured with either phytohemagglutinin (PHA) + phorbol myristate acetate (PMA) (black bars) or PMA + calcium ionophore (grey bars) and the supernatants assayed for RT activity.
- PHA phytohemagglutinin
- PMA phorbol myristate acetate
- grey bars PMA + calcium ionophore
- NIH minipig PBMC stimulated with PHA + PMA were cocultured with human 293 cells: 293 cells cocultured with live PBMC (closed squares); with lethally irradiated PBMC (open squares). The cell culture supernatants were assayed for RT activity.
- Figure 2. Schematic overview ofthe generation ofthe human 293 cell cultures infected with PERV produced by stimulated NIH minipig primary PBMC.
- FIG. 3 Relative titers of PERV produced from the infected 293 cell cultures.
- the titer of MLV- ⁇ gal/PERV pseudotyped virus stocks produced from the 1°, 2° and 3°-293/PERV cultures were quantitated on human 293 cells (open bars) and pig ST-IOWA cells (black bars).
- FIG. 4 Analysis ofthe relative number of PERV proviruses per cell in the 293/PERV infected cultures. Genomic DNA isolated from human 293 cells and the 293/PERV infected cultures was digested with EcoRI, and the fragments separated by agarose gel electrophoresis, transferred to nitrocellulose, and probed with 32 P-labeled PERV pol sequences. Two internal proviral DNA fragments hybridized to the PERV pol probe as expected. The film was scanned and the bands quantitated by Image Quant (Molecular Dynamics, Sunnyvale, CA). The blot was stripped and reprobed with 32 P-labeled human GAPDH sequences to normalize for the amount of DNA loaded per lane. After the band densities were normalized, the PERV pol level ofthe l°-293/PERV DNA was set as 1 copy.
- RT activity observed in cocultures of 293/2 virus producer cells and human hematopoietic cell lines The values shown are of cpm of 3 H- TTP incorporated in a reverse transcriptase assay measured in cell supernatants sampled at the times indicated post-coculture of 293/2 virus producer cells with each ofthe cell lines.
- FIG. 6 A comparison of the deduced amino acid sequences of the env genes of PERV-1.15 (SEQ ID NO:3 encoded by SEQ ID NO:18), PERV-A (Letissier et al., 1997; SEQ ID NO:4) and PERV-C (Akiyoshi et al., 1998; SEQ ID NO:5).
- SEQ ID NO:3 A schematic representation of the regions ofthe PERV-1.15 gene homologous to PERV-A (hatched) and PERV-C (open) genes (top figure).
- the envelope surface (SU) and transmembrane (TM) glycoprotein regions are also shown.
- Identical amino acids are denoted by a (.); gaps are denoted (_).
- FIG. 7 Schematic representation ofthe cloned PERV sequences.
- a proposed model for a PERV provirus with estimated locations ofthe viral domains is shown at the top.
- the PERV sequences contained in the six unique lambda clones are shown compared to the model.
- the lamA8 pol gene contains a 86 nucleotide deletion (del), and the env gene contains a 101 nucleotide insertion (ins) compared to all ofthe comparable sequences.
- FIG 8. A comparison of the nucleotide sequences of two PERV LTRs.
- the LTR sequence of the published cDNA clone PERV-MSL (SEQ ID NO:7) is compared to the lamAl LTR sequence (SEQ ID NO:6). Identical bases are denoted by (.); gaps are denoted (_).
- the estimated location ofthe major regions ofthe LTR, U3, R, and U5 are indicated.
- the sequence ofthe putative tRNA binding site is also indicated (18 of 18 nucleotides identical to the tRNA Pr0 binding site).
- Figure 9 Schematic representation of the construction of recombinant PERV molecular clones.
- Figure 10. Analysis of PERV proteins by SDS-PAGE and Western blot.
- Viral proteins were prepared and separated by SDS-PAGE as described above, and transferred to nitrocellulose. Lanes 1, 3, 5 and 7, 5 ml 293 supernatant; and lanes 2, 4, 6 and 8, 5 ml 2°-293/PERV supernatant. Lanes 1 and 2 were exposed to 1 :1000 dilution of goat anti-GALV capsid antisera; lanes 3 and 4 to 1 :1000 goat preimmune sera; lanes 5 and 6 to 1 :1000 goat anti-SSAV capsid antisera; and lanes 7 and 8 to 1 :1000 goat preimmune sera. The filters were washed and exposed to peroxidase-labeled rabbit anti-goat antibody. The antibody complexes were detected by chemiluminescence, and exposed to film for 30 seconds. The PERV CA protein migrates at about 25 kDa.
- Figure 11 Schematic of sTva antiviral gene constructs and the ALV- based retroviral vectors.
- Figure 12. General procedure for using replication-competent ALN- based retroviral vector system in vitro and in vivo.
- Figure 13. sTva-mlgG receptor expression levels in DF-1 cells.
- the sTva-mlgG protein was immunoprecipitated with goat -mouse-IgG agarose beads from supernatants (500 ⁇ l) of DF-1 cultures infected with the RCASBP(C), RCAS(C) or RCOSBP(C) vectors alone (V) or containing the stva-m gG gene (sTva).
- the immunoprecipitates were denatured, separated by 12%o SDS-PAGE, and analyzed by Western transfer.
- sTva-mlgG protein expressed transiently in human embryonic kidney 293 cells was included as a positive control (+).
- Figure 14 sTva-mlgG expression in sera of chickens infected with
- RCASBP vectors The sTva-mlgG protein was immunoprecipitated from chicken serum (500 ⁇ l) and analyzed as described ( Figure 13 legend). Lane 1, uninfected control; Lane 2, a RCASBP(B) vector alone infected bird; Austin 3- 4, RCASBP(B)stva-mIgG infected birds; Lane 5, a RCASBP(C) vector alone infected bird; Lane 6, a RCASBP(C)stva-mIgG infected bird; Lane 7, RCASBP(C)stva-mIgG infected DF-1 cells as a positive control.
- FIG. 15 Analysis of viral and soluble receptor RNA levels in tissues of chickens infected with RCASBP(B).
- the figure shows autoradiograms of 6%> polyacrylamide/7.6 M urea gels used to separate the protected RNA probe fragments produced in an RNase protection assay with RNA from a bird infected with RCASBP(B)stva or RCASBP(B)stva-mIgG.
- RNA was prepared from liver (L), heart (H), spleen (S), bursa (B), thymus (T), kidney (K), and muscle (M) tissues of each bird.
- RNA from DF-1 cells infected with the appropriate virus was included as a positive control (+).
- RNA from bursa of an uninfected bird was the negative control (-).
- ALV(B) env RNA protects a 467-nt fragment from the 522-nt 2 P-labeled full-length probe [env(B)];
- stva RNA protects a 388-nt fragment from the 498-nt probe (stva);
- stva-mlgG RNA protects a 363-nt fragment from the 423-nt probe (stva-mlgG).
- Each assay contained a chicken GAPDH probe as a control for RNA quality and quantity.
- GAPDH RNA protects a 200-nt fragment from the 279-nt GAPDH probe.
- FIG 16. Analysis of viral and soluble receptor RNA levels in the bursa of birds infected with RCASBP(B) vectors.
- the figure shows an autoradiogram of a 6% polyacrylamide/7.6 M urea gel used to separate the protected RNA probe fragments produced in an RNase protection assay with RNA from the bursa of birds infected with RCASBP(B) alone (V), RCASBP(B)stva (S), RCASBP(B)stva-mIgG (I), or uninfected (U).
- RNA from DF-1 cells infected with the appropriate virus was included as a positive control (+).
- ALV(A) env RNA protects a 423-nt fragment from the 483-nt 32 P-labeled full-length probe [env(A)];
- ALB(B) env RNA protects a 467-nt fragment from the 522-nt probe [env(B)];
- stva RNA protects a 388-nt fragment from the 498-nt probe (stva);
- stva-mlgG RNA protects a 363-nt fragment from the 423-nt probe (stva-mlgG).
- Each assay contained a chicken GapDH probe as a control for RNA quality and quantity.
- GAPDH RNA protects a 200-nt fragment from the 279-nt GAPDH probe.
- Genomic DNA was isolated from liver (L), heart (H), spleen (S), bursa (B), thymus (T), kidney (K), and muscle (M) samples of birds infected with RCASBP(B) alone (I), RCASBP(B)stva (II) and RCASBP(B)stva-mIgG (III) and challenged with RAV-1.
- DNA isolated from DF-1 cells infected with the appropriate virus was used as a positive control (+).
- DNA isolated from the bursa of an uninfected control bird was used as the negative control (-).
- DNA sequences were detected by PCR using specific primer pairs: RAV-1 challenge virus DNA [env(A)] was detected using primers specific for ALV(A) env yielding a 937 bp fragment; RCASBP(B) vector DNA [env(B)] was detected using primers specific for ALV(B) env yielding a 429 bp fragment; stva DNA (stva) and stva-mlgG DNA (stva-mlgG) were detected with specific primers yielding fragments of 314 bp and 589 bp respectively.
- the amplified DNA fragments were separated on 0.8%o agarose gels and visualized with ethidium bromide.
- the molecular weight marker is the 1 Kb plus DNA ladder (Gibco).
- Figure 18 A) Nucleotide sequence of env gene of PERV 1.15 (SEQ ID NO: 18). B) Nucleotide sequence of PERV sequences in lambda Al clone (SEQ ID NO: 19). C) Nucleotide sequence of PERV sequences in lambda A10 clone (SEQ ID NO:20). D) Nucleotide sequence of PERV sequences in lambda Al l clone (SEQ ID NO:32). E) Nucleotide sequence of PERV sequences in lamba A3A clone (SEQ ID NO:21). F) Nucleotide sequence of PERV sequences in lambda A6 clone (SEQ ID NO:22). G) Nucleotide sequence of PERV sequences in lambda clone A8 (SEQ ID NO:23). Detailed Description of the Invention
- isolated and/or purified refer to in vitro preparation, isolation and/or purification of a nucleic acid molecule or polypeptide (e.g., antibody) of the invention, so that it is not associated with in vivo substances.
- the "isolated nucleic acid molecule” (1) is not associated with all or a portion of a polynucleotide in which the "isolated nucleic acid molecule” is found in nature, (2) is operably linked to a polynucleotide which it is not linked to in nature, or (3) does not occur in nature as part of a larger sequence.
- An isolated nucleic acid molecule means a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.
- the term includes single and double stranded forms of DNA.
- oligonucleotide referred to herein includes naturally occurring, and modified nucleotides linked together by naturally occurring, and non-naturally occurring oligonucleotide linkages.
- Oligonucleotides are a polynucleotide subset with 200 bases or fewer in length.
- oligonucleotides are 10 to 60 bases in length and most preferably 12, 13, 14, 15, 16, 17, 18, 19, or 20 to 40 bases in length.
- Oligonucleotides are usually single stranded, e.g., for probes; although oligonucleotides may be double stranded, e.g., for use in the construction of a variant. Oligonucleotides ofthe invention can be either sense or antisense oligonucleotides.
- the term "naturally occurring nucleotides” referred to herein includes deoxyribonucleotides and ribonucleotides.
- modified nucleotides referred to herein includes nucleotides with modified or substituted sugar groups and the like.
- oligonucleotide linkages includes oligonucleotides linkages such as phosphorothioate, phosphorodithioate, phophoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoraniladate, phosphoroamidate, and the like.
- An oligonucleotide can include a label for detection, if desired.
- isolated polypeptide means a polypeptide encoded by cDNA or recombinant RNA, or is synthetic origin, or some combination thereof, which isolated polypeptide (1) is not associated with proteins found in nature, (2) is free of other proteins from the same source, e.g., free of human proteins, (3) is expressed by a cell from a different species, or (4) does not occur in nature.
- sequence homology means the proportion of base matches between two nucleic acid sequences or the proportion amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%o, the percentage denotes the proportion of matches over the length of a sequence that is compared to some other sequence (the reference sequence). Gaps (in either ofthe two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less are preferred with 2 bases or less more preferred.
- the sequence homology between the target nucleic acid and the oligonucleotide sequence is generally not less than 17 target base matches out of 20 possible oligonucleotide base pair matches (85%); preferably not less than 9 matches out of 10 possible base pair matches (90%), and more preferably not less than 19 matches out of 20 possible base pair matches (95%>).
- the term "selectively hybridize” means to detectably and specifically bind.
- Polynucleotides, oligonucleotides and fragments ofthe invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids.
- High stringency conditions can be used to achieve selective hybridization conditions as known in the art and discussed herein.
- the nucleic acid sequence homology between the polynucleotides, oligonucleotides, and fragments ofthe invention and a nucleic acid sequence of interest is at least 65%>, and more typically with preferably increasing homologies of at least about 70%, about 90%>, about 95%>, about 98%>, and 100%).
- Preferred PERV nucleic acid sequences for use in the methods ofthe invention are those which have at least about 80%>, more preferably 90%), and even more preferably 95%o, contiguous nucleotide sequence homology or identity to SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:32.
- PERV nucleic acid sequences are those which hybridize under moderate, preferably under stringent, hybridization conditions to SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:32.
- Two amino acid sequences are homologous if there is a partial or complete identity between their sequences. For example, 85% homology means that 85%o ofthe amino acids are identical when the two sequences are aligned for maximum matching. Gaps (in either ofthe two sequences being matched) are allowed in maximizing matching; gap lengths of 5 or less are preferred with 2 or less being more preferred. Alternatively and preferably, two protein sequences (or polypeptide sequences derived from them of at least 30 amino acids in length) are homologous, as this term is used herein, if they have an alignment score of at more than 5 (in standard deviation units) using the program ALIGN with the mutation data matrix and a gap penalty of 6 or greater. See Dayhoff, M.
- a polynucleotide sequence is homologous (i.e., is identical, not strictly evolutionarily related) to all or a portion of a reference polynucleotide sequence, or that a polypeptide sequence is identical to a reference polypeptide sequence.
- the term “complementary to” is used herein to mean that the complementary sequence is homologous to all or a portion of a reference polynucleotide sequence.
- the nucleotide sequence "TATAC” corresponds to a reference sequence "TATAC” and is complementary to a reference sequence "GTATA".
- reference sequence is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing, or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length, and often at least 50 nucleotides in length.
- two polynucleotides may each (1) comprise a sequence (i.e., a portion ofthe complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) may further comprise a sequence that is divergent between the two polynucleotides
- sequence comparisons between two (or more) polynucleotides are typically performed by comparing sequences ofthe two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity.
- a “comparison window”, as used herein, refers to a conceptual segment of at least 20 contiguous nucleotides and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment ofthe two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2: 482, by the homology alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48: 443, by the search for similarity method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci.
- sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
- percentage of sequence identity means that two polynucleotide sequences are identical (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
- percentage of sequence identity is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
- the identical nucleic acid base e.g., A, T, C, G, U, or I
- substantially identical denote a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 20 nucleotide positions, frequently over a window of at least 20-50 nucleotides, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less ofthe reference sequence over the window of comparison.
- substantially identical means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least about 80 percent sequence identity, preferably at least about 90 percent sequence identity, more preferably at least about 95 percent sequence identity, and most preferably at least about 99 percent sequence identity.
- stringent conditions are those that (1) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate (SSC); 0.1% sodium lauryl sulfate (SDS) at 50°C, or (2) employ a denaturing agent such as formamide during hybridization, e.g., 50%> formamide with 0.1 % bovine serum albumin/0.1% Ficoll/0.1%> polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42°C.
- SSC 0.015 M NaCl/0.0015 M sodium citrate
- SDS sodium lauryl sulfate
- a denaturing agent such as formamide during hybridization, e.g., 50%> formamide with 0.1 % bovine serum albumin/0.1% Ficoll/0.1%> polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with
- Another example is use of 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1%) sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 ⁇ g/ml), 0.1 % sodium dodecylsulfate (SDS), and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and 0.1% SDS.
- the present invention describes a method of interfering with viral replication.
- the fusion of an enzyme such as a nuclease, lipase, or protease
- a viral capsid, glycoprotein or accessory polypeptide which is incorporated into virions can inactivate essential viral components, such as nucleic acid, protein or lipid, which are necessary for replication.
- This technique is referred to as capsid-targeted viral inactivation (CTVI), although it includes the targeting of non-capsid fusions, e.g., env fusions, to the virion as well.
- the present invention uses nucleases, proteases, and/or lipases as antiviral therapeutic agents that degrade or modify essential viral components, such as nucleic acids, proteins, or lipids.
- the method ofthe present invention can be applied to viruses that have relatively flexible capsid structures such as retroviruses, lentiviruses, herpesviruses, poxviruses, togaviruses, hepadnaviruses, caulimoviruses, myxoviruses and paramyxoviruses, that readily allow the encapsidation of foreign proteins in an aqueous internal compartment containing the viral nucleic acid.
- Preferred viruses to be inhibited by the methods ofthe invention include porcine endogenous retroviruses (PERVs), herpesviruses such as EBV and CMV, and hepatitis viruses, e.g., hepatitis A, B, and C. See Fields, Virology, Lippincourt-Raven, Philadelphia, PA (1996), which is specifically incorporated by reference herein.
- the enzyme portion of the fusion protein preferably is oriented so that it is internal to the assembled capsid structure. However, externally facing enzymes may be used in the case of proteases and lipases. The use of such constructs does not require the virus to have an aqueous internal compartment. In the case of lipases, it is desirable to target the enzyme to the envelope ofthe virus.
- the enzyme portion can be either inside or outside the viral envelope. In this way, any enveloped virus can be targeted by CTVI. Retroviruses, and the closely related retrotransposons, which are referred to herein generically as retroviruses, are particularly susceptible to CTVI because of their assembly mechanism. It is possible to take advantage ofthe knowledge of how these capsids assemble to direct a destructive enzyme molecule to the inside surface ofthe capsid, where it can contract viral nucleic acids or proteins. Retroviral and retrotransposon reverse transcriptases are expressed as natural fusion proteins, in which the polymerase protein forms the C-terminal portion of the primary translation product and the gag protein forms the N-terminal portion.
- Gag-Pol fusion proteins are formed in different retroviruses vary, sometimes involving frameshifting during translation, suppression of a nonsense codon, or splicing. Regardless ofthe mechanism of synthesis, the reverse transcriptase protein sequence is found at the C-terminus ofthe Gag protein sequences. In addition, the reverse transcriptase is found internal to the capsid structure. Substitution of a destructive enzyme coding region for the reverse transcriptase gene (i.e., inserting an open reading frame for a destructive enzyme into the pol gene in frame), leads to the assembly ofthe enzyme in retroviral particles.
- the nuclease or protease is oriented relative to the capsid in such a way as to have access to the viral RNA or reverse transcriptase.
- Gag-degradative enzyme fusions as well as gag-pol-degradative enzyme fusions and env-degradative enzyme fusions, are envisioned.
- the amino acid linkage between the viral proteins and the degradative enzyme may include sequences that are susceptible to proteases present in the virion, and so are cleaved to yield a soluble degradative enzyme.
- a dominant negative effect is obtained by fusion of a protein with a destructive or modifying enzymatic activity that can alter or destroy an essential component ofthe virus (e.g., DNA, RNA or protein).
- the destructive or modifying activity is targeted to the desired site of action (inside or closely adjacent to the virus particle) because it is covalently linked to a core protein of the viral particle, e.g., in the same manner as reverse transcriptase.
- CTVI Besides its versatility, one ofthe main advantages of CTVI is that it is enzymatic. It does not rely on massive over-expression of a mutant protein that in some way interferes with the viral life cycle, as is the case in the strategies referenced above. Rather, a small number of enzyme molecules (e.g., nucleases) are incorporated into a viral particle, and they cleave or modify one or more essential components of the virus.
- enzyme molecules e.g., nucleases
- CTVI also has advantages over traditional chemotherapy. Viruses, especially viruses with error-prone replicative mechanisms such as HIV and other retroviruses, are likely to become resistant to a chemotherapeutic agent. For example, HIV isolates resistant to AZT, a widely used anti-HIV drug, have been reported. Clearly, resistance to drugs is an important problem with viral infections just as it is for bacterial infections. Gene therapy or intracellular immunization strategies may also be subject to problems of resistance. For example, if a virus mutates such that the capsid protein no longer assembles with the capsid fusion protein ofthe present invention, the virus will become resistant to the particular CTVI therapy.
- the DNA ofthe mutant virus can be cloned and the mutant capsid gene can be fused to the gene encoding a nuclease or other enzyme, thereby restoring the efficacy ofthe therapy.
- This approach is not possible with normal drug therapy; once a virus becomes resistant to a given drug, use of that drug has to be abandoned.
- Fusion proteins according to the present invention comprise a destructive enzyme which is capable of destroying the replication ability of a virus or virus- like particle.
- replication ability encompasses infectivity of a virus particle or transposition of a retrotransposon.
- the destructive enzyme is a nuclease, lipase or protease.
- Protein-modifying enzymes, such as kinases, which diminish enzyme activity can also be used, for example, one which inactivates a viral encoded polymerase.
- Fusion proteins also comprise a capsid protein, such as Gag, which confers upon the fusion proteins the ability to co-assemble into a virus particle or envelope protein.
- Nucleases which can be used in the practice ofthe present invention to make fusions include restriction endonucleases such as EcoRI, and less specific RNAses, such as Tl RNase, barnase, RNase HI, RNase III, retroviral RNase H domains from reverse transcriptase, and staphylococcal nuclease (SN).
- Other destructive enzymes which can be used in the practice ofthe present invention include proteases, e.g., nonhomologous retroviral proteases, and lipases. Any such enzymes known in the art can be used.
- proteins and lipids which may be essential for the replication (infectivity) of particular viruses.
- Other enzymes which modify protein structures may be used, if they result in the inactivation of proteins which are necessary for the viral life cycle.
- protein modification enzymes include: kinases, glycosylases, phosphatases, methyl transferases, acetylases, acylases, farnesyl transferases, and demyristylases.
- each virus particle formed have at least a single molecule ofthe fusion protein.
- statistical considerations would dictate that expression at a rate greater than one molecule of fusion protein per virus particle be obtained.
- calcium dependent enzymes may be used, which require a threshold level of calcium for activity.
- Calcium-dependent destructive enzymes which may be used include calpain, phospholipase A2 and staphylococcal nuclease. It may also be desirable to non-conditionally diminish the activity of the destructive enzyme to a level which is not toxic to cells but which is toxic to viruses. Random mutagenesis can be used to accomplish this end.
- DNA molecules are also provided according to the invention, which code for fusion proteins as described above.
- the DNA molecules comprise appropriate transcriptional and translational control signals which allow the DNA molecules to be expressed in the host cells ofthe viruses from which the capsid or envelope protein is derived.
- the expression ofthe fusion proteins may be dependent upon the presence of virus in the cell.
- Recombinant virus is also provided by the present invention. These particles comprise a nucleic acid molecule encoding a fusion protein, as described above. Thus, infection of cells with these recombinant viruses will yield fusion proteins.
- the recombinant virus is desirably not related to the virus from which the capsid or envelope protein ofthe fusion protein is derived.
- the recombinant virus is a mere vehicle for introduction of the fusion constructs.
- the normal infection cycle ofthe viruses proceeds. However, when the viruses encapsidate viral nucleic acid, wild-type capsid or envelope proteins co-assemble with fusion proteins.
- the newly assembled viruses are hybrids comprising wild-type and fusion capsid or envelope proteins.
- the newly assembled viruses are not infective because the enzyme portion of the fusion protein inactivates either the viral nucleic acid or the essential viral- packaged proteins or lipid comprising the viral envelope.
- nucleic acid molecules are those comprising PERV nucleic acid sequences.
- nucleic acid molecules encoding PERV capsid or env are employed.
- recombinant virus may be obtained from cells, e.g., helper cells, transfected or infected with a recombinant DNA molecule encoding a fusion protein comprising PERV capsid linked to a degradative enzyme.
- the degradative enzyme is proteolytically cleaved from the fusion protein, i.e., it is soluble within the virion.
- a method of inhibiting virus replication or infectivity is also provided by the present invention.
- a nucleic acid molecule encoding a fusion protein is introduced into a cell susceptible to a virus.
- the fusion protein may comprise a capsid or envelope protein ofthe virus as well as a destructive enzyme as described above.
- the method of introducing the nucleic acid molecule into the cell is not critical to the invention, and many such methods are known in the art. These include, without limitation: infection, transformation, transfection, lipofection, tungsten microprojectiles, electroporation, cell fusion, and transduction.
- Nucleic acid molecules encoding the fusion protein ofthe present invention can be introduced into solid organs, tissues or cells, e.g., stem cells of the hematopoietic lineage or B lymphocytes. T-lymphocytes and monocytes/macrophages, which are derived from hematopoietic stem cells, are the primary target of viruses such as HIV.
- Bone marrow cells can be taken from an individual, and if desired, the stem cells can be purified from the mixed population of marrow cells.
- the nucleic acid molecules ofthe present invention can be introduced into the stem cells by means of transfection, or any other means known in the art.
- the transfected stem cells can then be reinfused into the individual (autologous stem cell transplantation). To facilitate proliferation of the transplanted stem cells, the individual's bone marrow can be partially cleared by irradiation or chemotherapy.
- the nucleic acid molecule ofthe present invention is introduced into an animal, or gametic cells or embryos. Techniques such as microinjection or transfection can be used, as is well known to the art.
- the nucleic acid-treated cells can be used in artificial insemination (gametes) or can be reimplanted into a hormone-prepared female animal (embryos) as is known in the art.
- a recombinant virus can be used.
- the recombinant virus is desirably derived from a virus having the same cell-type tropism as the virus from which the capsid or envelope protein ofthe gene fusion is derived.
- a PERV viral vector may be used.
- the recombinant virus is then administered according to a route of viral infection for the particular virus ofthe vector.
- hybrid virus particles which contain the nucleic acid ofthe present invention but do not contain the fusion protein of the invention.
- Hybrid viruses can be prepared which contain the nucleic acid encoding the fusion protein ofthe present invention using a packaging cell line. Such cell lines may be propagated in culture according to techniques well known in the art. Such cell lines produce the proteins necessary for packaging viral genomes.
- the nucleic acids ofthe present invention can be introduced into such a packaging cell line. Desirably, the nucleic acids will contain the packaging signal which is recognized by the packaging proteins ofthe cell line.
- the fusion protein gene is under the control of an inducible promoter, such as the metallothionine promoter.
- an inducible promoter such as the metallothionine promoter.
- the inducible promoter can be induced to turn on transcription ofthe fusion protein gene construct, and a protein synthesis inhibitor, such as cycloheximide, can be added so that the fusion protein transcript is not translated in the packaging cell line.
- a protein synthesis inhibitor such as cycloheximide
- the fusion protein gene construct is transcribed and packaged into the particles produced by the cell line, without interference from (co-assembly with) the fusion protein.
- the packaged particles are used to infect cells, the nucleic acid encoding the fusion protein is expressed, and the fusion protein becomes co-assembled into the progeny particles, rendering them non-infectious.
- a nucleic acid molecule which encodes a fusion protein as described above is introduced into the germ line of an animal or an embryo, or to the animal, e.g., via DNA immunization or by infection with recombinant virus.
- Methods for the introduction of nucleic acid molecules to animals are known in the art (see, for example, Salter et al., 1991 ; Salter et al., 1989; Henininghausen, 1990; Ebert et al., 1991 ; Wright et al., 1991; Jaenish, 1988; Wagner et al. (U.S. Patent No.
- Another antiviral strategy targets the first step in the virus life cycle, the interaction ofthe viral envelope glycoprotein(s) with a host cell receptor.
- retroviral infection of cells can be significantly reduced by expressing soluble forms ofthe host receptor, which bind the glycoproteins ofthe incoming virions before the virion can bind to the host receptor, or the viral envelope glycoproteins (the product ofthe env gene), which block the host receptors, directly preventing virion binding.
- the env gene of retroviruses and lentiviruses encodes a polyprotein precursor that is subsequently processed into two glycoproteins, the surface glycoprotein (SU) which contains the domains that interact with the host receptor, and the transmembrane glycoprotein (TM) that anchors the SU protein to the membrane and appears to be directly involved with the fusion between the virus and cell membranes.
- SU surface glycoprotein
- TM transmembrane glycoprotein
- dsDNA double-stranded DNA
- RT reverse transcriptase
- LTRs long terminal repeats
- retroviruses, and vectors that derive from them appear to require the breakdown ofthe nuclear membrane that occurs during mitosis for the viral DNA to gain access to the cellular genome.
- the linear viral DNA is inserted into the host genome by the virally encoded enzyme integrase (IN).
- the integrated viral DNA is called a provirus. Efficient production of progeny viruses requires the integration ofthe viral genome into host DNA.
- the susceptibilities ofthe alv ⁇ and alvll transgenic lines to ALV(A) infection and associated pathogenesis were compared to other properties (e.g., resistance measured in vitro, env expression levels, etc.) to determine which characteristics were important indicators of an antiviral effect in vivo. None ofthe alv ⁇ birds were productively infected as determined by the absence of both infectious ALV(A) and ALV (A) neutralizing antibodies, while two-thirds ofthe alvll birds were productively infected by ALV(A). However, neither the alv ⁇ nor the alvll chickens showed significant ALV-induced pathogenesis. Thus, the level of Env glycoprotein expressed in the target tissues for ALV pathogenesis determined the magnitude of ALV interference (Federspiel et al., 1991).
- Reticuloendotheliosis virus is very cytotoxic to avian cells in vitro presumably due to the fusionogenic properties ofthe envelope glycoproteins, especially the TM glycoprotein.
- REV stocks are therefore produced in D17 cells, a canine osteosarcoma line tolerant to REV infection.
- D17 cell lines expressing the REV envelope glycoproteins were significantly more resistant to REV infection (up to 25, 000-fold) compared to controls.
- the same REV envelope expression cassette was delivered into chicken embryo fibroblasts (CEF)
- the REV envelope gene sustained large deletions and the envelope proteins were not expressed due to cytotoxicity ofthe REV envelope glycoproteins to CEF cells.
- soluble forms of viral envelope glycoprotein are employed.
- the soluble protein differs from the wild-type protein in that it lacks the transmembrane (TM) domain which anchors the protein in the membrane, and are therefore secreted from the cell.
- TM transmembrane
- Example 1 Expression of a Mo-MLV Gag-E. coli RNase H Fusion Polyprotein
- a gene encoding a Mo-MLV Gag-E. coli RNase HI fusion was constructed by linking the RNase HI coding region to the Mo-MLV Gag polyprotein six codons upstream ofthe Gag termination codon (Van Brocklin et al., 1997).
- the RNase HI coding sequence was isolated from E.
- the Mo-MLV Gag-RNase H fusion construct was based on the design ofthe Mo-MLV Gag-SN fusion which has been used to introduce SN into virions (Natsoulis et al., 1995).
- the genes encoding the CTVI constructs were delivered into C ⁇ F by the RCASBP(A) retroviral vector and expressed under the control ofthe viral promoter-enhancer in the long terminal repeat.
- C ⁇ F were cultured and passaged every 2 days when they reached confluence (Federspiel et al., 1994).
- ALV retroviral vector propagation was initiated by transfection of plasmid DNA that contained the retroviral vector in a proviral form by the calcium phosphate precipitation method (Kingston et al., 1989). The course ofthe retroviral infection was monitored by assaying culture supernatants from confluent cells for the viral Gag protein.
- Mo-MLV Gag-SN plasmid pGNl 600 (Natsoulis et al., 1995); Mo-MLV Gag plasmid pGN1601 (Natsoulis et al., 1995), which produces only the Mo-MLV Gag polyprotein; and Mo-MLV Gag-SN* plasmid pGS293 (Schumann et al., 1996), which differs from Mo-MLV Gag-SN in two missense mutations in the SN gene that result in an inactive SN enzyme.
- Mo(4070A) is an engineered hybrid Mo-MLV that contains the env gene and a portion of the o/ gene ofthe amphotropic 4070A virus.
- the Mo(4070A) virus stock was produced on NIH 3T3 cells (1 x 10 6 to 2 x 10 6 FFU/ml). Infectious virus was quantitated by the S+L- focus assay on D56 cells (Bassin et al., 1971). The CEF cultures, which were dividing rapidly, were passaged for 14 days after Mo(4070A) infection. Infectious Mo(4070A) was quantitated at day 14 by the S+L- focus assay (Table 1). CEF expressing the Mo-MLV Gag-RNase H polyprotein reduced the level of infectious Mo(4070A) produced by more than 1, 500-fold compared to the Mo(4070A)- infected CEF control.
- the Mo-MLV Gag polyprotein levels may decrease slightly due to proteolytic processing by protease from the infectious Mo(4070A).
- the levels ofthe MA protein (about 19 kDa) from the RCASBP(A) retroviral vector remained relatively constant throughout the experiment.
- the Mo-MLV Gag-SN fusion polyprotein was tested in parallel with the
- Mo-MLV Gag-RNase H fusion to provide a direct comparison to a characterized CTVI construct known to have antiviral activity.
- the antiviral effect of Mo-MLV Gag-SN was 100-fold greater in the experiments reported herein (> 3, 000-fold [Table 1]) than that previously observed (about 30-fold [Natsoulis et al., 1995]).
- the increase in the antiviral effect may be due to an increase in the efficiency of producing CEF cultures that express higher levels of the fusion polyprotein.
- the CEF themselves grew at a faster rate, presumably due to changes in the growth media including different serum lots. This difference in growth rate was especially apparent in CEF infected with Mo(4070A).
- Mo(4070A) infection dramatically slowed the growth of CEF and caused some cytotoxicity.
- CEF chronically infected with Mo(4070A) were transfected with the RCASBP(A) retroviral vector plasmids containing the Mo- MLV Gag fusions and passaged for 16 days.
- CEF chronically infected with Mo-MLV were generated by infecting 4 x 10 6 cells with 2 x 10 6 FFU of Mo(4070A) (1 ml of virus stock) and passaging the culture four to six times to allow maximum spread ofthe virus.
- the Mo(4070A)- infected CEF cultures produced a maximum titer of 3 x 10 5 to 4 x 10 5 FFU/ml as quantitated by the S+L- focus assay.
- the RCASBP virus spread through Mo(4070A)-infected CEFs with kinetics similar to the spread on CEF that had not been infected with Mo(4070A), reaching maximum levels after about 8 days as determined by Western analysis of ALV MA levels.
- the levels of infectious Mo(4070A) were quantitated throughout the experiment.
- the Mo(4070A) titers at 14 days posttransfection in two experiments are shown in Table 2.
- the level of infectious Mo(4070A) was reduced 7.5- to 18-fold in CEF expressing the Mo- MLV Gag-RNase H polyprotein and 15- to 38-fold in CEF expressing the Mo- MLV Gag-SN polyprotein.
- Infection with the RCASBP(A) vector alone or RCASBP(A) expressing the Mo-MLV Gag polyprotein lowered the titer of Mo(4070A) produced by a chronically infected culture two- to three-fold compared to Mo-MLV-infected CEF. This suggests that only a slight therapeutic effect is directly attributable to the CTVI constructs once the infection is established.
- Mo-MLV Gag 1 x 10 5 (3) 1.6 x 10 5 (2.4) Mo-MLV Gag-RNase H 4 x 10 4 (7.5) 2.1 x 10 4 (18) Mo-MLV Gag-SN 2 ⁇ 10 4 (15) 1.3 10 4 (29)
- CEF chronically infected with Mo(4070A) were transfected with plasmids containing the RCASBP(A) retroviral vector-CTVI constructs.
- Levels of infectious Mo-MLV in supernatants were quantitated 14 days posttransfection by S+L- focus assays. The experiment was performed twice.
- Titers were averages of duplicate assays.
- c Fold inhibition was determined by comparing the mo-MLV tiers ofthe experimental constructs to the Mo-MLV titer on mock-treated CEF. d ND, not done.
- An Mo-MLV Gag polyprotein fusion junction was designed that could be cleaved by the protease of an incoming infectious Mo-MLV by including the region six amino acids on either side ofthe normal Mo-MLV protease cleavage site (PRCS).
- the new Gag fusion plasmid moves the BamHI site to a position just downstream ofthe Gag termination codon (pMGagPRCS).
- the termination codon was changed to a codon for glutamine, the same amino acid that Mo-MLV inserts during suppression of the stop codon when the Gag-Pol polyprotein is produced.
- Virion proteins isolated from day 16 ofthe therapy assay of Mo-MLV-infected CEF and CEF expressing Mo-MLV Gag, Mo-MLV Gag- RNase H, and Mo-MLV Gag PRCS-RNase H were assayed for RNase H activity by in situ RNase H assay. Only virions from Mo-MLV Gag-RNase H and Mo- MLV Gag PRCS-RNase H cultures contained measurable RNase H activity. A new protein with RNase H activity about 22 kDa was observed in virions obtained from cultures expressing the Mo-MLV Gag PRCS-RNase H polyprotein. Presumably, this protein, which corresponds in size to E.
- coli RNase HI is the RNase HI domain cleaved from the Mo-MLV Gag PRCS- RNase H polyprotein by the Mo-MLV protease.
- the ability to release a degradative enzyme from the polyprotein should make it possible to design
- CTVI Inhibition of Mo-MLN Replication in Avian DF-1 Cells Line 0 CEF have been the cells of choice for the study of ALV, since line 0 does not contain endogenous loci related to ALV and produces high ALV titers. However, CEF are primary cells and have a limited life span (i.e., about 25 passages). Recently, a permanent cell line was derived from line 0 CEF, named DF-1 (Dr. Douglas Foster, University of Minnesota).
- ALV-based retroviral vectors and Mo-MLV were compared in DF-1 and CEF.
- the DF-1 and CEF cells grow at similar rates and support vigorous growth of ALV and Mo-MLV.
- the rate at which both ALV and Mo-MLV reach maximum titers, and the level of viral protein produced, is approximately the same in either cell type.
- the titer ofthe ALV-based retroviral vectors is 5- 10-fold higher when produced in DF-1 cells compared to CEF.
- Mo-MLV Gag-RH ⁇ 10 (>30,000) 1 10 2 (2,000) ⁇ 10 (>21,000)
- Mo-MLV Gag-SN ⁇ 10 (>30,000) 1 x 10 2 (2,000) ⁇ 10 (>21,000)
- a Titers were averages of duplicate assays.
- b Fold inhibition was determined by comparing the Mo(4070A) titers of the construct to mock-treated DF-1 cells.
- c DF-1 cells chronically infected with RCASBP(A)-CTVI construct were challenged with Mo(4070A) (multiplicity of infection, 0.05-0.1 FFU per cell). Infectious Mo(4070A) levels were quantitated from supernatants by S+L- assay 30 days post-infection.
- d DF-1 cells chronically infected with Mo(4070A) were infected with
- RACSBP(A)-CTVI or RCASBP(C)-CTVI construct viruses The levels of infectious Mo(4070A) in supernatants were quantitated by S+L- assay 30 days post-infection. e RCASBP(A)-CTVI viruses were used to initiate the therapy assay with the maximum antiviral effect achieved at 30 days. f The antiviral constructs were delivered a second time by the RCASBP(C) vectors.
- Example 2 Human Tropic PERVs Produced by Pig Primary PBMC Methods Cells and Cell Culture.
- the cell lines used were either obtained from the
- PG-4 feline glial and astrocytes were maintained in McCoy's 5A medium supplemented with 15%> FBS, 2 mM glutamine, 1 mM sodium pyruvate, 100 U of penicillin per ml, and 100 ⁇ g of streptomycin per ml.
- HepG-2 hepatoblastoma (ATCC HB-8065) and HT1080 fibrosarcoma (ATCC CCL-121) were maintained in Eagle's Modified Essential Medium supplemented in a similar manner.
- the following cell lines were maintained in RPMI 1640 supplemented with 10%> FBS, 2 mM glutamine, 0.05 mg gentamicin sulfate per ml, IX non-essential amino acids (Biofluids, Rockville, MD): Molt 4 acute lymphoblastic (ATCC CRL-1582), Daudi Burkitt's lymphoma (ATCC CCL- 213), Raji Burkitts lymphoma (ATCC CCL-86), U937 histiocytic lymphoma (ATCC CRL 1593.2) UCLA-SO-M14 T cells (Ramsdell et al., 1988), and the human natural killer cell line YTN10 (Yodoi et al., 1985).
- PBMCs were obtained from NIH and Yucatan minipigs.
- Primary pig aortic endothelial cells are isolated by incubating the inner layer of pig aortas with 0.2%o collagenase type I for 20 minutes at 37°C. Detached cells are washed with phosphate-buffered saline, and cultured in Ml 99 medium supplemented with 10%o fetal bovine serum, 25 mM HEPES, 2 mM glutamine, 100 U per ml of penicillin, and 100 ⁇ g streptomycin. Cultures are fed three times per week and subpassaged every 4-7 days.
- Pig hepatocytes are isolated by a two-step perfusion technique as described by Sielaff et al. (1995).
- the liver is treated by systemic heparinization before isolation.
- the liver is then treated with an EDTA and collagenase D solution to free the hepatocytes.
- the hepatocytes are isolated by gently combing the liver, washing the dislodged cells in Williams E medium supplemented with 5%> calf serum, 2 mM L-glutamine, 15 mM HEPES, 1.5 mg/ml insulin, 100 U penicillin per ml and 100 ⁇ g streptomycin per ml.
- the freshly harvested hepatocytes are cultured in collagen gel.
- GlBgSvN vector genome contains the coding sequence for both neomycin phosphotransferase and for ⁇ -galactosidase, pseudotype infection is monitored by the acquisition of target cell resistance to G418 or by immunohistochemical detection of target cells expressing ⁇ -galactosidase.
- the cells were fed with fresh medium.
- ⁇ -galactosidase expression was used to monitor infectivity, the cells were fixed and histochemically stained 48-72 hours post- exposure to viral supernatant and observed microscopically to enumerate blue- staining foci of cells (BFU/ml), as described elsewhere (Wilson et al., 1991). If the experiment was performed to assess productive infection ofthe target cell, the cells would be passaged 1-2 times per week as needed during the course of the experiment and monitored as described below.
- the coculture of target cells with virus-producer cells was used to assess the ability of the virus to be transmitted to non-adherent cells. Since several different cell types were used as a source of virus-producer cells in these experiments, the dosage of irradiation required to ensure the virus-producer cells would die within 5 days after irradiation was first determined. Three to four x 10 6 cells for each virus-producer cell line were subjected to 2,000,5,000 or 10,000 rads (using a I37 Cs source, Nordion GammaCell 100) and seeded into a 96-well plate at 2-3 x 10 5 cells/well.
- Irradiated and control non-irradiated cells were monitored for proliferation daily for 5 days by measuring [ H]TTP uptake after cells were cultured for 8 h with 1.0 ⁇ Ci [ 3 H]TTP (6.7 Ci/mmol; Dupont NEN, Boston, MA), harvested (Skatron, Sterling, VA) and processed for scintillation counting. Based on these findings, the following conditions were used: Daudi cells received 2000 rad, Molt4 and U937 received 5000 rads.
- the target cells in the coculture were human peripheral blood mononuclear cells (hPBMC), the mononuclear layer was collected from a buffy coat from a human donor separated by lymphocyte separation medium (Organon Teknika, Durham, NC).
- the titer of infectious virus pseudotypes was determined by ⁇ - galactosidase expression.
- Cells were histochemically stained 48-72 hours after exposure to virus-containing supernatant, and foci of ⁇ -galactosidase expressing blue cells were counted (BFU/ml).
- BFU/ml foci of ⁇ -galactosidase expressing blue cells.
- Those titers were then normalized to the titer observed on 293 cells exposed to the same viral supernatant and are reported as %> of control. The titer observed on 293 cells ranged 10-fold from several hundred BFU/ml to 2-3,000 BFU/ml.
- Virions are isolated for RT assays and Western analysis by ultracentrifugation of 10 ml virus stock underlaid with 1 ml 20%> sucrose at 35,000 rpm in a Beckman SW40 rotor for 1 hour at 4°C to pellet the virus (Federspiel et al., 1994). The viral pellet is then resuspended in either RT assay buffer or Laemmli load buffer.
- PERV virions are further purified for antibody production either by sucrose equilibrium density centrifugation or by a sucrose step gradient to concentrate the virions and remove proteins, nucleic acids and ribosomes from the cell supernatants.
- the supernatants are mixed with sucrose to a density slightly higher than 1.16 g/ml, the average buoyant density of retroviral particles, and the gradient formed by ultracentrifugation.
- Viral supernatants are layered onto a two-step sucrose gradient, 20%o and 50%o, and the virions banded at the boundary between the sucrose steps. In both methods, the banded virions are harvested by removing the band with a syringe through the side ofthe tube to prevent contamination.
- PERV-A TGGAAAGATTGGCAACAGCG and AGTGATGTTAGGCTCAGTGG (SEQ ID NO:8 and SEQ ID NO:9, respectively);
- PERV-B TTCTCCTTTGTCAATTCCGG and TACTTTATCGGGTCCCACTG (SEQ ID NO: 10 and SEQ ID NO:l 1, respectively);
- PERV-C TTCTCCTTTGTCAATTCCGG and TACTTTATCGGGTCCCACTG
- PCR products were separated on a 1.0%) agarose gel and DNA fragments of 2-2.5 kB were purified using Qiaex gel purification kit (Qiagen, Valencia, CA). Purified PCR products were then cloned into the TA vector using the TA Cloning Kit (In Vitrogen, Carlsbad, CA). Restriction analysis of clones derived from the TA vector was used to ensure an insert of the appropriate size was present. A minimum of 4 representative clones was chosen for sequence analysis.
- RNA is isolated from virions with RNA STAT 50-LS or STAT-60 (Tel-Test, Inc., Friendswood, TX), and converted to cDNA with 2.5 ⁇ M random hexanucleotide primers and Superscript II (Life Technologies, Gaithersburg, MD) (Wilson et al., 1998).
- cDNA templates are amplified with primers corresponding to the PERV pol/env gene boundary (ACCTCGAGACTCGGTGGAAGGG; SEQ ID NO: 14) and the untranslated region 3' ofthe PERV env gene (CTGGGTTCTGGGAGGGTTAGGTTG; SEQ ID NO: 15), or amplified with PB906 (5' ACGTACTGGAGGAGGGTCACCTGA 3'; SEQ ID NO: 16) and PB908 ('5 GTCCCGAACCCTTATAACCTCTTG 3'; SEQ ID NO: 17) or PERVenvl (sense) (5' ACCTCGAGACTCGGTGGAG; SEQ ID NO:l 1) and PERVenv2 (anti-sense) (5' CTGGGTTCTGGGAGGGTTAGGTTG; SEQ ID NO: 12) for 30 cycles at 94°C for 30 seconds, at 60°C for 30 seconds, and at 72°C for 1 minute.
- the amplified products are cloned
- RT assays The RT assays are conducted as described in Wilson et al. (1994) and Wilson et al. (1998) and are optimized for the detection of PERV RT as reported by Phan-Thanh et al. (1992). Pelleted virions or virions in cleared supernatant are treated in solubilization buffer (25 mM NaCl, 0.20% Triton X- 100, 10 mM Tris, pH 7.5) for 15 minutes at ambient temperature.
- solubilization buffer 25 mM NaCl, 0.20% Triton X- 100, 10 mM Tris, pH 7.5
- solubilized samples are incubated for 3 hours at 37°C in 2X substrate buffer (50 mM Tris, pH 7.5, 10 mM dithiothreitol, 0.6 mM MnCl 2 , 10 ⁇ g of poly (rA)-poly (dT) 12 _ 18 (Pharmacia, Piscataway, NJ) per ml, and 10 ⁇ Ci of 3 H[TTP] per 25 ⁇ l (22 Ci/mmol).
- 2X substrate buffer 50 mM Tris, pH 7.5, 10 mM dithiothreitol, 0.6 mM MnCl 2 , 10 ⁇ g of poly (rA)-poly (dT) 12 _ 18 (Pharmacia, Piscataway, NJ) per ml, and 10 ⁇ Ci of 3 H[TTP] per 25 ⁇ l (22 Ci/mmol).
- the incubation is terminated with EDTA followed by blotting the synthesized DNA on a DEAE filtermat (LKB-Wallac, Gaithersburg, MD) through use of a harvesting apparatus (Skatron, Sterling, VA) with a rinse of 1%> Na 2 HPO 4 (pH 7.0) containing 1 mM EDTA. Radioactivity is then determined via liquid scintillation. All samples are assayed in triplicate.
- RNase protection assays RPA
- RNA from viral particles or cells is extracted using RNAzolTM B (Tel-Test, Inc., Friendswood, TX). RPA are done with the RPA II Ribonuclease Protection Assay Kit (Ambion, Inc., Austin, TX). Antisense riboprobes are synthesized in the presence 32 P[UTP] using the RNA Transcription Kit (Stratagene, La Jolla, CA). In standard RPA conditions, labeled riboprobe (5 10 5 cpm) is incubated with the RNA at 50°C overnight. The annealed reaction is digested with an RNase A/Tl mix at 30°C for 45 minutes. The samples are cleaned up and fractionated on 6% acrylamide-7.6 M urea gels, dried and exposed to Kodak X-OMAT film.
- PBMC Primary PBMC were isolated from an NIH miniature pig and exposed to two different combinations of mitogens: phytohemagglutinin (PHA) and phorbol myristate acetate (PMA) or PMA and the calcium ionophore A23187. Mitogenic activation by either treatment resulted in a sharp increase in reverse transcriptase (RT) activity levels five days after stimulation ( Figure 1A). To determine if the increase in RT activity correlated with the production of infectious virus, stimulated PBMC from NIH and Yucatan minipigs were cocultured with the pig ST-IOWA cell line, a line that does not produce significant endogenous RT activity levels in the supernatants but is susceptible to PERV infection.
- PHA phytohemagglutinin
- PMA phorbol myristate acetate
- RT reverse transcriptase
- the titers of all three PERV cultures were approximately the same on the control ST-IOWA cells ( Figure 3). However, the titers ofthe MLV- ⁇ gal/PERV pseudotypes produced from the 2°-293 and 3°-293 cultures were 5-fold higher compared to the 1 °-293 culture.
- the relative copy number of integrated PERV proviruses in these three PERV infected 293 cultures was quantitated by Southern analysis. As shown in Figure 4, the DNA isolated from the 2°- 293/PERV and 3°-293/PERV cultures contained more integrated PERV proviruses per cell relative to the DNA ofthe l°-293/PERV cultures.
- MLV- ⁇ gal pseudotypes were produced in the PERV infected human cultures: negative (-); 1-100 BFU/ml (+); >100 BFU/ml (++).
- PERV Produced by the 293/PERV Cultures Can Productively Tnfect Other Human, Mink and Cat Cell Lines.
- a number of different cell lines were employed to determine the tissue and species specificity of PERV produced by 293/PERV cultures (Table 5). All the cell lines tested except Caco-2 were productively infected by the virus populations produced by the 2° and 3°- - 293/PERV cultures.
- the 3°-293/PERV infected Caco-2 culture produced RT activity at day 18 and detectable pol RNA by RT-PCR indicating a productive infection.
- the 1°- 293/PERV culture produces 5-fold lower PERV titers (see Figure 3) which may account for the lower replication efficiency in most lines.
- the transfer of significant levels of replication-defective PERV genomes into the primary 293 cells may account for the lower titers.
- the ability of the PERV produced by the 2° and 3°- 293/PERV cultures to efficiently replicate in most cultures may be the result of the loss of defective interfering PERV genomes or the adaptation ofthe virus, or both.
- telomeres were cocultured with irradiated 293/2° virus-producer cells and maintained in IL-2-containing medium for 8 weeks. No RT activity above background levels or viral RNA as measured by RT-PCR were produced during the course ofthe experiment. Since maintenance ofthe hPBMC in IL-2 during the course ofthe experiment biases the culture conditions towards the proliferation of T cells, other hematopoietic lineages that may be susceptible to infection may not have been represented.
- hematopoietic lineages may be permissive for infection
- a number of human hematopoietic cell lines representing the T cell, B cell, myeloid, and NK cell lineages were analyzed for their susceptibility to PERV infection by coculture with irradiated 293/2° virus producer cells.
- FIG. 5 shows the data from the RT activity for the cocultures containing the T cell line Molt 4, the B cell lines Daudi and Raji, and the myeloid cell line U937.
- RT activity for both the Raji and U937 sets of cocultures plateaued by 4 weeks post-culture.
- the results from this experiment suggest that the Molt 4, Daudi, Raji, and U937 cell lines were permissive for productive infection by PERV.
- the RT positive hematopoietic cell lines were then co-cultured with primary hPBMC, as a virus population may have been selected in the susceptible hematopoietic cell lines that could more efficiently infect primary hematopoietic cells.
- the irradiation conditions optimal for lethal irradiation were determined for each ofthe RT positive Daudi, Molt 4 and U937 cell lines.
- the envelope regions was cloned by RT-PCR amplification of virion RNA isolated from 1°, 2°, and 3°-293/PERV supernatants.
- the primers used for RT-PCR were designed from the PERV-A and PERV-B envelope sequences. Oligonucleotide primers were synthesized homologous to a conserved region at the 3 '-end of the pol gene (5' ofthe PERV env gene) and a conserved untranslated region 3' ofthe env gene.
- the amplified products were cloned into the pCRII T-A cloning vector (Invitrogen) and representative clones sequenced from each culture. Unexpectedly, only one PERV envelope gene species was detected in virions produced from all three cultures.
- the deduced amino acid sequence shows that the surface glycoprotein region ofthe gene is almost identical to PERV-A, but the transmembrane glycoprotein region ofthe gene is almost identical to PERV-C ( Figure 6).
- the nucleotide and amino acid sequence homologies of PERV-1.15 with PERV-A, - B, and -C are summarized in Table 6.
- PERV-1.15 envelope gene is clearly in the PERV-A receptor subgroup family, the gene contains a unique transmembrane glycoprotein that may be important for efficient PERV replication in human cells.
- the variation in the PERV env genes may be significant since variant MLV env genes have been shown to not only broaden the host range ofthe esotropic MLV but increase the pathogenicity (Rosenberg et al., 1997). These viruses arise by recombination between different endogenous MLVs. Recombination between env sequences of exogenous and endogenous feline leukemia viruses (FeLV) also occurs in FeLV-induced thymic tumors.
- FeLV feline leukemia virus
- All 293/PERV cultures contained PERV-A envelope sequences as determined by PCR using subgroup-specific envelope primers. However, PERV- B envelope sequences were not detected in the 293/PERV culture DNAs. The PERV-C envelope sequence was detected in the l°-293/PERV culture, but not in the subsequent virus passages. PERV-C does not infect most human cells efficiently.
- pig aortic endothelial cells PAEC from, for example, NIH and Yucatan minipig breeds
- pig PBMC PBMC
- primary pig hepatocytes from normal pig tissues are assayed for the production of human- tropic PERVs on human 293 cells.
- the cultures are passaged and monitored for PERV production by RT-PCR and RT activity.
- the PERV populations are passaged onto fresh human cells to generate secondary cultures to determine if a particular PERV species dominates, and if the overall replication efficiency improves.
- Env subgroups and LTR-U3 sequences are determined as described above.
- New preparations of PERV cDNA are synthesized by RT-PCR from virion RNA isolated from PERV sources, and 1°, 2°, and 3°- 293/PERV culture supernatants.
- the region from the virion mRNA polyA tail to the PERV pol gene is amplified by RT-PCR.
- the RT-PCR reactions use a pol primer that hybridizes just 5' ofthe env gene, and a second reaction using a pol primer homologous to the RT active site region. Two reactions that use different pol primers increase the chance of amplifying all PERV variants.
- HF High Fidelity
- RT-PCR System ProSTAR Ultra High Fidelity (HF) RT-PCR System (Stratagene) is employed for RT-PCR as it combines high fidelity with long target amplification using the PfuTurbo DNA polymerase. PfuTurbo DNA polymerase efficiently generates blunt ends. The product is cloned into PCR-Script (Stratagene) designed for blunt-end cloning. This approach does not rely on specific restriction sites to be present in the PERV sequence, and produces cDNA clones that contain both the envelope gene and the U3 LTR region.
- the resulting bacterial colonies are grouped first by envelope subgroups by probing colony lifts on nitrocellulose with 32 P-labeled DNA probes specific for each PERV envelope subgroup. These regions only detect the variable region ofthe envelope surface glycoprotein.
- the probing colony lifts with a specific 32 P-labeled probe (DNA region or oligonucleotide), by PCR with specific primers designed to identify the variant sequence, and/or by Southern blots of digested plasmid clone DNA probed with a specific 32 P-labeled probe. In this way, thousands of colonies are easily probed for specific PERV sequences, thereby increasing the detection of rare PERV RNAs.
- PERV-B was not detected in the DNA in any of the 293/PERV cultures, and PERV-C was barely detected in the DNA of 1°- 293/PERV.
- PERV-B and PERV-C envelope sequences may be represented in virions, especially in virions produced by PBMC and the 1 °- 293/PERV culture supernatants.
- RT-PCR reactions designed to amplify only PERV-B and PERV-C mRNAs are also done.
- the expression profile of PERV envelope and U3-LTR sequences in PBMC is analyzed by RNAse protection assays.
- PERV envelope and U3-LTR sequences are cloned into pBluescript KS (Stratagene), and used to produce 32 P-labeled antisense RNA probes. Pig and human GPDH probes are also used to normalize RNA levels in the assays for quantitation of PERV RNA levels in PBMC. These assays determine if PERV-B and PERV-C loci are expressed in PBMC. The nucleotide sequence is then determined for 10-15 representative clones of each unique PERV group. Cellular DNA is probed, by Southern analysis and PCR, for the presence of any new or variant PERV sequence identified by these experiments.
- PERVs A lambda genomic library was prepared from S ⁇ w3A-part ⁇ ally digested DNA isolated from 2°-293/PERV cells in the Lambda Dash II vector (Stratagene) The library was probed with a 2 P-labeled PERV pol gene fragment, and ten genomic clones isolated Six of the clones were unique and contained partial PERV proviruses
- lamA8 contains an 86 nucleotide deletion that results m the truncation ofthe open reading frame at ammo acid 887, a loss of 308 amino acids
- the lamA8 env gene contains 101 nucleotide insertion that results in the truncation of the open reading frame at ammo acid 599, a loss of 60 ammo acids which includes the putative transmembrane region ofthe transmembrane glycoprotein It is unlikely, therefore, that lamA8 contains a functional pol or env gene.
- the PERV regions cloned from the 2°-293/PERV culture were compared to the putative complete PERV cDNA, PERV-MSL (Akiyoshi et al., 1998), the PERV-A (Letissier et al., 1997) and PERV-1 15 envelope genes, and gibbon ape leukemia virus (GALV) (Table 7)
- the 293/PERV gag and pol genes, as well as the 5 ' and 3 ' untranslated regions were nearly identical to the PERV-MSL nucleotide and deduced ammo acid sequence
- PERV-MSL a putative full-length PERV cDNA clone with the C-type envelope gene.
- GALV gibbon ape leukemia virus. ut untranslated region.
- the env gene in lamA6 has 4 nucleotide and 2 amino acid differences with PERV-1.15, the 293/PERV env gene cloned by RT-PCR from virion RNA ( Figure 18).
- Figure 18 Upon comparing the nucleotide sequence of the 293/PERV and PERV-MSL LTRs, a large divergence was observed in the U3 region ( Figure 8).
- the 293/PERV LTR contains 71 more nucleotides than the PERV-MSL LTR.
- the sequence ofthe PERV sequences in Lambda clones Al, Al 1, A3 A, A10, and A8 is also shown in Figure 18.
- PERV proviruses Two recombinant PERV proviruses were prepared to test if they produce infectious virus in 293 cells.
- the constructs, an A3A/A6 chimera and an A1/A6 chimera, are outlined in Figure 9. All constructs were built in the pBluescript KS vector (Stratagene), and used the unique BspEI site in the pol gene to link the 3 '-half of the genome contained in lam A6 to the 5 '-half of the genome contained in either lamAl or lamA3A.
- a minimum of genomic sequence was cloned with the PERV region: Al, about 1000 bp; A3 A, about 30 bp; A6, about 700 bp.
- Rabbit polyclonal antisera is produced against 2°-293/PERV virion proteins and against 2°-293/PERV capsid proteins.
- the 2°-293/PERV cultures produce a relatively large amount of viral particles as demonstrated in Figure 10A.
- Goat anti-SSAV CA and goat anti-GALV CA antisera easily detect PERV Gag proteins on a Western blot with only minor cross-reaction to control 293 cell supernatant proteins ( Figure 10B). These antisera are used as positive controls for the characterization ofthe anti-PERV antisera and monoclonal antibodies.
- the 2°-293/PERV cultures produce approximately equal amounts of the p30 capsid (CA) protein in 5 ml of supernatant as ALV infected cultures produce ALV p27 CA protein (lanes 2 and 5).
- the high-titer ALV stock contained 10 7 iu/ml.
- the 2°-293/PERV virions are collected and purified by equilibrium density centrifugation on sucrose gradients. The banded virions are collected, dialyzed, and used for antibody production.
- the PERV CA protein is isolated from SDS-PAGE gels ( Figure 10A) and also used for polyclonal antisera production.
- the antigen 100 ⁇ g mixed in Complete Freund's Adjuvant is used for the initial inoculation.
- the animal is boosted with 50 ⁇ g antigen in Incomplete Freund's Adjuvant on day 14, 21 and 49 after the initial inoculation.
- the route of injection is normally subcutaneous and/or intramuscular at multiple sites.
- Test bleeds are drawn on day 35 and 56 and screened against PERV proteins by Western blot and immunoprecipitation assays.
- Purified PERV CA protein is used to produce mouse hybridomas that secrete monoclonal antibodies against PERV CA.
- the PERV capsid protein purified from polyacrylamide gels, is used as the antigen.
- mice Five Balb/c mice are injected intraperitoneally or subcutaneously with 400 ⁇ g antigen (per mouse) in Complete Freund's Adjuvant and boosted two weeks later with 250-500 ⁇ g of the antigen in Incomplete Freund's Adjuvant. All five mice are then tested for the presence of PERV anti-capsid antibodies by Western blot. One ofthe positive mice is used for hybridoma preparation. Spleenocytes and/or lymph node cells are removed and fused to non-immunoglobulin secreting myeloma cell line F/O. Hybridomas are screened and positive hybrids are cloned and then subcloned to obtain monoclonal antibody (MoAb) producing cell lines.
- MoAb monoclonal antibody
- the hybridomas are screened by both Western blot and immunoprecipitation of PERV capsid protein.
- the MoAb cell lines are isotyped and cryopreserved. MoAbs are purified from the cell line supernatant by protein A/G column chromatography.
- the new anti-PERV antibodies as well as the anti-SSAV and anti-GALV CA antisera, are tested for their ability to detect PERV proteins in live and fixed PERV infected cells.
- An immunofluorescence and/or immunohistochemical assay for PERV infection simplifies the detection of PERV infection and allows the direct quantitation of PERV titers.
- a Western-based assay system is employed. Protein preparations made from PERV virions produced by the 2°- 293/PERV culture are separated by SDS-PAGE and transferred to nitrocellulose filters. Virion protein extracts are used for two reasons. First, PERV produced by human cells does not display the -Gal xenoreactive carbohydrate that may bind to the ⁇ -Gal antibodies in human sera. Second, the 2°-293/PERV culture produces high levels of PERV virions as shown by analysis of PERV virion protein extracts. Goat anti-SSAV and anti-GALV CA antisera that cross-reacts with the PERV CA protein is employed.
- the 2°-293/PERV virions are purified by equilibrium centrifugation on sucrose gradients.
- the assay employs peroxidase-conj ugated secondary antibodies and enhanced chemiluminescence (Amersham, Pharmacia Biotech, Piscataway, NJ) to detect antibodies bound to the PERV proteins.
- peroxidase-conj ugated secondary antibodies and enhanced chemiluminescence Amersham, Pharmacia Biotech, Piscataway, NJ
- the anti-CA antisera is added to dilutions of control human sera (1 :10, 1 :50, 1 :100) and tested.
- Serum samples from at least 300 pig slaughterhouse workers, plus controls, are screened.
- Control samples including sera from a patient with little or no exposure to pigs, and sera from two populations of retro virus-infected patient populations (50 HIV-1; 20 HTLV-1) is used to evaluate the specificity of antibody binding to PERV and non-PERV proteins.
- Preparative single well SDS-PAGE is used to separate the PERV virion proteins, and the proteins transferred to a nitrocellulose filter.
- the Miniblotter II apparatus permits the screening of 45 different samples by dividing the Western blot into 45 sample cells.
- a negative control serum and a positive control serum (human sera with SSAV or GALV anti-capsid antisera) is assayed with each blot. A 1 :50 dilution ofthe serum samples is screened initially. Human blood samples are also tested for PERV nucleic acid and anti-PERV antibodies.
- ALV receptors Three cell surface proteins have been identified as ALV receptors: Tva, the receptor for ALV(A) (Bates et al., 1998; Bates et al., 1993; Young et al., 1993); CAR1, the receptor for ALV(B) and ALV(D) (Brojatsch et al., 1996; Smith et al., 1998); and SEAR, the receptor for ALV(E) (Adkins et al, 1997).
- Tva Tva receptor protein
- ALV-based replication-competent retroviral vectors were used to efficiently deliver and express stva genes (Federspiel et al., 1997).
- the vectors are available with five different envelope subgroups (A-E) which enables multiple genes to be delivered and expressed in virtually every cell.
- Soluble receptor and retroviral vector constructs were gifts of John Young (Harvard Medical School).
- the pLC126 stva gene (Connolly et al., 1994; Hughes et al, 1987), encoding the 83-amino-acid Tva extracellular domain fused to a 9-amino-acid antibody epitope tag derived from influenza virus hemagglutinin, followed by six histidine residues, was isolated as a Ncol-Pstl fragment and cloned into the Ncol and Pstl sites ofthe CLA12 ⁇ CO adaptor plasmid (Federspiel et al., 1997; Hughes et al., 1987).
- the pKZ457 stva- mlgG gene encoding the 83-amino-acid Tva extracellular domain fused to the constant region of the mouse IgG heavy chain (nucleotides 353-1072) (Tucker et al., 1979), was isolated as a Ncol-Blpl fragment. The Blpl site was made blunt and the modified fragment was cloned into the Ncol and Smal sites of CLA12 ⁇ CO. Both the stva and stva-mlgG genes had been modified to contain Ncol sites at their initiator ATGs.
- the soluble receptor gene cassettes were isolated as Clal fragments from the adaptor plasmids and cloned into the unique Clal site ofthe RCASBP, RCAS, and RCOSBP retroviral vectors with subgroup (B) and subgroup (C) envelope genes.
- the RCAS family of replication- competent retroviral vectors have been described (Federspiel et al., 1994; Federspiel et al., 1997; Hughes et al., 1987; Petropoulous et al., 1991; Petropoulous et al., 1992).
- TFANEO is a companion expression vector to the RCAS family of retroviral vectors.
- the expression cassette of TFANEO consists of two LTRs derived from the RCAS vector that provide strong promoter, enhancer, and polyadenylation sites flanking a unique Clal insertion site.
- the TFANEO plasmid also contains a neo resistance gene expressed under the control ofthe chicken ⁇ -actin promoter, and an ampicillin resistance gene for selection in E. coli.
- RCASBP(A)AP, RCASBP(C)AP and RCASBP(C)AP retroviral vectors which contain the heat-stable human placental alkaline phosphatase gene (AP) have been described (Federspiel et al., 1997; Field-Berry et al., 1992; Fekete et al., 1993).
- the AP gene, contained on a Sail fragment was cloned into the Sail site ofthe CLA12 adaptor plasmid, and then subcloned into the RCASBP vectors as a Clal fragment (gift of Constance Cepko).
- C/E chicken embryo fibroblasts
- DMEM fetal bovine serum
- GBCO/BRL fetal bovine serum
- GBCO/BRL 5% newborn calf serum
- DF-1 cells were grown in DMEM supplemented with 10%o fetal bovine serum, 100 units of penicillin per ml, and 100 ⁇ g of streptomycin per ml (Himly et al., 1998; Schaefer-Klein et al., 1998). Both CEF and DF-1 cultures were passages 1 :3 when confluent.
- Virus propagation was initiated by calcium phosphate transfection of plasmid DNA that contained the retroviral vector in proviral form (Federspiel et al., 1997). In standard transfections, 5 ⁇ g of purified plasmid DNA was introduced into DF-1 cells or early passage CEF by the calcium phosphate precipitation method (Kingston et al., 1989). Viral spread was monitored by assaying culture supernatants for ALV capsid protein by either Western transfer analysis or ELISA (Smith et al., 1979). Virus stocks were generated from the cell supernatants. The supernatants were cleared of cellular debris by centrifugation at 2000 x g for 10 minutes at 4°C and stored in aliquots at -80°C.
- DF-1 cells transfected with the TFANEO plasmid were grown in 500 ⁇ g/ml G418 (Gibco/BRL) to select for neomycin-resistant cells.
- Clones were isolated using cloning cylinders (Bellco Glass Inc., Vineland, NJ), expanded, and maintained with standard medium supplemented with 250 ⁇ g/ml G418.
- ALV alkaline phosphatase challenge assay In a direct AP challenge assay, CEF or DF-1 cell cultures (about 30% confluent) were incubated with 10- fold serial dilutions ofthe RCASBP/ AP virus stocks for 36-48 hours at 39°C. In a pre-absorption AP challenge assay, the 10-fold viral serial dilutions were first mixed with 2 ml of supernatant containing sTva-mlgG for 3 hours at 4°C, and then assayed as above.
- the assay for alkaline phosphatase activity was modified from procedures of Cepko and co-workers (Federspiel et al., 1994; Fekete et al., 1993; Fields-Berry et al., 1995). Cells were fixed in 4%. paraformaldehyde in Dulbecco's phosphate-buffered saline (PBS) for 30 minutes at 25°C, washed twice in PBS for 5 minutes each, and incubated for 1 hour at 65°C to inactivate endogenous AP activity.
- PBS Dulbecco's phosphate-buffered saline
- the cells were then washed twice with AP detection buffer (100 mM Tris-Cl, pH 9.5/100 mM NaCl/50 mM MgCl 2 ) for 10 minutes and exposed to the AP chromogenic substrates nitroblue tetrazolium (300 ⁇ g/ml) and 5-bromo-4-chloro-3-indoyl phosphate (170 ⁇ g/ml) (GIBCO/BRL). Enzymatically active AP produces an insoluble purple precipitate. The reaction was stopped by the addition of 20 mM EDTA, pH 8.0 in PBS.
- AP detection buffer 100 mM Tris-Cl, pH 9.5/100 mM NaCl/50 mM MgCl 2
- the washed complexes were collected by centrifugation, resuspended in 50 ⁇ l IX Laemmli buffer (2% SDS, 10% glycerol, 0.05 M Tris-Cl, pH 6.8, 0.1% bromophenol blue) without ⁇ -mercaptoethanol, and heated for 5 minutes at 100°C.
- the agarose in the samples was collected by centrifugation for 2 minutes and the supernatants were transferred to new tubes.
- Prior to gel electrophoresis 1.0 ⁇ l ⁇ -mercaptoethanol was added to each 50 ⁇ l sample and the samples were heated for 5 minutes at 100°C.
- the denatured immunoprecipitates were separated by 12% SDS-PAGE, and transferred to a nitrocellulose membrane.
- the filters were blocked with 10%> non-fat dry milk (NFDM) in PBS, probed with 0.05 ⁇ g/ml peroxidase-conjugated goat anti-mouse IgG antibodies (Kirkegaard and Perry laboratories, Gaithersburg, MD) in rinse buffer (100 mM NaCl, 10 mM Tris-Cl, pH 8, 1 mM EDTA, 0.1% Tween 20) and 1% NFDM, and washed in rinse buffer. Protein/antibody complexes were detected with the Western Blot Chemiluminescence Reagent (NEN) according to the manufacturer's instructions. The immunoblot was then exposed to Kodak X- Omat film.
- NFDM non-fat dry milk
- Line 0 embryos were somatically infected with RCASBP(B), RCASBP(B)stva, or RCASBP(B)stva-mIgG by injecting unincubated eggs near the blastoderm with 100 ⁇ l containing 1 ⁇ 10 6 CEF or DF-1 cells producing the virus.
- Line 0 is a White Leghorn line that is genetically susceptible to all ALV subgroups except subgroup (E) and is free of endogenous proviruses that are closely related with ALV (Astrin et al., 1979). Viremic chicks were identified at hatch by ELISA for the ALV capsid protein p27.
- Viremic and uninfected control chicks were infected intra-abdominally with 10 5 infectious units of either RAV-1 [an ALV (A) isolate] or RAV-49 [an ALV(C) isolate].
- Blood was collected at 2, 4 or 9 weeks post-challenge, and the serum assayed for infectious subgroup (A), (B), or (C) ALV by the in vitro ALV Assay (see below).
- In vitro ALV assay The presence of infectious ALV in chickens was determined by assaying the serum samples on a panel of cell lines with different ALV envelope subgroup susceptibilities.
- the panel of indicator cell lines included: line 0 CEF (C/E) which supports the replication of ALV(A), ALV(B), and ALV(C); line alv6 CEF (C/A) which supports ALV(B) and ALV(C) replication; line RP30B-cell line (C/B) which supports ALV(A) and ALV(C) replication; and line 15.C-12 CEF (C/C) which supports ALV(A) and ALV(B) replication.
- Serum samples 100 ⁇ l were added to the cells and the cells were incubated for 9 days in media (5%o serum) to allow ALV to spread. The media was changed after 3 days to avoid detection of ALV proteins in the original serum sample.
- the cells were then solubilized by 2 cycles of rapid freeze-thaw to release ALV Gag antigens.
- the ALV capsid protein was detected by ELISA.
- a positive sample was defined as having an optical density reading of > 0.200.
- the in vitro ALV Assay can detect infectious ALV titers as low as 10 IFU/ml.
- a fragment ofthe chicken glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene (Genbank accession # K01458; nucleotides 163-361) (Panabieres et al., 1984) was used as a control for the quantity and quality ofthe RNA.
- the constructs were linearized by restriction endonuclease digestion and gel purified.
- 32 P-labeled antisense RNA probes were synthesized using the RNA Transcription Kit (Stratagene, La Jolla, CA).
- the probes were hybridized with 20 ⁇ g of total RNA in 20 ⁇ l hybridization solution (80%> formamide, 10 mM sodium citrate pH 6.4, 300 mM sodium acetate pH 6.4, 1 mM EDTA) overnight at 42°C.
- RNase protection assays were performed using the RPA II Ribonuclease Protection Kit (Ambion, Austin, TX).
- the RNA samples were digested with the RNase A/Tl mixture diluted 1 :75.
- the protected RNA probe fragments were separated on a 6%> acrylamide/7.6 M urea gel and exposed to Kodak X-Omat film.
- the reactions were heated to 90°C for 1 minute and initiated by the addition of 1.5 ⁇ l of Taq DNA polymerase (Promega, Madison, WI) diluted 1 :10 v/v (0.75 units). Thirty cycles of PCR were carried out as follows: 90°C for 40 seconds, then 59°C for 80 seconds. Diagnostic primers used to detect ALV (A) env (Bora et al., 1988) were 5'-GGGACGAGGTTATGCCGCTG-3' (SEQ ID NO:24; about 50 bp upstream of Kpnl site) and 5'-GGGCGTGCGCGCATTACCAC-3' (SEQ ID NO:25; nucleotides 871-851), yielding a 937 bp fragment.
- the PCR extension temperature was increased to 62°C for amplifying ALV(A) env.
- Diagnostic primers used to detect ALV(B) env were 5'- GACCGACCCAGGGAACAATC-3' (SEQ ID NO:26; nucleotides 713-732) and 5-ATGAGGAAAATTGCGGGTGG-3' (SEQ ID NO:27; nucleotides 1141- 1122), yielding a 429 bp fragment.
- Diagnostic primers used to detect stva were 5'-GGAATGTGACTGGTAATGGA-3' (SEQ ID NO:28; nucleotides 56-75) and 5'-GCCTTAGTGATGGTGATGGT-3' (SEQ ID NO:29; nucleotides 369-350), yielding a 314 bp fragment.
- Diagnostic primers used to detect stva-mlgG were 5'-CCATCCGTCTTCATCTTCCCT-3' (SEQ ID NO:30; nucleotides 974-994) and 5'-
- the stva and stva-mlgG receptor gene fusions were subcloned into the CLA12NCO adaptor plasmid which contains a transcriptional leader sequence and has a consensus ATG start site contained in a Ncol site. These sequences work very efficiently with the promoter/enhancer elements ofthe ALV-based retroviral vectors to express experimental genes at high levels (Hughes et al., 1987).
- the RCAS family of retroviral vectors were derived from the Schmidt-Ruppin A strain of Rous sarcoma virus (RSV) and were present in proviral form on pBR-based plasmids (Federspiel et al., 1997).
- Retroviral vectors that carry and express the stva and stva-mlgG genes are shown schematically in Figure 11.
- Virus propagation was initiated by transfection of plasmid D ⁇ A containing the retroviral vector into avian cells ( Figure 12). The culture was then passaged until a maximum viral titer was achieved (6-10 cell passages depending on the vector (Federspiel et al., 1997). Because vectors that use different receptors are available, this system can be used to deliver multiple genes to virtually all cells in the culture (Givol et al., 1994).
- Cell cultures that express sTva or sTva-mlgG from a subgroup (B) or (C) vector were subsequently challenged with ALV (A) to quantitate the antiviral effect ofthe sTva proteins.
- the CEF cultures infected with RCASBP(B) and RCASBP(B)stva were used to inoculate unincubated line 0 eggs to produce chicks viremic with RCASBP(B) or RCASBP(B)stva.
- Viremic chicks produced in this manner are tolerant to most ALV antigens since the early embryo was infected.
- the chicks were challenged with 10 5 infectious units of RAV-1, an aggressive ALV(A) strain, to quantitate the antiviral effect of sTva. Blood samples were collected from representative birds of each group at 2 weeks post-challenge, and from all birds 9 weeks post-challenge.
- sTva-mlgG Antiviral effect of sTva-mlgG in vitro. Although the tagged version of sTva could not be immunoprecipitated efficiently, an sTva immunoadhesin sTva-mlgG can be immunoprecipitated and quantitated.
- sTva-mlgG consists of the 83-amino acid Tva extracellular domain fused to the constant region ofthe mouse IgG heavy chain. The stva-mlgG gene was introduced into the RC ASBP(C) vector.
- CEF cultures infected with RCASBP(C)stva-mIgG, RCASBP(C)stva, or RCASBP(C) were challenged with either RCASBP(A)AP or RCASBP(B)AP.
- CEF expressing sTva-mlgG were about 300-fold more resistant to RCASBP(A)AP infection compared to cells infected with the vector alone, and 2- to 3-fold more resistant than cells expressing sTva (Table 8).
- the antiviral effect was specific for ALV(A) since no significant change in susceptibility was observed when the cultures were challenged with RCASBP(B)AP.
- ALV replication in a permanent, non-transformed cell line derived from line 0 CEF called DF-1 has been described (Himly et al., 1998; Schaefer-Klein et al., 1998).
- ALV and ALV-based retroviral vectors replicate and express inserted genes in DF-1 cells at levels similar to CEF, and DF-1 can be used to generate clonal cell lines.
- the antiviral effect of sTva-mlgG produced in DF-1 cultures infected with RC ASBP(C)stva-mIgG (Table 10) was similar to that seen in CEF cultures (Table 8).
- the sTva-mlgG protein was immunoprecipitated from cell culture supernatants with anti-mouse IgG antibody conjugated to agarose beads and analyzed by Western transfer of SDS-PAGE gels (Figure 13).
- the immunoprecipitated sTva-mlgG protein migrates as a broad band (50-60 kDa) due to post-translational modification and as a minor about 38 kDa band.
- the about 38 kDa band is probably a degradation product of sTva-mlgG since both bands appear after immunoprecipitation with an ALV(A) surface glycoprotein immunoadhesin, and the amount of the about 38 kDa band increases after repeated freeze-thaw cycles ofthe viral supernatants.
- Stable clonal DF-1 cell lines were generated that express different levels of sTva-mlgG under the control of the TFANEO expression vector. These cell lines do not produce infectious ALV and are resistant to RCASBP(A)AP infection at levels similar to cultures expressing sTva-mlgG from the retroviral vectors. Therefore, chronic ALV infection does not make a major contribution to the antiviral effect obtained. Relationship between sTva-mlgG expression level and the antiviral fiftecl. The stva-mlgG gene was subcloned into the RCAS(C) and RCOSBP(C) retroviral vectors.
- the RCOSBP vector which lacks a strong transcription enhancer in the LTR, replicates to about 100-fold lower titer compared to RCASBP and produces lower levels of protein.
- DF-1 cultures infected with RCASBP(C)stva-mIgG, RCAS(C)stva-mIgG, or RCOSBP(C)stva- mlgG were challenged with RCSABP(A)AP to determine the antiviral effect of different levels of sTva-mlgG on ALV(A) infection.
- the results of a representative assay are shown in Table 10.
- the sTva-mlgG produced by these DF-1 cultures was detected by immunoprecipitation of sTva-mlgG followed by the analysis ofthe proteins by Western transfer ( Figure 13). As expected, cultures infected with RCASBP produced the highest level of sTva-mlgG and the greatest antiviral effect (about 200-fold).
- the resistance ofthe cells to ALV(A) infection was determined by dividing the titer obtained on the control uninfected DF-1 cells by the titer obtained for each experimental group.
- the antiviral effect of sTva and sTva-mlgG on ALV(A) infection may represent the minimum antiviral effect attainable in vitro as measured by the direct ALV AP challenge assay.
- the assays were done on subconfluent cell cultures (30%) where the levels ofthe soluble receptor protein had not accumulated to the levels expressed by a confluent culture.
- RCASBP(A)AP was pretreated with supernatants collected from confluent DF-1 cultures infected with RCASBP(B), RCASBP(B)stva-mIgG, RCOSBP(B), or RCOSBP(B)stva-mIgG, and then assayed as before.
- RCASBP(A)AP Preabsorption of RCASBP(A)AP with high levels of sTva-mlgG significantly increased the antiviral effect compared to a direct assay: RCASBP(B)stva-mIgG pretreatment increased the antiviral effect ofthe direct assay about 500-fold; and RCOSBP(B)stva-mIgG pretreatment increased the direct antiviral effect about 60-fold. Delivery and expression of sTva and sTva-mlgG in vivo.
- the stva, stva-mlgG, and RCASBP(B) env RNA expression levels in liver, heart, spleen, bursa, thymus, kidney, and muscle tissues of infected birds were analyzed by RNase protection assay.
- An RNase protection analysis of a representative bird infected with RCASBP(B)stva and a representative bird infected with RCASBP(B)stva-mIgG are shown in Figure 15. Relatively high levels ofthe stva or stva-mlgG and ALV(B) env RNAs were detected in all tissues assayed, indicating that the inserted genes were delivered and expressed efficiently by the RCASBP(B) vector.
- Chickens expressing either sTva or sTva-mlgG are resistant to ALV(A) infection but not ALV(C) infection.
- RCASBP(B) vector alone, RCASBP(B)stva, or RCASBP(B)stva-mIgG were split into two groups and challenged with 10 5 infectious units of either RAV-1 (subgroup A) or RAV-49 (subgroup C). Blood was collected from each bird four weeks after challenge, and the serum was assayed for ALV(A), ALV(B) and ALV(C) by the in vitro ALV Assay (Table 11). As expected, ALV(B) was detected in virtually all ofthe birds since the RCASBP(B) vector was used for gene delivery. ALV (A) was not detected in the serum of RAV-1 challenged birds containing the stva or the stva-mlgG genes.
- ALV (A) was detected in the serum ofthe birds infected with the RCASBP(B) vector alone and challenged with RAV-1.
- the birds of all three experimental groups were equally susceptible to RAV-49 challenge as shown by the presence of ALV(C) in the majority ofthe birds. Since 19%o ofthe birds challenged with RAV-49 did not produce detectable levels of ALV(C), the titer ofthe RAV-49 stock may have been lower than expected.
- the antiviral effect of sTva and sTva- mlgG was specific for ALV(A), consistent with the proposed mechanism of antiviral action, receptor interference.
- sTva may inhibit ALV(A) entry by simply binding to SU and physically blocking the access of membrane bound Tva to the virion.
- the sTva proteins block the entry of ALV(A) into cultured cells and cells and tissues of chickens.
- the replication-competent ALV-based retroviral vector experimental system enabled the efficient delivery and expression ofthe stva and stva-mlgG genes both in cultured cells and in virtually all the cells and tissues ofthe chicken.
- RCASBP(A) and (RCASBP(B), as well as other combinations of ALV retroviral vectors [ALV(B) followed by ALV(A); ALV(C) followed by AVL(A)], can be used in CEF and DF-1 cells in vitro and in vivo.
- ALV retroviral vectors [ALV(B) followed by ALV(A); ALV(C) followed by AVL(A)]
- RCASBP(B) viruses in CEF and DF-1 cells were somewhat cytopathic (Himly et al., 1998; Schaefer-Klein et al, 1998).
- the cytopathic effect manifests itself as a pause in growth rate (2-6 days), after which the cells recover, divide at a normal rate, and express the viral and experimental proteins.
- Both the RCASBP(B) and RCASBP(C) retroviral vectors were efficient in generating viremic chicks without detectable pathologic effects in short term infections, and the infected chicks expressed relatively high levels of sTva-mlgG protein in their serum. Chicks infected with RCASBP(B) were also efficiently infected with ALV (A).
- the RCASBP(B) vector efficiently delivered and expressed the stv-a and stva-mlgG genes in all tissues tested, and resulted in a significant antiviral effect on ALV(A) infection and replication. By delivering the stva genes in the early embryo, the immune system ofthe chicken can be evaded.
- the birds are tolerized to the sTva and sTva-mlgG proteins, and to most ofthe ALV antigens since the viral vector used to deliver stva and stva-mlgG and the challenge viruses are virtually identical except for small regions of SU.
- the expression ofthe sTva and sTva-mlgG proteins in vivo allowed the examination of the effects ofthe viral glycoprotein-soluble receptor interactions in a wide variety of cells.
- One RAV-1 challenged RCASBP(B)stva infected bird did contain infectious ALV (A) in its serum. Unfortunately the bird died of non- viral causes before tissues could be obtained.
- CD4 an important cell-surface protein ofthe T-lymphocytes, is the primary receptor for HIV-1.
- sCD4 soluble forms of CD4
- sCD4 Several groups developed and expressed soluble forms of CD4 (sCD4) and demonstrated that recombinant sCD4 proteins could bind specifically to HIV-1 envelope glycoproteins and inhibit HIV-1 infection in vitro (Daar et al., 1990; Harbison et al., 1990; Klasse et al., 1993; Orloff et al, 1993; Schacker et al., 1995; Weiss, 1992).
- a recombinant antiviral protein it may be necessary to use a gene therapy approach in which target cells actively express the soluble receptor.
- sCD4 gene construct was expressed by a murine leukemia virus-based retroviral vector in human T-cell lines and in primary peripheral blood lymphocytes (Morgan et al., 1994).
- sCD4 30-50%> ofthe cells contained the sCD4 gene
- HIV-1 replication was inhibited 50-70%> indicating that a sCD4 antiviral approach against HIV-1 might be more effective.
- the chemokine receptors have been identified as co-receptors necessary for efficient HIV-1 entry into cells (Hunter, 1997). Since both CD4 and a chemokine receptor are required for efficient HIV-1 entry into cells, sCD4 alone may not be an effective inhibitor of HIV-1 entry.
- a soluble receptor interference antiviral strategy can effectively block the replication of at least some retroviruses, and that this approach may be applicable to other virus groups that require specific viral glycoprotein-host receptor interactions for entry into the cell.
- the application of this strategy to protect animals against specific viral diseases is relatively straightforward since transgenic technology can be used to introduce genes into animals and the transgenes will produce the desired protein without provoking an immune response.
- ALV(A) was passaged on the sTva and SUA expressing cell lines. Variant viruses capable of more rapid growth on the sTva cell lines were identified at passage 7 and on the SUA cell lines at passage 9 post-infection. The SU region ofthe env gene was PCR amplified from these cells, cloned and analyzed by sequencing. Selection on sTva expressing cells produced mutant viruses which were identical in sequence to ALV (A) except that 50%> ofthe clones screened had an amino acid change at codon 142, while the other 50%> had an amino acid change at codon 149 of env. All mutants selected on SUA expressing cell lines contained a 6 amino acid deletion at codons 155-160 within env.
- the SU region of env containing the mutation, from Kpn I to Sal I was introduced into a wild-type ALV(A) molecular clone. Transfection of these mutants showed an enhanced rate of growth as compared to wild-type.
- the avian retrovirus env gene family molecular analysis of host range and antigenic variants. Journal of Virology. 62:75-83 (1988).
- CAR1 a TNFR-related protein, is a cellular receptor for cytopathic avian leukosis-sarcoma viruses and mediates apoptosis. Cell. £2:845-855 (1996).
- the DF-1 chicken fibroblast cell line transformation induced by diverse oncogenes and cell death resulting from infection by avian leukosis viruses. Virology. 248:295-304 (1998).
- Adaptor plasmids simplify the insertion of foreign DNA into helper-independent retroviral vectors. Journal of Virology. £1:3004-3012 (1987).
- Patience, C G.R. Simpson, A.A. Colletta, H.M. Welch, R.A. Weiss, and M.T. Boyd. Human endogenous retrovirus expression and reverse transcriptase activity in the T47D mammary carcinoma cell line. Journal of Virology, 20:2654-2657 (1996).
- the EV-0- derived cell line DF-1 supports efficient replication of avian leukosis-sarcoma viruses and vectors. Virology. 248:305-311 (1998).
- Decay-accelerating factors CD55 is identified as the receptor for echovirus 7 using CELICS, a rapid immuno-focal cloning method. The EMBO Journal 12:5070-5074 (1994).
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AU52865/00A AU5286500A (en) | 1999-05-24 | 2000-05-24 | Methods to inhibit infectious agent transmission during xenotransplantation |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US13563199P | 1999-05-24 | 1999-05-24 | |
US60/135,631 | 1999-05-24 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2000071726A1 WO2000071726A1 (en) | 2000-11-30 |
WO2000071726A9 true WO2000071726A9 (en) | 2002-06-27 |
Family
ID=22468932
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/014296 WO2000071726A1 (en) | 1999-05-24 | 2000-05-24 | Methods to inhibit infectious agent transmission during xenotransplantation |
Country Status (2)
Country | Link |
---|---|
AU (1) | AU5286500A (en) |
WO (1) | WO2000071726A1 (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7449562B2 (en) | 2001-06-29 | 2008-11-11 | Novartis Ag | PERV screening method and use thereof |
US9420770B2 (en) | 2009-12-01 | 2016-08-23 | Indiana University Research & Technology Corporation | Methods of modulating thrombocytopenia and modified transgenic pigs |
CN107916257B (en) * | 2018-01-09 | 2020-07-28 | 华南理工大学 | T1 lipase mutant and application |
CN114410808B (en) * | 2022-03-30 | 2022-07-01 | 华南农业大学 | Genetic resistance molecular marker for avian A, K subgroup avian leukosis and application thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996032494A1 (en) * | 1995-04-14 | 1996-10-17 | University Of Alabama Research Foundation | Fusion protein delivery system and uses thereof |
GB9710154D0 (en) * | 1997-05-16 | 1997-07-09 | Medical Res Council | Detection of retroviruses |
-
2000
- 2000-05-24 WO PCT/US2000/014296 patent/WO2000071726A1/en active Application Filing
- 2000-05-24 AU AU52865/00A patent/AU5286500A/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
AU5286500A (en) | 2000-12-12 |
WO2000071726A1 (en) | 2000-11-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6410326B1 (en) | Method for inhibiting human tumor cells | |
JP4041535B2 (en) | Recombinant retroviruses that carry vector constructs to target cells | |
Magre et al. | Xenotransplantation and pig endogenous retroviruses | |
CA1341585C (en) | Recombinant retroviruses | |
US5888502A (en) | Recombinant retroviruses | |
Kozak | The mouse" xenotropic" gammaretroviruses and their XPR1 receptor | |
Łopata et al. | Porcine endogenous retrovirus (PERV)–molecular structure and replication strategy in the context of retroviral infection risk of human cells | |
EP1017797B1 (en) | Non-primate lentiviral vectors and packaging systems | |
JP3765103B2 (en) | Defective packaging non-oncovirus vector based on MPMV and HIV | |
Barsov et al. | Adaptation of chimeric retroviruses in vitro and in vivo: isolation of avian retroviral vectors with extended host range | |
WO2000071726A9 (en) | Methods to inhibit infectious agent transmission during xenotransplantation | |
Dudley et al. | Endogenous retroviruses and cancer | |
Kitagawa et al. | Establishment of a therapeutic model for retroviral infection using the genetic resistance mechanism of the host | |
Gu | Studies of retrovirus host range and retroviral gene transfer into the lymphoid compartment | |
Mahoney | Studies using pseudotyped retroviral vectors | |
Moreno Carranza | Self-inactivating gammaretroviral vectors for the gene therapy of chronic granulomatous disease | |
GB2254424A (en) | Indicator cells and retroviruses for the detection of gene sequenes |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
REG | Reference to national code |
Ref country code: DE Ref legal event code: 8642 |
|
WWE | Wipo information: entry into national phase |
Ref document number: 09980526 Country of ref document: US |
|
AK | Designated states |
Kind code of ref document: C2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: C2 Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG |
|
COP | Corrected version of pamphlet |
Free format text: PAGES 1/21-13/21, DRAWINGS, REPLACED BY NEW PAGES 1/28-20/28 AND PAGES 14/21-21/21 RENUMBERED AS PAGES 21/28-28/28; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE PAGES |
|
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase in: |
Ref country code: JP |