WO2000069463A1 - Compositions and methods for treating cell proliferation disorders - Google Patents

Compositions and methods for treating cell proliferation disorders Download PDF

Info

Publication number
WO2000069463A1
WO2000069463A1 PCT/US2000/008081 US0008081W WO0069463A1 WO 2000069463 A1 WO2000069463 A1 WO 2000069463A1 US 0008081 W US0008081 W US 0008081W WO 0069463 A1 WO0069463 A1 WO 0069463A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
tumor
antagonist
human
antibodies
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2000/008081
Other languages
English (en)
French (fr)
Inventor
Hervé Fridman
Eric Tartour
Jacques Banchereau
François FOSSIEZ
Serge J. E. Lebecque
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Merck Sharp and Dohme LLC
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Institut Curie
Schering Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM, Institut Curie, Schering Corp filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Priority to JP2000617923A priority Critical patent/JP2004500325A/ja
Priority to EP00919693A priority patent/EP1251872A1/en
Priority to AU40339/00A priority patent/AU4033900A/en
Priority to CA002373938A priority patent/CA2373938A1/en
Priority to MXPA01011923A priority patent/MXPA01011923A/es
Publication of WO2000069463A1 publication Critical patent/WO2000069463A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/244Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the invention relates to the use of cytokines.
  • cytokines antagonists and/or cytokine receptor antagonists in the treatment of disease states. More specifically, the invention relates to methods of using interleukin-17 (IL-17), IL-17 antagonists and/or IL-17 receptor antagonists to treat certain cell proliferative diseases such as cancer.
  • IL-17 interleukin-17
  • Soluble proteins known as cytokines play a critical role in many aspects of cell differentiation, in cellular interactions, in cellular proliferation and in the development of an immune response.
  • interleukin-6 behaves as a growth factor for many tumor cell lines derived from myeloma, lymphoma, Kaposi's sarcoma, melanoma, ovarian and renal or bladder cell carcinoma (Fridman and Tartour 1997, Molecular aspects of Medicine. Eds Elsevier Science Ltd, Oxford, England, 18:3-90).
  • IL-6 transfected tumors often exhibit increased tumorigenicity (Vink et al., 1990, J. Exp. Med. 172:997-1000; Durandy et al, 1994, J. Immunol. 152:5361-5367).
  • anti-IL-6 monoclonal antibody administration transiently inhibits myeloma cell proliferation (Bataille et al, 1995, Blood. 86:685-691 ).
  • Interleukin-8 a member of the CXC family of chemotactic cytokines, also stimulates the proliferation of tumor cells, as IL-8 is an autocrine growth factor for human melanoma (Schadendorf et al, 1993, J. Immunol 151 :2667-2675). Its expression by tumor cells is directly correlated with their metastatic potential in nude mice (Singh et al, 1994, Cancer Res. 54:3242-3247).
  • Cervical cancer is associated with human papillomavirus (HPV) infection, but additional factors must contribute to its pathogenesis, since only a minority of HPV infections result in persistent lesions or progress to malignancy (Schiffmank and Brinton, 1995, Cancer 76:1888-1901 ).
  • HPV human papillomavirus
  • IL-6 may be involved in the pathogenesis and development of cervical cancers. IL-6 stimulates the growth of both normal cervical cells, HPV immortalized and cervical carcinoma derived cell lines (Iglesias et al, 1995, Am. J. Pathol. 146:944-952; Eustace et al, 1993. Gynecol Oncol. 50:15-19.).
  • cervical carcinoma cells also secrete higher levels of IL-6 and IL-8 than HPV infected and normal cervical epithelial cells (Woodworm and Simpson, et al. 1993, Am. J. Pathol. 142:1544-1555). Increased expression of IL-6 mRNA has been demonstrated in biopsies derived from invasive cervical carcinoma compared to cervical intraepithelial neoplasia or normal cervix (Tartour et al, 1994, Cancer Res. 54:6243- 6248).
  • IL-17 previously termed cytotoxic T lymphocyte associated antigen-8 (CTLA-8), is a 17 kDa cytokine mainly expressed by activated human memory CD4 T cells (Rouvier et al, 1993, J. Immunol. 150:5445-5556; Fossiez et al, 1996, J. Exp. Med. 183:2593- 2603; Spriggs, 1997, J. Clin. Immunol. 17:366-369).
  • CTL-8 cytotoxic T lymphocyte associated antigen-8
  • IL-17 is considered to be a proinflammatory cytokine since it has been shown to increase the production of interleukin-6 (IL-6) and interleukin-8 (IL-8) in macrophages, fibroblasts, keratinocytes and synovial cells (Fossiez et al, 1996, J. Exp. Med. 183:2593-2603; Yao et al, 1995, Immunity 3:811-821; Chabaud et al, 1998 J. Immunol.
  • IL-6 interleukin-6
  • IL-8 interleukin-8
  • the present invention fulfills the foregoing need by providing materials and methods for treating disease states characterized by abnormal tumor cell proliferation.
  • the invention provides a method of treating disease states comprising administering to an individual in need thereof IL-17, an IL-17 antagonist or an IL-17 receptor antagonist in an amount sufficient to inhibit tumor growth.
  • non-immunogenic tumor growth is prevented or inhibited by administering an effective amount of an IL-17 anagonist or an IL-17 receptor antagonist.
  • the antagonist is an antibody that binds IL- 17 or an anibody that binds IL-17 receptor.
  • immunogenic tumor growth is prevented or inhibited by administering an effective amount of IL-17.
  • the IL-17, IL-17 antagonist and/or IL-17 receptor antagonist may be administered in combination with other cytokines, and/or with chemotherapuetic agents.
  • IL-17 promotes tumor growth and that the tumor- growth promoting effects of IL-17 can be inhibited by blocking the biological activity of IL-17.
  • the growth-promoting activity of IL-17 can be reduced or eliminated by blocking circulating IL-17 using IL-17 specific antibodies or an antagonist molecule to IL-17.
  • the IL-17 receptor can be blocked using a IL-17 receptor specific antibody or an antagoinist molecule to IL-17 receptor. By blocking IL-17 and/or IL-17 receptor, the growth rate of tumor cells is reduced.
  • Both the naturally occurring and recombinant forms of IL-17 and IL-17 receptor may be used to prepare antibodies for use as antagonist, and for use in drug screening and development.
  • IL-17 has an antiproliferative effect on immunogenic tumors.
  • the antiproliferative effect of IL-17 on immunogenic tumors is mediated by T cells.
  • Both the naturally occurring and recombinant forms of IL-17 may be used to inhibit the growth of immunogenic tumors.
  • IL-17 can also be delivered by standard gene therapy techniques, including e.g., direct DNA injection into tissues, the use of recombinant viral vectors, or implantation of transfectred cells. See, e.g., Rosenbert, 1992, J. Clin. Oncol. 10:180.
  • IL-17 either stimulates tumor growth (i.e., non-immunogenic tumor growth) or activates immunogenic tumor rejection.
  • Both primary and metastatic cancer can be treated in accordance with the invention.
  • Types of cancers which can be treated include but are not limited to melanoma, cervical, breast, pancreatic, colon, lung, glioma, hepatocellular, endometrial, gastric, intestinal, renal, prostate, thyroid, ovarian, testicular, liver, head and neck, colorectal, esophagus, stomach, eye, bladder, glioblastoma, and metastatic carcinomas.
  • carcinoma refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas.
  • Metastatic as this term is used herein, is defined as the spread of tumor to a site distant to regional lymph nodes.
  • IL-17, the IL-17 antagonist and/or the IL-17R antagonists is administered as a pharmaceutical composition comprising an effective amount of IL- 17/IL-17 antagonist/IL-R antagonist in a pharmaceutical carrier.
  • a pharmaceutical carrier can be any compatible, non-toxic substance suitable for delivering the compositions of the invention to a patient. The quantities of reagents necessary for effective therapy will depend upon many different factors, including means of administration, target site, physiological state of the patient, and other medicants administered.
  • treatment dosages should be titrated to optimize safety and efficacy.
  • Animal testing of effective doses for treatment of particular cancers will provide further predictive indication of human dosage.
  • Various considerations are described, e.g., in Gilman et al. (eds.) (1990) Goodman and Gilman 's: The Pharmacological Bases of Therapeutics, 8th Ed.. Pergamon Press; and Remington's Pharmaceutical Sciences, 17th ed. (1990), Mack Publishing Co., Easton, PA.
  • Methods for administration are discussed therein and below, e.g., for intravenous, intraperitoneal, or intramuscular administration, transdermal diffusion, and others.
  • Pharmaceutically acceptable carriers will include water, saline, buffers, and other compounds described, e.g., in the Merck Index, Merck & Co., Rahway, New Jersey. Slow release formulations, or a slow release apparatus may be used for continuous administration.
  • the preferred biologically active dose of IL-17, IL-17 antagonist and IL-17 receptor antagonists in the practice of the claimed invention is that dosage will induce maximum suppression or inhibition of cell proliferation.
  • suppression and inhibition are used synonomously and refer to the prevention of further growth of an established tumor or the slowing or reduction in the rate of tumor cell proliferation.
  • treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under the circumstance is reached. Determination of the proper dosage and administration regime for a particular situation is within the skill of the art.
  • Dosage ranges for IL-17 and IL-17 receptor antagonists would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ⁇ M concentrations, usually less than about 100 nM, preferably less than about 10 pM (picomolar), and most preferably less than about 1 fM (femtomolar), with an appropriate carrier.
  • IL-17 antagonists/IL-17R antagonists are particularly preferred for IL-17 receptor antagonists, for example, would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ⁇ M concentrations, usually less than about 100 nM, preferably less than about 10 pM (picomolar), and most preferably less than about 1 fM (femtomolar), with an appropriate carrier.
  • IL-17 antagonists/IL-17R antagonists would ordinarily be expected to be in amounts lower than 1 mM concentrations, typically less than about 10 ⁇ M concentrations, usually less than about 100 nM, preferably less
  • IL-17 antagonists may take the form of proteins which compete for receptor binding, e.g., which lack the ability to activate the receptor while blocking IL-17 binding, or IL-17 binding molecules, e.g., antibodies.
  • Antibodies can be raised to the IL-17 cytokine, fragments, and analogs, both in their naturally occurring forms and in their recombinant forms.
  • IL-17 polypeptides and nucleic acid sequences encoding them are disclosed in published International Applications WO95/18826 and WO97/15320.
  • Receptors for IL-17 and nucleic acids encoding such receptors are disclosed in U.S. Patent No. 5,869,286.
  • antibodies can be raised to IL-17 in either its active forms or in its inactive forms, the difference being that antibodies to the active cytokine are more likely to recognize epitopes which are only present in the active conformation.
  • Antibodies including binding fragments and single chain versions, against predetermined fragments of the desired antigens, e.g., cytokine, can be raised by immunization of animals with conjugates of the fragments with immunogenic proteins.
  • Monoclonal antibodies are prepared from cells secreting the desired antibody. These antibodies can be screened for binding to normal or inactive analogs, or screened for agonistic or antagonistic activity. These monoclonal antibodies will usually bind with at least a Kr> of about 1 mM, more usually at least about 300 ⁇ M, typically at least about 10 ⁇ M, more typically at least about 30 ⁇ M, preferably at least about 10 ⁇ M, and more preferably at least about 3 ⁇ M or better.
  • the antibodies can be potent antagonists that bind to the IL-17 receptor and inhibit ligand binding to the receptor or inhibit the ability of IL-17 to elicit a biological response.
  • IL-17 or fragments may be joined to other materials, particularly polypeptides, as fused or covalently joined polypeptides to be used as immunogens.
  • IL-17R Antibodies raised against IL-17 or IL-17 receptors (IL-17R) will also be useful to raise anti-idiotypic antibodies which may be tested for antagonist properties. These will be useful in modulating various cellular responses.
  • the present invention encompasses the use of antibodies that specifically bind IL-17/IL-17R.
  • Antibodies useful in practicing the present invention include polyclonal and monoclonal antibodies.
  • the antibodies may be elicited in an animal host by immunization with IL-17/IL-17R proteins or fragments thereof or may be formed by in vitro immunization (sensitization) of immune cells.
  • the immunogenic components used to elicit the production of antibodies may be isolated from cells or chemically synthesized.
  • the antibodies may also be produced in recombinant systems programmed with appropriate antibody-encoding DNA. Alternatively, the antibodies may be constructed by biochemical reconstitution of purified heavy and light chains.
  • the antibodies include hybrid antibodies, chimeric antibodies, humanized antibodies and univalent antibodies. Also included are Fab fragments, including Fab' and F(ab) 2 fragments of antibodies.
  • Hybridomas of the invention used to make monoclonal antibodies are produced by well-known techniques. Usually, the process involves the fusion of an immortalizing cell line with a B-lymphocyte that produces the desired antibody. Alternatively, non-fusion techniques for generating immortal antibody-producing cell lines are possible, and come within the purview of the present invention, e.g., virally-induced transformation, Casali et al., 1986, Science 234:476. Immortalizing cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin. Most frequently, rat or mouse myeloma cell lines are employed as a matter of convenience and availability.
  • Hybridomas are selected by standard procedures, such as HAT (hypoxanthine- aminopterin-thymidine) selection. From among these hybridomas, those secreting the desired antibody are selected by assaying their culture medium by standard immunoassays, such as immunoblotting, ELISA (enzyme-linked immunosorbent assay), RIA (radioimmunoassay), or the like. Antibodies are recovered from the medium using standard protein purification techniques, Tijssen, 1985, Practice and Theory of Enzyme Immunoassays, Elsevier, Amsterdam.
  • IL-17/IL-R Both the naturally occurring and recombinant forms of human IL-17/IL-R may be used for drug screening and development.
  • Nucleic acid sequences encoding IL-17 (e.g., cDNA, mRNA) and IL-17 polypeptides can advantageously be used to screen for antagonist, e.g., by screening compounds for IL-17/IL-17R binding activity.
  • IL-17/IL-R or fragments thereof may be used as the basis for low-throughput and high-throughput assays to identify IL-17/IL-R antagonists.
  • the inhibitory agents may comprise nucleic acids, particularly antisense oligonucleotides; peptides; oligosaccharides; lipids; derivatives of any of the foregoing, or other molecules.
  • the inhibitory agents may be identified using methods well-known in the art, such as, for example, by screening chemical or natural product libraries for the ability to bind to, and/or inhibit or alter the function of the nucleic acids or polypeptides of the invention.
  • Such compounds may be found in, for example, natural product libraries, fermentation libraries (encompassing plants and microorganisms), combinatorial libraries, compound files, and synthetic compound libraries.
  • synthetic compound libraries are commercially available from Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Brandon Associates (Merrimack, NH), and Microsource (New Milford, CT).
  • a rare chemical library is available from Aldrich Chemical Company, Inc. (Milwaukee, WI).
  • libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available from, for example, Pan Laboratories (Bothell, WA) or MycoSearch (NC), or are readily producible. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means (Blondelle et al, 1996, TibTech 14:60).
  • Ligand-binding assays are useful to identify inhibitor compounds that interfere with the function of a particular target protein. These assays are designed to detect binding of test compounds to particular targets. The detection may involve direct measurement of binding. Alternatively, indirect indications of binding may involve stabilization of protein structure or disruption of a biological function.
  • Non-limiting examples of useful ligand- binding assays is the Biomolecular Interaction Assay (BIAcore) system developed by Pharmacia Biosensor and described in the manufacturer's protocol (LKB Pharmacia, Sweden), the yeast two-hybrid system (Fields and Song, 1989. Nature 340:245-246; U.S. Patent No. 5,283,173) and scintillation proximity assays (U.S. Patent No. 4,568,649).
  • BIOS. Patent No. 4,568,649 Biomolecular Interaction Assay
  • Compounds identified as binding to an IL-17/IL-R polypeptide or otherwise interfering with its function are potentially useful as IL-17/IL-R antagonists for use in pharmaceutical compositions.
  • test compound Once a particular test compound has been identified as a candidate agent, it is tested for two properties: (i) the ability to inhibit tumor growth; and (ii) a lack of effect on different animals. Agents that exhibit tumor growth suppressing activity and a exhibit lack of toxicity for animal cells are especially preferred.
  • compositions suitable for therapy comprise IL-17/IL-17 antagonist/IL-R antagonist in conjunction with one or more biologically acceptable carriers.
  • suitable biologically acceptable carriers include, but are not limited to, phosphate-buffered saline, saline, deionized water, or the like.
  • Preferred biologically acceptable carriers are physiologically or pharmaceutically acceptable carriers.
  • the compositions include a tumor growth suppressing amount of active agent. This amount will depend upon the agent, the location and nature of the tumor, and the particular host. The amount can be determined by experimentation known in the art, such as by establishing a matrix of dosages and frequencies and comparing a group of experimental units or subjects to each point in the matrix. The therapeutically effective amount can be administered in one administration or over repeated administrations.
  • the active agents or compositions can be formed into dosage unit forms, such as for example, creams, ointments, lotions, powders, liquids, tablets, capsules, suppositories, sprays, or the like. If the composition is formulated into a dosage unit form, the dosage unit form may contain an effective amount of active agent. Alternatively, the dosage unit form may include less than such an amount if multiple dosage unit forms or multiple dosages are to be used to administer a total dosage of the active agent.
  • Dosage unit forms can include, in addition, one or more excipient(s), diluent(s), disintegrant(s), lubricant(s), plasticizer(s), colorant(s), dosage vehicle(s), absorption enhancer(s), stabilizer(s), bactericide(s), or the like.
  • compositions can be administered topically or systemically Topical application is typically achieved by administration of creams, ointments, lotions, or sprays as desc ⁇ bed above
  • Systemic administration includes both oral and parental routes
  • Parenteral routes include, without limitation, subcutaneous, intramuscular, mtrape ⁇ toneal, intravenous, transdermal, and intranasal administration
  • the HeLa cervical tumor cell lme was obtained from the American Type Culture Collection (Manassas, VA)
  • the IC1 cervical carcinoma cell line was provided by Dr J Coutu ⁇ er (Coutu ⁇ er et al , 1991, J Virol 65 4534-4538)
  • the human melanoma cell lines WM 793, 1341D, MZ2 and HT144 have been desc ⁇ bed by Montero et al , 1997, Clin Cancer Res.
  • cDNA encoding hIL-17 was inserted into an expression vector under the control of the SR ⁇ promoter in pBR322 into which a neomycin resistance gene was introduced (NT-Neo) (Daeron et al , 1995, Immunin 3 635-646) NT-Neo, containing or not containing the 640-bp IL- 17 cDNA, were hnea ⁇ zed with Sea I rest ⁇ ction enzyme, and stably transfected by electroporation into HeLa and IC1 cells. Electroporation was performed with a Bio-Rad Gene Pulser, at a voltage of 260 V and with a capacitance of 960 mF.
  • transfectants were selected by culture in RPMI medium (Gibco) supplemented with 1 mg/ ' ml of G418 (Geneticin) from Gibco BRL (Paisley, Scotland). G418-resistant clones were expanded in selection medium and tested for IL-17 expression.
  • Recombinant hIL-17 was purified from the supernatant of IL-17 transfected NSO cells as described by Fossiez et al, 1996, J. Exp. Med. 183:2593-2603.
  • Neutralizing anti- IL-17 mAb 5 as well as anti-IL17 mAb 16 and 25 were produced in ascites and purified by anion-exchange chromatography (Fossiez et al, 1996, J. Exp. Med. 183:2593-2603).
  • IL-6 and IL-8 were assayed using enzyme-linked immunosorbent assay (ELISA) kits purchased from Immunotech (Marseille, France) and Medgenix (Brussels, Belgium), respectively.
  • ELISA enzyme-linked immunosorbent assay
  • ELISA was used to measure human IL-17 concentrations in culture supernatants. Briefly, ninety-six break-away, flat-bottomed-well (Nunc) microtiter plates were coated with 50 ml of anti-IL-17 mAb 25 (10 mg/ml) diluted in carbonate buffer (0.1 M Na 2 CO 3 NaHCO 3 , pH 9.6) overnight at 4°C. The plate was then saturated with 200 ml of PBS-1 % BSA for lh at room temperature. After washes with PBS-0.05% Tween 20 (Merck, Schuchardt, Germany), 50 ml of recombinant hIL-17 or samples diluted in PBS- 1% BSA were added and incubated for 3 hours at 37°C.
  • RT-PCR was performed as described by Tartour et al, 1998, J. Natl Cancer Inst. 4:287-294.
  • the following oligonucleotide primers were used: Human (h) b actin sense (TCGTCGACAACGGCTCCGGCATGTGC), hb actin antisense (TTCTGCAGGGAGG AGCTGGAAGCAGC), hIL-6 sense (ACGAATT CACAAACNAATTCGGTACA).
  • hIL-6 antisense (CATCTAGATTCTTTGCCTTTTTCTGC), M -8 sense (TTCTGCAGCTCTG TGTGAAGG), hIL-8 antisense (GAAGAGGGCTGAGAATTCAT), hIL-17 sense (ACTC CTGGGAAGACCTCATTG), hIL-17 antisense (GGCCACATGGTGGACAATCG).
  • hCD4 sense GGAGTCCCTTTTAGGCACTTGC
  • hCD4 antisense GAACTCCACC TGTTCCCCCTC
  • hCD8 sense CCCTCCTGGCCGCGCAGCTG
  • hCD8 antisense GCCGGGCTCCTCCGCCG
  • murine m
  • IL-6 sense TGGAGTCACAGAAGG AGTGGCTAAG
  • mIL-6 antisense TCTGACCACAGTGAGGAATGTCCAC
  • HPRT m- Hypoxanthine-guanine phosphoribosyl transferase
  • Example 1 IL-6 and IL-8 production bv tumor cell lines stimulated with rhIL-17
  • rhIL-17 recombinant human IL-17 significantly increased IL-6 secretion by the two human cervical cell lines, HeLa and ICl This action was not rest ⁇ cted to tumor cell lines de ⁇ ved from cervical carcinoma, since two out of the four melanoma cell lines tested were also sensitive to rIL-17 Addition of anti-IL-17 mAb inhibited up-regulation of IL-6 production by IL-17 Tumor cells did not constitutively secrete significant levels of IL-17 and ant ⁇ -IL17 antibody alone had no effect on IL-6 secretion Only cell lines which already produced basal levels of IL-6 appeared to respond to IL-17 An increased production of IL-8 was also demonstrated after treatment of HeLa, ICl, WM793 and HT144 cell lines with rIL-17.
  • IL-6 and IL-8 Treatment resulted in an increased production of IL-6 and IL-8 after in vitro treatment of HeLa cells with hIL-17.
  • the human cervical carcinoma cell line. HeLa was plated at 10 6 cells per ml and cultured with various concentrations of purified hIL-17. After 24 hours the levels of IL-6 and IL-8 in the supernatants were measured by ELISA. In contrast, cell lines resistant to rIL-17-induced IL-6 production (MZ2, WM35) did not secrete IL-8 after IL-17 treatment. The activity of rIL-17 was observed at a dose range between 0.2 and 2 ng/ml.
  • IL-6 and IL-8 mRNA expression was assessed by RT-PCR in rIL-17- ⁇ reated and untreated cervical carcinoma cells in order to more thoroughly analyze the mechanisms of action of IL-17.
  • cDNA derived from mRNA extracted from HeLa cells was cultured for 6 hours with medium alone or hIL-17 (10 and 100 ng/ml), was amplified by PCR using primers specific for ⁇ actin, IL-6 and IL-8 mRNA. Amplified PCR products were then loaded onto a 2% agarose gel and stained with ethidium bromide for ultraviolet visualization. A clear upregulation of IL-6 and IL-8 mRNA was observed 6 hours after in vitro stimulation of HeLa cells with rIL-17. IL-17 therefore appears to regulate IL-6 and IL-8 either at the transcriptional level or by increasing their mRNA half life.
  • IL-17 human cervical carcinoma cell lines
  • two tumor cell lines (Hela, ICl) were transfected with a cDNA encoding human IL-17.
  • Wild type (WT) or human cervical carcinoma cells (HeLa , ICl) transfected with NT plasmid alone (Neo) or cDNA encoding human IL-17 were plated in 24-well flat-bottom plates at a density of 10 6 cells per well. The cells were cultured for 24 hours and the IL-6 or IL-17 levels were determined by ELISA.
  • IL-17 transfected- cell lines produced more IL-6 than the parent cervical carcinoma cell lines or cells transfected with the vector alone, which confirms results obtained w ith rIL-17 No clear increase of IL-8 secretion was observed in these IL-17-transfectants. which could explain by the weaker effect of IL-17 in the regulation of IL-8 than IL-6 in these cells
  • the growth rate of the va ⁇ ous clones was also investigated Wild type (WT) or human cervical carcinoma cells (HeLa , ICl) transfected with NT plasmid alone (Neo) or cDNA encoding human IL-17 were plated in 96-well flat-bottom plates at a density of 10 4 cells per well The cells were cultured for 3 days and their proliferation was determined by a MTT assay For these expe ⁇ ments, all cells were cultured in the same medium without G418/Neomyc ⁇ n For each cell line, a standard curve between the absorbance of the MTT test and the number of cells was determined Identical in vitro growth was observed in IL-17-ex ⁇ ress ⁇ ng and parent cells (Hela, ICl) Similarly, exogenous recombinant IL-17 did not influence the proliferation of human cervical cell lines
  • Human IL-17 cDNA was detected in 4/4 biopsies derived from mice transplanted with HeLa-IL-17 cells, but not in mice previously injected with the control transfectant (HeLa-Neo), indicating that the transgene was not lost during tumor development.
  • IL-17 is biologically active in murine cells (Kennedy et al, 1996, J. Interf Cyt. Res. 16:611-617), the in situ expression of genes normally regulated by IL-17, such as IL-6, were analyzed. Increased expression of murine IL-6 mRNA was demonstrated in biopsies excised from HeLa-IL-17 cells.
  • Murine IL-6 primers used for this study did not cross-react with human interleukin-6. The same analysis could not be performed for human IL-6 mRNA because the primers used could also amplify murine IL-6 mRNA. The murine counterpart of human IL-8 has not yet been isolated and its expression was therefore not investigated. Cryostat section of biopsies derived from IL-17- or mock- transfected HeLa cervical carcinoma transplanted in nude mice were fixed in acetone and incubated with biotinylated rat anti Mac 1 or isotype matched control biotinylated rat mAb.
  • IC1-IL17 tumors using other antibodies recognizing antigenic determinants on macrophages.
  • the intratumoral infiltration of other immune cells such as T cells, B cells and neutrophils did not seem to differ in tumor xenografts derived from mock or IL-17 transfected HeLa cells.
  • IL-17 is expressed in tumor biopsies from cervical carcinoma patients.
  • Six cDNA derived from mRNA extracted from 6 primary invasive cervical carcinomas were amplified by PCR using oligonucleotide primers specific for human IL-17, CD4 and CD8. Amplified PCR products were loaded onto a 2% agarose gel and stained with ethidium bromide for ultraviolet visualization. Significant expression of IL-17 was shown in 4/6 samples tested. No IL-17 mRNA expression could be observed in tumors only infiltrated by CD8 T cells. Equivalent ⁇ actin mRNA in the various samples assessed by RT-PCR excluded a bias in the interpretation of these results due to variation of total mRNA levels.
  • CD4 positive T cells seemed to be associated with IL-17 mRNA expression, in line with previous studies indicating the activated memory CD4 origin of this cytokine (Fossiez et al, 1996, J. Exp. Med. 183:2593-2603).
  • Example 6 IL-17 inhibits immunogenic tumor cell growth bv a T-cell dependent mechanism
  • IL-17 did not appear to affect the tumor incidence rate.
  • the tumors producing IL-17 wre significantly inhibited in their growth compared to the mock transfected tumors.
  • a tunnel assay was used to measure the amount of apoptotic cells in biopsies derived from the tumors.
  • mice were immunized with P815 mastocytoma producing IL-17.
  • mice were immunized with the mock transfected P815 tumor.
  • the mice immunized with the P815 tumor producing IL-17 had a significantly increased level of anti-P815 cytotoxic T lymphocytes compaired to mice vaccinated with the mock transfected P815 tumor. Therefore, it appeard that T-cells medicate the antiproliferative effect that IL-17 has on these tumors.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/US2000/008081 1999-05-17 2000-03-27 Compositions and methods for treating cell proliferation disorders Ceased WO2000069463A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
JP2000617923A JP2004500325A (ja) 1999-05-17 2000-03-27 細胞増殖障害を処置するための組成物および方法
EP00919693A EP1251872A1 (en) 1999-05-17 2000-03-27 Compositions and methods for treating cell proliferation disorders
AU40339/00A AU4033900A (en) 1999-05-17 2000-03-27 Compositions and methods for treating cell proliferation disorders
CA002373938A CA2373938A1 (en) 1999-05-17 2000-03-27 Compositions and methods for treating cell proliferation disorders
MXPA01011923A MXPA01011923A (es) 1999-05-17 2000-03-27 Composiciones y metodos para tratar alteraciones en la proliferacion celular.

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP99401191.4 1999-05-17
EP99401191A EP1053751A1 (en) 1999-05-17 1999-05-17 Compositions and methods for treating cell proliferation disorders

Publications (1)

Publication Number Publication Date
WO2000069463A1 true WO2000069463A1 (en) 2000-11-23

Family

ID=8241974

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/008081 Ceased WO2000069463A1 (en) 1999-05-17 2000-03-27 Compositions and methods for treating cell proliferation disorders

Country Status (6)

Country Link
EP (2) EP1053751A1 (https=)
JP (1) JP2004500325A (https=)
AU (1) AU4033900A (https=)
CA (1) CA2373938A1 (https=)
MX (1) MXPA01011923A (https=)
WO (1) WO2000069463A1 (https=)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006013107A1 (en) * 2004-08-05 2006-02-09 Novartis Ag Il-17 antagonistic antibodies
WO2007117749A3 (en) * 2006-01-31 2008-06-12 Novartis Ag Il-17 antagonistic antibodies fpr treating cancer
US8057794B2 (en) 2006-06-29 2011-11-15 Ucb Pharma S.A. Antibody molecules which bind to human IL-17
AU2005305677B2 (en) * 2004-11-19 2012-02-02 Ucb Pharma, S.A. Neutralising antibody molecules having specificity for human IL-17
US8303953B2 (en) 2006-10-18 2012-11-06 Ucb Pharma S.A. Antibody molecules which bind IL-17A and IL-17F
US8580265B2 (en) 2011-01-14 2013-11-12 Ucb Pharma S.A. Antibody molecules which bind IL-17A and IL-17F
US8679494B2 (en) 2008-04-23 2014-03-25 Ucb Pharma S.A. Antibodies specific to IL-17A and IL-17F
US10011654B2 (en) 2003-07-08 2018-07-03 Genentech, Inc. Antibodies directed to IL-17A/IL-17F heterodimers
US10017568B2 (en) 2011-05-05 2018-07-10 Merck Patent Gmbh Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same
JP2021080301A (ja) * 2002-07-03 2021-05-27 小野薬品工業株式会社 癌治療剤
US11633503B2 (en) 2009-01-08 2023-04-25 Northwestern University Delivery of oligonucleotide-functionalized nanoparticles
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
US11866700B2 (en) 2016-05-06 2024-01-09 Exicure Operating Company Liposomal spherical nucleic acid (SNA) constructs presenting antisense oligonucleotides (ASO) for specific knockdown of interleukin 17 receptor mRNA
US12296008B2 (en) 2014-12-22 2025-05-13 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US12577585B2 (en) 2020-01-10 2026-03-17 Carogen Corporation Compositions and methods of use of oncolytic virus like vesicles

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110293629A1 (en) * 2010-05-14 2011-12-01 Bastid Jeremy Methods of Treating and/or Preventing Cell Proliferation Disorders with IL-17 Antagonists
TR201908550T4 (tr) 2014-06-04 2019-07-22 Exicure Inc Profilaktik veya terapötik uygulamalar için lipozomal sferik nükleik asitler tarafından immün modülatörlerin çok değerlikli teslimi.

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997004097A2 (en) * 1995-07-19 1997-02-06 Genetics Institute, Inc. Human ctla-8 and uses of ctla-8-related proteins
WO1999014240A1 (en) * 1997-09-17 1999-03-25 Human Genome Sciences, Inc. Interleukin-17 receptor-like protein
DE29820466U1 (de) * 1998-11-16 1999-04-08 Reutter, Werner, Prof. Dr.med., 14195 Berlin Rekombinante Glycoproteine und sie enthaltende Arzneimittel

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1997004097A2 (en) * 1995-07-19 1997-02-06 Genetics Institute, Inc. Human ctla-8 and uses of ctla-8-related proteins
WO1999014240A1 (en) * 1997-09-17 1999-03-25 Human Genome Sciences, Inc. Interleukin-17 receptor-like protein
DE29820466U1 (de) * 1998-11-16 1999-04-08 Reutter, Werner, Prof. Dr.med., 14195 Berlin Rekombinante Glycoproteine und sie enthaltende Arzneimittel

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
E. TARTOUR ET AL.: "IL17, a T cell-derived cytokine which promotes the in vivo growth of cervical tumors in nude mice.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 39, March 1998 (1998-03-01), USA, pages 653, XP002129053 *
E. TARTOUR ET AL.: "Interleukin 17, a T-cell-derived cytokine, promotes tumorigenicity of human cervical tumors in nude mice.", CANCER RESEARCH, vol. 59, no. 15, 1 August 1999 (1999-08-01), BALTIMORE, MD, USA, pages 3698 - 3704, XP002129059 *
F. FOSSIEZ ET AL.: "Interleukin-17", INTERNATIONAL REVIEWS OF IMMUNOLOGY, vol. 16, no. 5-6, 1998, LONDON, GB, pages 541 - 551, XP002129057 *
F. PAGES ET AL.: "Control of tumor development by intratumoral cytokines.", IMMUNOLOGY LETTERS, vol. 68, no. 1, 3 May 1999 (1999-05-03), AMSTERDAM, THE NETHERLANDS, pages 135 - 139, XP002129058 *
M. ANTONYSAMY ET AL.: "Evidence for a role of IL-17 in organ allograft rejection: IL-17 promotes the functional differentiation of dendritic cell progenitors.", THE JOURNAL OF IMMUNOLOGY, vol. 162, no. 1, 1 January 1999 (1999-01-01), BALTIMORE, MD, USA, pages 577 - 584, XP002129056 *
M. LAAN ET AL.: "Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways.", THE JOURNAL OF IMMUNOLOGY, vol. 162, no. 4, 15 February 1999 (1999-02-15), BALTIMORE, MD, USA, pages 2347 - 2352, XP002129055 *
S. WAKASUGI ET AL.: "Tumorigenicity of cancer cells transfected with IL-17 gene in vivo.", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, vol. 39, March 1998 (1998-03-01), USA, pages 6, XP002129054 *

Cited By (46)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2021080301A (ja) * 2002-07-03 2021-05-27 小野薬品工業株式会社 癌治療剤
US10011654B2 (en) 2003-07-08 2018-07-03 Genentech, Inc. Antibodies directed to IL-17A/IL-17F heterodimers
EP2784084B1 (en) 2003-07-08 2019-07-24 Genentech, Inc. Antagonist antibodies to IL-17A/F heterologous polypeptides
EP2902039A1 (en) * 2004-08-05 2015-08-05 Novartis AG IL-17 antagonistic antibodies
US7807155B2 (en) 2004-08-05 2010-10-05 Novartis Ag IL-17 antagonistic antibodies
US9765140B2 (en) 2004-08-05 2017-09-19 Novartis Ag IL-17 antagonistic antibodies
US10344084B2 (en) 2004-08-05 2019-07-09 Novartis Ag IL-17 antagonistic antibodies
EP3409288A1 (en) * 2004-08-05 2018-12-05 Novartis AG Il-17 antagonistic antibodies
EP2366405A3 (en) * 2004-08-05 2012-01-18 Novartis AG IL-17 antagonistic antibodies
EP2364729A3 (en) * 2004-08-05 2012-01-18 Novartis AG IL-17 antagonistic antibodies
WO2006013107A1 (en) * 2004-08-05 2006-02-09 Novartis Ag Il-17 antagonistic antibodies
US8119131B2 (en) 2004-08-05 2012-02-21 Novartis Ag IL-17 antagonistic antibodies
US8617552B2 (en) 2004-08-05 2013-12-31 Novarts Ag IL-17 antibodies
US8231875B2 (en) 2004-11-19 2012-07-31 Ucb Pharma S.A. Neutralising antibody molecules having specificity for human IL-17
US8329431B2 (en) 2004-11-19 2012-12-11 Ucb Pharma S.A. Nucleic acid molecules encoding neutralising antibodies having specificity for human IL-17
AU2005305677B2 (en) * 2004-11-19 2012-02-02 Ucb Pharma, S.A. Neutralising antibody molecules having specificity for human IL-17
US8865167B2 (en) 2004-11-19 2014-10-21 Ucb Pharma, S.A. Neutralising antibody molecules having specificity for human IL-17
WO2007117749A3 (en) * 2006-01-31 2008-06-12 Novartis Ag Il-17 antagonistic antibodies fpr treating cancer
US8012477B2 (en) 2006-01-31 2011-09-06 Novartis Ag Methods of treating multiple myeloma using IL-17 binding molecules
AU2007235199B2 (en) * 2006-01-31 2010-09-23 Novartis Ag IL-17 antagonistic antibodies for treating cancer
RU2430110C2 (ru) * 2006-01-31 2011-09-27 Новартис Аг Антитела - антагонисты интерлейкина-17 (ил-17) для лечения рака
AU2007235199B8 (en) * 2006-01-31 2010-10-28 Novartis Ag IL-17 antagonistic antibodies for treating cancer
US8057794B2 (en) 2006-06-29 2011-11-15 Ucb Pharma S.A. Antibody molecules which bind to human IL-17
US8435761B2 (en) 2006-06-29 2013-05-07 Ucb Pharma Sa DNA encoding antibody molecules which bind human IL-17
US8303953B2 (en) 2006-10-18 2012-11-06 Ucb Pharma S.A. Antibody molecules which bind IL-17A and IL-17F
US9890219B2 (en) 2006-10-18 2018-02-13 Ucb Biopharma Sprl Methods of treating an IL-17A mediated pathological condition
US10308723B2 (en) 2006-10-18 2019-06-04 Ucb Biopharma Sprl Method of treating inflammation by administering antibody molecules which bind IL-17A and IL-17F
US8679494B2 (en) 2008-04-23 2014-03-25 Ucb Pharma S.A. Antibodies specific to IL-17A and IL-17F
US9045537B2 (en) 2008-04-23 2015-06-02 Ucb Pharma Sa Antibodies specific to IL-17A and IL-17F
US9771420B2 (en) 2008-04-23 2017-09-26 Ucb Biopharma Sprl Methods of treating an IL-17A mediated pathological condition
US11633503B2 (en) 2009-01-08 2023-04-25 Northwestern University Delivery of oligonucleotide-functionalized nanoparticles
US9034600B2 (en) 2011-01-14 2015-05-19 Ucb Biopharma Sprl DNA encoding antibody molecules which bind IL-17A and IL-17F
US11919950B2 (en) 2011-01-14 2024-03-05 UCB Biopharma SRL Expression vector encoding antibody molecule which binds IL-17A and IL-17F
US9988446B2 (en) 2011-01-14 2018-06-05 Ucb Biopharma Sprl Methods of treatment using antibodies which bind IL-17A and IL-17F
US8580265B2 (en) 2011-01-14 2013-11-12 Ucb Pharma S.A. Antibody molecules which bind IL-17A and IL-17F
US10829552B2 (en) 2011-05-05 2020-11-10 Merck Patent Gmbh Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same
US10017568B2 (en) 2011-05-05 2018-07-10 Merck Patent Gmbh Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and method of treatment using same
US11773159B2 (en) 2011-05-05 2023-10-03 Merck Patent Gmbh Polypeptides that bind to IL-17A, IL-17F and/or IL17-A/F and methods of treatment using same
US12485173B2 (en) 2014-12-22 2025-12-02 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US12296008B2 (en) 2014-12-22 2025-05-13 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US12485172B2 (en) 2014-12-22 2025-12-02 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US12544438B2 (en) 2014-12-22 2026-02-10 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US12599664B2 (en) 2014-12-22 2026-04-14 Novartis Ag Pharmaceutical products and stable liquid compositions of IL-17 antibodies
US11866700B2 (en) 2016-05-06 2024-01-09 Exicure Operating Company Liposomal spherical nucleic acid (SNA) constructs presenting antisense oligonucleotides (ASO) for specific knockdown of interleukin 17 receptor mRNA
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
US12577585B2 (en) 2020-01-10 2026-03-17 Carogen Corporation Compositions and methods of use of oncolytic virus like vesicles

Also Published As

Publication number Publication date
EP1053751A1 (en) 2000-11-22
AU4033900A (en) 2000-12-05
JP2004500325A (ja) 2004-01-08
MXPA01011923A (es) 2003-10-15
CA2373938A1 (en) 2000-11-23
EP1251872A1 (en) 2002-10-30

Similar Documents

Publication Publication Date Title
EP1053751A1 (en) Compositions and methods for treating cell proliferation disorders
Klein et al. Survival and proliferation factors of normal and malignant plasma cells
Firestein et al. IL-1 receptor antagonist protein production and gene expression in rheumatoid arthritis and osteoarthritis synovium
EP1576011B1 (en) Inhibition of il-17 production
Martínez-Borra et al. High serum tumor necrosis factor-α levels are associated with lack of response to infliximab in fistulizing Crohn's disease
US7291332B2 (en) Inflammatory mediator antagonists
CN105617387B (zh) 治疗白介素-6相关疾病的方法
US20090142806A1 (en) Interleukin-17f antibodies and other il-17f signaling antagonists and uses therefor
US20080167264A1 (en) Materials and methods to inhibit hodgkin and reed sternberg cell growth
CN106413751A (zh) 用于治疗癌症的抗ccr4抗体和4‑1bb激动剂的组合
TW200803895A (en) Method of using IL6 antagonists with proteasome inhibitors
WO2014003742A1 (en) Anti-cxcl9, anti-cxcl10, anti-cxcl11, anti-cxcl13, anti-cxcr3 and anti-cxcr5 agents for inhibition of inflammation
US20160130350A1 (en) Anti-cxcl9, anti-cxcl10, anti-cxcl11, anti-cxcl13, anti-cxcr3 and anti-cxcr5 agents for inhibition of inflammation
KR102674516B1 (ko) Il-33 안타고니스트를 포함하는 자궁내막증 치료제
WO2019084307A1 (en) ANTI-MERTK ANTIBODIES AND METHODS OF USE
Kragballe et al. Unmet needs in the treatment of psoriasis
Tsimberidou et al. TNF-α targeted therapeutic approaches in patients with hematologic malignancies
WO2001005821A2 (en) Viral il-10 for the inhibition of angiogenesis, tumorigenesis and metastasis
Majchrzak et al. Biologic therapy in Crohn’s disease–what we have learnt so far
EP2240517B1 (en) Fdf03 antibodies and uses thereof
EP3277718B1 (en) Dosage regimen for anti-mif antibodies
EP1148889A2 (en) Method of treating demyelinating inflammatory disease using ccr1 antagonists
JP2024545101A (ja) 抗clever-1がん治療を誘導するための炎症マーカーの使用方法
US20020068060A1 (en) Cytokine antagonists
Gregory et al. Inflammatory diseases

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CZ DE DK DM DZ EE ES FI GB GD GE HR HU ID IL IN IS JP KG KR KZ LC LK LR LT LU LV MA MD MG MK MN MX NO NZ PL PT RO RU SE SG SI SK SL TJ TM TR TT TZ UA US UZ VN YU ZA

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
ENP Entry into the national phase

Ref document number: 2373938

Country of ref document: CA

Ref country code: CA

Ref document number: 2373938

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: JP

Ref document number: 2000 617923

Kind code of ref document: A

Format of ref document f/p: F

WWE Wipo information: entry into national phase

Ref document number: PA/a/2001/011923

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2000919693

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWP Wipo information: published in national office

Ref document number: 2000919693

Country of ref document: EP