WO2000069873A1 - Polypeptides trmd - Google Patents
Polypeptides trmd Download PDFInfo
- Publication number
- WO2000069873A1 WO2000069873A1 PCT/US2000/013214 US0013214W WO0069873A1 WO 2000069873 A1 WO2000069873 A1 WO 2000069873A1 US 0013214 W US0013214 W US 0013214W WO 0069873 A1 WO0069873 A1 WO 0069873A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- polypeptide
- seq
- polynucleotide
- amino acid
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1003—Transferases (2.) transferring one-carbon groups (2.1)
- C12N9/1007—Methyltransferases (general) (2.1.1.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Definitions
- This invention relates to newly identified polynucleotides and polypeptides, and their production and uses, as well as their variants, agonists and antagonists, and their uses.
- the invention relates to polynucleotides and polypeptides of the tRNAmethyltransferases family, as well as their variants, herein referred to as "trmD,” “trmD polynucleotide(s),” and “trmD polypeptide(s)” as the case may be.
- Staphylococcal genes and gene products are particularly preferred to employ Staphylococcal genes and gene products as targets for the development of antibiotics.
- the Staphylococci make up a medically important genera of microbes. They are known to produce two types of disease, invasive and toxigenic. Invasive infections are characterized generally by abscess fonnation effecting both skin surfaces and deep tissues. S. aureus is the second leading cause of bacteremia in cancer patients. Osteomyelitis, septic arthritis, septic tlirombophlebitis and acute bacterial endocarditis are also relatively common. There are at least tliree clinical conditions resulting from the toxigenic properties of Staphylococci. The manifestation of these diseases result from the actions of exotoxins as opposed to tissue invasion and bacteremia. These conditions include: Staphylococcal food poisoning, scalded skin syndrome and toxic shock syndrome.
- polynucleotides and polypeptides such as the trmD embodiments of the invention, that have a present benefit of, among other things, being useful to screen compounds for antimicrobial activity.
- Such factors are also useful to determine their role in pathogenesis of infection, dysfunction and disease.
- identification and characterization of such factors and their antagonists and agonists to find ways to prevent, ameliorate or correct such infection, dysfunction and 'disease.
- the present invention relates to trmD, in particular trmD polypeptides and trmD polynucleotides, recombinant materials and methods for their production.
- the invention relates to methods for using such polypeptides and polynucleotides, including treatment of microbial diseases, amongst others.
- the invention relates to methods for identifying agonists and antagonists using the materials provided by the invention, and for treating microbial infections and conditions associated with such infections with tl e identified agonist or antagonist compounds.
- tl e invention relates to diagnostic assays for detecting diseases associated with microbial infections and conditions associated with such infections, such as assays for detecting trmD expression or activity.
- the invention relates to trmD polypeptides and polynucleotides as described in greater detail below.
- the invention relates to polypeptides and polynucleotides of a trmD of Staphylococcus aureus, that is related by amino acid sequence homology to B. subtilis trmD polypeptide.
- the invention relates especially to trmD having a nucleotide and amino acid sequences set out in Table 1 as SEQ ID NO:l and SEQ ID NO:2 respectively.
- sequences recited in the Sequence Listing below as "DNA” represent an exemplification of the invention, since those of ordinary skill will recognize that such sequences can be usefully employed in polynucleotides in general, including ribopolynucleotides.
- ATGAAAATTGATTATTTAACTTTATTTCCTG7 ⁇ ATGTTTGATGGTGTTTTAAATCATTCAATTATGAAACGTGCC CAAGA
- NCIMB National Collections of Industrial and Marine Bacteria Ltd.
- Staphylococcus aureus WCUH29 on deposit.
- the Staphylococcus aureus strain deposit is referred to herein as "the deposited strain” or as "the DNA of the deposited strain.”
- the deposited strain comprises a full length trmD gene.
- the sequence of the polynucleotides comprised in the deposited strain, as well as the amino acid sequence of any polypeptide encoded thereby, are controlling in the event of any conflict with any description of sequences herein.
- an isolated nucleic acid molecule encoding a mature polypeptide expressible by the Staphylococcus aureus WCUH 29 strain, which polypeptide is comprised in the deposited strain.
- trmD polynucleotide sequences in tl e deposited strain such as DNA and RNN and amino acid sequences encoded thereby.
- trmD polypeptide and polynucleotide sequences isolated from the deposited strain are also provided by the invention.
- TrmD polypeptide of the invention is substantially phylogenetically related to other proteins of tl e tR ⁇ Amethyltransferases family.
- polypeptides of Staphylococcus aureus referred to herein as "trmD” and “trmD polypeptides” as well as biologically, diagnostically, prophylactically, clinically or therapeutically useful variants thereof, and compositions comprising the same.
- trmD polypeptide encoded by naturally occurring alleles of a trmD gene.
- the present invention further provides for an isolated polypeptide that: (a) comprises or consists of an amino acid sequence that has at least 95% identity, most preferably at least 97-99% or exact identity, to that of SEQ ID ⁇ O:2 over the entire length of SEQ ID NO:2; (b) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence that has at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO:l over the entire length of SEQ ID NO:l, or the entire length of that portion of SEQ ID NO:l which encodes SEQ ID NO:2; (c) a polypeptide encoded by an isolated polynucleotide comprising or consisting of a polynucleotide sequence encoding a polypeptide that has at least 95% identity, even more preferably at least 97-99% or exact identity, to the amino acid sequence of SEQ ID NO:2, over the entire length of SEQ
- polypeptides of the invention include a polypeptide of Table 1 [SEQ ID NO:2] (in particular a mature polypeptide) as well as polypeptides and fragments, particularly those that has a biological activity of trmD, and also those that have at least 95% identity to a polypeptide of Table 1 [SEQ ID NO:2] and also include portions of such polypeptides with such portion of the polypeptide generally comprising at least 30 amino acids and more preferably at least 50 amino acids.
- the invention also includes a polypeptide consisting of or comprising a polypeptide of the formula:
- X is hydrogen, a metal or any other moiety described herein for modified polypeptides, and at the carboxyl terminus
- Y is hydrogen, a metal or any other moiety described herein for modified polypeptides
- Ri and R3 are any amino acid residue or modified amino acid residue
- m is an integer between 1 and 1000 or zero
- n is an integer between 1 and 1000 or zero
- R 2 is an amino acid sequence of the invention, particularly an amino acid sequence selected from Table 1 or modified forms thereof.
- R 2 is oriented so that its amino terminal amino acid residue is at the left, covalently bound to R [ and its carboxy terminal amino acid residue is at the right, covalently bound to R3.
- Any stretch of amino acid residues denoted by either Ri or R3, where m and/or n is greater than 1, may be either a heteropoiymer or a homopolymer, preferably a heteropoiymer.
- Other preferred embodiments of the invention are provided where m is an integer between 1 and 50, 100 or 500, and n is an integer between 1 and 50, 100, or 500.
- a polypeptide of tl e invention is derived from Staphylococcus aureus, however, it may preferably be obtained from other organisms of the same taxonomic genus.
- a polypeptide of the invention may also be obtained, for example, from organisms of the same taxonomic family or order.
- a fragment is a variant polypeptide having an amino acid sequence that is entirely the same as part but not all of any amino acid sequence of any polypeptide of the invention.
- fragments may be "free-standing,” or comprised within a larger polypeptide of which they form a part or region, most preferably as a single continuous region in a single larger polypeptide.
- Preferred fragments include, for example, truncation polypeptides having a portion of an amino acid sequence of Table 1 [SEQ ID NO:2], or of variants thereof, such as a continuous series of residues that includes an amino- and/or carboxyl-terminal amino acid sequence.
- Degradation forms of the polypeptides of the invention produced by or in a host cell, particularly a Staphylococcus aureus, are also preferred.
- fragments characterized by structural or functional attributes such as fragments that comprise alpha-helix and alpha-helix forming regions, beta-sheet and bela-sheet-forrning regions, turn and m-fo ⁇ ning regions, coil and coil-forming regions, hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-foiming regions, substrate binding region, and high antigenic index regions.
- fragments include an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids from the amino acid sequence of SEQ ID NO:2, or an isolated polypeptide comprising an amino acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous amino acids truncated or deleted from the amino acid sequence of SEQ ID NO:2.
- Fragments of the polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.
- the polynucleotide comprises a region encoding trmD polypeptides comprising a sequence set out in Table 1 [SEQ ID NO:l] that includes a full length gene, or a variant thereof.
- SEQ ID NO:l a sequence set out in Table 1 [SEQ ID NO:l] that includes a full length gene, or a variant thereof. The Applicants believe that this full length gene is essential to the growth and/or survival of an organism that possesses it, such as Staphylococcus aureus.
- isolated nucleic acid molecules encoding and/or expressing trmD polypeptides and polynucleotides, particularly Staphylococcus aureus trmD polypeptides and polynucleotides, including, for example, unprocessed RNAs. ribozyme RNAs, mRNAs, cDNAs, genomic DNAs, B- and Z-DNAs.
- Further embodiments of the invention include biologically, diagnostically, prophylactically, clinically or therapeutically useful polynucleotides and polypeptides, and variants thereof, and compositions comprising the same.
- Another aspect of the invention relates to isolated polynucleotides, including at least one full length gene, that encodes a trmD polypeptide having a deduced amino acid sequence of Table 1 [SEQ ID NO:2] and polynucleotides closely related thereto and variants thereof.
- trmD polypeptide from Staphylococcus aureus comprising or consisting of an amino acid sequence of Table 1 [SEQ ID NO:2], or a variant thereof.
- SEQ ID NO:2 amino acid sequence of Table 1 [SEQ ID NO:2]
- a polynucleotide of the invention encoding trmD polypeptide may be obtained using standard cloning and screening methods, such as those for cloning and sequencing chromosomal DNA fragments from bacteria using Staphylococcus aureus WCUH 29 cells as starling material, followed by obtaining a full length clone.
- standard cloning and screening methods such as those for cloning and sequencing chromosomal DNA fragments from bacteria using Staphylococcus aureus WCUH 29 cells as starling material, followed by obtaining a full length clone.
- a polynucleotide sequence of the invention such as a polynucleotide sequence given in Table 1 [SEQ ID NO: 1]
- coli or some other suitable host is probed with a radiolabeled oligonucleotide, preferably a 17-mer or longer, derived from a partial sequence.
- Clones carrying DNA identical to that of the probe can then be distinguished using stringent hybridization conditions.
- sequencing primers designed from the priginal polypeptide or polynucleotide sequence it is then possible to extend the polynucleotide sequence in both directions to determine a full length gene sequence.
- sequencing is performed, for example, using denatured double stranded DNA prepared from a plasmid clone. Suitable techniques are described by Maniatis, T., Fritsch, E.F.
- each DNA sequence set out in Table 1 [SEQ ID NO:l] contains an open reading frame encoding a protein having about the number of amino acid residues set forth in Table 1 [SEQ ID NO:2] with a deduced molecular weight that can be calculated using amino acid residue molecular weight values well known to those skilled in the art.
- the present invention provides for an isolated polynucleotide comprising or consisting of: (a) a polynucleotide sequence that has at least 95% identity, even more preferably at least 97-99% or exact identity to SEQ ID NO:l over the entire length of SEQ ID NO:l, or the entire length of that portion of SEQ ID NO:l which encodes SEQ ID NO:2; (b) a polynucleotide sequence encoding a polypeptide that has at least 95 % identity, even more preferably at least 97-99% or 100% exact, to the amino acid sequence of SEQ ID NO:2, over the entire length of SEQ ID NO:2.
- a polynucleotide encoding a polypeptide of the present invention may be obtained by a process that comprises the steps of screening an appropriate library under stringent hybridization conditions with a labeled or detectable probe consisting of or comprising the sequence of SEQ ID NO: 1 or a fragment thereof; and isolating a full-length gene and/or genomic clones comprising said polynucleotide sequence.
- the invention provides a polynucleotide sequence identical over its entire length to a coding sequence (open reading frame) in Table 1 [SEQ ID NO: 1]. Also provided by the invention is a coding sequence for a mature polypeptide or a fragment thereof, by itself as well as a coding sequence for a mature polypeptide or a fragment in reading frame with another coding sequence, such as a sequence encoding a leader or secretory sequence, a pre-, or pro- or prepro-protein sequence.
- the polynucleotide of the invention may also comprise at least one non-coding sequence, including for example, but not limited to at least one non-coding 5' and 3' sequence, such as the transcribed but non-translated sequences, termination signals (such as rho-dependent and rho-independent termination signals), ribosome binding sites, Kozak sequences, sequences that stabilize mRNN introns, and polyadenylation signals.
- the polynucleotide sequence may also comprise additional coding sequence encoding additional amino acids. For example, a marker sequence that facilitates purification of a fused polypeptide can be encoded.
- the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz et al, Proc. Natl. Acad. Set, USA 86: 821-824 (1989), or an HA peptide tag (Wilson et al, Cell 37: 767 (1984), both of that may be useful in purifying polypeptide sequence fused to them.
- Polynucleotides of the invention also include, but are not limited to, polynucleotides comprising a structural gene and its naturally associated sequences that control gene expression.
- a preferred embodiment of the invention is a polynucleotide of consisting of or comprising nucleotide 1 to the nucleotide immediately upstream of or including nucleotide 736 set forth in SEQ ID NO: 1 of Table 1, both of that encode a trmD polypeptide.
- the invention also includes a polynucleotide consisting of or comprising a polynucleotide of the formula:
- R ⁇ and R3 are independently any nucleic acid residue or modified nucleic acid residue
- m is an integer between 1 and 3000 or zero
- n is an integer between 1 and 3000 or zero
- R 2 is a nucleic acid sequence or modified nucleic acid sequence of the invention, particularly a nucleic acid sequence selected from Table 1 or a modified nucleic acid sequence thereof.
- R 2 is oriented so that its 5' end nucleic acid residue is at the left, bound to Ri and its 3' end nucleic acid residue is at the right, bound to R3.
- Any stretch of nucleic acid residues denoted by either Ri and/or R 2 , where m and/or n is greater than 1, may be either a heteropoiymer or a homopoiymer, preferably a heteropoiymer.
- the polynucleotide of the above formula is a closed, circular polynucleotide, that can be a double-stranded polynucleotide wherein the formula shows a first strand to which the second strand is complementary.
- m and/or n is an integer between 1 and 1000.
- Other preferred embodiments of the invention are provided where m is an integer between 1 and 50, 100 or 500, and n is an integer between 1 and 50, 100, or 500.
- a polynucleotide of the invention is derived from Staphylococcus aureus, however, it may preferably be obtained from other organisms of the same taxonomic genus.
- a polynucleotide of the invention may also be obtained, for example, from organisms of the same taxonomic family or order.
- polynucleotide encoding a polypeptide encompasses polynucleotides that include a sequence encoding a polypeptide of the invention, particularly a bacterial polypeptide and more particularly a polypeptide of the Staphylococcus aureus trmD having an amino acid sequence set out in Table 1 [SEQ ID NO:2].
- polynucleotides that include a single continuous region or discontinuous regions encoding the polypeptide (for example, polynucleotides interrupted by integrated phage, an integrated insertion sequence, an integrated vector sequence, an integrated transposon sequence, or due to RNA editing or genomic DNA reorganization) together with additional regions, that also may comprise coding and/or non-coding sequences.
- the invention further relates to variants of the polynucleotides described herein that encode variants of a polypeptide having a deduced amino acid sequence of Table 1 [SEQ ID NO:2]. Fragments of polynucleotides of the invention may be used, for example, to synthesize full-length polynucleotides of the invention.
- polynucleotides encoding trmD variants that have the amino acid sequence of trmD polypeptide of Table 1 [SEQ ID NO:2] in which several, a few, 5 to 10, 1 to 5,
- Preferred isolated polynucleotide embodiments also include polynucleotide fragments, such as a polynucleotide comprising a nuclic acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids from the polynucleotide sequence of SEQ ID NO: l, or an polynucleotide comprising a nucleic acid sequence having at least 15, 20, 30, 40, 50 or 100 contiguous nucleic acids truncated or deleted from the 5' and/or 3' end of the polynucleotide sequence of SEQ ID
- polynucleotides that are at least 95% or 97% identical over their entire length to a polynucleotide encoding trmD polypeptide having an amino acid sequence set out in Table 1 [SEQ ID NO:2], and polynucleotides that are complementary to such polynucleotides.
- polynucleotides that comprise a region that is at least 95% are especially preferred.
- those with at least 97% are highly preferred among those with at least
- Preferred embodiments are polynucleotides encoding polypeptides that retain substantially the same biological function or activity as a mature polypeptide encoded by a DNA of Table 1 [SEQ ID NO: 1].
- polynucleotides that hybridize, particularly under stringent conditions, to trmD polynucleotide sequences, such as those polynucleotides in Table 1.
- the invention further relates to polynucleotides that hybridize to the polynucleotide sequences provided herein.
- the invention especially relates to polynucleotides that hybridize under stringent conditions to the polynucleotides described herein.
- stringent conditions and “stringent hybridization conditions” mean hybridization occurring only if there is at least 95% and preferably at least 97% identity between the sequences.
- a specific example of stringent hybridization conditions is overnight incubation at 42°C in a solution comprising: 50% formamide, 5x SSC (150mM
- Solution hybridization may also be used with the polynucleotide sequences provided by the invention.
- the invention also provides a polynucleotide consisting of or comprising a polynucleotide sequence obtained by screening an appropriate library comprising a complete gene for a polynucleotide sequence set forth in SEQ ID NO: l under stringent hybridization conditions with a probe having the sequence of said polynucleotide sequence set forth in SEQ ID NO:l or a fragment thereof; and isolating said polynucleotide sequence.
- Fragments useful for obtaining such a polynucleotide include, for example, probes and primers fully described elsewhere herein.
- tlie polynucleotides of the invention may be used as a hybridization probe for RNA, cDNA and genomic DNA to isolate full-length cDNAs and genomic clones encoding trmD and to isolate cDNA and genomic clones of other genes that have a high identity, particularly high sequence identity, to a trmD gene.
- Such probes generally will comprise at least 15 nucleotide residues or base pairs.
- such probes will have at least 30 nucleotide residues or base pairs and may have at least 50 nucleotide residues or base pairs.
- Particularly preferred probes will have at least 20 nucleotide residues or base pairs and will have lee than 30 nucleotide residues or base pairs.
- PCR Nucleic acid amplification
- PCR Nucleic acid amplification
- the PCR reaction is then repeated using "nested" primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the selected gene sequence)
- primers designed to anneal within the amplified product typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the selected gene sequence
- the products of this reaction can then be analyzed by DNA sequencing and a full-length DNA constructed either by joining the product directly to the existing DNA to give a complete sequence, or carrying out a separate full- length PCR usmg the new sequence information for the design of the 5' primer
- polynucleotides and polypeptides of the mvention may be employed, for example, as research reagents and materials for discovery of treatments of and diagnostics for diseases, particularly human diseases, as further discussed herem relatmg to polynucleotide assays
- polynucleotides of the invention that are ohgonucleotides derived from a sequence of Table 1 [SEQ ID NOS 1 or 2] may be used in the processes herein as described, but preferably for PCR, to determine whether or not the polynucleotides identified here in whole or in part are transc ⁇ bed in bacteria in infected tissue It is recognized that such sequences will also have utility in diagnosis of the stage of mfection and type of infection the pathogen has attained
- a precursor protein, having a mature form of the polypeptide fused to one or more prosequences may be an inactive form of the polypeptide When prosequences are removed such mactive precursors generally are activated Some or all of the prosequences may be removed before activation Generally, such precursors are called proproteins
- a polynucleotide of the invention may encode a mature protein, a mature protein plus a leader sequence (which may be referred to as a preprotein), a precursor of a mature protein having one or more prosequences that are not the leader sequences of a preprotein, or a preproprotein, that is a precursor to a proprotein, having a leader sequence and one or more prosequences, that generally are removed during processing steps that produce active and mature forms of the polypeptide.
- a leader sequence which may be referred to as a preprotein
- a precursor of a mature protein having one or more prosequences that are not the leader sequences of a preprotein or a preproprotein, that is a precursor to a proprotein, having a leader sequence and one or more prosequences, that generally are removed during processing steps that produce active and mature forms of the polypeptide.
- the invention also relates to vectors that comprise a polynucleotide or polynucleotides of the invention, host cells that are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
- Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the invention.
- Recombinant polypeptides of the present invention may be prepared by processes well known in those skilled in the art from genetically engineered host cells comprising expression systems.
- the present invention relates to expression systems that comprise a polynucleotide or polynucleotides of the present invention, to host cells that are genetically engineered with such expression systems, and to the production of polypeptides of the invention by recombinant techniques.
- host cells can be genetically engineered to incorporate expression systems or portions thereof or polynucleotides of the invention.
- Introduction of a polynucleotide into the host cell can be effected by methods described in many standard laboratory manuals, such as Davis, et al, BASIC METHODS IN MOLECULAR BIOLOGY, (1986) and Sambrook, et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1 89), such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection.
- bacterial cells such as cells of streptococci, staphylococci, enterococci E. coli, streptomyces, cyanobacteria, Bacillus subtilis, and Staphylococcus aureus
- fungal cells such as cells of a yeast, Kluveromyces, Saccharomyces, a basidiomycete, Candida albicans and Aspergillus
- insect cells such as cells of Drosophila S2 and Spodoptera Sf9
- animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293, CV-1 and Bowes melanoma cells
- plant cells such as cells of a gymnosperm or angiospe ⁇ n.
- vectors include, among others, chromosomal-, episomal- and virus-derived vectors, for example, vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses, picornaviruses and retioviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
- the expression system constructs may comprise control regions that regulate as well as engender expression.
- any system or vector suitable to maintain, propagate or express polynucleotides and/or to express a polypeptide in a host may be used for expression in this regard.
- the appropriate DNA sequence may be inserted into the expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook et al, MOLECULAR CLONING, A LABORATORY MANUAL, (supra).
- secretion signals may be incorporated into the expressed polypeptide. These signals may be endogenous to the polypeptide or they may be heterologous signals.
- Polypeptides of the invention can be recovered and purified from recombinant cell cultures by well- known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding protein may be employed to regenerate active conformation when the polypeptide is denatured during isolation and or purification.
- This invention is also related to the use of trmD polynucleotides and polypeptides of the invention for use as diagnostic reagents. Detection of trmD polynucleotides and/or polypeptides in a eukaryote, particularly a mammal, and especially a human, will provide a diagnostic method for diagnosis of disease, staging of disease or response of an infectious organism to drugs.
- Eukaryotes particularly mammals, and especially humans, particularly those infected or suspected to be infected with an organism comprising the trmD gene or i protein, may be detected at the nucleic acid or amino acid level by a variety of well known techniques as well as by methods provided herein.
- Polypeptides and polynucleotides for prognosis, diagnosis or other analysis may be obtained from a putatively infected and/or infected individual's bodily materials.
- Polynucleotides from any of these sources, particularly DNA or RNN may be used directly for detection or may be amplified enzymatically by using PCR or any other amplification technique prior to analysis.
- RNN particularly mR ⁇ N cD ⁇ A and genomic D ⁇ A may also be used in the same ways.
- characterization of the species and strain of infectious or resident organism present in an individual may be made by an analysis of the genotype of a selected polynucleotide of the organism.
- Deletions and insertions can be detected by a change in size of the amplified product in comparison to a genotype of a reference sequence selected from a related organism, preferably a different species of the same genus or a different strain of the same species.
- Point mutations can be identified by hybridizing amplified D ⁇ A to labeled trmD polynucleotide sequences. Perfectly or significantly matched sequences can be distinguished from imperfectly or more significantly mismatched duplexes by D ⁇ ase or R ⁇ ase digestion, for D ⁇ A or R ⁇ A respectively, or by detecting differences in melting temperatures or renaturation kinetics.
- Polynucleotide sequence differences may also be detected by alterations in the electrophoretic mobility of polynucleotide fragments in gels as compared to a reference sequence. This may be carried out with or without denaturing agents. Polynucleotide differences may also be detected by direct D ⁇ A or R ⁇ A sequencing. See, for example, Myers et al, Science, 230: 1242 (1985). Sequence changes at specific locations also may be revealed by nuclease protection assays, such as R ⁇ ase, VI and SI protection assay or a chemical cleavage method. See, for example, Cotton et al, Proc. Natl. Acad. Sci., USA, 85: 4397-4401 (1985).
- an array of oligonucleotides probes comprising trmD nucleotide sequence or fragments thereof can be constructed to conduct efficient screening of, for example, genetic mutations, serotype, taxonomic classification or identification.
- Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability (see, for example, Chee et al, Science, 274: 610 (1996)).
- the present invention relates to a diagnostic kit that comprises: (a) a polynucleotide of the present invention, preferably the nucleotide sequence of SEQ ID ⁇ O:l, or a fragment thereof ; (b) a nucleotide sequence complementary to that of (a); (c) a polypeptide of the present invention, preferably the polypeptide of SEQ ID NO: 2 or a fragment thereof; or (d) an antibody to a polypeptide of the present invention, preferably to the polypeptide of SEQ ID NO:2. It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise a substantial component. Such a kit will be of use in diagnosing a disease or susceptibility to a Disease, among others.
- This invention also relates to the use of polynucleotides of the present invention as diagnostic reagents.
- Detection of a mutated form of a polynucleotide of the invention, preferable, SEQ ID NO:l, (that is associated with a disease or pathogenicity will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, a prognosis of a course of disease, a detemiination of a stage of disease, or a susceptibility to a disease, that results from under-expression, over-expression or altered expression of the polynucleotide.
- Organisms, particularly infectious organisms, carrying mutations in such polynucleotide may be detected at the polynucleotide level by a variety of techniques, such as those described elsewhere herein.
- the differences in a polynucleotide and/or polypeptide sequence between organisms possessing a first phenotype and organisms possessing a different, second different phenotype can also be determined. If a mutation is observed in some or all organisms possessing the first phenotype but not in any organisms possessing the second phenotype, then the mutation is likely to be the causative agent of the first phenotype.
- Cells from an organism carrying mutations or polymorphisms (allelic variations) in a polynucleotide and/or polypeptide of the invention may also be detected at the polynucleotide or polypeptide level by a variety of techniques, to allow for serotyping, for example.
- RT-PCR can be used to detect mutations in the RNA. It is particularly preferred to use RT-PCR in conjunction with automated detection systems, such as, for example, GeneScan.
- RNA, cDNA or genomic DNA may also be used for the same purpose, PCR.
- PCR primers complementary to a polynucleotide encoding trmD polypeptide can be used to identify and analyze mutations.
- the invention further provides these primers with 1, 2, 3 or 4 nucleotides removed from the 5' and/or the 3' end.
- These primers may be used for, among other things, amplifying trmD DNA and/or RNA isolated from a sample derived from an individual, such as a bodily material.
- the primers may be used to amplify a polynucleotide isolated from an infected individual, such that the polynucleotide may then be subject to various techniques for elucidation of the polynucleotide sequence. In this way, mutations in the polynucleotide sequence may be detected and used to diagnose and/or prognose the infection or its stage or course, or to serotype and/or classify the infectious agent.
- the invention further provides a process for diagnosing, disease, preferably bacterial infections, more preferably infections caused by Staphylococcus aureus, comprising determining from a sample derived from an individual, such as a bodily material, an increased level of expression of polynucleotide having a sequence of Table 1 [SEQ ID NO:l].
- Increased or decreased expression of a t ⁇ nD polynucleotide can be measured using any on of the methods well known in the art for the quantitation of polynucleotides, such as, for example, amplification, PCR, RT-PCR, RNase protection, Northern blotting, spectrometry and other hybridization methods.
- a diagnostic assay in accordance with the invention for detecting over-expression of trmD polypeptide compared to normal control tissue samples may be used to detect the presence of an infection, for example.
- Assay techniques that can be used to determine levels of a trmD polypeptide, in a sample derived from a host, such as a bodily material, are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis, antibody sandwich assays, antibody detection and ELISA assays.
- Polypeptides and polynucleotides of the invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product rnixtures. These substrates and ligands may be natural substrates and ligands or may be structural or functional mimetics. See, e.g., Coligan eto/., Current Protocols in Immunology 1(2): Chapter 5 (1991). Polypeptides and polynucleotides of the present invention are responsible for many biological functions, including many disease states, in particular the Diseases herein mentioned.
- the present invention provides for a method of screening compounds to identify those that agonize or that antagonize the function of a polypeptide or polynucleotide of the invention, as well as related polypeptides and polynucleotides.
- agonists or antagonists e.g., inhibitors
- Compounds may be identified from a variety of sources, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures. Such agonists and antagonists so-identified may be natural or modified substrates, ligands, receptors, enzymes, etc., as the case may be, of trmD polypeptides and polynucleotides; or may be structural or functional mimetics thereof (see Coligan et al, Current Protocols in Immunology l(2):Chapter 5 (1991)).
- the screening methods may simply measure the binding of a candidate compound to the polypeptide or polynucleotide, or to cells or membranes bearing the polypeptide or polynucleotide, or a fusion protein of the polypeptide by means of a label directly or indirectly associated with the candidate compound.
- the screening method may involve competition with a labeled competitor.
- these screening methods may test whether the candidate compound results in a signal generated by activation or inhibition of the polypeptide or polynucleotide, using detection systems appropriate to the cells comprising the polypeptide or polynucleotide.
- Inhibitors of activation are generally assayed in the presence of a known agonist and the effect on activation by the agonist by the presence of the candidate compound is observed.
- Constitutively active polypeptide and/or constitutively expressed polypeptides and polynucleotides may be employed in screening methods for inverse agonists, in the absence of an agonist or antagonist, by testing whether the candidate compound results in inhibition of activation of the polypeptide or polynucleotide, as the case may be.
- the screening methods may simply comprise the steps of mixing a candidate compound with a solution comprising a polypeptide or polynucleotide of the present invention, to form a mixture, measuring trmD polypeptide and/or polynucleotide activity in the mixture, and comparing the trmD polypeptide and/or polynucleotide activity of the mixture to a standard.
- Fusion proteins such as those made from Fc portion and trmD polypeptide, as herein described, can also be used for high-throughput screening assays to identify antagonists of the polypeptide of the present invention, as well as of phylogenetically and and/or functionally related polypeptides (see D. Bennett et al, J Mol Recognition, 8:52-58 (1995); and K. Johanson et al, J Bi Chem, 270(16):9459-9471 (1995)).
- polypeptides and antibodies that bind to and/or interact with a polypeptide of the present invention may also be used to configure screening methods for detecting the effect of added compounds on the production of mRNA and/or polypeptide in cells.
- an ELISA assay may be constructed for measuring secreted or cell associated levels of polypeptide using monoclonal and polyclonal antibodies by standard methods known in the art. This can be used to discover agents that may inhibit or enhance the production of polypeptide (also called antagonist or agonist, respectively) from suitably manipulated cells or tissues.
- the invention also provides a method of screening compounds to identify those that enhance (agonist) or block (antagonist) the action of trmD polypeptides or polynucleotides, particularly those compounds that are bacteristatic and/or bactericidal.
- the method of screening may involve high-throughput techniques. For example, to screen for agonists or antagonists, a synthetic reaction mix, a cellular compartment, such as a membrane, cell envelope or cell wall, or a preparation of any thereof, comprising trmD polypeptide and a labeled substrate or ligand of such polypeptide is incubated in the absence or the presence of a candidate molecule that may be a trmD agonist or antagonist.
- the ability of the candidate molecule to agonize or antagonize the trmD polypeptide is reflected in decreased binding of the labeled ligand or decreased production of product from such substrate.
- Molecules that bind gratuitously, i. e. , without inducing the effects of trmD polypeptide are most likely to be good antagonists.
- Molecules that bind well and, as tlie case may be, increase the rate of product production from substrate, increase signal transduction, or increase chemical channel activity are agonists. Detection of the rate or level of, as the case may be, production of product from substrate, signal transduction, or chemical channel activity may be enhanced by using a reporter system.
- Reporter systems that may be useful in this regard include but are not limited to colorimetric, labeled substrate converted into product, a reporter gene that is responsive to changes in trmD polynucleotide or polypeptide activity, and binding assays known in the art.
- Polypeptides of the invention may be used to identify membrane bound or soluble receptors, if any, for such polypeptide, through standard receptor binding techniques known in the art. These techniques include, but are not limited to, ligand binding and crosslinking assays in which the polypeptide is labeled with a radioactive isotope (for instance, ⁇ I), chemically modified (for instance, biotinylated), or fused to a peptide sequence suitable for detection or purification, and incubated with a source of the putative receptor (e.g., cells, cell membranes, cell supernatants, tissue extracts, bodily materials). Other methods include biophysical techniques such as surface plasmon resonance and spectroscopy. These screening methods may also be used to identify agonists and antagonists of the polypeptide that compete with the binding of the polypeptide to its receptor(s), if any. Standard methods for conducting such assays are well understood in the art.
- a radioactive isotope for instance, ⁇ I
- chemically modified for
- the fluorescence polarization value for a fluorescently-tagged molecule depends on the rotational correlation time or tumbling rate. Protein complexes, such as formed by trmD polypeptide associating with another trmD polypeptide or other polypeptide, labeled to comprise a fluorescently- labeled molecule will have higher polarization values than a fluorescently labeled monomeric protein. It is preferred that this method be used to characterize small molecules that disrupt polypeptide complexes.
- Fluorescence energy transfer may also be used characterize small molecules that interfere with the formation of trmD polypeptide dimers, trimers, tetramers or higher order structures, or structures formed by trmD polypeptide bound to another polypeptide.
- TrmD polypeptide can be labeled with both a donor and acceptor fiuorophore. Upon mixing of the two labeled species and excitation of the donor fiuorophore, fluorescence energy transfer can be detected by observing fluorescence of the acceptor. Compounds that block dimerization will inhibit fluorescence energy transfer.
- TrmD polypeptide can be coupled to a sensor chip at low site density such that covalently bound molecules will be monomeric.
- Solution protein can then passed over the trmD polypeptide -coated surface and specific binding can be detected in real-time by monitoring the change in resonance angle caused by a change in local refractive index.
- This technique can be used to characterize the effect of small molecules on kinetic rates and equilibrium binding constants for trmD polypeptide self-association as well as an association of trmD polypeptide and another polypeptide or small molecule.
- a scintillation proximity assay may be used to characterize the interaction between an association of trmD polypeptide with another trmD polypeptide or a different polypeptide.
- TrmD polypeptide can be coupled to a scintillation-filled bead. Addition of radio-labeled trmD polypeptide results in binding where the radioactive source molecule is in close proximity to the scintillation fluid. Thus, signal is emitted upon trmD polypeptide binding and compounds that prevent trmD polypeptide self-association or an association of trmD polypeptide and another polypeptide or small molecule will diminish signal.
- methods for identifying compounds that bind to or otherwise interact with and inhibit or activate an activity or expression of a polypeptide and/or polynucleotide of the invention comprising: contacting a polypeptide and/or polynucleotide of the invention with a compound to be screened under conditions to permit binding to or other interaction between the compound and the polypeptide and/or polynucleotide to assess the binding to or other interaction with the compound, such binding or interaction preferably being associated with a second component capable of providing a detectable signal in response to the binding or interaction of the polypeptide and/or polynucleotide with the compound; and determining whether the compound binds to or otherwise interacts with and activates or inhibits an activity or expression of the polypeptide and/or polynucleotide by detecting the presence or absence of a signal generated from the binding or interaction of the compound with the polypeptide and/or polynucleotide.
- TrmD can be labeled, such as by radioactivity or a colorimetric compound, such that the number of trmD molecules bound to a binding molecule or converted to product can be determined accurately to assess the effectiveness of the potential antagonist.
- a polypeptide and/or polynucleotide of the present invention may also be used in a method for the structure-based design of an agonist or antagonist of the polypeptide and/or polynucleotide, by: (a) determining in the first instance the three- dimensional structure of the polypeptide and/or polynucleotide, or complexes thereof; (b) deducing the three-dimensional structure for the likely reactive site(s), binding site(s) or motif(s) of an agonist or antagonist; (c) synthesizing candidate compounds that are predicted to bind to or react with the deduced binding site(s), reactive site(s), and/or motif(s); and (d) testing whether the candidate compounds are indeed agonists or antagonists.
- the present invention provides methods of treating abnormal conditions such as, for instance, a Disease, related to either an excess of, an under-expression of, an elevated activity of, or a decreased activity of trmD polypeptide and/or polynucleotide.
- One approach comprises actministering to an individual in need thereof an inhibitor compound (antagonist) as herein described, optionally in combination with a pharmaceutically acceptable carrier, in an amount effective to inhibit the function and/or expression of the polypeptide and/or polynucleotide, such as, for example, by blocking the binding of ligands, substrates, receptors, enzymes, etc., or by inhibiting a second signal, and thereby alleviating the abnormal condition.
- soluble forms of the polypeptides still capable of binding the ligand, substrate, enzymes, receptors, etc. in competition with endogenous polypeptide and/or polynucleotide may be administered. Typical examples of such competitors include fragments of the trmD polypeptide and/or polypeptide.
- expression of the gene encoding endogenous trmD polypeptide can be inhibited using expression blocking techniques.
- This blocking may be targeted against any step in gene expression, but is preferably targeted against transcription and/or translation.
- An examples of a known technique of this sort involve the use of antisense sequences, either internally generated or separately administered (see, for example, O'Connor, J Neurochem (1991) 56:560 in Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988)).
- oligonucleotides that form triple helices with the gene can be supplied (see, for example, Lee et al, Nucleic Acids Res (1979) 3:173; Cooney et al, Science (1988) 241 :456; Dervan et al, Science (1991) 2 1:1360). These oligomers can be administered per se or the relevant oligomers can be expressed in vivo.
- Each of the polynucleotide sequences provided herein may be used in the discovery and development of antibacterial compounds.
- the encoded protein upon expression, can be used as a target for the screening of antibacterial drugs.
- the polynucleotide sequences encoding the amino terminal regions of the encoded protein or Shine-Delgarno or other translation facilitating sequences of the respective mRNA can be used to construct antisense sequences to control the expression of the coding sequence of interest.
- the invention also provides the use of the polypeptide, polynucleotide, agonist or antagonist of the invention to interfere with the initial physical interaction between a pathogen or pathogens and a eukaryotic, preferably mammalian, host responsible for sequelae of infection.
- the molecules of the invention may be used: in the prevention of adhesion of bacteria, in particular gram positive and/or gram negative bacteria, to eukaryotic, preferably mammalian, extracellular!
- trmD agonists and antagonists preferably bacteristatic or bactericidal agonists and antagonists.
- the antagonists and agonists of the invention may be employed, for instance, to prevent, inhibit and/or treat diseases.
- H. pylori Helicobacter pylori bacteria infect the stomachs of over one-third of the world's population causing stomach cancer, ulcers, and gastritis (International Agency for Research on Cancer (1994) Schistosomes, Liver Flukes and Helicobacter Pylori (International Agency for Research on Cancer, Lyon, France, http://www.uicc.ch/ecp/ecp2904.htm). Moreover, the International Agency for Research on Cancer recently recognized a cause-and-effect relationship between H. pylori and gastric adenocarcinoma, classifying the bacterium as a Group I (definite) carcinogen.
- Preferred antimicrobial compounds of the invention should be useful in the treatment of H. pylori infection. Such treatment should decrease the advent of H. £y/ ⁇ r;-induced cancers, such as gastrointestinal carcinoma. Such treatment should also prevent, inhibit and or cure gastric ulcers and gastritis.
- Bodily material(s) means any material derived from an individual or from an organism infecting, infesting or inhabiting an individual, including but not limited to, cells, tissues and waste, such as, bone, blood, serum, cerebrospinal fluid, semen, saliva, muscle, cartilage, organ tissue, skin, urine, stool or autopsy materials.
- Disease(s) means any disease caused by or related to infection by a bacteria, including , for example, disease, such as, infections of the upper respiratory tract (e.g., otitis media, bacterial tracheitis, acute epiglottitis, thyroiditis), lower respiratory (e.g., empyema, lung abscess), cardiac (e.g., infective endocarditis), gastrointestinal (e.g., secretory diarrhoea, splenic absces, retroperitoneal abscess), CNS (e.g., cerebral abscess), eye (e.g., blepharitis, conjunctivitis, keratitis, endophthalmitis, preseptal and orbital cellulitis, darcryocystitis), kidney and urinary tract (e.g., epididymitis, intrarenal and perinephric absces, toxic shock syndrome), skin (e.g., impetigo, f
- “Host cell(s)” is a cell that has been introduced (e.g., transformed or transfected) or is capable of introduction (e.g., transformation or transfection) by an exogenous polynucleotide sequence.
- Identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as the case may be, as determined by comparing the sequences.
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences.
- Identity can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M.
- Methods to determine identity are designed to give the largest match between the sequences tested. Moreover, methods to determine identity are codified in publicly available computer programs. Computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and FASTA (Altschul, S.F. et al., J. Molec. Biol 215: 403-410 (1990).
- the BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al, J. Mol. Biol. 215: 403-410 (1990).
- the well known Smith Waterman algorithm may also be used to determine identity.
- Parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol Biol. 48: 443-453 (1970) Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992) Gap Penalty: 12 Gap Length Penalty: 4 A program useful with these parameters is publicly available as the "gap" program from Genetics Computer Group, Madison WI. The aforementioned parameters are the default parameters for peptide comparisons (along with no penalty for end gaps).
- Polynucleotide embodiments further include an isolated polynucleotide comprising a polynucleotide sequence having at least a 95, 97 or 100% identity to the reference sequence of SEQ ID NO: 1, wherein said polynucleotide sequence may be identical to tlie reference sequence of SEQ ID NO: 1 or may include up to a certain integer number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides in SEQ ID NO:l by the integer defining the percent identity divided by 100 and then subtract
- n n is the number of nucleotide alterations
- x n is the total number of nucleotides in SEQ ID NO:l
- y is 0.95 for 95%, 0.97 for 97% or 1.00 for 100%
- • is the symbol for the multiplication operator, and wherein any non-integer product of x n and y is rounded down to the nearest integer prior to subtracting it from x n .
- Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.
- Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO:2, wherein said polypeptide sequence may be identical to the reference sequence of SEQ ID NO:2 or may include up to a certain integer number of amino acid alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non-conservative substitution, or insertion, and wherein said alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of amino acid alterations is determined by multiplying the total number of ammo acids in SEQ ID NO 2 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of ammo acids in SEQ ID NO 2, or
- n a is the number of ammo acid alterations
- x a is the total number of ammo acids in SEQ ID NO 2
- y is 0 95 for 95%, 0 97 for 97% or 1 00 for 100%
- • is the symbol for the multiplication operator
- any non-mteger product of x a and y is rounded down to the nearest integer prior to subtracting it from x a
- “Ind ⁇ v ⁇ dual(s)" means a multicellular eukaryote, mcludmg, but not limited to a metazoan, a mammal, an ovid, a bovid, a simian, a primate, and a human
- Isolated means altered “by the hand of man” from its natural state, i e , if it occurs in nature, it has been changed or removed from its onginal environment, or both
- a polynucleotide or a polypeptide naturally present m a living organism is not “isolated,” but tlie same polynucleotide or polypeptide separated from the coexisting mate ⁇ als of its natural state is “isolated", as the term is employed herem
- a polynucleotide or polypeptide that is mtroduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated” even if it is still present m said organism, which organism may be living or non-living
- Orgamsm(s) means a (l) prokaryote, mcludmg but not limited to, a member of the genus Streptococcus, Staphylococcus, Bordetella, Corynebactenum, Mycobactenum, Neisseria, Haemoph ⁇ us, Actinomycetes, Streptomycetes, Nocardia, Enterobacter, Yersinia, Fanc sella, Pasturella, Moraxella, Ac netobacter, Erysipelothnx, Branhamella, Actinobac ⁇ lus, Streptobac ⁇ lus, Listena, Calymmatobactenum, Brucella, Bacillus, Clostndium, Treponema, Eschenchia, Salmonella, Kleibsiella, Vibrio, Proteus, Erwima, Borreha, Leptosptra, Spinllum, Campylobacter, Shigella, Legionella, Pseudom
- Polynucleotide(s) generally refers to any poly ⁇ bonucleotide or polydeoxy ⁇ bonucleotide, that may be unmodrfied RNA or DNA or modified RNA or DNA
- Polynucleotide(s) include, without limitation, smgle- and double-stranded DNN DNA that is a mixture of smgle- and double-stranded regions or single-, double- andt ⁇ ple-stranded regions, smgle- and double-stranded RNN and R ⁇ A that is mixture of smgle- and double-stranded regions, hyb ⁇ d molecules compnsing D ⁇ A and R ⁇ A that may be single-stranded or.
- polynucleotide refers to t ⁇ ple-stranded regions comp ⁇ smg R ⁇ A or D ⁇ A or both R ⁇ A and D ⁇ A
- the strands m such regions may be from the same molecule or from different molecules
- the regions may mclude all of one or more of the molecules, but more typically mvolve only a region of some of the molecules
- One of the molecules of a t ⁇ ple-hebcal region often is an oligonucleotide
- the term "polynucleotide(s)” also mcludes D ⁇ As or R ⁇ As as desc ⁇ bed above that comp ⁇ se one or more modified bases
- D ⁇ As or R ⁇ As with backbones modified for stability or for other reasons are "polynucleotide(s)" as that term is
- Polypeptide(s) refers to any peptide or protem comp ⁇ smg two or more ammo acids jomed to each other by peptide bonds or modified peptide bonds
- Polypeptide(s) refers to both short chains, commonly referred to as peptides, oligopeptides and ohgomers and to longer chams generally refe ⁇ ed to as protems
- Polypeptides may comp ⁇ se am o acids other than the 20 gene encoded ammo acids
- Polypept ⁇ de(s)" mclude those modified either by natural processes, such as processmg and other post-translational modifications, but also by chemical mo ⁇ rfication techniques Such modifications are well desc ⁇ bed m basic texts and in more detailed monographs, as well as m a voluminous research literature, and they are well known to those of skill in the art.
- a given polypeptide may comprise many types of modifications. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains, and the amino or carboxyl termini.
- Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, GPI anchor fo ⁇ nation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, selen
- Polypeptides may be branched or cyclic, with or without branching. Cyclic, branched and branched circular polypeptides may result from post- translational natural processes and may be made by entirely synthetic methods, as well.
- Recombinant expression system(s) refers to expression systems or portions thereof or polynucleotides of the invention introduced or transformed into a host cell or host cell lysate for tlie production of the polynucleotides and polypeptides of the invention.
- a typical variant of a polypeptide differs in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical.
- a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
- a substituted or inserted amino acid residue may or may not be one encoded by the genetic code.
- the present invention also includes include variants of each of the polypeptides of the invention, that is polypeptides that vary from the referents by conservative amino acid substitutions, whereby a residue is substituted by another with like characteristics.
- the polynucleotide having a DNA sequence given in Table 1 [SEQ ID NO:l] was btained from a library of clones of chromosomal DNA of Staphylococcus aureus in E. coli.
- the sequencing data from two or more clones comprising overlapping Staphylococcus aureus DNAs was used to construct the contiguous DNA sequence in SEQ ID NO:l.
- Libraries may be prepared by routine methods, for example: Methods 1 and 2 below.
- Total cellular DNA is mechanically sheared by passage through a needle in order to size- fractionate according to standard procedures.
- DNA fragments of up to l lkbp in size are rendered blunt by treatment with exonuclease and DNA polymerase, and EcoRI linkers added. Fragments are ligated into the vector Lambda ZapII that has been cut with EcoRI, the library packaged by standard procedures and E.coli infected with the packaged library.
- the library is amplified by standard procedures.
- Total cellular DNA is partially hydrolyzed with a one or a combination of restriction enzymes appropriate to generate a series of fragments for cloning into library vectors (e.g., Rsal, Pall, Alul, Bshl235I), and such fragments are size-fractionated according to standard procedures.
- EcoRI linkers are ligated to the DNA and the fragments then ligated into the vector Lambda ZapII that have been cut with EcoRI, the library packaged by standard procedures, and E.coli infected with the packaged library.
- the S. aureus trmD gene is expressed during infection in a thigh lesion and pyelonephritis infection models.
- WCUH29 Necrotic fatty tissue from a four day groin infection or kidney from a seven day pyelonephritis infection of Staphylococcus aureus WCUH29 in the mouse is efficiently disrupted and processed in the presence of acid phenol and detergent to provide a mixture of animal and bacterial RNA. By freezing the tissue immediately in liquid nitrogen, and processing the tissue samples while still frozen, changes in the population of bacterial mRNA is minimized. The resultant total RNA is free of DNA and protein (including RNAases and DNAases).
- RNA preparations are stored in this isopropanol solution at -80°C if necessary.
- the RNA is pelleted (12,000g for 10 min.), washed with 75% ethanol (v/v in DEPC-treated water), air-dried for 5-10 min, and resuspended in 0.1 ml of DEPC-treated water.
- mice are each infected by subcutaneous injection of 0.5ml. of this broth culture of Staphylococcus aureus WCUH29 (diluted in broth to approximately 108 cfu/ml.) into the anterior , right lower quadrant (groin area). Mice should be monitored regularly during the first 24 hours after infection, then daily until termination of study. Animals with signs of systemic infection, i.e. lethargy, ruffled appearance, isolation from group, should be monitored closely and if signs progress to moribundancy, the animal should be culled immediately.
- mice should be killed individually rather than in groups.
- the dead animal is placed onto its back and the fur swabbed liberally with 70% alcohol.
- An initial incision using scissors is made through the skin of the abdominal left lower quadrant, travelling superiorly up to, then across the thorax.
- the incision is completed by cutting inferiorly to the abdominal lower right quadrant. Care should be taken not to penetrate the abdominal wall. Holding the skin flap with forceps, the skin is gently pulled way from the abdomen.
- the exposed abscess which covers the peritoneal wall but generally does not penetrate the muscle sheet completely, is excised, taking care not to puncture the viscera
- the abscess/muscle sheet and other infected tissue may require cutting in sections, prior to flash-freezing in liquid nitrogen, thereby allowing easier storage in plastic collecting vials.
- mice Male CD-I mice (18 - 20g) were infected with 0.2 ml of this suspension by tail vein inoculation using a 30g needle attached to a tuberculin syringe. Each mouse receives approximately 4 x 107 bacteria in this fashion. Mice are monitored daily for signs of illness, and usually within 48 hours show signs of lethargy, ruffled fur, sluggishness; animals which appear moribund are euthanized prior to the end of the experiment.
- PBS sterile phosphate-buffered saline
- All animals are euthanized via carbon dioxide overdose seven days post-infection.
- the animal is placed on its back and swabbed with ethanol, and then with RNAZap, and instruments are swabbed as well.
- the abdominal cavity is opened and the kidneys aseptically removed, cut into four pieces, and placed in cryovials which are immediately frozen in liquid nitrogen.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
L'invention concerne des polypeptides trmD et des polynucléotides codant pour ces polypeptides, ainsi que des procédés de production desdits polypeptides à l'aide de techniques de recombinaison. L'invention concerne également des procédés d'utilisation de ces polypeptides pour cribler des composés antibactériens.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US31139299A | 1999-05-13 | 1999-05-13 | |
US09/311,392 | 1999-05-13 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2000069873A1 true WO2000069873A1 (fr) | 2000-11-23 |
Family
ID=23206682
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/US2000/013214 WO2000069873A1 (fr) | 1999-05-13 | 2000-05-12 | Polypeptides trmd |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2000069873A1 (fr) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7648636B2 (en) | 2004-12-04 | 2010-01-19 | Merck Patent Gmbh | Mixed-modal anion-exchanged type separation material |
-
2000
- 2000-05-12 WO PCT/US2000/013214 patent/WO2000069873A1/fr active Application Filing
Non-Patent Citations (4)
Title |
---|
DATABASE PIR60 ON MPSRCH KUNST F. ET AL.: "tRNA methyltransferase trmD- bacillus subtilis. Gene sequence", XP002931647 * |
GABRYSZUK J. ET AL.: "tRNA recognition for modification: solution probing of tRNA complexed with escherichia coli tRNA (guanosine-1) methyltransferase", RNA, vol. 3, 1997, pages 1327 - 1336, XP002931644 * |
PERSSON B.C. ET AL.: "Functional analysis of the ffh-trmD region of the escherichia coli chromosome by using reverse genetics", JOURNAL OF BACTERIOLOGY, vol. 177, no. 19, October 1995 (1995-10-01), pages 5554 - 5560, XP002931646 * |
REDLAK M. ET AL.: "Interaction of tRNA with tRNA (Guanosine-1) methyltransferase: binding specificity determinants involve the dinucleotide G36pG37 and tertiary structure", BIOCHEMISTRY, vol. 36, no. 29, 1997, pages 8699 - 8709, XP002931645 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US7648636B2 (en) | 2004-12-04 | 2010-01-19 | Merck Patent Gmbh | Mixed-modal anion-exchanged type separation material |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6350600B1 (en) | trmD | |
US6451556B1 (en) | EF-Tu | |
US20060223082A1 (en) | Map | |
US6238887B1 (en) | Ribosome recycling factor (FRR) of Staphylococcus aureus | |
WO2000044778A1 (fr) | mvk | |
US6110704A (en) | 3-ketoacyl-ACP-reductase (FabG) of Staphylococcus aureus | |
US6448038B1 (en) | BirA from staphylococcus aureus | |
US6287810B1 (en) | Polynucleotides encoding an undercaprenyl diphosphate synthase of staphylococcus aureus | |
US6352843B1 (en) | YsxC from Staphylococcus aureus | |
US6352840B1 (en) | pskG | |
US6340564B1 (en) | yhxB | |
US6245891B1 (en) | nusB polypeptides and polynucleotides and methods thereof | |
US6316211B1 (en) | ThdF | |
US6197546B1 (en) | PcrA Helicase of Staphylococcus aureus | |
US6194174B1 (en) | Histidine kinase, 636 HK, of staphylococcus aureus | |
US6326172B1 (en) | ytgP | |
US6406889B1 (en) | 509hk | |
US6326167B1 (en) | TktA from Streptococcus pneumoniae | |
WO2000069873A1 (fr) | Polypeptides trmd | |
US6251633B1 (en) | Polynucleotides encoding Staphylococcus aureus FtsA polypeptide | |
US6225457B1 (en) | murF2 | |
WO2000049042A1 (fr) | nadE | |
US20020061572A1 (en) | Histidine kinase | |
WO2001030806A1 (fr) | Polynucleotides et polypeptides intervenant dans la biologie des films biologiques, et leurs utilisations | |
WO2000061778A1 (fr) | Mvaa de staphylococcus aureus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A1 Designated state(s): JP |
|
AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE |
|
121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
DFPE | Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101) | ||
122 | Ep: pct application non-entry in european phase | ||
NENP | Non-entry into the national phase |
Ref country code: JP |