WO2000071722A1 - Nouveaux agents de controle de la floraison, plantes transgeniques et leurs utilisations - Google Patents

Nouveaux agents de controle de la floraison, plantes transgeniques et leurs utilisations Download PDF

Info

Publication number
WO2000071722A1
WO2000071722A1 PCT/US2000/014297 US0014297W WO0071722A1 WO 2000071722 A1 WO2000071722 A1 WO 2000071722A1 US 0014297 W US0014297 W US 0014297W WO 0071722 A1 WO0071722 A1 WO 0071722A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
nucleic acid
flowering
plant
Prior art date
Application number
PCT/US2000/014297
Other languages
English (en)
Other versions
WO2000071722A9 (fr
Inventor
Paul Oeller
Neal Gutterson
Original Assignee
Dna Plant Technology Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Dna Plant Technology Corporation filed Critical Dna Plant Technology Corporation
Priority to AU52866/00A priority Critical patent/AU5286600A/en
Publication of WO2000071722A1 publication Critical patent/WO2000071722A1/fr
Publication of WO2000071722A9 publication Critical patent/WO2000071722A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
    • C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]

Definitions

  • the present invention is generally related to plant genetic engineering.
  • the invention is directed to novel nucleic acids involved in the control of floral homeotic genes and the flowering process.
  • the Physiology and Genetics of Flowering Angiosperm species normally flower in response to day length, temperature, and other environmental stimuli as well as internal cues such as hormone concentration and age. Whereas the vegetative meristem gives rise to leaves with their associated axillary meristems, the inflorescence meristem gives rise to floral meristems as well as secondary inflorescence meristems. Floral meristems are strictly determinate and differentiate to form floral organs (sepals, petals, stamens and carpels) depending on specific genetic signals (see, e.g., Parcy (1998) Nature 395:561-566).
  • region-specific gene expression is believed to be required to allow the derivation of specific structures (i.e., floral organs) from a collection of undifferentiated cells. It is generally believed that two types of activities within the inflorescence meristem are required for such specificity.
  • Meristem identity genes are required for activation of the organ identity genes. Cadastral genes are proposed to demarcate the expression domains of organ identity genes. Though several cadastral genes have been identified, it remains unclear how their spatial patterns are established. See, e.g., Parcey (1998) supra; Bowman (1991) Development 112:1-20; Carpenter (1990) Genes Develop.
  • Arabidopsis thaliana LEAFY and APETALAl Genes The Arabidopsis thaliana LEAFY (LFY) gene and polypeptide are described, e.g., by U.S. Patent Nos. 5,844,119, and 5,637,785, Parcy (1998) supra; Weigel (1995) Nature 377:495-500; Mandel (1995) Nature 377:522-524; Weigel (1992) supra.
  • a gene related to the Arabidopsis LEAFY gene is FLORICAULA (Coen (1990) Cell 63:1311). See also Souer (1998) Development 125:733-742, showing the Petunia alf locus encoding a FLORICAULA/LEAFY ortholog.
  • Arabidopsis thaliana APETALAl (API) gene and polypeptide are described, e.g., by Parcy (1998) supra; Weigel (1995) supra; Mandel (1992) Nature 360:273-277.
  • APETALAl a gene related to the APETALAl gene is SQUAMOSA (Huijser (1992) EMBO J 11 : 1239).
  • LFY and API are considered floral meristem identity genes since they are expressed in cells on the flanks of the inflorescence meristem in those cells destined to become flower primordia.
  • Detailed analyses has revealed that not only does LFY activity precede API but that LFY is a regulator of API . However, if either of these genes is constitutively expressed throughout a plant early flowering results. Flower formation at the apical meristem is associated with this early flowering phenotype due to the conversion of the inflorescence meristem into a floral meristem. This aberrant behavior arises from the inappropriate expression of these genes within the inflorescence meristem and their ability to bestow the floral meristem fate via induction of the floral organ identity genes.
  • TERMINAL FLOWER- 1 The accumulation of both LFY and API mRNAs is controlled in part by the meristem identity gene TERMINAL FLOWER- 1 (see discussion below). This gene prevents the floral meristem identity genes from being expressed in the inflorescence meristem in the natural state.
  • Arabidopsis thaliana TERMINAL FLOWER-1 and Antirrhinum majus CENTRORADIALIS Genes The Arabidopsis thaliana TERMINAL FLOWER- 1 gene (TFL 1 ) and polypeptide is described, e.g., by Bradley (1997) Science 275:80-83; and the Antirrhinum majus CENTRORADIALIS gene (CEN) and polypeptide is described, e.g., by Bradley
  • inflorescence architecture indeterminate, in which the inflorescence grows indefinitely and continually produces floral meristems, or determinate, in which a terminal flower is produced.
  • CEN and TFL1 (loss of function) mutants inflorescences that are normally indeterminate (indefinitely growing) are converted to a determinate (flowering) architecture (Bradley
  • TFL1 constitutive expression of TFL1 in Arabidopsis results in plants in which all growth phases (vegetative as well as reproductive) are protracted, resulting in an overall altered architecture. While CEN and TFL1 are related to each other in their primary sequence and have similar roles in inflorescence determinacy, TFL1 appears to also have an overall repressive function on the initiation of flowering (i.e., it is flower inhibiting). This may be due to TFL1 's ability to inhibit the floral meristem identity genes such as LFY and API . TFL1 is also known to be expressed in vegetative meristems and has been shown to play a role in the timing of the initiation of inflorescence development (Bradley (1997) supra). Arabidopsis plants lacking TFL1 activity flower earlier than wildtype. In contrast, Antirrhinum CEN mutants display normal flowering time behavior.
  • the Arabidopsis CONSTANS (“CO”) gene has been shown to be a positive regulator (flower inducing) of the transition to inflorescence meristem development. It acts prior to the point at which the floral meristem identity genes LFY and API are required (see, e.g., Simon (1996) supra). Plants with elevated expression of this gene, either by the insertion of extra copies of the gene or by the addition of constitutively expressed transgenes (Putterill 1995 supra), display photoperiod- independent early flowering. Mutant (lack of CO function) plants display delayed flowering under normally floral -promotive conditions.
  • day-neutral flowering phenotype is desired by strawberry growers since these plants flower with no dependence on day length to produce fruit throughout the growing season.
  • Flower induction in day-neutral varieties can be influenced by temperature, with high temperatures being inhibitory. However, as with light-influenced behavior, different varieties often display somewhat different temperature requirements (Gutteridge (1985) supra).
  • Manipulating the flowering process in plants, and in particular in strawberry may make possible the generation of early flowering varieties, delayed flowering varieties, day neutral flowering varieties, as well as varieties in which flowering time is controllable by chemical application or other means.
  • Control of the flowering process may also provide a means of altering the growth habit or overall plant architecture.
  • Particular genes which influence flowering may also affect the formation of the inflorescence meristem. It is believed that the balance of vegetative and inflorescence meristem activity is a prime determinant of plant architecture. Therefore genes involved in controlling the flowering process and combinations thereof provide the opportunity for manipulating flowering as discussed above as well as generating diversity in plant growth habit which otherwise could be difficult to obtain by conventional breeding strategies.
  • the present invention fulfills these and other needs.
  • This invention provides nucleic acids and polypeptides which control the flowering process.
  • novel genes can be operably linked to various promoters. These recombinant constructs can be incorporated alone or in combination into plant cells to provide means to control the flowering process.
  • the invention uses these genes to generate plants with altered flowering behavior such as early flowering, delayed flowering, day neutral flowering or regulated flowering.
  • the invention also uses these genes to as a means to generate variation in the overall architecture or growth habit of the plant either alone or in conjunction with altered flowering behavior.
  • the nucleic acids of the invention have at least 75% sequence identity to SEQ ID NO:l or an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has a sequence as set forth in SEQ ID NO:2.
  • the invention also provides an isolated nucleic acid having at least 85% sequence identity to SEQ ID NO:3 or an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has a sequence as set forth in SEQ ID NO:4.
  • the invention further provides an isolated nucleic acid having at least 85% sequence identity to SEQ ID NO:5 or an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has a sequence as set forth in SEQ ID NO:6.
  • the invention additionally provides an isolated nucleic acid having at least 75% sequence identity to SEQ ID NO:7 or an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has a sequence as set forth in SEQ ID NO:8.
  • sequence identities are determined (calculated) using a CLUSTAL W algorithm program.
  • CLUSTAL W algorithm is used with the following parameters: K tuple (word) size: 1, window size: 5, scoring method: percentage, number of top diagonals: 5, gap penalty: 3.
  • the invention also provides expression cassettes comprising at least one nucleic acid of the invention operably linked to a promoter.
  • An expression cassette may be used alone or in combination with other expression cassettes comprising other nucleic acids of the invention.
  • the nucleic acid is operably linked to the promoter in the sense orientation or the antisense orientation.
  • the promoter can be a constitutive promoter, an inducible promoter, a developmentally regulated promoter, and a tissue specific promoter.
  • transgenic plants or progeny thereof comprising expression cassettes of the invention.
  • the plant is a strawberry plant.
  • the nucleic acids of the invention can be used in methods of modulating the flowering phenotype of a plant.
  • the methods comprise the steps of introducing an expression cassette comprising a polynucleotide of the invention.
  • the methods can further comprise introducing a second expression cassette comprising a second nucleic acid, for example, one having a sequence at least substantially identical to SEQ ID NO:5.
  • the expression cassette can further comprise a second nucleic acid operably linked to a second promoter, wherein the second nucleic acid has a sequence as set forth in SEQ ID NO:5.
  • Methods of the invention can be used to produce plants that have a early flowering phenotype or a day-neutral flowering phenotype.
  • the methods may also be used to make plants improved with respect to synchronized fruit production, enhanced hybrid seed production (e.g., via improved flowering control) rapidity of cycling (e.g., as with biennials) or altered plant architecture.
  • the invention further provides genomic sequences corresponding to SEQ ID NO: 5 and SEQ ID NO: 7. These sequences are set forth in SEQ ID NO: 37 and SEQ ID NO: 36, respectively.
  • Various embodiments include expression cassettes, transformed cells (e.g., plant cells, such as strawberry cells) and plant parts (e.g., seeds), and transgenic plants (e.g., strawberry plants) comprising the genomic sequences of the invention.
  • Genomic sequences in the invention include various non-transcribed sequences, including introns and cis-acting transcriptional control elements.
  • Transformed cells and seeds and transgenic plants of the invention include those into which one or more copies of the nucleic acid sequences of the invention have been transiently or stably inserted; including cDNA or genomic sequences operably linked to endogenous or heterologous transcriptional control elements.
  • cDNA and genomic sequences from genes related to SEQ ID NO: 5. These sequences are at least about 80% identical to SEQ ID NO: 40 (genomic sequence) or SEQ ID NO: 43 (cDNA sequence). Such sequences encode a protein at least 80% identical to SEQ ID NO: 44.
  • the invention further provides promoters from the genomic sequences disclosed here!
  • the invention further provides expression systems, e.g., expression cassettes incorporating these cis-ac ng transcriptional control elements.
  • the promoters of the genomic sequences provided herein can be used to drive expression of heterologous nucleic acid sequences in plants.
  • the promoter sequences of the invention comprise residues 1-6098 of SEQ ID NO: 36, residues 1-1798 of SEQ ID NO: 37 and residues 1-3348 of SEQ ID NO: 40.
  • Figure 1 shows a schematic illustration of the exemplary Agrobacterium- based binary plasmid pMM7400, as described in detail in Example 2, below, for use in the making of the transgenic plants of the invention.
  • the present invention provides novel isolated nucleic acids and polypeptides that can be used to positively and negatively control the flowering process.
  • Recombinant constructs incorporating the nucleic acids of the invention operably linked to various promoters are used to generate transformed plant cells and transgenic plants.
  • the transformed plant cells and the transgenic plants are strawberry Fragaria cells and plants.
  • the invention provides composition and means to both activate and/or repress the flowering process.
  • both flowering-inducing and flowering-inhibiting genes can be combined in a single recombinant construct, a single transformed cell, or a transgenic plant, to generate an expression system, cell, or plant, in which the flowering process can be turned on or off or in which the plant's growth habit can be altered.
  • the gene or genes in the recombinant construct are controlled by a constitutive promoter such that the transformed cell or transgenic plant will display altered flowering behavior or growth habit.
  • a transgenic plant of the invention has an early flowering or a day-neutral flowering phenotype produced by the constitutive expression of flowering promoting genes.
  • the expression of the gene or genes contained in the recombinant construct can be controlled by the application of appropriate regulatory agents or manipulation of environmental conditions. This allows manipulation of the flowering process and its timing. It also allows manipulation and regulation of the transformed cell's or transgenic plant's growth patterns and habits.
  • the recombinant construct can include a chemically regulable promoter controlling the expression of a flowering-promoting gene.
  • the application of the appropriate chemical will lead to the initiation of flowering due to the activity of the flowering-promoting gene.
  • Transgenic plants harboring this type of recombinant construct may flower in a synchronized fashion, facilitating synchronized, unifo ⁇ ri fruit production.
  • the constructs, transformed cells and transgenic plants of the invention comprise flowering-inducing nucleic acids with sequence identity to and including SEQ ID NO: l and SEQ ID NO:3, which may encode polypeptides having a sequence at least substantially identical to SEQ ID NO:2 and SEQ ID NO:4, respectively.
  • the constructs, transformed cells and transgenic plants comprise flowering-inducing nucleic acids with sequence identity to and including SEQ ID NO:7 or SEQ ID NO: 37, which may encode polypeptides with sequence identity to SEQ ID NO:8.
  • these flowering-activating genes, constructs, vectors, and polypeptides of the invention are applied to and expressed in transformed strawberry cells and transgenic strawberry plants.
  • constitutive expression of these flowering-promoting genes in plants results in a plant, such as Fragaria, displaying an early flowering or a day-neutral flowering phenotype.
  • expression of the flowering-inducing genes of the invention in a sense orientation can result in the expression of a flowering-inducing polypeptide.
  • This polypeptide can direct development of vegetative meristem tissue into inflorescence and/or floral meristems resulting in flower formation.
  • transformed cells and transgenic plants are provided in which these flowering-inducing nucleic acids of the invention are used to downregulate or inhibit expression of endogenous floral homeotic genes. This can be done using either anti-sense or sense suppression technology, as described below.
  • the invention also provides nucleic acids (expressed in the sense orientation), recombinant constructs, and polypeptides to generate transformed plant cells and transgenic plants in which the flowering process or timing thereof is repressed, disabled or delayed.
  • the constructs, transformed cells and transgenic plants of the invention comprise nucleic acids with sequence identity to SEQ ID NO: 5 or SEQ ID NO: 37 or which encode polypeptides with sequence identity to SEQ ID NO:6.
  • genes and polypeptides may be negative regulators of flowering.
  • the constitutive expression of SEQ ID NO 5 may delay the initiation of flowering.
  • Plants harboring such constitutive constructs may also display an altered growth habit; in particular, plants may grow larger or more bushy than untransformed plants of the same variety.
  • Alternative embodiments include constructs, transformed cells and transgenic plants in which expression of these flowering-repressing nucleic acids are inhibited to stimulate flowering.
  • a transgenic plant expressing these nucleic acids as antisense transcripts may produce more flowers, ectopic flowers, and/or may produce flowers earlier than wild type.
  • transformed cells or transgenic plants may express combinations of floral-inducing and floral-repressing nucleic acids either concomitantly or at different times in the growth period of the plant.
  • transgenic plants may harbor a recombinant construct comprised of both SEQ ID 7 or SEQ ID NO: 37 (a flowering inducing gene) as well as SEQ ID 5 or SEQ ID NO: 36 (a gene which delays flowering time).
  • SEQ ID 7 may generate day neutral flowering behavior while SEQ ID 5 expression may be used to delay flowering until an appropriate time or until the plant achieves a desired size.
  • SEQ ID 7 may generate day neutral flowering behavior
  • SEQ ID 5 expression may be used to delay flowering until an appropriate time or until the plant achieves a desired size.
  • such plants may have an altered growth habit with respect to untransformed plants of the same variety.
  • promoters can be used in the constructs of the invention depending on the intended use of the transformed cell or transgenic plant.
  • constitutively active, tissue-specific, developmentally regulated and inducible promoters are used, as described in detail, below.
  • alternative embodiments include constructs, transformed cells and transgenic plants in which flowering-promoting and flowering -repressing nucleic acids of the invention are used alone or in any combination and may be variously controlled by constitutive, tissue specific, developmentally regulated or inducible promoters. Additionally constructs may be used in which activity of the polypeptides encoded by the nucleic acids of the invention are under the control of certain chemicals or environmental conditions.
  • transgenic plants of the invention harbor a construct comprising nucleic acids with sequence identity to SEQ ID NO 5 (a flowering delaying nucleic acid) and SEQ ID NO 7 (flowering promoting nucleic acid).
  • a chemically regulable promoter may control the expression of SEQ ID NO 5 and a constitutive promoter may control the expression of SEQ ID NO7.
  • flowering may be inhibited while expression of SEQ ID NO 5 (in a sense orientation) is induced by the application of the appropriate chemical.
  • Flowering may be induced by the removal of such chemical coupled with the elevated expression of SEQ ID NO 7 (in the sense orientation). Induction of flowering may be rapid and somewhat synchronized due to the action of both of these genes in this manner.
  • Another transgenic plant of the invention comprises nucleic acid with sequence identity to SEQ ID NO 5 under the control of a constitutive promoter and SEQ ID NO 7 under the control of a chemically regulable promoter.
  • flowering may be delayed due to the elevated expression of SEQ ID NO 5 (in a sense orientation) and plants may become large or bushy.
  • Application of the appropriate chemical agent will induce SEQ ID NO 7 expression (in a sense orientation) and flowering may result due to its flowering promoting activity.
  • the invention includes all combinations of nucleic acids of the invention, whose expression in cells and plants are controlled in various manners by promoters or other means (e.g. controlled sense and anti-sense gene expression for the production and/or inhibition of polypeptides) to change the plant's phenotype, e.g., to vary the flowering behavior and/or growth habit of the plant.
  • promoters or other means e.g. controlled sense and anti-sense gene expression for the production and/or inhibition of polypeptides
  • the transformed cells and transgenic plants of the invention are strawberry cells and plants. It is preferable to use the nucleic acids of the invention derived from a member of the genus Fragaria, to generate transgenic strawberry plants in which flowering and photoperiod influence on flowering can be manipulated. For example, induction of floral homeotic genes and flowering involves the expression of a polypeptide which interacts with strawberry genes and gene products. Thus, recombinant expression of the strawberry-derived nucleic acids of the invention as a sense transcript in Fragaria cells can generate polypeptides with more specificity, better stability, and higher binding affinities than polypeptides from non-strawberry flower- inducing genes.
  • the nucleic acids of the invention are also used to generate "knockout" cells and plants in which the co ⁇ esponding endogenous gene has been disrupted.
  • the knockout is initially made by homologous recombination of the endogenous gene with the inserted heterologous construct.
  • progeny of these "knockouts” are used to generate transformed cells and transgenic plants containing the nucleic acids of the invention expressed in a sense orientation by an inducible promoter.
  • the floral homeotic genes and flowering are activated only by application of an inducing agent. When the inducing agent is removed or degraded, the flowering process reverts to its disabled "knockout" state.
  • amplifying as used herein incorporates its common usage and refers to the use of any suitable amplification methodology for generating or detecting recombinant or naturally expressed nucleic acid, as described in detail, below.
  • the invention provides methods and reagents (e.g., specific oligonucleotide PCR primer pairs) for amplifying (e.g., by PCR) naturally expressed or recombinant nucleic acids of the invention in vivo or in vitro.
  • one indication that two polynucleotides are substantially identical is if the reference sequence, amplified by a pair of oligonucleotide primers or a pool of degenerate primers substantially identical to a strawberry-derived sequence of the invention, can then be used as a probe under stringent hybridization conditions (defined below) to identify or isolate a second sequence from a cDNA or genomic library, or to identify the second sequence in, e.g., a Northern or Southern blot.
  • another indication that the sequences are substantially identical is if the same set of PCR primers can be used to amplify both sequences.
  • day-neutral-flowering phenotype refers to the ability of a plant to initiate inflorescence formation and flower development with little or no dependence on photoperiod duration.
  • the term includes plants completely independent of a specific photoperiod requirement for flowering as well as plants with reduced dependence on photoperiod for flowering as a result of alteration with a nucleic acid of the invention compared with the photope ⁇ od requirements for flowe ⁇ ng of an ongmal, unaltered plant
  • expression cassette refers to any recombinant expression system for the purpose of expressing a nucleic acid sequence of the invention in vitro or in v ⁇ o, constitutively or mducibly, in any cell, including, in addition to plant cells, prokaryotic, yeast, fungal, insect or mammalian cells
  • the term includes linear or circular expression systems
  • the term includes all vectors
  • the cassettes can remain episomal or integrate mto the host cell genome
  • the expression cassettes can have the ability to self- rephcate or not, i e , d ⁇ ve only transient expression m a cell
  • the term includes recombinant expression cassettes which contain only the minimum elements needed for transc ⁇ ption of the recombinant nucleic acid
  • heterologous when used with reference to a nucleic acid, indicates that the nucleic acid is in a cell or plant where it is not normally found in nature, or, compnses two or more subsequences which are not found m the same relationship to each other as normally found in nature, or is recombinantly engineered so that its level of expression, or physical relationship to other nucleic acids or other molecules m a cell, or structure, is not normally found in nature
  • a heterologous nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged in a manner not found in nature, e g , a non-strawberry-de ⁇ ved promoter sequence operably linked to a strawberry-denved gene of the invention
  • the mvention provides recombinant constructs (expression cassettes, vectors, viruses, and the like) compnsing vanous combinations of promoters and sequences of the invention many examples of which are descnbed
  • isolated when refernng to a molecule or composition, such as, e g , a nucleic acid or polypeptide of the invention, means that the molecule or composition is separated from at least one other compound, such as a protein, DNA, RNA, or other contaminants with which it is associated in vivo or m its naturally occurring state
  • a nucleic acid sequence is considered isolated when it has been isolated from any other component with which it is naturally associated
  • An isolated composition can, however, also be substantially pure
  • An isolated composition can be in a homogeneous state It can be in a dry or an aqueous solution Punty and homogeneity can be determined, e g , using analytical chemistry techniques such as, e g , polyacrylamide gel electrophoresis (SDS-PAGE) or high performance liquid chromatography (HPLC)
  • the terms "nucleic acid” and “polynucleotide” are used interchangeably, and include oligonucleotides
  • the terms also refer to synthetic and/or non-naturally occurring nucleic acids (i.e., comprising nucleic acid analogues or modified backbone residues or linkages).
  • the terms also refer to deoxyribonucleotide or ribonucleotide oligonucleotides in either single-stranded
  • operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
  • a promoter (defined below) is operably linked to a coding sequence, such as a nucleic acid of the invention, if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are c/-?-acting.
  • some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
  • a promoter is operably linked to a nucleic acid sequence of the invention, as exemplified by SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO: 43.
  • plant includes whole plants, plant parts (e.g., leaves, stems, flowers, roots, etc.), plant protoplasts, seeds and plant cells and progeny of same.
  • the class of plants which can be used in the method of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including angiosperms (monocotyledonous and dicotyledonous plants), as well as gymnosperms. It includes plants of a variety of ploidy levels, including polyploid, diploid, haploid and hemizygous states.
  • polypeptide As used herein, when referring to a "polypeptide" sequence, the sequence includes all variations with “conservative amino acid” substitutions or variations.
  • Constant substitution refers to a change in the amino acid composition of a protein, such as the polypeptides of the invention, that does not substantially alter the protein's activity. This includes conservatively modified variations of a pa ⁇ icular amino acid sequence, i.e., amino acid substitutions of those amino acids that are not critical for protein activity or substitution of amino acids with other amino acids having similar properties (e.g., acidic, basic, positively or negatively charged, polar or non-polar, etc.) such that the substitutions of even critical amino acids does not substantially alter activity.
  • a polypeptide sequence of the invention implicitly, and expressly, as defined herein, encompasses conservatively substituted variants thereof. Conservative substitution tables providing functionally similar amino acids are well known in the art.
  • the following six groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (a), Serine (S), Threonine (T); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); and 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W) (see also, Creighton (1984) Proteins, W.H. Freeman and Company).
  • substitutions are not the only possible conservative substitutions.
  • nucleic acid sequence of the invention implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences and as well as the sequence explicitly indicated.
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer (1991) Nucleic Acid Res. 19:5081; Ohtsuka (1985) J. Biol. Chem. 260:2605-2608; Rossolini (1994) Mol. Cell. Probes 8:91-98).
  • promoter includes all sequences capable of driving transcription of a coding sequence in a plant cell.
  • promoters used in the constructs of the invention include cis-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene, including the strawberry-derived sequences of the invention.
  • a promoter can be a czs-acting transcriptional control element, including an enhancer, a promoter, a transcription terminator, an origin of replication, a chromosomal integration sequence, 5' and 3' untranslated regions, or an intronic sequence, which are involved in transcriptional regulation.
  • These czs-acting sequences typically interact with proteins or other biomolecules to carry out (turn on/off, regulate, modulate, etc.) transcription.
  • recombinant refers to a polynucleotide synthesized or otherwise manipulated in vitro (e.g., “recombinant polynucleotide”), to methods of using recombinant polynucleotides to produce gene products in cells or other biological systems, or to a polypeptide ("recombinant protein") encoded by a recombinant polynucleotide.
  • “Recombinant means” also encompass the ligation of nucleic acids having coding or promoter sequences from different sources into an expression cassette or vector for.
  • sequence of a gene (unless specifically stated otherwise) or nucleic acid refers to the order of nucleotides in the polynucleotide, including either or both strands (sense and antisense) of a double-stranded DNA molecule, e.g., the sequence of both the coding strand and its complement, or of a single- stranded nucleic acid molecule (sense or antisense).
  • promoters drive the transcription of sense and/or antisense polynucleotide sequences of the invention, as exemplified by SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7 or SEQ ID NO: 43.
  • nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides (or amino acid residues) that are the same, when compared and aligned for maximum correspondence over a comparison window, as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. This definition also refers to the complement (antisense strand) of a sequence.
  • nucleic acids within the scope of the invention include those with a nucleotide sequence identity that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the exemplary sequences set forth in SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7.
  • polypeptides within the scope of the invention include those with an amino acid sequence identity that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the exemplary sequences set forth in SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. Two sequences with these levels of identity are "substantially identical" and within the scope of the invention.
  • nucleic acid sequence has the requisite sequence identity to SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:5, or SEQ ID NO:7, or a subsequence thereof, it also is a polynucleotide sequence within the scope of the invention. If a polynucleotide sequence has the requisite sequence identity to SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, or a subsequence thereof, it also is a polypeptide within the scope of the invention.
  • the percent identity exists over a region of the sequence that is at least about 25 nucleotides or amino acid residues in length, more preferably over a region that is at least about 50 to 100 nucleotides or amino acids in length.
  • Parameters including, e.g., window sizes, gap penalties and the like) to be used in calculating
  • a nucleic acid can be determined to be within the scope of the invention (e.g., is substantially identical to SEQ ID NO: 1, 3, 5, or 7) by its ability to hybridize under stringent conditions to a nucleic acid otherwise determined to be within the scope of the invention (such as the exemplary sequences described herein).
  • stringent hybridization conditions refers to conditions under which a probe will primarily hybridize to its target subsequence, typically in a complex mixture of nucleic acid, but to no other sequences in significant amounts (a positive signal (e.g., identification of a nucleic acid of the invention) is about 10 times background hybridization). Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH.
  • Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal (e.g., identification of a nucleic acid of the invention) is about 10 times background hybridization.
  • "Stringent" hybridization conditions that are used to identify substantially identical nucleic acids within the scope of the invention include hybridization in a buffer comprising 50%o formamide, 5x SSC, and 1% SDS at 42°C, or hybridization in a buffer comprising 5x SSC and 1% SDS at 65°C, both with a wash of 0.2x SSC and 0.1% SDS at 65°C.
  • Exemplary “moderately stringent hybridization conditions” include a hybridization in a buffer of 40% formamide, 1 M NaCl, and 1 % SDS at 37°C, and a wash in IX SSC at 45°C.
  • Nucleic acids which do not hybridize to each other under moderately stringent or stringent hybridization conditions are still substantially identical if the polypeptides which they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code, as discussed herein (see discussion on "conservative substitutions").
  • strawberry plant means any plant of the genus Fragaria, including, e.g., F. vesca and F. anannassa.
  • transgenic plant means a plant or plant cell into which a heterologous nucleic acid sequence has been inserted, e.g., the nucleic acids and various recombinant constructs (e.g., expression cassettes) of the invention.
  • flowering-regulating means to regulate or change the phenotype of the flowering process, including the timing, extent or formation of flower formation. This includes control of inflorescence meristem formation as well as subsequent floral meristem formation. It also includes development derived from such inflorescence and floral meristems.
  • the dependence of flower formation on photoperiod or temperature, the timing of flowering, uniformity of flower formation or the growth habit of the plant are all a consequence at least in part on the formation of the inflorescence meristem.
  • the meaning of “flowering-inducing,” “floral-inducing,” “flowering promoting” or “floral promotive” includes a general promotive effect on the formation or the timing of formation of the inflorescence meristem.
  • the meaning of “flowering-repressing,” “flowering-inhibiting,” “floral repressing” or “floral-inhibiting” includes any inhibitory effect on the formation or the timing or the extent of formation of the inflorescence meristem.
  • FLOWERING-REGULATING GENES AND POLYPEPTIDES This invention provides genes and polypeptides that can induce or repress the flowering process in plants.
  • the nucleic acids of the invention also include non- coding regions of these genes and complementary, or antisense, polynucleotides.
  • the genes and polypeptides can be expressed in vitro or in vivo, the invention provides for a variety of means of expressing these genes, including expression cassettes, vectors, cell lines, transgenic plants, and the like.
  • phenotypes associated with altered gene activity can be obtained by modulating the expression or activity of the genes and polypeptides of the invention. Any of the known methods described for increasing or decreasing expression or protein activity can be used for this invention. The invention can be practiced in conjunction with any method or protocol known in the art, which are well described in the scientific and patent literature.
  • nucleic acid sequences of the invention and other nucleic acids used to practice this invention may be isolated from a variety of sources, genetically engineered, amplified, and/or expressed recombinantly. Any recombinant expression system can be used, including, in addition to plants, e.g., bacterial, yeast, insect or mammalian systems. Alternatively, these nucleic acids can be chemically synthesized in vitro.
  • nucleic acids such as, e.g., subcloning into expression vectors, labeling probes, sequencing, and hybridization are well described in the scientific and patent literature, see e.g., Sambrook, ed., MOLECULAR CLONING: A LABORATORY MANUAL (2ND ED.), Vols. 1-3, Cold Spring Harbor Laboratory, (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel, ed. John Wiley & Sons, Inc., New York (1997); LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY: HYBRIDIZATION WITH NUCLEIC ACID PROBES, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
  • Nucleic acids can be analyzed and quantified by any of a number of general means well known to those of skill in the art. These include, e.g., analytical biochemical methods such as NMR, spectrophotometry, radiography, electrophoresis, capillary electrophoresis, high performance liquid chromatography (HPLC), thin layer chromatography (TLC), and hyperdiffusion chromatography, various immunological methods, such as fluid or gel precipitin reactions, immunodiffusion (single or double), immunoelectrophoresis, radioimmunoassays (RIAs), enzyme-linked immunosorbent assays (ELISAs), immuno-fluorescent assays, Southern analysis, Northern analysis, dot- blot analysis, gel electrophoresis (e.g., SDS-PAGE), RT-PCR, quantitative PCR, other nucleic acid or target or signal amplification methods, radiolabeling, scintillation counting, and affinity chromatography.
  • analytical biochemical methods such as NMR,
  • the present invention provides identification, characterization and isolation of genomic sequences corresponding to the nucleic acids of the invention.
  • the invention further provides cJs-acting transcriptional regulatory sequences, e.g., promoters, comprising the genomic sequences of the invention, including, e.g., 5' (upstream) of a transcriptional start site and intronic sequences.
  • the promoters of the invention contain cts-acting transcriptional regulatory elements involved in message expression. It will be apparent that promoter sequences may be readily obtained using routine molecular biological techniques.
  • genomic sequences may be obtained by screening plant, e.g., strawberry, genomic libraries using nucleic acid probes comprising a sequence or subsequence as set forth in the exemplary sequences of the invention (a nucleic acid sequence is within the scope of the invention if it has the requisite sequence identity, or, if it hybridizes under stringent conditions, as defined above, to the exemplary sequences of the invention).
  • genomic sequence can be readily identified by "chromosome walking” techniques, as described by, e.g., Hauser (1998) Plant J 16:117-125; Min (1998) Biotechniques 24:398-400.
  • any of a number of means known in the art can be used to increase flowering-inducing or flowering-repressing activity in plants.
  • enhanced expression of flowering-inducing genes and polypeptides is useful, e.g., to generate ectopic or earlier flowering.
  • flowering-repressing genes can be expressed to delay flowering. While any organ can be targeted, such as shoot vegetative organs/structures (e.g. leaves, stems and tubers), roots, flowers and floral organs/structures (e.g.
  • the vegetative meristem, the inflorescence meristem, and the floral cells are targeted.
  • one or several genes of the invention can be expressed constitutively (e.g., using the CaMV 35S promoter). Increasing flowering-inducing or flowering-repressing gene expression
  • Isolated sequences prepared as described herein can be used to introduce expression of a particular nucleic acid to increase gene expression using methods well known to those of skill in the art. Preparation of suitable constructs and means for introducing them into plants are described below.
  • the polypeptides encoded by the genes of the invention like other proteins, have different domains that perform different functions. Thus, the gene sequences need not be full length, so long as the desired functional domain of the protein is expressed. The distinguishing features of flowering-inducing and flower- repressing polypeptides and the means to test for flower-inducing or flower-repressing activity are discussed herein.
  • Modified protein chains can also be readily designed utilizing various recombinant DNA techniques well known to those skilled in the art and described in detail below.
  • the chains can vary from the naturally occurring sequence at the primary structure level by amino acid substitutions (particularly conservative substitutions, as discussed supra), additions, deletions, and the like. These modifications can be used in a number of combinations to produce the final modified protein chain.
  • seeds or other plant material can be treated with a mutagenic chemical substance, according to standard techniques.
  • chemical substances include, but are not limited to, the following: diethyl sulfate, ethylene imine, ethyl methanesulfonate and N-nitroso-N-ethylurea.
  • ionizing radiation from sources such as, X-rays or gamma rays can be used.
  • homologous recombination can be used to induce targeted gene modifications by specifically targeting the genes of the invention in vivo (see, generally, Grewal (1997) Genetics 146: 1221-1238; Xu (1996) Genes Dev. 10: 2411- 2422). Homologous recombination has been demonstrated in plants (see, e.g., Puchta (1994) Experientia 50: 277-284; Swoboda (1994) EMBO J. 13: 484-489; Offringa (1993) Proc. Nat Acad. Sci. USA 90: 7346-7350; Kempin (1997) Nature 389:802-803).
  • one means to apply homologous recombination technology to the genes of the invention involves making mutations in selected portions of a gene sequences (including 5 ' upstream, 3 ' downstream, and intragenic regions) in vitro and then introducing the modified nucleic acid into a desired plant cell using standard techniques. Since the efficiency of homologous recombination is known to be dependent on the vectors used, use of dicistronic gene targeting vectors as described by Mountford (1994) Proc. Natl. Acad. Sci. USA 91 : 4303-4307; Vaulont (1995) Transgenic Res. 4: 247-255, are conveniently used to increase the efficiency of selecting for altered gene expression in transgenic plants.
  • the mutated gene will interact with the target wild-type gene in such a way that homologous recombination and targeted replacement of the wild- type gene will occur in transgenic plant cells.
  • the altered and introduced gene can be designed to result in suppression of endogenous gene activity.
  • oligonucleotides composed of a contiguous stretch of RNA and DNA residues in a duplex conformation with double hairpin caps on the ends can be used.
  • the RNA/DNA sequence is designed to align with the sequence of the target gene and to contain the desired nucleotide change.
  • Introduction of the chimeric oligonucleotide on an extrachromosomal T-DNA plasmid results in efficient and specific gene conversion directed by chimeric molecules in a small number of transformed plant cells. This method is described in, e.g., Cole-Strauss (1996) Science 273:1386-1389; Yoon (1996) Proc. Natl. Acad. Sci. USA 93: 2071-2076.
  • Other means for increasing gene activity are described in, e.g., Cole-Strauss (1996) Science 273:1386-1389; Yoon (1996) Proc. Natl. Acad. Sci. USA 93: 2071-2076.
  • activation mutagenesis is to be used in this method.
  • an endogenous flower-inducing or flower-repressing gene can be modified to be expressed constitutively, ectopically, or excessively by insertion of T-DNA sequences that contain strong/constitutive promoters upstream of the endogenous gene.
  • Activation mutagenesis of the endogenous gene will give the same effect as overexpression of the transgenic nucleic acid in transgenic plants.
  • transgenic plants overexpressing flowering- regulating genes of the invention by this means may have an altered timing of flower formation.
  • an endogenous gene encoding an enhancer of expression of an endogenous flowering regulating gene can also be modified to be over-expressed by insertion of T-DNA sequences. This also results in increased gene expression and activity resulting in an altered timing of flower formation.
  • the invention includes transformed cells and transgenic plants with heterologous promoters inserted upstream of endogenous flower-inducing or flower-repressing genes.
  • Another strategy to increase gene expression can be the use of dominant hyperactive mutants by expressing modified transgenes.
  • expression of a modified flowering-regulating gene with a defective domain that is important for interaction with a negative regulator of activity can be used to generate dominant hyperactive proteins.
  • expression of truncated flowering- regulating protein which has only a domain that interacts with a negative regulator can titrate the negative regulator and thereby alter endogenous flowering-inducing activity.
  • Such domains can be identified by routine screening, as described herein.
  • Use of dominant mutants to hyperactivate target genes is described in, e.g., Mizukami (1996) Plant Cell 8:831-845 (see also Tones-Schumann (1996) Plant J 9:283-96).
  • the invention includes expression of polypeptides with only flower-inducing domains and lacking negative regulatory domains; and, alternatively, polypeptides with only negative regulatory domains.
  • a further means to potentially increase gene expression is to inhibit the target plant cell's "sense suppression” mechanism, also called “posttranscriptional gene silencing, or, PTGS.
  • a highly expressed transgene can be "silenced” by the plant cell via a PTGS mechanism.
  • PTGS may be prevented or inhibited by the co-expression of viral polypeptides known to inhibit sense suppression (see, e.g., Kasschau (1998) Cell 95:461-70, where a viral Pl/HC-Pro polyprotein encoded by tobacco etch virus functioned as a suppressor of PTGS).
  • the expression vectors of the invention are designed to co-express inhibitors of sense suppression.
  • inhibition of flowering-regulating gene expression activity can be used, for instance, to delay or repress flowering in plants.
  • Targeted expression of nucleic acids that inhibit endogenous gene expression e.g., antisense or sense suppression
  • nucleic acid sequences disclosed herein can be used to design nucleic acids useful in a number of methods to inhibit gene expression in cells and plants.
  • antisense technology can be conveniently used. See, e.g., Bourque (1995) Plant Sci. (Limerick) 105: 125-149; Pantopoulos In Progress in Nucleic Acid Research and Molecular Biology, Vol. 48. Cohn, W. E. and K. Moldave (Ed.). Academic Press, Inc., San Diego, CA; p. 181-238; Heiser (1997) Plant Sci. (Shannon) 127:61-69; Baulcombe (1996) Plant Mol. Bio. 32:79-88; Prins (1996) Arch. Virol.
  • Another well-known method of suppression is sense suppression.
  • Introduction of nucleic acid configured in the sense orientation has been shown to be an effective means by which to block the transcription of target genes in plants.
  • this method to modulate expression of endogenous plant genes, see, e.g., Assaad (1993) Plant Mol. Bio. 22: 1067-1085; Flavell (1994) Proc. Natl. Acad. Sci. USA 91 : 3490-3496; Stam (1997) Annals Bot. 79: 3-12; Napoli (1990) The Plant Cell 2:279-289; U.S. Patents Nos. 5,034,323, 5,231,020, and 5,283,184.
  • Oligonucleotide-based triple-helix formation can also be used to disrupt plant gene expression.
  • Triplex DNA can inhibit DNA transcription and replication, generate site-specific mutations, cleave DNA, and induce homologous recombination. See, e.g., Havre (1993) J. Virology 67:7324-7331 ; Scanlon (1995) FASEB J. 9:1288- 1296; Giovannangeli (1996) Biochemistry 35: 10539-10548; Chan (1997) J. Mol. Medicine (Berlin) 75: 267-282.
  • Triple helix DNAs can be used to target the same sequences identified for antisense regulation.
  • RNA molecules or ribozymes can also be used to inhibit expression of plant genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs. Thus, ribozymes can be used to target the same sequences identified for antisense regulation. A number of classes of ribozymes have been identified.
  • RNAs that are capable of self- cleavage and replication in plants.
  • the RNAs replicate either alone (viroid RNAs) or with a helper virus (satellite RNAs).
  • helper virus satellite RNAs
  • examples include RNAs from avocado sunblotch viroid and the satellite RNAs from tobacco ringspot virus, lucerne transient streak virus, velvet tobacco mottle virus, solanum nodiflorum mottle virus and subte ⁇ anean clover mottle virus.
  • the design and use of target RNA-specific ribozymes is described in, e.g., Zhao (1993) Nature 365:448-451; Eastham (1996) J. Urology 156:1186-1188; Sokol (1996) Transgenic Res. 5:363-371 ; Sun (1997) Mol. Biotechnology 7:241-251; Haseloff (1988) Nature, 334:585-591.
  • Flowering-inducing or flowering-repressing gene activity may be modulated by regulating the expression of proteins that are required for cell-specific gene expression.
  • expression of regulatory proteins e.g., tra/.s-acting transcriptional or translational regulators
  • sequences that control gene expression can be modulated using the methods described here.
  • Another strategy is to inhibit the ability of a flowering-inducing or flowering-repressing protein to interact with itself or with other proteins.
  • This can be achieved, for instance, using antibodies specific to a polypeptide of the invention.
  • cell-specific expression of specific antibodies is used to inactivate functional domains through antibody: antigen recognition (see, e.g. Hupp (1995) Cell 83:237-245).
  • Interference of activity of a protein that interacts with a flowering-inducing or flowering- repressing polypeptide can be applied in a similar fashion.
  • dominant negative mutants can be prepared by expressing a transgene that encodes a truncated flowering-inducing or flowering-repressing protein.
  • Either naturally occu ⁇ ing or recombinant polypeptides can be purified for use in functional assays.
  • Naturally occurring polypeptides can be purified, e.g., from plant tissue.
  • Recombinant polypeptides can be purified from any suitable expression system.
  • polypeptides of the invention be purified to substantial purity by standard techniques, including selective precipitation with such substances as ammonium sulfate; column chromatography, immunopurification methods, and others (see, e.g., Scopes, Protein Purification: Principles and Practice (1982); U.S. Patent No. 4,673,641 ; Ausubel, supra; and Sambrook. supra).
  • proteins having established molecular adhesion properties can be fused (reversibly or i ⁇ eversibly, i.e., by chemically or genetic engineering means) to the polypeptides of the invention.
  • the polypeptides can be selectively adsorbed to a fixed surface (e.g., a purification column, a bead, a membrane) and then freed from the column in a relatively pure form.
  • the fused protein is then removed, e.g., by enzymatic activity or reduction.
  • the fusion proteins can be initially or further purified using immunoaffmity columns. Isolation of nucleic acids
  • nucleic acids may be accomplished by a number of techniques, all well known in the art. For instance, oligonucleotide probes (e.g., PCR primers or hybridization probes) based on the sequences disclosed herein can be used to identify desired nucleic acids in a cDNA or a genomic DNA library.
  • oligonucleotide probes e.g., PCR primers or hybridization probes
  • genomic libraries large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector.
  • cDNA is isolated from the desired organ, such as a floral meristem cell, and a cDNA library which contains a flowering-inducing or flowering-repressing transcript is prepared from the mRNA.
  • cDNA may be prepared from mRNA extracted from other tissues in which flowering-inducing or flowering-repressing genes or homologues are expressed.
  • the cDNA or genomic library can then be screened using a probe based upon the sequence of a cloned gene disclosed herein. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. As discussed above, defined stringent hybridization conditions can be used to identify nucleic acid sequences within the scope of the invention.
  • antibodies raised against a flowering-inducing or flowering- repressing polypeptide can be used to screen a cDNA expression library.
  • the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques to generate flowering-inducing or flowering- repressing gene sequences directly from genomic DNA, from cDNA, from genomic libraries or cDNA libraries.
  • Gene amplification methods may also be useful, e.g., to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes.
  • the invention provides oligonucleotide primers that can amplify all or any specific region within a nucleic acid sequence of the invention, particularly, the exemplary species having sequences set forth in SEQ ID NOs: 1, 3, 5, and 7.
  • the nucleic acids of the invention can also be detected, generated or measured quantitatively using amplification techniques.
  • the skilled artisan can select and design suitable oligonucleotide amplification primers.
  • Amplification methods are also known in the art, and include, e.g., polymerase chain reaction, PCR (PCR PROTOCOLS, A GUIDE TO METHODS AND APPLICATIONS, ed. Innis, Academic Press, N.Y. (1990) and PCR STRATEGIES (1995), ed. Innis, Academic Press, Inc., N.Y. (Innis )), ligase chain reaction (LCR) (Wu (1989) Genomics 4:560; Landegren (1988) Science 241 : 1077; Barringer (1990) Gene 89:117); transcription amplification (Kwoh (1989) Proc. Natl. Acad. Sci.
  • Polynucleotides may also be synthesized by well-known chemical synthesis techniques, as described in, e.g., Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47:411-418; Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90;
  • Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA polymerase with an appropriate primer sequence. Preparation of recombinant vectors
  • DNA sequence coding for the desired polypeptide e.g., a cDNA sequence encoding a full length protein, can be combined with transcriptional and translational initiation regulatory sequences which will direct the transcription of the sequence from the gene in the intended tissues of the transformed plant.
  • the nucleic acids of the invention can be expressed in expression cassettes, vectors or viruses which are transiently expressed in cells using, e.g., episomal expression systems (e.g., cauliflower mosaic virus (CaMV) viral RNA generated in the nucleus by transcription of an episomal minichromosome containing supercoiled DNA, Covey (1990) Proc. Natl. Acad. Sci. USA 87:1633-1637).
  • episomal expression systems e.g., cauliflower mosaic virus (CaMV) viral RNA generated in the nucleus by transcription of an episomal minichromosome containing supercoiled DNA
  • coding sequences i.e., all or sub fragments of SEQ ID NO: l, 3, 5, or 7, can be inserted into the host cell genome becoming an integral part of the host chromosomal DNA.
  • Sense or antisense transcripts can be expressed in this manner.
  • the invention provides "knockout plants” where insertion of gene sequence by homologous recombination has disrupted the expression of the endogenous gene. Means to generate "knockout" plants are well-known in the art, see, e.g., Strepp (1998) Proc Natl Acad Sci USA 95:4368-4373; Miao (1995) Plant J 7:359-365.
  • Expression vectors capable of expressing proteins in plants are well known in the art, and can include, e.g., vectors from Agrobacterium spp., potato virus X (see, e.g., Angell (1997) EMBO J. 16:3675-3684), tobacco mosaic virus (see, e.g., Casper (1996) Gene 173:69-73), tomato bushy stunt virus (see, e.g., Hillman (1989) Virology 169:42-50), tobacco etch virus (see, e.g., Dolja (1997) Virology 234:243-252), bean golden mosaic virus (see, e.g., Morinaga (1993) Microbiol Immunol.
  • potato virus X see, e.g., Angell (1997) EMBO J. 16:3675-3684
  • tobacco mosaic virus see, e.g., Casper (1996) Gene 173:69-73
  • tomato bushy stunt virus see, e.g., Hillman (1989) Virology 169
  • cauliflower mosaic virus see, e.g., Cecchini (1997) Mol. Plant Microbe Interact. 10:1094-1101
  • maize Ac/Ds transposable element see, e.g., Rubin (1997) Mol. Cell. Biol. 17:6294-6302; Kunze (1996) Cu ⁇ . Top. Microbiol. Immunol. 204:161-194)
  • Spm maize suppressor-mutator
  • any strong, constitutive promoter such as the CaMV 35 S promoter, can be used for expression throughout the plant.
  • a plant promoter fragment may be employed which will direct expression of the gene in all tissues of a regenerated plant.
  • Such promoters are refe ⁇ ed to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation.
  • constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'- promoter derived from T- DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill.
  • Such genes include, e.g., ACT11 from Arabidopsis (Huang (1996) Plant Mol. Biol. 33: 125-139); Cat3 from Arabidopsis (GenBank No. U43147, Zhong (1996) Mol. Gen. Genet. 251 :196-203); the gene encoding stearoyl-acyl carrier protein desaturase from Brassica napus (Genbank No. X74782, Solocombe (1994) Plant Physiol. 104: 1167-1176); GPcl from maize (GenBank No. X15596; Martinez (1989) J. Mol. Biol 208:551-565); the Gpc2 from maize (GenBank No. U45855, Manjunath (1997) Plant Mol. Biol. 33:97-1 12); plant promoters described in U.S. Patent Nos. 4,962,028; 5,633,440.
  • the plant promoter may direct expression of flowering- inducing or flowering-repressing nucleic acid in a specific tissue, organ or cell type (i.e. tissue-specific promoters) or may be otherwise under more precise environmental or developmental control or under the control of an inducible promoter.
  • Examples of environmental conditions that may affect transcription include anaerobic conditions, elevated temperature, the presence of light, or sprayed with chemicals/hormones.
  • Tissue-specific promoters may promote transcription only within a certain time frame of developmental stage within that tissue.
  • the genes of the invention are operatively linked to promoters which are only active in plant meristem cells, including, e.g., inflorescence and/or floral meristem cells. See, e.g., Blazquez (1998) Plant Cell 10:791-800, characterizing the Arabidopsis LEAFY gene promoter. See also Cardon (1997) Plant J 12:367-77, describing the transcription factor SPL3, which recognizes a conserved sequence motif in the promoter region of the A. thaliana floral meristem identity gene API; and Mandel (1995) Plant Molecular Biology, Vol. 29, pp 995-1004, describing the meristem promoter eIF4. Tissue specific promoters which are active throughout the life cycle of a particular tissue are also used.
  • tissue-specific promoter may drive expression of operably linked sequences in tissues other than the target tissue.
  • a tissue-specific promoter is one that drives expression preferentially in the target tissue or cell type, but may also lead to some expression in other tissues as well.
  • the genes of the invention can also be operably linked to plant promoters which are inducible upon exposure to chemicals reagents. These reagents include, e.g., herbicides, synthetic auxins, or antibiotics which can be applied, e.g., sprayed, onto transgenic plants.
  • the invention provides the means to facilitate the harvesting of fruits and plant parts.
  • the maize In2-2 promoter activated by benzenesulfonamide herbicide safeners, is used (De Veylder (1997) Plant Cell Physiol. 38:568-577); application of different herbicide safeners induces distinct gene expression patterns, including expression in the root, hydathodes, and the shoot apical meristem.
  • Coding sequences of the invention are also under the control of a tetracycline-inducible promoter, e.g., as described with transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11 :465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11 :1315-1324).
  • a tetracycline-inducible promoter e.g., as described with transgenic tobacco plants containing the Avena sativa L. (oat) arginine decarboxylase gene (Masgrau (1997) Plant J. 11 :465-473); or, a salicylic acid-responsive element (Stange (1997) Plant J. 11 :1315-1324).
  • polyadenylation region at the 3'-end of the coding region should be included.
  • the polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from genes in the Agrobacterial T-DNA.
  • the vector comprising the sequences (e.g., promoters or coding regions) from genes of the invention will typically comprise a marker gene that confers a selectable phenotype on plant cells.
  • the marker may encode biocide resistance, particularly antibiotic resistance, such as resistance to kanamycin, G418, bleomycin, hygromycin, or herbicide resistance, such as resistance to chlorosulfuron or
  • DNA constructs of the invention may be introduced into the genome of the desired plant host by a variety of conventional techniques.
  • the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment, as discussed below.
  • transformed cells including transformed strawberry cells, can be generated by fusion of the recipient cells with bacterial protoplasts containing DNA, use of DEAE dextran, polyethylene glycol precipitation, as described, e.g., in Paszkowski (1984) EMBO J. 3:2717-2722.
  • DNA construct can be introduced directly into the genomic DNA of the plant cell using electroporation, as described, e.g., in Fromm (1985) Proc. Natl. Acad. Sci. USA 82:5824, or by microinjection of plant cell protoplasts, as described, e.g., Schnorf (1991) Transgenic Res. 1 :23-30.
  • DNA constructs can be introduced directly to plant tissue using ballistic methods, such as DNA particle bombardment.
  • Microprojectile bombardment to deliver DNA into plant cells is an alternative means of transformation for the numerous species considered recalcitrant to Agrobacterium- or protoplast-mediated transformation methods. For example, see, e.g., Christou (1997) Plant Mol. Biol. 35:197-203; Pawlowski (1996) Mol. Biotechnol. 6:17-30; Klein (1987) Nature 327:70-73; Takumi (1997) Genes Genet. Syst. 72:63-69, discussing use of particle bombardment to introduce transgenes into wheat; and Adam (1997) supra, for use of particle bombardment to introduce YACs into plant cells.
  • DNA can also be introduced in to plant cells using recombinant viruses.
  • Plant cells can be transformed using viral vectors, such as, e.g., tobacco mosaic virus derived vectors (Rouwendal (1997) Plant Mol. Biol. 33:989-999), see Porta (1996) "Use of viral replicons for the expression of genes in plants," Mol. Biotechnol. 5:209-221.
  • the DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector.
  • the virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria.
  • Agrobacterium tumefaciens-med ⁇ ated transformation techniques including disarming and use of binary vectors, are well described in the scientific literature. See, e.g., Horsch (1984) Science 233:496-498; Fraley (1983) Proc. N ⁇ tl. Ac ⁇ d. Sci. USA 80:4803 (1983); Gene Transfer to Plants, Potrykus, ed.
  • Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype, such as a modified flowering phenotype.
  • Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and or herbicide marker that has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp.
  • Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. Such regeneration techniques are described generally in Klee (1987) Ann. Rev. of Plant Phys. 38:467-486.
  • the nucleic acids of the invention can be used to confer desired traits on essentially any plant, particularly, in flowering plants.
  • the invention has use over a broad range of plants, including but not limited to species from the genera Anacardium, Arachis, Asparagus, Atropa, Avena, Brassica, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannesetum, Persea, Phaseolus, Pistachia, Pisum, Pyrus, Prunus, Raphanus, Ricinus, Secale, Seneci
  • the expression cassette after the expression cassette is stably incorporated in transgenic plants, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. Since transgenic expression of the nucleic acids of the invention leads to phenotypic changes, plants comprising the recombinant nucleic acids of the invention can be sexually crossed with a second plant to obtain a final product. Thus, the seed of the invention can be derived from a cross between two transgenic plants of the invention, or a cross between a plant of the invention and another plant.
  • the desired effects can be enhanced when both parental plants express the polypeptides of the invention.
  • the desired effects can be passed to future plant generations by standard propagation means. Using known procedures one of skill can screen for plants of the invention by detecting the increase or decrease of transgene mRNA or protein in transgenic plants. Means for detecting and quantitation of mRNAs or proteins are well known in the art. Alignment Analysis of Gene Sequences
  • the nucleic acid sequences of the invention include genes and gene products identified and characterized by analysis using the exemplary nucleic acid and protein sequences of the invention, including SEQ ID NO: l and SEQ ID NO:2; SEQ ID NO:3 and SEQ ID NO:4; SEQ ID NO:5 and SEQ ID NO:6; SEQ ID NO:7 and SEQ ID NO: 8, respectively.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters are used unless alternative parameters are designated herein.
  • the sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated or default program parameters.
  • a "comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 25 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (CLUSTAL, GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection .
  • CLUSTAL algorithm is used, particularly, the CLUSTAL W program, see, e.g., Thompson (1994) Nuc. Acids Res. 22:4673-4680; Higgins (1996) Methods Enzymol 266:383-402. Variations can also be used, such as CLUSTAL X, see Jeanmougin (1998) Trends Biochem Sci 23:403-405; Thompson
  • CLUSTAL is a particularly prefe ⁇ ed program for determining if sequences are so substantially identical they are within the scope of the invention because, if a comparison set consists of enough closely related sequences so that the first alignments are accurate, then CLUSTAL W will usually find an alignment that is very close to ideal.
  • the CLUSTAL W program described by Thompson (1994) supra is used with the following parameters: K tuple (word) size: 1, window size: 5, scoring method: percentage, number of top diagonals: 5, gap penalty: 3, to determine whether a nucleic acid has sufficient sequence identity to an exemplary nucleic acid (SEQ ID NO:l, 3, 5, or 7) to be with the scope of the invention.
  • PILEUP Another algorithm is PILEUP, which can be used to determine whether a nucleic acid has sufficient sequence identity to SEQ ID NO:l, 3, 5, or 7 to be with the scope of the invention.
  • This program creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show relationship and percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment.
  • PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351-360 (1987). The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153 (1989).
  • a reference sequence e.g., a sequence of the invention as set forth by SEQ ID NO:l, 3, 5, 7
  • PILEUP obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux(1984) Nuc. Acids Res. 12:387-395), using the parameters described therein, is used to identify nucleic acids within the scope of the invention.
  • BLAST algorithm Another example of an algorithm that is suitable for determining percent sequence identity (i.e., substantial similarity or identity) in this invention is the BLAST algorithm, which is described in Altschul (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for
  • HSPs high scoring sequence pairs
  • Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues, always ⁇ 0).
  • M forward score for a pair of matching residues; always > 0
  • N penalty score for mismatching residues, always ⁇ 0.
  • a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLASTP program uses as default parameters a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see, e.g., Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).
  • W wordlength
  • E expectation
  • BLOSUM62 scoring matrix see, e.g., Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915.
  • the invention provides transformed strawberry plant cells and transgenic plants, e.g., from Fragaria, such as F. vesca and F. anannassa.
  • Fragaria such as F. vesca and F. anannassa.
  • these can be generated using any of the above transformation techniques.
  • transformed strawberry cells can be produced and cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype.
  • regeneration techniques typically rely on manipulation of certain phytohormones in a tissue culture growth medium, and frequently use a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences.
  • one method involves culturing an explant in a callus growth medium supplemented with glucose as a primary carbon source until undifferentiated callus is formed from the explant; transferring the callus to a shoot induction medium, culturing the callus on the shoot induction medium until a shoot is formed from the callus, allowing the shoots to grow to a suitable size, transferring the shoot to root inducing medium until roots are formed; transferring the plantlets to obtain plants, and growing these plants under conditions to select for a desired characteristic and collecting the plants with the desired characteristics.
  • Example 1 A Isolation of SEQ ID NO 7 from Strawberries This example details the isolation of an exemplary strawberry cDNA of the invention by a polymerase chain reaction (PCR) based approach.
  • PCR polymerase chain reaction
  • the invention provides nucleic acids having at least 75% sequence identity to SEQ ID NO:7 and an isolated nucleic acid encoding a polypeptide, wherein the polypeptide has a sequence as set forth in SEQ ID NO:8.
  • RNA was isolated from developing strawberry (E. vesca) inflorescence tissue. Tissue was dissected from plants and immediately frozen in liquid nitrogen and stored at -80°C. Frozen tissue was ground to a fine powder in a mortar and pestle taking care to keep the tissue frozen at all times by periodic addition of liquid nitrogen during the grinding process. The addition of alumina during grinding aided in breakage of the tissue.
  • RNA from the stored tissue Five milliliters of extraction buffer was added per gram of powdered tissue; buffer was 0.2 M Boric Acid / Tris pH 7.6 (i.e., 0.2 M Boric Acid adjusted to pH 7.6 with Tris base) / 10 mM ⁇ DTA / 0.5% SDS / 2% ⁇ - mercaptoethanol ("2-M ⁇ "), 2-ME added just before use).
  • the powdered tissue was mixed thoroughly with the buffer by vortexing.
  • Ten milliliters of phenol buffered with Tris at pH 8.0 was added per gram of tissue and vortexed again for 3 to 4 minutes.
  • SEVAG a mixture in the ratio of 24: 1 of chloroform and isoamyl alcohol respectively
  • SEVAG a mixture in the ratio of 24: 1 of chloroform and isoamyl alcohol respectively
  • the homogenate was transfe ⁇ ed into CorexTM centrifuge tubes and centrifuged at 10,000 x g in a swinging bucket rotor at 4°C for 20 minutes.
  • the aqueous supernatant was removed and transfe ⁇ ed to a 50 ml Falcon tube, 5 mis buffered phenol and 5 mis SEVAG was added and the mixture was vortexed for 5 minutes.
  • the mixture was centrifuged at 10.000 x g in a swinging bucket rotor at 4°C for 20 minutes.
  • the aqueous phase was removed and the organic extraction repeated once more as described.
  • the volume of the final aqueous phase was measured (17 mis) and transfe ⁇ ed to a centrifuge tube that would hold 10 this volume, 6.8 mis of 1M NaOAc (pH 4.5) was added and mixed thoroughly then 44.2 mis RNase-free water was added and mixed well (the total volume is now 68 mis).
  • 2-Butoxyethanol Sigma # E-0883 Ethylene Glycol Monobutyl Ether or Butyl Cellosolve or 2-Butoxyethanol (“2-BE”) was added to give a final concentration of 9% (i.e., 27.2 mis) 2-BE is added),the solution was mixed thoroughly, transferred into an Oakridge tube and incubated on ice for 45 minutes.
  • Insoluble material was collected by centrifugation at 20,000 X g for 15 min. at 4°C. The supernatant was decanted into a clean, sterile, RNase-free beaker and 40.8 mis of 2-BE was added to yield a final concentration of 20% 2-BE, the solution was mixed well, transfe ⁇ ed into Oakridge and incubated on ice for 45 minutes. The RNA was collected by centrifugation 20,000 X g for 15 min. at 4°C. The supernatant was decanted and the pellets were washed with 3 mis of a solution of 0.2 M Boric acid/Tris pH 7.6, 10 mM EDTA, 50% 2-BE.
  • Pellets were combined and washed with 70% ethanol and collected by centrifugation at 10,000 x g for 10 min. at 4°C.
  • the pellets were dissolved in 10 mis BTEN (25 mM Boric Acid / Tris (pH 7.6) / 1.25 mM EDTA / 100 mM NaCl) + 1% ⁇ -mercaptoethanol + 0.5% sodium dodecyl sulfate (SDS), then an equal volume of 2-BE was added, mixed well and placed on ice for 45 min.
  • RNA was collected by centrifugation at 20,000 X g for 15 min. at 4°C and the supernatant was discarded.
  • Pellets were washed with a 1 : 1 mixture of
  • BTEN 2-BE by vortexing thoroughly followed by centrifugation 20,000 X g for 15 min. at 4°C and the supernatant was discarded. The pellets were washed with 70% ethanol and collected by centrifugation at 10,000 x g for 10 min.
  • the RNA was dissolved in 5 mis RNase-free water with 1% ⁇ -mercaptoethanol and 0.2% SDS, adjusted to 3M LiCl, mixed well and placed on ice for a minimum of 4 hrs to a maximum of 16 hrs. The RNA was collected by centrifugation at 10,000 X g for 10 min at 4°C, the supernatant discarded and the pellets washed with 70% ethanol.
  • the pellets were dissolved in 3 mis RNase-free water, adjusted to 0.3 M NaOAc pH 5.2, 2.5 volumes of ethanol was added, mixed well and the mixtures were held at -20°C for a few hrs to overnight.
  • the RNA was collected by centrifugation at 10,000 x g for 10 min., the supernatant decanted and the pellets washed with 70% ethanol.
  • the RNA pellet was dissolved in 300 ⁇ l RNase-free water, transfe ⁇ ed to a 1.5 ml microcentrifuge tube, and 1/10 vol. 2 M KOAc (pH 5.5) was added, mixed well and the mixture was incubated on ice for 20 min.
  • the pellet was collected by centrifugation in micro fuge for 10 minutes at 16,000 X g and 4°C to remove polysaccharides and insoluble material. The supernatant was transferred to a new microfuge tube and the pellet was discarded.
  • the RNA was precipitated by the addition of 2.5 volumes of 100% ethanol, mixed well and placed at -20°C for about 1 hour.
  • the RNA pellet was collected by centrifugation in a microfuge for 10 minutes at 16,000 x g and 4°C.
  • the RNA pellet was washed with 70% ethanol, dissolved in 300 ⁇ l RNase free water and adjusted to 1 M NaCl.
  • the solution was then extracted with a mixture of 200 ⁇ l phenol which had been previously equilibrated with 150 mM NaCl / 50 mM Tris pH 7.5 / 1 mM EDTA and 200 ⁇ l SEVAG.
  • the aqueous phase was collected after centrifugation at 16,000 x g for 5 min at 4°C, diluted to 3 mis with a solution of 1M NaCl / 50 mM Tris pH 7.5 / 10 mM EDTA and layered over 2 mis of a solution of 5.7 M CsCl / 50 mM Tris pH 7.5 / 10 mM EDTA in an SW50.1 centrifuge tube (Beckman Instruments).
  • RNA isolated from developing strawberry inflorescences as described above was used to synthesize first strand cDNA using the Superscript IITM system from Life Technologies (Gaithersburg, MD USA). Five micrograms RNA was diluted to 12 ⁇ l with RNase-free water in a 0.5 ml microcentrifuge tube, heated to 70°C for 10 minutes then quick chilled in an ice/water mixture.
  • the tube was microfuged for a few seconds to collect the contents at the bottom and 4 ⁇ l of 5X First Strand Buffer was added (250 mM Tris-HCl (pH 8.3), 375 mM KCl, 15 mM Mg 2 Cl), followed by 2 ⁇ l of 0.1M dithiothreitol and 1 ⁇ l of a mixture which was 10 mM of each dATP, dTTP, dCTP, dGTP. The solution was mixed well, placed at 42°C for 2 min, then 1 ⁇ l of Superscript IITM was added, the entire solution was mixed gently and placed at 42°C for 1 hr. The reaction was diluted to 100 ⁇ l with RNase-free water and stored at -20°C until used as a template for the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the initial degenerate oligonucleotide primers were made based on the alignment of Arabidopsis thaliana CONSTANS protein (Genbank # S77098), the
  • Brassica napus COal protein (Genbank # AFO 16009), and the Raphinus sativus CO-like protein (Genbank #AF052690). Alignment of these sequences using the CLUSTAL W program (described by Thompson (1994) supra, using parameters as described above) revealed a region (residues 312 to 353) near the carboxy terminus which is highly conserved among all three of these sequences.
  • NC478 5' TAY MGN GAR AAR MGN AA 3'
  • NC-479 5' TT NCK YTT YTC NCK RTA 3'
  • NC-480 5' GC RTA NCK DAT NGT YTT YTC RAA 3'
  • An initial RT-PCR was performed using first strand cDNA generated by the reverse transcription of RNA isolated from developing inflorescence tissue using NC478 and NC481 and the AdvantageTM system from Clontech (Palo Alto, CA USA).
  • Two microliters of the diluted first strand cDNA was mixed with 36 ⁇ l of water, 5 ⁇ l 10X PCR buffer (400 mM Tricine-KOH (pH 9.2 at 25°C), 150 mM KOAc, 35 mM Mg(OAc) 2 , 37.5 ⁇ g/ml Bovine Serum Albumin), 2 ⁇ l 5 mM dNTPs, 2 ⁇ l 10 ⁇ M NC 478, 2 ⁇ l 10 ⁇ M NC 481 and 1 ⁇ l 50X Polymerase Mix (Clontech).
  • 10X PCR buffer 400 mM Tricine-KOH (pH 9.2 at 25°C)
  • 150 mM KOAc 35 mM Mg(OAc) 2 , 37.5 ⁇ g/ml Bovine Serum Albumin
  • 2 ⁇ l 5 mM dNTPs 2 ⁇ l 10 ⁇ M NC 478, 2 ⁇ l 10 ⁇ M NC 481 and 1 ⁇ l 50X Polymerase Mix
  • the solution was mixed well, microfuged a few seconds and subjected to 35 cycles of the following temperature regime: (denaturation) 95°C for 30 seconds, (annealing) 43°C for 30 seconds, (extension) 72°C for 1 minute in a Perkin Elmer Cetus Thermal Cycler.
  • the products of this reaction were run on a 4% agarose gel according to standard procedures (see, e.g., Ausubel, supra).
  • DNA band migrating between 50 base pairs (bp) and 100 bp was removed from this gel by the insertion of a standard Pasteur pipet directly into the ultraviolet light induced ethidium bromide fluorescing area.
  • the agarose plug in the end of the pipet was transferred to a 0.5 ml microfuge tube and incubated in 20 ⁇ l of water at 37°C for 6 hrs.
  • One microliter of the resulting supernatant was subjected to another PCR using the conditions described above and substituting NC 478 and NC480 for the oligonucleotide primers.
  • ds double stranded cDNA was produced exactly as described previously (Chenchik et. al. (1996) "A New Method for Full-Length cDNA Cloning by PCR," in A Laboratoiy Guide to RNA: Isolation, Analysis, and Synthesis, Paul A. Krieg (ed.)Wiley- Liss, Inc. NY.) using the kit available from Clontech (catalog # K 1802-1).
  • the 3' end of the transcript was amplified by PCR using NC 482, the Adaptor Primer PI : 5' CCATCCTAATACGACTCACTATAGGGC 3' ((SEQ ID NO:14), supplied with the kit), components of the PCR were as described above however the cycling conditions were as follows: 5 cycles of 30 sec at 95°C, 30 sec at 61 °C, 3 min at 72°C; 5 cycles of 30 sec at 95°C, 30 sec at 58°C, 3 min at 72°C, 35 cycles of 30 sec at 95°C, 30 sec at 56°C, 3 min at 72°C.
  • NC 483 5' GCCTCTAGACTAAAAGGAAGGAACGACGCCGTAGC 3'
  • NC 482 5' GCCTCTAGACTAAAAGGAAGGAACGACGCCGTAGC 3'
  • the strawberry-derived nucleotide SEQ ID NO: l was similarly isolated and analyzed. Its translation product has a sequence as set forth in SEQ ID NO:2. Isolation of this nucleotide sequence was done in the same manner as described in Example 1 A for SEQ ID NO 7 except as follows.
  • the 5' and 3' ends were isolated as described for the 5' end of SEQ ID NO 7 except for the primers used.
  • the 5' end was isolated using NC 441 (5' GGAAGAGGTAATCCAGTCCGT 3') (SEQ ID NO: 18) and PI ; the 3' end was isolated using NC 439 (5' GGAGGTGGCACGTGGCAA 3') (SEQ ID NO: 19) and PI.
  • the entire coding region was amplified by RT-PCR using NC 454 (5' GGCCATGGATCCAAA- TTCGTTCACTG 3') (SEQ ID NO:20) and NC 455 (5' GGTCTAGATTTCAGTAG GGAAGCGGATCAG 3') (SEQ ID NO:21) using conditions described previously in Example 1A except the cycling regime consisted of 35 cycles of 30 sec at 95°C, 30 sec at 65°C, 4 min at 72°C.
  • One exemplary nucleic acid clone insert has the nucleotide sequence (SEQ ID NO:l) with translation product sequence (SEQ ID NO:2).
  • EXAMPLE 1C Isolation of SEQ ID NO 3 The strawberry-derived SEQ ID NO:3 was similarly isolated and analyzed
  • the 5' end was isolated using primers NC 433 (5* AGCAACCTGAGCATCGCACA 3') (SEQ ID NO:24) and PI; the 3' end was isolated using NC 431 (5' AGGCAGGTGACGTTTTCGAA 3 * ) (SEQ ID NO:25) and PI .
  • the entire coding region was amplified by RT-PCR using NC 452 (GGCCATGGGAAGGGGTAGGGTTCA-GCT 3') (SEQ ID NO:26) and NC 453 (5' GGTCTAGATATTCATGAAGCAAAGCATCCAA 3') (SEQ ID NO:27) using conditions described previously in Example 1 A except the cycling regime consisted of 35 cycles of 30 sec at 95°C, 30 sec at 65°C, 4 min at 72°C.
  • One exemplary nucleic acid clone insert has the nucleotide sequence (SEQ ID NO:3) with translation product sequence (SEQ ID NO:4).
  • SEQ ID NO: 5 The strawberry-derived SEQ ID NO: 5 was similarly isolated and analyzed.
  • SEQ ID NO:5 has a translation product with a sequence as set forth in SEQ ID NO:6. Isolation of this sequence was done in the same manner as described for SEQ ID NO 7 in Example 1A except as follows.
  • the initial RT-PCR used primers NC 421 (5' GACCCWGATGT TCCWGGTCCTAGTGA 3') (SEQ ID NO:28) and PL
  • the cycling regime consisted of 1 cycle of 5 min at 95°C, 2 min at 52°C and 35 cycles of 1 min at 95°C, 1.5 min at 52°C and 3 min at 72°C.
  • the products of this reaction were run on an agarose gel and the material comigrating with a 500 bp size standard was eluted from the gel by diffusion into distilled water.
  • the eluted products were amplified using primers NC 421 and NC 438 (5' TTRAARAANACNGCNGC 3') (SEQ ID NO:29) using conditions described in Example 1 A and a cycling regime consisting of 35 cycles of 30 sec at 95°C, 30 sec at 52°C , 1 min at 72°C and the resulting 278 bp product was cloned and sequenced.
  • the 5' end was isolated using primers NC 444 (5' ACCGGAAGCCC GAACTCGTT 3') (SEQ ID NO:31) and PI using conditions described in Example 1 A for the 5' end of SEQ ID NO 7.
  • NC 445 5' GTTGTTCCTGGGATGTCC GTG 3'
  • Adapter Primer P2 5' ACTCACTATAGGGCTCGA- GCGGC 3'
  • the approximately 325 bp product was cloned and sequenced.
  • the entire coding region was amplified by RT-PCR using primers NC 460 (5' ATTCCATGGCAA AGATCTCAGATGG 3') (SEQ ID NO:34) and NC 461 (5' GGCTCTAGACTATTAGCG TCTTCTTGCAGCAGTT 3') (SEQ ID NO:35) using conditions described in Example 1A and a cycling regime consisting of 35 cycles of 30 sec at 95°C, 30 sec at 65°C, 2 min at 72°C.
  • the 3' end was isolated using primers NC 431 (5' AGGCAGGTGACG TTTTCGAA 3') (SEQ ID NO:25) and PI .
  • NC 431 5' AGGCAGGTGACG TTTTCGAA 3'
  • PI PI .
  • the entire coding region was amplified by RT- PCR using primers NC 452 (GGCCATGGGAAGGGGTAGGGTTCAGCT 3') (SEQ ID NO:26) and NC 453 (5' GGTCTAGATATTCATGAAGCAAAGCATCCAA 3') (SEQ ID NO:27) using conditions as described in Example 1 A except for the following.
  • the cycling regime consisted of 35 cycles of 30 sec at 95°C, 30 sec at 65°C, 4 min at 72°C.
  • One exemplary nucleic acid clone insert has the nucleotide sequence (SEQ ID NO:5) with translation product sequence (SEQ ID NO:6).
  • EXAMPLE IE Isolation of genomic sequence corresponding to SEQ ID NO:7
  • Fragaria vesca genomic DNA was isolated as follows. Young leaves were harvested from actively growing plants, and frozen in liquid nitrogen. Ten grams of leaf tissue was ground to a fine powder in a mortar and pestle in 1-1.5 gram aliquots and stored at -80°C. Powderd leaf tissue was addd to 60 mis ice cold Isolation Buffer [50mM Tris.HCl (pH8.0), 5 mM EDTA, 0.35M Sorbitaol, 5% polyvinylpyrolidone-40, lOmM sodium metabisulfite, 20 mM -mercaptoethanol) and the mixture sti ⁇ ed well with a glass rod to eliminate aggregates of powdered tissue.
  • Isolation Buffer 50mM Tris.HCl (pH8.0), 5 mM EDTA, 0.35M Sorbitaol, 5% polyvinylpyrolidone-40, lOmM sodium metabisulfite, 20 mM -mercaptoethanol
  • the suspension was filtered through 2 layers of cheese cloth and 1.5 mis of 25% TritonX-100 was added to the filtrate while stirring well.
  • the mixture was filtered through a 100 m nylon mesh and the filtrate was passed through a 50 m nylon mesh. Seventy five mis of the filtrate was mixed with 75 mis of Percoll/Sorbitol solution [9 parts Percoll/1 part 2.4 M sorbitol in water]. Thirty mis of this mixture was gently layered over 20 mis of a solution comprised of 5 parts percoll: 1 part 2.4 M sorbitol : 4 part Isolation buffer in a 50 ml centrifuge tube.
  • the tubes were centrifuged at 2000 x g at 4°C for 45 minutes and the supernatant was removed by pipeting. the pellets were gently resuspended in a total 5 ml of Extraction Buffer (3% Cetyl Trime hyl Ammonium Bromide, 1.4 M Sodium Chloride, 20 mM EDTA), combined and incubated for 60 minutes at 60°C. The mixture was extracted with 5 mis of a solution comprised of 24 parts chloroform, 1 part isoamyl alcohol by gentle shaking.
  • Extraction Buffer 3% Cetyl Trime hyl Ammonium Bromide, 1.4 M Sodium Chloride, 20 mM EDTA
  • the mixture was centrifuged at 1000 x g for 10 minutes at room temperature and the aqueous phase re-extracted with 24 parts chloroform, 1 part isoamyl alcohol and centrifuged again at 1000 x g at room temperature for 10 minutes. The aqueous phase was removed, 7 mis isopropanol was added and mixed thoroughly.
  • the DNA was collected by centrifugation at 2000 x g at room temperature for 20 minutes and washed with 70 % ethanol. Genomic DNA was subsequently purified by CsCl gradient centrifugation according to standard procedures (Ausubel, 1992). DNA was dissolved in lOmM Tris .HCl, 1 mM EDTA and quantitated by spectrophotometry. and screening by plaque hybridization using radioactively labeled probes (Ausubel et. al. supra).
  • genomic DNA was partially digested with Sau3A (Ausubel et al. supra) and subjected to sucrose gradient centrifugation (Ausubel et. at. supra) to separate the different sizes.
  • the 15-20 kb size fraction was identified by agarose gel electrophoresis and precipitated according to standard protocols (Ausubel et. al. supra).
  • the genomic library was constructed in Xhol cut, partially filled in Lambda FIX IITM (Stratagene, La Jolla, CA, USA), a phage lambda based cloning vector, according to the manufacturer's instructions (Stratagene catalog #248712 revision #047001).
  • the library was screened according to previously described methods using radiolabelled nucleotide probes (Ausubel et. al. supra).
  • the probes were comprised of SEQ ID NO 7 or SEQ ID NO 5 as well as SEQ ID NO 38 described below.
  • Genomic DNA was identified based on its ability to hybridize to a probe made from SEQ ID NO 7 under normal high stringency conditions in a Southern blot experiment using restriction enzyme-digested purified lambda clone DNA as the target.
  • An approximately 10 kb Xbal fragment which hybridized with the probe was subcloned into Bluescript SK+ (Stratagene, La Jolla, CA USA) following standard procedures (see, e.g., Ausubel, supra).
  • the insert was sequenced using the EZ::TNTM ⁇ KAN-l>Tnp TransposomeTM Kit (Epicentre, Madison WI) and has the nucleotide sequence shown in SEQ ID NO 36.
  • Genomic DNA was identified in the library described above based on its ability to hybridize to a probe made from SEQ ID NO 5 under normal high stringency conditions in a Southern blot experiment using restriction enzyme-digested purified lambda clone DNA as the target.
  • An approximately 3.7 kb Notl-EcoRI fragment which hybridized with the probe was subcloned into Bluescript SK+ (Stratagene, La Jolla, CA USA) following standard procedures (see, e.g., Ausubel, supra).
  • the insert was sequenced using the EZ::TNTM ⁇ KAN-l>Tnp TransposomeTM Kit (Epicentre, Madison WI) and has the nucleotide sequence as shown in SEQ ID NO 37.
  • EXAMPLE 1G Isolation of genomic sequence related to SEQ ID NO:5
  • a genomic clone which is highly similar to SEQ ID NO: 5 was isolated in a similar manner as SEQ ID NO 36 except the probe was a PCR product using Fragaria vesca genomic DNA as the template and NC 421 (5'
  • Genomic DNA was identified based on its ability to hybridize to a probe made from the 580 bp PCR product formed using NC421 and NC525 under normal high stringency conditions in a Southern blot experiment using restriction enzyme-digested purified lambda clone DNA as the target.
  • EXAMPLE 1H Isolation of cDNA corresponding to SEQ ID NO:40
  • a cDNA sequence corresponding to SEQ ID NO: 40 was isolated in a similar manner as SEQ ID NO 7 except primers were NC 551 (5' CCGCCATGGCAATGTCGGAACC 3') (SEQ ID NO 41 ) and NC552 (5' CCGGCTAGCGTCTTCTTGCTGCCGTT 3') (SEQ ID NO 42) as the primers and an annealing temperature of 65°C and first strand cDNA from RNA isolated from developinginflorescence tissue was used as the template, other conditions were as described for SEQ ID NO 7.
  • One exemplary nucleic acid clone insert has the sequence as shown in SEQ ID NO 43 with the translation product sequence as shown in SEQ ID NO 44.
  • the invention provides a transformed plant cell comprising a nucleic acid of the invention operably linked to a promoter.
  • the invention also provides a transgenic plant or progeny thereof comprising a nucleic acid of the invention operably linked to a promoter.
  • the following example details the transformation of strawberry plant cells and the production of a transgenic strawberry plant by regeneration of the plant from the transformed cell. Leaves from young Fragaria X annassa variety Camarosa (obtained from
  • the Agrobacterium cells harbor a binary plasmid pMM7400, illustrated in Figure 1.
  • This plasmid contains a selectable marker gene suitable for expression in a plant cell and capable of conferring upon that cell resistance to the herbicide chlorsulfuron. It also contains a gene comprised of the CaMV 35S promoter and the cab221eader, and a coding region for a nucleic acid of the invention in the sense orientation. The coding region is operably linked to polyadenylation signals from the octopine synthase gene. See the schematic diagram of the exemplary plasmid illustrated in Figure 1. The plant tissue is gently agitated for 2 to 3 minutes, whereupon the
  • Agrobacterium solution is removed by pipetting.
  • the leaf strips are gently blotted dry using sterile filter paper and carefully placed on the surface of a petri dish containing co- cultivation medium such that the dull side is facing up.
  • the plates are sealed with parafilm and placed in an incubator at 24°C in the dark for 3 days.
  • the leaf strips are then carefully transfe ⁇ ed to a plate containing selection medium suitable for the selectable marker present in the plasmid (i.e., 5 ppb chlorsulfuron in the case of pMM7400).
  • selection medium suitable for the selectable marker present in the plasmid i.e., 5 ppb chlorsulfuron in the case of pMM7400.
  • Generally 15 strips of leaf tissue are placed onto one plate of selection medium. Plates are wrapped with parafilm and placed in an incubator with dim light at 28°C for 3 weeks.
  • Leaf strips are then transfe ⁇ ed to fresh selection medium, sealed with parafilm and returned to the incubator with dim light at 28°C for another 3 weeks.
  • Callus is then dissected from the leaf tissue and placed onto callus medium + selection, sealed with parafilm and place at 28°C in dim light. If any buds or small shoots are evident, they are dissected from the leaf tissue and surrounding callus, placed onto normalization medium (no more than 4 buds or shoots per plate), the plate is sealed with micropore tape and placed at 28°C in dim light.
  • normalization medium no more than 4 buds or shoots per plate
  • tissue is inspected for non vitrified shoots, which contain a distinct meristem in the center of the shoot. These shoots should have 2-3 normal leaves and should appear like a small strawberry plant. No more than 6 such shoots are transfe ⁇ ed to shoot medium after trimming off the roots and any drooping or otherwise unhealthy looking leaves which may be present.
  • the plates are wrapped with micropore tape and placed at 28°C in dim light. If no normal looking shoots are observed, the tissue is transfe ⁇ ed to fresh normalization medium, wrapped with micropore tape and placed in the incubator as described.
  • the shoots begin to grow and enlarge in the shoot medium, they are periodically inspected and transfe ⁇ ed to Box Medium taking care not to damage any part of the plants, ensuring the roots are placed into the agar and the meristems are kept above the agar surface. Only 1 shoot is transfe ⁇ ed per box and the boxes are placed at 28°C in a lighted culture room. As the plants continue to grow, they are moved into soil in the greenhouse when it is judged they are large enough for transfer (approximately four inches in height).
  • Cocultivation medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, pH 5.6 2.2 mg/1 TDZ, 0.1 mg/1 IAA, 100 mM acetosyrigone.
  • Selection medium with either 10 mg/1 geneticin or 5 ppb chlorosulfuron comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, 100 mg/1 cefotaxime, pH 5.6 2.2 mg/1 TDZ, 0.1 mg/1 IAA.
  • Callus medium with either 10 mg/1 geneticin or 5 ppb chlorosulfuron comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, 100 mg/1 cefotaxime, pH 5.6.
  • Normalization medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 4 g/1 gelrite, 100 mg/1 cefotaxime, pH 5.6.
  • Shoot medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 4 g/1 gelrite, pH 5.6.
  • Box medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, pH 5.6.
  • Nonselection medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, 100 mg/1 cefotaxime, pH 5.6 2.2 mg/1 TDZ, 0.1 mg/1 IAA.
  • Callus medium comprises MS salts, B 5 vitamins, 30 g/1 sucrose, 2.5 g/1 gelrite, 100 mg/1 cefotaxime, pH 5.6. The resultant plants display early flowering characteristics.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physiology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne de nouveaux acides nucléiques, vecteurs, cellules transformées et plantes transgéniques impliqués dans le contrôle des gènes de stimulation de la floraison et de gènes d'inhibition de la floraison et du processus de floraison.
PCT/US2000/014297 1999-05-25 2000-05-24 Nouveaux agents de controle de la floraison, plantes transgeniques et leurs utilisations WO2000071722A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU52866/00A AU5286600A (en) 1999-05-25 2000-05-24 Novel genes to control flowering, transgenic plants, and uses thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US31878999A 1999-05-25 1999-05-25
US09/318,789 1999-05-25

Publications (2)

Publication Number Publication Date
WO2000071722A1 true WO2000071722A1 (fr) 2000-11-30
WO2000071722A9 WO2000071722A9 (fr) 2002-04-18

Family

ID=23239586

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/014297 WO2000071722A1 (fr) 1999-05-25 2000-05-24 Nouveaux agents de controle de la floraison, plantes transgeniques et leurs utilisations

Country Status (2)

Country Link
AU (1) AU5286600A (fr)
WO (1) WO2000071722A1 (fr)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002042475A1 (fr) * 2000-11-24 2002-05-30 National Institute Of Agrobiological Sciences Gene hd3a induisant la floraison d'une plante et utilisation associee
FR2841248A1 (fr) * 2002-06-20 2003-12-26 Nat Agricultural Res Org Proteine, acide nucleique, vecteur, transformant, graine et procede de floraison precoce
EP1439233A1 (fr) * 2003-01-16 2004-07-21 Genoplante-Valor Polypeptides impliqués dans le développement floral et gènes les codant
WO2004070036A1 (fr) * 2003-02-04 2004-08-19 Wakunaga Pharmaceutical Co., Ltd. Proteine et gene participant a la floraison perpetuelle d'un angiosperme
WO2018064503A1 (fr) * 2016-09-30 2018-04-05 J.R. Simplot Company Culture de fraisiers en mottes à faible altitude sans nécessiter de conditionnement

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997010339A1 (fr) * 1995-09-13 1997-03-20 John Innes Centre Innovations Limited Genes de floraison

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997010339A1 (fr) * 1995-09-13 1997-03-20 John Innes Centre Innovations Limited Genes de floraison

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BRADLEY ET AL.: "Control of influorescence architecture in antirrhinum", NATURE, vol. 379, 29 February 1996 (1996-02-29), pages 791 - 796, XP002931912 *
DATABASE GENBANK ON EMBL GEMBL/GENBANK; YAO ET AL.: "Seven apple MADS-box genes are expressed in different parts of fruit", XP002931911 *
DATABASE GENBANK ON EMBL PNUELI ET AL.: "The SELF-PRUNING gene of tomato regulates vegetative to reproductive switching of sympodial meristems and is the ortholog of CEN and TFL1", XP002931910 *
DEVELOPMENT, vol. 125, 1998, pages 1979 - 1989 *

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002042475A1 (fr) * 2000-11-24 2002-05-30 National Institute Of Agrobiological Sciences Gene hd3a induisant la floraison d'une plante et utilisation associee
US7196246B2 (en) 2000-11-24 2007-03-27 National Agriculture And Bio-Oriented Research Organization HD3a Gene inducing flowering of plant and utilization thereof
FR2841248A1 (fr) * 2002-06-20 2003-12-26 Nat Agricultural Res Org Proteine, acide nucleique, vecteur, transformant, graine et procede de floraison precoce
US7208653B2 (en) 2002-06-20 2007-04-24 National Agricultural Research Organization Flower-bud formation suppressor gene and early flowering plant
US7888555B2 (en) 2002-06-20 2011-02-15 National Agricultural Research Organization Flower-bud formation suppressor gene and early flowering plant
EP1439233A1 (fr) * 2003-01-16 2004-07-21 Genoplante-Valor Polypeptides impliqués dans le développement floral et gènes les codant
WO2004063378A2 (fr) * 2003-01-16 2004-07-29 Genoplante-Valor Polypeptides impliques dans l'initiation florale et genes codant pour ces polypeptides
WO2004063378A3 (fr) * 2003-01-16 2005-01-13 Genoplante Valor Polypeptides impliques dans l'initiation florale et genes codant pour ces polypeptides
WO2004070036A1 (fr) * 2003-02-04 2004-08-19 Wakunaga Pharmaceutical Co., Ltd. Proteine et gene participant a la floraison perpetuelle d'un angiosperme
WO2018064503A1 (fr) * 2016-09-30 2018-04-05 J.R. Simplot Company Culture de fraisiers en mottes à faible altitude sans nécessiter de conditionnement
JP2019532643A (ja) * 2016-09-30 2019-11-14 ジェイ．アール．シンプロット カンパニー コンディショニングの必要なしでの低地でのイチゴプラグ苗の生育

Also Published As

Publication number Publication date
AU5286600A (en) 2000-12-12
WO2000071722A9 (fr) 2002-04-18

Similar Documents

Publication Publication Date Title
US6235975B1 (en) Leafy cotyledon1 genes and methods of modulating embryo development in transgenic plants
EP1003868B1 (fr) BLé RHAT GENE POUR REGULATION GENETIQUE DE LA CROISSANCE ET DU DEVELOPPEMENT VEGETAUX
US6320102B1 (en) Leafy cotyledon1 genes and their uses
US6781035B1 (en) Leafy cotyledon1 genes and their uses
WO1998037184A9 (fr) Genes de type 'cotyledon1 feuillu' et leurs utilisations
US6492577B1 (en) Leafy cotyledon2 genes and their uses
AU2001245729A1 (en) Leafy cotyledon2 genes and their uses
US6545201B1 (en) Leafy cotyledon1 genes and their uses
US7052871B2 (en) Methods of improving transformation efficiency of plants with auxin responsive promoter sequences
AU2001241600B2 (en) Leafy cotyledon1 genes and their uses
EP1002086A1 (fr) Matieres et procedes relatifs a une proteine regulatrice vegetale
WO2000071722A1 (fr) Nouveaux agents de controle de la floraison, plantes transgeniques et leurs utilisations
US7138566B2 (en) Methods of modulating cytokinin related processes in a plant using B3 domain proteins
US7560612B2 (en) Early-inflorescence-preferred regulatory elements and uses thereof
US7071379B2 (en) Methods for altering organ mass in plants
WO2017009253A1 (fr) Procédés et moyens pour augmenter la tolérance au stress et la biomasse dans des plantes
US20020199219A1 (en) Modulation of abscisic acid signal transduction in plants
US7199285B2 (en) Modulation of abscisic acid signal transduction in plants
US6376751B1 (en) Nucleic acids encoding EMF1 that control reproductive development in plants
US20020059657A1 (en) Homeobox binding sites and their uses
US7164006B1 (en) Alteration of plant meristem function by manipulation of the Retinoblastoma-like plant RRB gene
US20020157137A1 (en) Nucleic acids that control reproductive development in plants
WO2016050509A1 (fr) Procédés et moyens pour accroître la tolérance au stress et la biomasse chez les plantes
MXPA02004307A (es) Promotor de semilla seleccionada de cebada.

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

AK Designated states

Kind code of ref document: C2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: C2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1-47, DESCRIPTION, REPLACED BY NEW PAGES 1-47; PAGE 1/1, DRAWINGS, REPLACED BY A NEW PAGE 1/1; DUE TO LATE TRANSMITTAL BY THE RECEIVING OFFICE

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP